METHOD FOR PREDICTING A SUBJECT'S RESPONSE TO VALPROIC ACID THERAPY
20180275149 ยท 2018-09-27
Inventors
Cpc classification
C12Q2600/106
CHEMISTRY; METALLURGY
A61P25/18
HUMAN NECESSITIES
A61K31/198
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
G01N2800/52
PHYSICS
International classification
Abstract
The present invention provides, inter alia, methods for treating or ameliorating the effects of a disorder, such as schizophrenia or bipolar disorder, by increasing or decreasing proline levels. Further provided are methods of predicting and monitoring the clinical response in a patient, and diagnostic systems for identifying a patient likely to benefit from proline modulation.
Claims
1. A method for predicting the clinical response of a subject with a disorder to a proline modulator comprising: a) obtaining a biological sample from the subject; b) determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene in the sample; wherein the presence of Val/Val is indicative of a subject who will benefit from an agent that increases proline levels, and wherein the presence of at least one Met allele is indicative of a subject who will benefit from an agent that decreases proline levels; and c) administering, if appropriate based on the results of step b), an effective amount of a proline modulator to the subject to achieve an appropriate clinical response.
2. The method of claim 1, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
3. The method of claim 1, wherein the disorder is a psychiatric disorder.
4. The method of claim 1, wherein the disorder is selected from the group consisting of schizophrenia, bipolar disorder, schizophrenia spectrum and other psychotic disorders, 22q11.2 deletion syndrome, depressive disorders, mood disorders, Alzheimer's disease, substance use disorders, addictive disorders, alcohol use disorder (AUD), anxiety disorders, obsessive-compulsive disorders, traumatic brain injury (TBI), and trauma and stressor-related disorders.
5. The method of claim 4, wherein the disorder is schizophrenia.
6. The method of claim 4, wherein the disorder is bipolar disorder.
7. The method of claim 4, wherein the disorder is alcohol use disorder (AUD).
8. The method of claim 4, wherein the disorder is traumatic brain injury (TBI).
9. The method of claim 1, wherein the proline modulator is an agent that increases proline levels in the subject and is a composition selected from the group consisting of valproic acid (VPA), divalproex sodium, valproate, sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate.
10. The method of claim 1, wherein the proline modulator is an agent that decreases proline levels in the subject and is a composition selected from the group consisting of vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept, S26948, INT131, phentoin, analogs of any of the foregoing, and combinations thereof.
11. The method of claim 10, wherein the one or more thiazolidinedione compounds is selected from the group consisting of troglitazone, rosiglitazone, roglitazone, ciglitazone, darglitazone, englitazone, hydroxypioglitazone, ketopioglitazone, pioglitazone, pioglitazone hydrochloride, ragaglitazar, naveglitazar, aleglitazar, rivoglitazone, netoglitazone, pharmaceutically acceptable salts thereof, analogs of any of the foregoing, and combinations thereof.
12. The method of claim 1, wherein the biological sample is selected from the group consisting of a blood sample, a biopsy sample, a plasma sample, a saliva sample, a tissue sample, a serum sample, a tear sample, a sweat sample, a skin sample, a cell sample, a hair sample, an excretion sample, a waste sample, a bodily fluid sample, a nail sample, a cheek swab, a cheek cell sample, and a mucous sample.
13. A method for monitoring the treatment of a subject in need thereof, the method comprising: a) obtaining a biological sample from the subject; b) determining the genotype for the allele(s) of the COMT gene at amino acid position 158 in the biological sample; c) determining the subject's proline level; and d) modifying the course of treatment, if necessary, including administering a different proline modulator to the subject, or stopping or omitting treatment with a proline modulator, based upon the presence or absence of a Val.sup.158Met polymorphism in the COMT gene, and/or an increase or decrease in the subject's proline level.
14. The method of claim 13, wherein the presence of Val/Val at amino acid position 158 indicates the subject is a candidate for treatment or continued treatment with a proline modulator that increases proline levels in a subject and is a composition selected from the group consisting of valproic acid (VPA), divalproex sodium, valproate, sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate.
15. The method of claim 13, wherein the presence of at least one Met allele at amino acid position 158 indicates the subject is a candidate for treatment or continued treatment with a proline modulator that decreases proline levels in the subject and is a composition selected from the group consisting of vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept, S26948, INT131, phentoin, analogs of any of the foregoing, and combinations thereof.
16. The method of claim 15, wherein the one or more thiazolidinedione compounds is selected from the group consisting of troglitazone, rosiglitazone, roglitazone, ciglitazone, darglitazone, englitazone, hydroxypioglitazone, ketopioglitazone, pioglitazone, pioglitazone hydrochloride, ragaglitazar, naveglitazar, aleglitazar, rivoglitazone, netoglitazone, pharmaceutically acceptable salts thereof, analogs of any of the foregoing, and combinations thereof.
17. The method of claim 13, wherein the disorder is a psychiatric disorder.
18. The method of claim 13, wherein the subject has a disorder selected from the group consisting of schizophrenia, bipolar disorder, schizophrenia spectrum and other psychotic disorders, 22q11.2 deletion syndrome, depressive disorders, mood disorders, Alzheimer's disease, substance use disorders, addictive disorders, alcohol use disorder (AUD), anxiety disorders, obsessive-compulsive disorders, traumatic brain injury (TBI), and trauma and stressor-related disorders.
19. The method of claim 18, wherein the disorder is schizophrenia.
20. The method of claim 18, wherein the disorder is bipolar disorder.
21. The method of claim 18, wherein the disorder is alcohol use disorder (AUD).
22. The method of claim 18, wherein the disorder is traumatic brain injury (TBI).
23. A diagnostic system for identifying a subject with a disorder who will benefit from an agent that increases or decreases proline levels comprising: a) obtaining a biological sample from the subject; b) determining the identity of alleles of the Val.sup.158Met locus associated with the COMT gene in the sample; wherein the presence of Val/Val is indicative of a subject who will benefit from an agent that increases proline levels and wherein the presence of at least one Met allele is indicative of a subject who will benefit from an agent that decreases proline levels.
24. The diagnostic system of claim 23, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
25. The diagnostic system of claim 23 further comprising c) administering, to the subject who will benefit from an agent that increases proline levels, a composition that is selected from the group consisting of valproic acid (VPA), divalproex sodium, valproate, sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate.
26. The diagnostic system of claim 23 further comprising c) administering, to the subject who will benefit from an agent that decreases proline levels, a composition that is selected from the group consisting of vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept, S26948, INT131, phentoin, analogs of any of the foregoing, and combinations thereof.
27. The diagnostic system of claim 26, wherein the one or more thiazolidinedione compounds is selected from the group consisting of troglitazone, rosiglitazone, roglitazone, ciglitazone, darglitazone, englitazone, hydroxypioglitazone, ketopioglitazone, pioglitazone, pioglitazone hydrochloride, ragaglitazar, naveglitazar, aleglitazar, rivoglitazone, netoglitazone, pharmaceutically acceptable salts thereof, analogs of any of the foregoing, and combinations thereof.
28. The diagnostic system of claim 23, wherein the disorder is a psychiatric disorder.
29. The diagnostic system of claim 23, wherein the disorder is selected from the group consisting of schizophrenia, bipolar disorder, schizophrenia spectrum and other psychotic disorders, 22q11.2 deletion syndrome, depressive disorders, mood disorders, Alzheimer's disease, substance use disorders, addictive disorders, alcohol use disorder (AUD), anxiety disorders, obsessive-compulsive disorders, traumatic brain injury (TBI), and trauma and stressor-related disorders.
30. The diagnostic system of claim 29, wherein the disorder is schizophrenia.
31. The diagnostic system of claim 29, wherein the disorder is bipolar disorder.
32. The diagnostic system of claim 29, wherein the disorder is alcohol use disorder (AUD).
33. The diagnostic system of claim 29, wherein the disorder is traumatic brain injury (TBI).
34. The diagnostic system of claim 23, wherein step b) comprises use of a probe that selectively binds to the Val.sup.158Met locus associated with the COMT gene, wherein the probe is selected from the group consisting of an antibody, an antibody fragment, or a molecular beacon.
35. The diagnostic system of claim 23, wherein step b) comprises use of a primer or a probe, which specifically binds to a rs4680 G>A single nucleotide polymorphism (SNP).
36. A kit comprising the diagnostic system of claim 23, packaged together with instructions for its use.
37. A method for predicting the clinical response of a subject with a disorder to a proline modulator comprising: a) determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene using a biological sample of the subject; wherein the presence of Val/Val at the locus is indicative of a subject who will benefit from an agent that increases proline levels, and wherein the presence of at least one Met allele at the locus is indicative of a subject who will benefit from an agent that decreases proline levels; and b) administering, if appropriate based on the results of step (a), an effective amount of a proline modulator to the subject to achieve a clinically appropriate response.
38. The method of claim 37, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
39. A method for monitoring the treatment of a subject with a disorder, the method comprising: a) determining the genotype for the allele(s) of the COMT gene at amino acid position 158 in a biological sample of the subject; b) determining the proline level of the subject; and c) modifying the course of treatment of the subject, if necessary, including administering a different proline modulator to the subject or stopping or omitting treatment with a proline modulator, based upon the presence or absence of a Val.sup.158Met polymorphism in the COMT gene.
40. A diagnostic system for identifying a subject with a disorder who will benefit from treatment with an agent that increases or decreases proline levels comprising: determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene using a biological sample from the subject; wherein the presence of Val/Val at the locus is indicative of a subject who will benefit from an agent that increases proline levels and wherein the presence of at least one Met allele at the locus is indicative of a subject who will benefit from an agent that decreases proline levels.
41. The diagnostic system of claim 40, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
42. A method for treating or ameliorating the effects of a disorder in a subject in need thereof comprising: a) obtaining a biological sample from the subject; b) determining, in the biological sample, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene; and c) administering to the subject, if appropriate based on the results of step b), an effective amount of an agent that increases proline levels if the subject is determined from step b) to have a Val/Val genotype at codon 158; or d) administering to the subject, if appropriate based on the results of step b), an effective amount of an agent that decreases proline levels if the subject is determined from step b) to have a Val/Met or Met/Met genotype at codon 158.
43. The method of claim 42, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
44. The method of claim 42, wherein the subject is human.
45. The method of claim 42, wherein the Val.sup.158Met polymorphism in the COMT gene is a rs4680 G>A single nucleotide polymorphism (SNP).
46. The method of claim 42, wherein the disorder is a psychiatric disorder.
47. The method of claim 42, wherein the disorder is selected from the group consisting of schizophrenia, bipolar disorder, schizophrenia spectrum and other psychotic disorders, 22q11.2 deletion syndrome, depressive disorders, mood disorders, Alzheimer's disease, substance use disorders, addictive disorders, alcohol use disorder (AUD), anxiety disorders, obsessive-compulsive disorders, traumatic brain injury (TBI), and trauma and stressor-related disorders.
48. The method of claim 47, wherein the disorder is schizophrenia.
49. The method of claim 47, wherein the disorder is bipolar disorder.
50. The method of claim 47, wherein the disorder is alcohol use disorder (AUD).
51. The method of claim 47, wherein the disorder is traumatic brain injury (TBI).
52. The method of claim 42, which reduces a negative symptom of the disorder.
53. The method of claim 52, wherein the negative symptom is selected from the group consisting of diminished emotional expression, avolition, impaired social functioning, alogia, apathy, anhedonia and combinations thereof.
54. The method of claim 52, which comprises decreasing a total Scale for Negative Symptoms (SANS) score, a Brief Psychiatric Rating Scale (BPRS) negative symptom sub-scale score, a Positive and Negative Syndrome Scale (PANSS) negative symptom sub-scale score, a Brief Negative Symptom Scale (BNSS) score, clinical assessment interview for negative symptoms, negative assessment, or other measures of negative symptoms in the subject.
55. The method of claim 42, wherein the agent that increases proline levels in the subject is a composition selected from the group consisting of valproic acid (VPA), divalproex sodium, valproate, sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate.
56. The method of claim 42, wherein the agent that decreases proline levels in the subject is a composition selected from the group consisting of vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept, S26948, INT131, phentoin, analogs of any of the foregoing, and combinations thereof.
57. The method of claim 56, wherein the one or more thiazolidinedione compounds is selected from the group consisting of troglitazone, rosiglitazone, roglitazone, ciglitazone, darglitazone, englitazone, hydroxypioglitazone, ketopioglitazone, pioglitazone, pioglitazone hydrochloride, ragaglitazar, naveglitazar, aleglitazar, rivoglitazone, netoglitazone, pharmaceutically acceptable salts thereof, analogs of any of the foregoing, or combinations thereof.
58. The method of claim 42, wherein the biological sample is selected from the group consisting of a blood sample, a biopsy sample, a plasma sample, a saliva sample, a tissue sample, a serum sample, a tear sample, a sweat sample, a skin sample, a cell sample, a hair sample, an excretion sample, a waste sample, a bodily fluid sample, a nail sample, a cheek swab, a cheek cell sample, and a mucous sample.
59. A method for treating or ameliorating the effects of a disorder in a subject in need thereof comprising: a) determining, using a biological sample of the subject, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene of the subject; and b) administering to the subject, if clinically appropriate, an effective amount of an agent that increases proline levels if the subject is determined from step a) to have a Val/Val genotype at codon 158; or c) administering to the subject, if clinically appropriate, an effective amount of an agent that decreases proline levels if the subject is determined from step a) to have a Val/Met or Met/Met genotype at codon 158.
60. The method of claim 59, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
61. A method for eradicating or reducing a negative symptom experienced by a subject who suffers from a disorder comprising: a) obtaining a biological sample from the subject; b) determining, in the biological sample, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene; and c) administering to the subject, if clinically appropriate, an effective amount of an agent that increases proline levels if the subject is determined from step (b) to have a Val/Val genotype at codon 158; or d) administering to the subject, if clinically appropriate, an effective amount of an agent that decreases proline levels if the subject is determined from step (b) to have at least one Met allele at codon 158; or e) modifying the course of treatment of the subject, if clinically appropriate, including stopping or omitting treatment with a proline modulator, based upon the presence or absence of a Val.sup.158Met polymorphism in the COMT gene.
62. The method of claim 61, wherein the negative symptom is selected from the group consisting of diminished emotional expression, avolition, impaired social functioning, alogia, apathy, anhedonia and combinations thereof.
63. The method of claim 61, wherein a total Scale for Negative Symptoms (SANS) score, a Brief Psychiatric Rating Scale (BPRS) negative symptom sub-scale score, a Positive and Negative Syndrome Scale (PANSS) negative symptom sub-scale score, a Brief Negative Symptom Scale (BNSS) score, clinical assessment interview for negative symptoms, negative assessment, or other measures of negative symptoms in the subject is reduced.
64. The method of claim 61, wherein the disorder is a psychiatric disorder.
65. The method of claim 61, wherein the disorder is selected from the group consisting of schizophrenia, bipolar disorder, schizophrenia spectrum and other psychotic disorders, 22q11.2 deletion syndrome, depressive disorders, mood disorders, Alzheimer's disease, substance use disorders, addictive disorders, alcohol use disorder (AUD), anxiety disorders, obsessive-compulsive disorders, traumatic brain injury (TBI), and trauma and stressor-related disorders.
66. The method of claim 65, wherein the disorder is schizophrenia.
67. The method of claim 65, wherein the disorder is bipolar disorder.
68. The method of claim 65, wherein the disorder is alcohol use disorder (AUD).
69. The method of claim 65, wherein the disorder is traumatic brain injury (TBI).
70. The method of claim 61, wherein the agent that increases proline levels in the subject is a composition selected from the group consisting of valproic acid (VPA), divalproex sodium, valproate, sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate.
71. The method of claim 61, wherein the agent that decreases proline levels in the subject is a composition selected from the group consisting of vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept, S26948, INT131, phentoin, analogs of any of the foregoing, and combinations thereof.
72. The method of claim 71, wherein the one or more thiazolidinedione compounds is selected from the group consisting of troglitazone, rosiglitazone, roglitazone, ciglitazone, darglitazone, englitazone, hydroxypioglitazone, ketopioglitazone, pioglitazone, pioglitazone hydrochloride, ragaglitazar, naveglitazar, aleglitazar, rivoglitazone, netoglitazone, pharmaceutically acceptable salts thereof, analogs of any of the foregoing, and combinations thereof.
73. The method of claim 61, wherein the biological sample is selected from the group consisting of a blood sample, a biopsy sample, a plasma sample, a saliva sample, a tissue sample, a serum sample, a tear sample, a sweat sample, a skin sample, a cell sample, a hair sample, an excretion sample, a waste sample, a bodily fluid sample, a nail sample, a cheek swab, a cheek cell sample, and a mucous sample.
74. The method of claim 61, further comprising determining a proline level in the subject and adjusting a treatment protocol for the subject based on the determined proline level.
75. The method according to claim 74, wherein one of steps c), d), or e) is carried out based on the presence or absence of a Val.sup.158Met polymorphism in the COMT gene and/or the determined proline level.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0050] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0051] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
DETAILED DESCRIPTION OF THE INVENTION
[0060] One embodiment of the present invention is a method for predicting the clinical response of a subject with a disorder to a proline modulator comprising: [0061] a) obtaining a biological sample from the subject; [0062] b) determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene in the sample; [0063] wherein the presence of Val/Val is indicative of a subject who will benefit from an agent that increases proline levels, and wherein the presence of at least one Met allele is indicative of a subject who will benefit from an agent that decreases proline levels; and [0064] c) administering, if appropriate based on the results of step b), an effective amount of a proline modulator to the subject to achieve an appropriate clinical response.
[0065] As used herein, the term disorder broadly refers to a syndrome, condition, chronic illness or a particular disease. For example, the disorder may be a psychiatric disorder. In the present invention, a psychiatric disorder is one of a number of disorders that affect mood, thinking, and behavior. Thus, as used herein, psychiatric disorder includes but is not limited to: schizophrenia, bipolar disorder, schizoaffective disorders, schizophreniform disorders, schizotypal and schizoid personality disorders, delusional disorders, 22q11.2 deletion syndrome, mood disorders, anxiety disorders, substance use disorders, and personality disorders.
[0066] Other non-limiting examples of disorders according to the present invention include: schizophrenia, bipolar disorder, schizophrenia spectrum and other psychotic disorders, 22q11.2 deletion syndrome, depressive disorders, mood disorders, Alzheimer's disease, substance use disorders, addictive disorders, alcohol use disorder (AUD), anxiety disorders, obsessive-compulsive disorders, traumatic brain injury (TBI), and trauma and stressor-related disorders. In a preferred embodiment, the disorder is e.g., schizophrenia, bipolar disorder, alcohol use disorder (AUD) or traumatic brain injury (TBI).
[0067] As used herein, the terms treat, treating, treatment and grammatical variations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. However, because every treated subject may not respond to a particular treatment protocol, regimen, process or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population, e.g., patient population. Accordingly, a given subject or subject population, e.g., patient population may fail to respond or respond inadequately to treatment. The term clinical response as used herein means a reduction of the severity or number of symptoms or characteristics of a disorder, during or following treatment.
[0068] In some aspects of this and other embodiments, the subject is a mammal. Preferably, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals. More preferably, the mammal is a human.
[0069] As used herein, a biological sample means a biological specimen, which may be a bodily fluid or a tissue. Biological samples include, for example, whole blood, serum, plasma, cerebro-spinal fluid, leukocytes or leukocyte subtype cells (e.g. neutrophils, basophils, and eosinophils, lymphocytes, monocytes, macrophages), fibroblast sample, olfactory neuron sample, and tissues from the central nervous system, such as the cortex and hippocampus. Examples of preferred biological samples include, e.g., a blood sample, a biopsy sample, a plasma sample, a saliva sample, a tissue sample, a serum sample, a tear sample, a sweat sample, a skin sample, a cell sample, a hair sample, an excretion sample, a waste sample, a bodily fluid sample, a nail sample, a cheek swab, a cheek cell sample, or a mucous sample.
[0070] There is one single gene for COMT, which codes for both soluble COMT (S-COMT) and membrane-bound COMT (MB-COMT) using two separate promoters. The nucleic acid sequence for the human COMT gene is set forth in GenBank Accession Number Z26491 (see, e.g., SEQ ID NO: 1). Human S-COMT contains 221 amino acids (see, e.g., SEQ ID NO: 2), and the molecular mass is 24.4 kDa. Human MB-COMT (see, e.g., SEQ ID NO: 3) contains 50 additional amino acids, of which 20 are hydrophobic membrane anchors. The remainder of the MB-COMT molecule is suspended on the cytoplasmic side of the intracellular membranes. The corresponding molecular mass is 30.0 kDa.
[0071] A single nucleotide polymorphism (SNP) in the COMT gene causes a trimodal distribution of low, intermediate, and high activity. That polymorphism is caused by autosomal codominant alleles and leads to 3- to 4-fold differences in COMT activity. It has been shown that the molecular basis for this variation in activity is due to a transition of guanine to adenine at codon 158 of the COMT gene that results in a substitution of valine (Val) by methionine (Met) at position 158 in MB-COMT (SEQ ID NO: 3) or the corresponding amino acid 108 in S-COMT (SEQ ID NO: 2). The SNP polymorphism is referred to interchangeably herein as rs4680 or G158A or Val.sup.158Met. In subjects with 22q11.2 deletion syndrome (22q11DS), there is only one allele which determines COMT activity.
[0072] Exemplary methods which may be used for the determination/identification of the COMT genotype or Val.sup.158Met polymorphism in the present invention are disclosed, for example, in US2003/0100476, which is incorporated herein by reference. Further examples of such methods include, but are not limited to, PCR-based restriction fragment length polymorphism analysis using the restriction enzyme III, allele specific hybridization, use of a primer in a polymerase chain reaction (PCR), such as, for example, anchor PCR or RACE PCR or in a ligase chain reaction (LCR), identification of alterations in restriction enzyme cleavage patterns, sequencing reactions, analysis of the protection from cleavage agents (such as, for example, nuclease, hydroxylamine or osmium tetroxide and with piperidine), recognition of mismatched base pairs in double strand DNA by specific enzymes, alterations in electrophoretic mobility, analysis of the movement of polymorphic fragments in polyacrylamide gels containing gradients of denaturant (denaturing gradient gel electrophoresis, DGGE), selective oligonucleotide hybridization (for example using a specialized exonuclease-resistance nucleotide), selective amplification depending on selective PCR or selective primer extension, oligonucleotide ligation assays, expansion methods using dideoxynucleotides derivatives, and Genetic Bit Analysis (GBA). The detection of a variant in the COMT protein sequence can also be determined by methods such as in situ detection using an antibody specific to a variant sequence, immunoassays such as, for example, EIA or ELISA, immunofluorescence and the like. A preferred method for determining a COMT genotype is disclosed in Example 1.
[0073] As set forth above, the determination/identification of the COMT genotype or mutation in the COMT protein of a subject may be carried out by methods known to the skilled artisan. Such methods may be carried out, e.g., on a biological sample obtained from the subject, such as for example, a blood sample or a sample obtained after a biopsy has been carried out on the subject. Furthermore, any cell type or tissue may be utilized in the detection procedures described above. In a preferred embodiment, a bodily fluid, e.g., blood, is obtained from the subject to determine the presence of the allelic variant of a polymorphic region, such as the region including the Val.sup.158Met, in the COMT gene. A bodily fluid, e.g., blood, can be obtained by known techniques (e.g., venipuncture). Alternatively, nucleic acid tests can be performed on dry samples (e.g., skin).
[0074] As used herein, an agent that increases or decreases proline levels is used interchangeably with the phrase proline modulator and means any drug or other composition that increases or decreases the plasma proline levels in a subject. Such proline modulators may be administered to a subject in partly or fully deuterated forms, or containing other stable, medically appropriate isotopes such as, e.g., .sup.13C. Non-limiting examples of agents that increase proline levels include valproic acid (VPA, 2-propylpentanoic acid), divalproex sodium, valproate (2-propylpentanoate), sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate. As used herein, an analog of an agent means a chemical compound that is structurally and functionally similar to the agent. In the present invention, combinations of such agents and/or their analogs is also contemplated.
[0075] Non-limiting examples of agents that decrease proline levels include, e.g., activators of PRODH or activators of peroxisomal proliferator-activated receptor gamma (PPAR). As used herein, activators when used with respect to PRODH or PPAR, means a drug or other composition that can increase the function or expression of PRODH or PPAR. In the present invention, a proline modulator that decreases proline levels in a subject includes, e.g., vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept (Amgen/Pfizer), S26948 (Sigma-Aldrich), INT131 (InteKrin), phentoin, analogs of any of the foregoing, and combinations thereof.
[0076] In the present invention, a proline modulator also includes any molecule, enzyme, or treatment that affects circulating proline levels. For example, Table S1 (Supplemental Content), which is incorporated by reference herein in its entirety, identifies molecules that up- or down-regulate expression of genes regulating proline synthesis, transport, or metabolism. All such molecules are proline modulators of the present invention. The products of these genes influence circulating proline levels. These genes may also be targeted using known gene editing tools including, for example, CRISPR/Cas9 based systems, TALENs, etc., and thus are also considered proline modulators of the present invention. Table 1 contains a list of genes that are up- or down-regulated by valproate compounds, including VPA, valproate sodium salt and divalproate salt. These genes may provide targets for new treatments to modulate proline.
[0077] In the present invention, each embodiment optionally includes determining a proline level in the subject. Based on the determined proline level, if appropriate, the subject's treatment protocol may be adjusted. For example, by modifying the course of treatment, if necessary, including administering a different proline modulator to the subject, or stopping or omitting treatment with a proline modulator.
TABLE-US-00001 TABLE 1 Genes regulated by VPA, valproate sodium salt or divalproate sodium salt Up-regulated genes ABAT FOS EHHADH EGR1 Acot1 THRSP Cyp4a14 DBP PDK4 CA3 TUBB2B CYP1A1 NR1D2 DPP8 AKR1D1 ANGPTL4 ELOVL4 AIG1 KIF5C RETSAT ELOVL6 FZD5 PEX11A TIMP3 CPT1A RRAGD CKB VNN1 SPP1 SAP30 DLX5 SLC22A8 LYZ GCFC2 MAPT HSD17B2 ZFP37 CLIC6 FMO2 PPAP2C CTSH CYP51A1 SLC34A2 CD36 RGN TUBB2A H1F0 GRPR CYP4A11 UBR2 AKR1C3 Plscr2 EGLN3 NGFRAP1 PFN2 GPC3 PENK USP2 ARMCX2 CEP104 BCL6 LRP11 GABRB1 IL1B TNRC18 HLA-DQB1 SERPINE1 MT2A PGM2L1 HMGCS1 ATP8B3 EDNRA GUCY1B3 Prl2c2 TNFRSF9 FAM5C GJB5 KRT23 L1TD1 RSPO4 LOC284379 S100A8 PODXL Retnla AKR1C3 FETUB CYP2S1 UGT2B10 BCMO1 SERPINB2 PRR15L DIO2 CEACAM19 GJB3 GPX2 PPBP SLC17A6 GATA4 MGARP FAM163A UPP1 MMP10 CD7 EPGN ACPP LRRC2 ATP13A4 BST1 TMPRSS11BNL GPR115 WFDC12 MUC5B HDC KRT8 C4orf26 GRIK2 KRT18 DPPA4 QRFPR KCNA3 LOC643037 CRYAA FGB Down-regulated genes FAM111A CDK1 ALAS2 ARNTL TOLLIP CCNA2 DCXR MX1 SLC16A1 C1orf210 GPR37 INMT IGFBP3 IL6 NPAS2 MFAP4 CDKN1A RRM2 CHKA ENPP2 LOC100912446 FBXW5 CCNB2 IRF7 CDH17 RBM8A PC ADAMTSL3 MFAP4 ITGA11 C1QTNF3 ASPN DLK1 PAPPA2 CSPG4 THBS4 EGFL6 COL8A1 TSPAN18 POSTN Tlr13 LYZ FMOD SOX10 AFF3 ITGBL1 TNMD NGFR AW551984 ELN OGN PTGDS EPHA3 NKD2 COL14A1 LPAR4 PODN LDB2 TRIM66 FAM180A ADRA1B Ccl9 HR MDGA1 LPPR4 SLC6A17 PCSK9 MSR1 EDIL3 SEMA3D LAMA2 LCP1 CTSS PTN EMR1 CHRDL1 RSPO2
[0078] As used herein, an analog of vitamin D means a chemical compound that is structurally and functionally similar to vitamin D, or (1,25-dihydroxyvitamin D3 [1,25(OH).sub.2D.sub.3]). Non-limiting examples of vitamin D and analogs thereof include ergocalciferol, cholecalciferol, 22-oxacalcitriol, paricalcitol, doxercalciferol, alfacalcidol, dihydrotachystero, pharmaceutically acceptable salts thereof, and combinations thereof.
[0079] As used herein, an analog of curcumin means a chemical compound that is structurally and functionally similar to curcumin, and curcuminoid species. Non-limiting examples of curcumin and analogs thereof include curcumin, curcuma oil, turmerone, demethoxycurcum in, bisdemethoxycurcum in, pharmaceutically acceptable salts thereof, and combinations thereof.
[0080] Non-limiting examples of thiazolidinedione compounds include troglitazone, rosiglitazone, roglitazone, ciglitazone, darglitazone, englitazone, hydroxypioglitazone, ketopioglitazone, pioglitazone, pioglitazone hydrochloride, ragaglitazar, naveglitazar, aleglitazar, rivoglitazone, netoglitazone, pharmaceutically acceptable salts thereof, analogs of any of the foregoing, and combinations thereof.
[0081] Non-limiting examples of pharmaceutically acceptable salts include, for example, acid salts formed from inorganic or organic acids. Such acid salts are non-toxic and include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, and nitric acid; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmoic, maleic, hydroxymaleic, phenylacetic, glutamic, mesylate, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, and isethionic acid. Non-limiting examples of pharmaceutically acceptable base salts include, for example, aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic, manganous, potassium, sodium, and zinc salts.
[0082] In some preferred embodiments, a pharmaceutically acceptable salt of valproate is sodium valproate. In other preferred embodiments, a pharmaceutically acceptable salt of valproate is magnesium valproate.
[0083] The terms administering, administration and variants thereof (particularly administering an agent or modulator) as used herein means introducing an agent, e.g., proline modulator into the body of a subject, such as a human, in need of such treatment. In the present invention, however, administration of such a proline modulator or agent is appropriate only if such administration will reduce, alleviate, or eradicate at least one negative symptom as defined herein. In the present invention, based on the result of the COMT genotype analysis and/or a subject's proline levels, it may be that no treatment should be administered, that a prior treatment with a proline modulator should be reduced or discontinued, or that a different proline modulator be administered. The appropriateness of a particular treatment option is readily determined by a medical professional based on the COMT genotype analysis and/or proline determination as disclosed herein.
[0084] In the present invention, an effective amount or a therapeutically effective amount of a proline modulator, an agent, a compound, or a composition disclosed herein is an amount of such material that is sufficient to effect beneficial or desired results as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It is understood by those skilled in the art that the dosage amount will vary with the route of administration, the rate of excretion, the duration of the treatment, the identity of any other drugs being administered, the age, size, and species of mammal, e.g., human patient, and like factors well known in the arts of medicine and veterinary medicine. In general, a suitable dose of any active agent disclosed herein or a composition containing the same will be that amount of the active agent or composition, which is the lowest dose effective to produce the desired effect.
[0085] A suitable, non-limiting example of a dosage of a proline modulator according to the present invention may be from about 1 ng/kg to about 5000 mg/kg. In general, however, doses employed for adult human treatment typically may be in the range of 0.0001 mg/kg/day to 0.0010 mg/kg/day, 0.0010 mg/kg/day to 0.010 mg/kg/day, 0.010 mg/kg/day to 0.10 mg/kg/day, 0.10 mg/kg/day to 1.0 mg/kg/day, 1.00 mg/kg/day to about 200 mg/kg/day, 200 mg/kg/day to about 5000 mg/kg/day. For example, the dosage may be about 1 mg/kg/day to about 100 mg/kg/day, such as, e.g., 2-10 mg/kg/day, 10-50 mg/kg/day, or 50-100 mg/kg/day. The dosage of the proline modulator also may be about 1 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, 50 mg/kg, 60 mg/kg, 70 mg/kg, 80 mg/kg, 90 mg/kg, 100 mg/kg, 125 mg/kg, 150 mg/kg, 175 mg/kg, 200 mg/kg, 250 mg/kg, 300 mg/kg, 400 mg/kg, 500 mg/kg, 600 mg/kg, 700 mg/kg, 800 mg/kg, 900 mg/kg, 1000 mg/kg, 1 100 mg/kg, 1200 mg/kg, 1300 mg/kg, 1400 mg/kg, 1500 mg/kg, 1600 mg/kg, 1700 mg/kg, 1800 mg/kg, 1900 mg/kg, 2000 mg/kg, 2100 mg/kg, 2200 mg/kg, 2300 mg/kg, 2400 mg/kg, 2500 mg/kg, 2600 mg/kg, 2700 mg/kg, 2800 mg/kg, 2900 mg/kg, 3000 mg/kg, 3500 mg/kg, 4000 mg/kg, 5000 mg/kg.
[0086] With respect to proline modulators that are vitamin D and its analogs, the dosage of the proline modulator also may be denominated in International Units (IU) per day (IU/Day) and about 100 IU/day, 200 IU/day, 300 IU/day, 400 IU/day, 500 IU/day, 600 IU/day, 700 IU/day, 800 IU/day, 900 IU/day, 1000 IU/day, 1 100 IU/day, 1200 IU/day, 1300 IU/day, 1400 IU/day, 1500 IU/day, 1600 IU/day, 1700 IU/day, 1800 IU/day, 1900 IU/day, 2000 IU/day, 2100 IU/day, 2200 IU/day, 2300 IU/day, 2400 IU/day, 2500 IU/day, 2600 IU/day, 2700 IU/day, 2800 IU/day, 2900 IU/day, 3000 IU/day, 3100 IU/day, 3200 IU/day, 3300 IU/day, 3400 IU/day, 3500 IU/day, 3600 IU/day, 3700 IU/day, 3800 IU/day, 3900 IU/day, 4000 IU/day, 4500 IU/day, 5000 IU/day, 5500 IU/day, 6000 IU/day, 6500 IU/day, 7000 IU/day, 7500 IU/day, 8000 IU/day, 9000 IU/day, 10,000 IU/day, 20,000 IU/day, 30,000 IU/day, 40,000 IU/day, 50,000 IU/day, 60,000 IU/day, 70,000 IU/day, 90,000 IU/day, 100,000 IU/day, 200,000 IU/day, 300,000 IU/day, 400,000 IU/day, 500,000 IU/day, 600,000 IU/day, 700,000 IU/day, 800,000 IU/day, 900,000 IU/day, 1,000,000 IU/day, 1,100,000 IU/day, 1,200,000 IU/day, 1,300,000 IU/day, 1,400,000 IU/day, or 1,500,000 IU/day. Preferably, the dosage of the vitamin D species and analogs range between about 1,000-1,500,000 IU administered on a periodic basis of dosing per day or per week or per month.
[0087] The effective dose of the proline modulator may be administered as two, three, four, five, six or more sub-doses, administered separately at appropriate intervals throughout the day.
[0088] The proline modulators, agents and compositions of the present invention may be administered in any desired and effective manner: for oral ingestion, or as an ointment or drop for local administration to the eyes, or for parenteral or other administration in any appropriate manner such as intraperitoneal, subcutaneous, topical, intradermal, inhalation, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic. Further, the proline modulators, agents and compositions of the present invention may be administered in conjunction with other treatments. Each proline modulator, agent and composition of the present invention may be encapsulated or otherwise protected against gastric or other secretions, if desired.
[0089] Another embodiment of the present invention is a method for monitoring the treatment of a subject in need thereof, the method comprising: [0090] a) obtaining a biological sample from the subject; [0091] b) determining the genotype for the allele(s) of the COMT gene at amino acid position 158 in the biological sample; [0092] c) determining the subject's proline level; and [0093] d) modifying the course of treatment, if necessary, including administering a different proline modulator to the subject, or stopping or omitting treatment with a proline modulator, based upon the presence or absence of a Val.sup.158Met polymorphism in the COMT gene, and/or an increase or decrease in the subject's proline level.
[0094] Assays for determining a subject's genotype for the allele(s) of the COMT gene have been disclosed previously herein. Assays for determining a subject's proline level are well-known in the art. See, e.g., Wu, 1993; Inoue et al., 1996; Le Boucher et al., 1997; and Grainger et al., 2004; Liang et al., 2015. Non-limiting examples of proline assays include high throughput (HTP) proline assay, liquid chromatography/mass spectrometry (LC-MS/MS), and automated ion-exchange chromatography. In addition, commercial services for such assays are also available from vendors such as ARUP Laboratories (Salt Lake City, Utah).
[0095] As used herein, modifying the course of treatment refers to any change in the subject's treatment type and/or dosage, including administering a different proline modulator to the subject, stopping or omitting treatment with a proline modulator, adding an additional proline modulator to the treatment, and increasing or decreasing the dosage of a proline modulator. For subjects homozygous for Val, when it is determined that a subject's proline levels are not optimal, a target overnight fasting proline range after treatment onset of greater than about 158 M is desired. Other target proline ranges of the invention include, for example, between 150 M to 700 M or 150 M to 550 M. For subjects with at least one Met allele, when it is determined that a subject's proline levels are not optimal, a target overnight fasting proline range after treatment onset below about 258 M, such as below 170 M, is desired. Other target proline ranges of the invention include, for example, between 80 M to 318 M.
[0096] Another embodiment of the present invention is a diagnostic system for identifying a subject with a disorder who will benefit from an agent that increases or decreases proline levels, comprising: [0097] a) obtaining a biological sample from the subject; [0098] b) determining the identity of alleles of the Val.sup.158Met locus associated with the COMT gene in the sample; [0099] wherein the presence of Val/Val is indicative of a subject who will benefit from an agent that increases proline levels and wherein the presence of at least one Met allele is indicative of a subject who will benefit from an agent that decreases proline levels.
[0100] In one aspect of the present invention, the diagnostic system may be used to assess prodromal subjects prior to onset of, e.g., psychotic symptoms, and to determine possible treatment protocols based on COMT and/or proline status.
[0101] One aspect of this embodiment may further comprise c) administering, to the subject who will benefit from an agent that increases proline levels, a composition that is selected from the group consisting of valproic acid (VPA), divalproex sodium, valproate, sodium valproate, magnesium valproate, lactic acid, miR-23b, miR-23a/b, (L or D)-proline, (L or D)-arginine, (L or D)-glutamine, (L or D)-ornithine, (L or D)-glutamic acid, (L or D)-glutamate, poly(L or D)-proline, poly(L or D)-glutamine, poly(L or D)-ornithine, poly(L or D)-glutamate, poly(L or D)-arginine, analogs of any of the foregoing, and combinations thereof, including mixed polypeptides of (L or D)-proline, (L or D)-glutamine, (L or D)-ornithine, (L or D)-arginine, (L or D)-glutamic acid, or (L or D)-glutamate. Alternatively, another aspect of this embodiment may further comprise c) administering, to the subject who will benefit from an agent that decreases proline levels, a composition that is selected from the group consisting of vitamin D.sub.1, vitamin D.sub.2, vitamin D.sub.3, vitamin D.sub.4, vitamin D.sub.5, Calcitriol, curcumin, one or more thiazolidinedione compounds, colchicine, Etanercept, S26948, INT131, phentoin, analogs of any of the foregoing, and combinations thereof. In this embodiment, the obtaining and determining steps are previously disclosed herein.
[0102] Another embodiment of the present invention is a kit comprising any of the diagnostic systems disclosed herein. Such kits are packaged together with instructions for its use. Such a kit may include, for example, one or more reagents for determination/identification of a COMT genotype or Val.sup.158Met polymorphism, a collection device, and one or more containers. The kit may be used in determining how to regulate proline levels in a subject to effect reduction or eradication of one or more negative symptoms of the subject. Exemplary reagents include, but are not limited to, primers, probes, antibodies, enzymes, oligonucleotides, and immunoassays.
[0103] Another embodiment of the present invention is a method for predicting the clinical response of a subject with a disorder to a proline modulator comprising: [0104] a) determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene using a biological sample of the subject; [0105] wherein the presence of Val/Val at the locus is indicative of a subject who will benefit from an agent that increases proline levels, and wherein the presence of at least one Met allele at the locus is indicative of a subject who will benefit from an agent that decreases proline levels; and [0106] b) administering, if appropriate based on the results of step (a), an effective amount of a proline modulator to the subject to achieve a clinically appropriate response.
The determining and administering steps as well as the proline modulators of this embodiment are as previously disclosed herein.
[0107] Another embodiment of the present invention is a method for monitoring the treatment of a subject with a disorder, the method comprising: [0108] a) determining the genotype for the allele(s) of the COMT gene at amino acid position 158 in a biological sample of the subject; [0109] b) determining the proline level of the subject; and [0110] c) modifying the course of treatment of the subject, if necessary, including administering a different proline modulator to the subject or stopping or omitting treatment with a proline modulator, based upon the presence or absence of a Val.sup.158Met polymorphism in the COMT gene.
[0111] Another embodiment of the present invention is a diagnostic system for identifying a subject with a disorder who will benefit from treatment with an agent that increases or decreases proline levels comprising: [0112] determining the identity of the allele(s) of the Val.sup.158Met locus associated with the COMT gene using a biological sample from the subject; [0113] wherein the presence of Val/Val at the locus is indicative of a subject who will benefit from an agent that increases proline levels and wherein the presence of at least one Met allele at the locus is indicative of a subject who will benefit from an agent that decreases proline levels.
In the last two embodiments, the determining and modifying steps, if present, and the proline modulators, are as disclosed previously herein.
[0114] Another embodiment of the present invention is a method for treating or ameliorating the effects of a disorder in a subject in need thereof. The method includes: [0115] a) obtaining a biological sample from the subject; [0116] b) determining, in the biological sample, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene; and [0117] c) administering to the subject, if appropriate based on the results of step (b), an effective amount of an agent that increases proline levels if the subject is determined from step (b) to have a Val/Val genotype at codon 158; or [0118] d) administering to the subject, if appropriate based on the results of step (b), an effective amount of an agent that decreases proline levels if the subject is determined from step (b) to have a Val/Met or Met/Met genotype at codon 158.
[0119] In this embodiment, the obtaining, determining, and administering steps have been disclosed previously herein. As used herein, the terms ameliorate, ameliorating and grammatical variations thereof mean to decrease the severity of the symptoms, particularly negative symptoms, of a disease in a subject, preferably a human. The polymorphism, disorders, biological samples, and agents for increasing or decreasing proline levels in this embodiment are as disclosed previously herein.
[0120] In one aspect of this embodiment, carrying out the method results in reducing or eradicating negative symptoms associated with the disorder. Examples of such negative symptoms include, but are not limited to, flat or blunted affect, social withdrawal, apathy, diminished emotional expression, avolition, alogia, autonomic dysfunction, impairment of executive performances, inattention, and behavioral problems. Preferred examples of negative symptoms according to the present invention include diminished emotional expression, avolition, impaired social functioning, alogia, apathy, anhedonia, or combinations thereof.
[0121] In another aspect of this embodiment, numerous ways to assess negative symptoms in a subject are provided, including, e.g., a Scale for Negative Symptoms (SANS) score, a Brief Psychiatric Rating Scale (BPRS) negative symptom sub-scale score, a Positive and Negative Syndrome Scale (PANSS) negative symptom sub-scale score, a Brief Negative Symptom Scale (BNSS) score, clinical assessment interview for negative symptoms, negative assessment, or other measures of negative symptoms in the subject. Other methods for detecting negative symptoms known in the art may also be used. Such additional methods include, e.g., tests and assessments for physical, physiological, or behavioral markers, including neuroimaging, electroencephalogram (EEG), and neurophysiological tests such as mismatched negativity (MMN), P3a, P50, and P100 indices, pre-pulse inhibition (PPI), startle habituation, and antisaccade. In the present invention, however, the preferred method for assessing negative symptoms is the SANS score as disclosed in more detail in the Examples and Figures.
[0122] Another embodiment of the present invention is a method for treating or ameliorating the effects of a disorder in a subject in need thereof comprising: [0123] a) determining, using a biological sample of the subject, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene of the subject; and [0124] b) administering to the subject, if clinically appropriate, an effective amount of an agent that increases proline levels if the subject is determined from step a) to have a Val/Val genotype at codon 158; or [0125] c) administering to the subject, if clinically appropriate, an effective amount of an agent that decreases proline levels if the subject is determined from step a) to have a Val/Met or Met/Met genotype at codon 158.
In this embodiment, the determining and administering steps, and the agents, are as disclosed previously herein.
[0126] Yet another embodiment of the present invention is a method for eradicating or reducing a negative symptom experienced by a subject who suffers from a disorder comprising: [0127] a) obtaining a biological sample from the subject; [0128] b) determining, in the biological sample, the presence or absence of a Val.sup.158Met polymorphism in the COMT gene; and [0129] c) administering to the subject, if clinically appropriate, an effective amount of an agent that increases proline levels if the subject is determined from step b) to have a Val/Val genotype at codon 158; or [0130] d) administering to the subject, if clinically appropriate, an effective amount of an agent that decreases proline levels if the subject is determined from step b) to have at least one Met allele at codon 158.
[0131] In this embodiment, the negative symptoms are as described previously. Furthermore, the obtaining, determining, and, if appropriate, administering steps in this embodiment have been described previously.
[0132] Below are a set of genes and variants which (individually and/or in various combinations and/or groups) may modify interaction(s) of proline and/or (glutamate, GABA, glycine, L- and/or D-serine, D-cycloserine, and molecules listed above) with COMT. They include proline and dopamine metabolism and transporter genes.
[0133] COMT genotypes and/or gene-associated variants including the Val.sup.158Met polymorphism and/or rs6270 and/or rs6269 and/or rs4633 and/or rs4818 and/or rs6267 and/or rs5031015 and/or rs4986871 and/or rs4680 (including either allele and/or sequence alternative for COMT Uniprot variant Ids: VAR_013925 and/or VAR_013926 and/or VAR_020274 and/or VAR_020275 and/or VAR_005139 (both alleles (Val and/or Met)) and/or VSP_018778.
[0134] PRODH variants including the rs450046 and/or rs372055 and/or rs2904552 and/or rs137852934 and/or rs4819756 and/or rs193919334 and/or rs2008720 and/or rs2904551 and/or rs3970559 and/or rs1807467 and/or rs2870983 and/or rs3970555 and/or rs2238731 and/or rs2870984 and/or (including either allele alternative for PRODH Uniprot Variant ids: VAR_029566 and/or VAR_029568 and/or VAR_029569 and/or VAR_029570 and/or VAR_029571 and/or VAR_029572 and/or VAR_029573 and/or VAR_029575 and/or VAR_029577 and/or VAR_029567 and/or VAR_029569 and/or VAR_029571 and/or VAR_029574 and/or VAR_029575 and/or VAR_029577.
[0135] SLC6A7 variants and associated variants including rs1468564, and/or rs13153971 and/or rs3776083.
[0136] SLC6A20 variants and associated variants including rs17279437 and/or rs2271615 and/or rs6770261 and/or rs758386 and/or rs4327428.
[0137] SLC6A15 variants and associated variants including rs1545843 and/or rs12424429 and/or rs3782369 and/or rs1031681.
[0138] SLC6A18 variants and associated variants including rs34469326 and/or rs7728667 and/or rs7705355 and/or rs113861454 and/or rs4073918 and/or rs147278493 and/or rs12522796 and/or rs4975623 and/or rs4975625 and/or rs7447815 and/or rs7728646.
[0139] PEPD variants and associated variants including rs121917721 and/or rs121917724 and/or rs121917723 and/or rs17570 and/or rs121917722 and/or rs121917725 and/or rs267606944 and/or rs267606943 and/or rs757386104 and/or rs797045185 and/or rs794728007 and/or rs747700126 and/or rs794728008 and/or rs3786897 and/or rs4805885 and/or rs731839 and/or rs8182584 and/or rs889140 and/or (including either allele alternative for Prolidase PEPD Uniprot Variant ids: VAR_011614 and/or VAR_004404 and/or VAR_011615 and/or VAR_004405 and/or VAR_004406).
[0140] MAOA variants and associated variants including rs77698881 and/or rs587777457 and/or rs1799835 and/or rs1800466 and/or rs1137070 and/or rs1465107 and/or rs2072743 and/or rs2235186 and/or rs2283725 and/or rs3027400 and/or rs3027407 and/or rs3027409 and/or rs5906883 and/or rs5906957 and/or rs5953210 and/or rs6323 and/or rs6609257 and/or rs72554632 and/or rs796065311 and/or rs796065312 and/or rs909525 and/or rs979606 and/or (including either allele and/or sequence alternative for MAOA Uniprot Variant and associated variant ids VAR_036545 and/or id VSP_045173).
[0141] MAOB variants and associated variants including rs10521432 and/or rs1799836 and/or rs2283729 and/or rs3027415 and/or rs6651806 and/or (including either allele and/or sequence alternative for MAOB Uniprot Variant and associated variant ids VSP_057047 and/or VSP_057048 and/or VSP_057049).
[0142] GAD1 variants and associated variants including rs121918345 and/or rs45566933 and/or rs769403 and/or rs769402 and/or rs1049736 and/or rs11542313 and/or rs12185692 and/or rs2058725 and/or rs2241165 and/or rs3749034 and/or rs3762555 and/or rs3791850 and/or rs3791851 and/or rs3791878 and/or rs3828275 and/or rs769390 and/or rs769391 and/or rs769404 and/or rs769407.
[0143] GAD2 variants and associated variants including rs8190591 and/or rs8190600 and/or rs2839672 and/or rs2839673 and/or rs8190671 and/or rs2839678 and/or rs8190730 and/or rs1805398 and/or rs185649317 and/or rs2236418 and/or rs8190590 and/or rs8190748 and/or rs992990.
Additional Definitions
[0144] The term amino acid means naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function similarly to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. An amino acid analog means compounds that have the same basic chemical structure as a naturally occurring amino acid, e.g., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs may have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Imino acids such as, e.g., proline, are also within the scope of amino acid as used here. An amino acid mimetic means a chemical compound that has a structure that is different from the general chemical structure of an amino acid, but that functions similarly to a naturally occurring amino acid.
[0145] As used herein, the terms polypeptide, peptide and protein are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymers.
[0146] Nucleic acid or oligonucleotide or polynucleotide used herein mean at least two nucleotides covalently linked together. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof.
[0147] Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequences. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be synthesized as a single stranded molecule or expressed in a cell (in vitro or in vivo) using a synthetic gene. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.
[0148] The nucleic acid may also be a RNA such as a mRNA, tRNA, short hairpin RNA (shRNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), transcriptional gene silencing RNA (ptgsRNA), Piwi-interacting RNA, pri-miRNA, pre-miRNA, micro-RNA (miRNA), or anti-miRNA, as described, e.g., in U.S. patent application Ser. Nos. 11/429,720, 11/384,049, 11/418,870, and 11/429,720 and Published International Application Nos. WO 2005/116250 and WO 2006/126040.
[0149] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the specification and the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise.
[0150] For recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
EXAMPLES
[0151] The following examples are provided to further illustrate certain aspects of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way.
Example 1
Materials and Methods
Participants:
[0152] Male and female, African American, Caucasian and Hispanic patients, aged 18-65, were recruited from Bellevue Hospital Center (BHC). A diagnosis of schizophrenia or bipolar disorder was confirmed using the Structured Clinical Interview for DSM IV Disorders (SCID). After description of the study to subjects, written informed consent was obtained in accordance with IRB regulations.
[0153] For schizophrenia inpatients, recruitment was cross-sectional and independent of their duration of hospitalization. Psychiatric symptoms were measured using the Scale for the Assessment of Negative Symptoms (SANS), the Scale for the Assessment of Positive Symptoms (SAPS), and the Brief Psychiatric Rating Scale (BPRS). Proline levels of a subset of the schizophrenia patients, those who did not receive treatment with VPA or divalproex, were reported previously (Clelland et al., 2011).
[0154] Bipolar patients were recruited upon presentation at the BHC Comprehensive Emergency Psychiatric Program. Psychiatric symptoms in bipolar disorder patients were measured at an admission visit (visit 1), using the BPRS. At a follow-up inpatient ward visit (visit 2), fasting bloods were collected plus a repeat BPRS assessment performed. Additionally, as shown in
Determination of Fasting Plasma Levels:
[0155] Fasting morning blood draws were performed and proline measured in moles/liter as reported (Clelland et al., 2011).
Genotyping:
[0156] DNA was extracted from blood using the Puregene Blood Core Kit (Qiagen Inc) and the COMT fragment containing the Val.sup.158Met polymorphism amplified using the 5-3 primers: ACTGTGGCTACTCAGCTGTG (SEQ ID No: 4) and CCTTTTTCCAGGTCTGACAA (SEQ ID NO: 5). A step-down PCR was employed with an initial denaturation of 94 C.: 15 minutes, then 12 cycles of 94 C.: 30 seconds, 58 C.: 45 seconds and 72 C.: 30 seconds, followed by 31 cycles of 94 C.: 30 seconds, 50 C.: 45 seconds and 72 C.: 30 seconds, with a final 72 C.: 7 minute extension. Restriction enzyme N1aIII recognizes and cleaves the amplicon into Val (114 bp) or Met (96 bp) fragments, visualized following electrophoreses. To confirm genotyping accuracy, 25% of samples were repeat assayed.
Statistical Analysis:
[0157] Group differences were assessed using ANOVA, Kruskal-Wallis and Mann-Whitney tests (following skewness and kurtosis normality tests), .sup.2 or Fisher exact tests. Meansstandard deviations (SD) were reported, plus Bonferroni adjusted p-values where appropriate. Genotype distributions were tested for Hardy-Weinberg equilibrium (HWE) using a .sup.2 or exact test.
[0158] Linear regression was employed to test for an interaction between fasting plasma proline and COMT on symptoms in schizophrenia, modelling the relationships of these variables on outcomes of total SANS, SAPS and BPRS scores. Based upon the schizophrenia sample result, the primary outcome for bipolar patients was assessed using the BPRS negative symptom subscale (Kane et al., 1988), and percent reduction in negative symptoms calculated. Positive symptom subscale of the BPRS (Id.) and total BPRS scores were also investigated. When outliers in the data or leverage points were identified, a robust regression procedure was employed using an MM estimator to minimize data-point effects (SASv9.3).
[0159] Significant models were investigated further: To assess utility in adjusting the dependent variable, demographic and clinical covariates were entered into a bivariate regression and terms found to have p-values of <0.10 carried forward to a multivariate model. Gender was a covariate in all models, to adjust for previously reported proline gender differences (Jacquet et al., 2005; Tomiya et al., 2007; Clelland et al., 2011). Model fit and selection was determined using the Wald test, testing the null hypothesis that non-significant (p>0.05) covariate parameters were simultaneously equal to zero in full and subsequent reduced models. Statistical analysis was performed in SASv9.3, Stata ICv12, with graphs plotted in GGplot2v1.0.1 in Rv3.1.2.
Example 2
Results
COMT Genotype Modifies the Relationship Between Proline and Negative Symptoms of Schizophrenia:
[0160] The schizophrenia sample consisted of 95 patients. Although recruitment was not targeted by COMT genotype, patients were well matched on demographic characteristics and medication use across genotypes (Table 2).
[0161] In the entire sample, fasting plasma proline was not significantly different across genotypes (range 87 M to 502 M). There were also no differences in BPRS total or negative symptoms (SANS total score), however positive symptoms were significantly different: Met/Met patients had lower SAPS scores than Val/Met (Mann-Whitney z=2.52, adjusted p=0.035) or Val/Val patients (z=2.92, adjusted p=0.001), as previously reported (Goghari & Sponheim, 2008). 100% accuracy was achieved from confirmatory re-genotyping and a sample of 90 control subjects were in HWE for COMT Val.sup.158Met (p>0.05, data not shown). However, COMT distributions of the schizophrenia patients deviated from HWE (.sup.2=8.08, df=1, p<0.05). Although deviations for this polymorphism in schizophrenia have been reported (Joober et al., 2002), this finding may represent substructure due to mixed ethnicity: when stratified by ethnicity, all groups were in HWE (p>0.05).
TABLE-US-00002 TABLE 2 Demographic and Clinical Characteristics of Schizophrenic Patients (SZ), n = 95 Met/Met Val/Met Val/Val n = 21 n = 32 n = 42 Prob.sup.a Characteristic Gender, n (row %) 0.288 Female 11 (23.4) 19 (40.4) 17 (36.2) Males 10 (20.8) 13 (27.1) 25 (52.1) Ethnicity, n (row %) 0.096 African American 5 (13.5) 10 (27.0) 22 (59.5) Caucasian 10 (35.7) 10 (35.7) 8 (28.6) Hispanic 6 (20.0) 12 (40.0) 12 (40.0) Age (years), mean SD 40.9 10.9 39.1 11.5 39.9 11.6 0.820 Smoking Status.sup.b, n (row %) 0.389 Current or Previous 15 (24.6) 24 (39.3) 22 (36.1) Never Smoked 6 (20.7) 8 (27.6) 15 (51.7) History of Alcoholism, n (%) 0.426 Neither 17 (23.6) 27 (37.5) 28 (38.9) Abuse 1 (10.0) 2 (20.0) 7 (70.0) Dependence 3 (23.1) 3 (23.1) 7 (53.8) Education.sup.c 3.6 1.9 3.1 1.0 3.4 1.5 0.859 Age at First Hospitalization.sup.d, mean 23.5 8.0 25 6.5 23.7 7.5 0.465 SD Hospital Duration (days).sup.e, mean SD 19.1 17.1 21.9 23.4 20.0 19.6 0.998 Fasting Plasma Proline, umol/L 219.9 91.6 240.5 68.6 246.4 91.1 0.391 Symptoms BPRS.sup.f Total Symptoms, mean SD 32 8.5 33.6 7.1 33.6 8.4 0.500 SAPS.sup.g Total Symptoms, mean SD 10.3 8.3 15.8 9.6 18.2 10.1 0.006* SANS.sup.h Total Symptoms, mean SD 24 16.8 21.8 13.1 17.5 13.9 0.127 Neuroleptic Medications Neuroleptic Type, n (row %) 0.348 Typical only 5 (27.8) 3 (16.7) 10 (55.6) Atypical only 13 (22.4) 19 (32.8) 26 (44.8) Both 3 (16.7) 9 (50.0) 6 (33.3) None 0 1 (100) 0 Daily CPZE dose.sup.i, mean SD 490.6 234.0 571.1 418.1 526.8 281.0 0.981 Mood Stabilizing Medications Total Number Administered, n (row 0.786 %) 0 15 (26.3) 19 (33.3) 23 (40.4) 1 6 (16.7) 12 (33.3) 18 (50.0) 2 0 1 (50) 1 (50) VPA Treatment, n (row %) 0.327 Yes 4 (12.9) 11 (35.5) 16 (51.6) No 17 (26.6) 21 (32.8) 26 (40.6) Other Medications Benzodiazapines, yes: n (row %) 4 (21.0) 8 (42.1) 7 (36.8) 0.641 Antidepressants, yes: n (row %) 1 (9.1) 5 (45.4) 5 (45.4) 0.596 .sup.a*= significant p-value when comparing characteristic across three COMT genotypes, calculated by one-way ANOVA, Kruskal-Wallis, or Fisher exact tests. .sup.bn = 90, five subjects not reported. .sup.cRecorded as a continuous variable from the SCID (range 2-8). n = 93, two subjects not reported. .sup.dn = 60 for whom this characteristic could be obtained. .sup.eDays in hospital prior to fasting blood draw. .sup.fBrief Psychiatric Rating Scale. .sup.gSchedule for Assessment of Positive Symptoms. .sup.hSchedule for Assessment of Negative Symptoms. .sup.iChlorpromazine (CPZ) equivalent dose, n = 94 as one subject's NL had no CPZ equivalent.
[0162] Testing the primary hypothesis of effect modification, a significant interaction was observed between COMT genotype and proline on negative symptoms in schizophrenia patients (n=95, interaction coefficient=0.082, p<0.0001). As shown in
[0163] Possible confounds on this relationship were assessed (see Table 3). While there was no relationship between SANS score and either medication type, neuroleptic dose (summarized as daily chlorpromazine equivalents), or the number of days in hospital prior to blood draw and symptom assessment, covariate analysis showed that ethnicity and alcohol use were predictors of SANS score (p<0.1, Table 3), and along with gender were taken forward to a multivariate model (Table 4). Model fit was determined with the final model retaining genotype, proline, alcohol use, and the highly significant COMT-proline interaction (p<0.0001). The significant interaction also remained in a stratified analysis following removal of patients reporting alcohol abuse/dependence (p<0.001, n=72). Interestingly, there was no interaction of COMT genotype on the relationship between fasting peripheral proline and positive symptoms (interaction =0.005, p=0.64), or total symptoms (interaction =0.23, p=0.097), suggesting specificity of the relationship to negative symptoms.
TABLE-US-00003 TABLE 3 Bivariate Association Between Schizophrenia Patient Demographic and Clinical Characteristics, with Total SANS Score, n = 95 Characteristic (95% Cl) Prob Gender.sup.a 1.697 (7.609, 4.215) 0.570 Ethnicity.sup.b African American v Caucasian 6.059 (1.026, 13.143) 0.093* African American v Hispanic 7.028 (0.079, 13.977) 0.047* Age 0.024 (0.239, 0.287) 0.857 Education.sup.c 0.389 (1.660, 2.438) 0.707 Alcohol Dependence/abuse.sup.b None v Abuse 0.236 (9.775, 9.303) 0.961 None v Dependence 9.505 (18.023, 0.987) 0.029* Smoking Status.sup.d 0.882 (4.112, 2.349) 0.589 Hospital Duration.sup.e 0.026 (0.121, 0.172) 0.729 Daily CPZE dose.sup.f 0.004 (0.005, 0.014) 0.353 Neuroleptic (NL) Type.sup.b,g Atypical v Typical 2.082 (5.763, 9.930) 0.599 Atypical v both 1.584 (9.430, 6.261) 0.689 Total Number of NLs 2.961 (10.614, 4.692) 0.444 Administered.sup.h Total Number of Mood Stabilizers 1.320 (4.886, 7.526) 0.674 Administered.sup.i VPA Treatment.sup.j 0.578 (7.157, 6.001) 0.862 Benzodiazapines 3.342 (10.713, 4.028) 0.370 .sup.aBinary variable: Male v female. .sup.bFor categorical analysis the reference category is the first level listed for each variable. .sup.cRecorded as a continuous variable from the SCID (range 2-8) .sup.dBinary variable: Never v current or previous smokers, n = 90 as four subjects did not report smoking status. .sup.eDays in hospital prior to fasting blood draw and symptoms assessment. .sup.fChlorpromazine (CPZ) equivalent dose, n = 93 as one subject's NL had no CPZ equivalent, and one subjects did not receive a NL. .sup.gn = 94, as one subject did not receive a NL. .sup.hBinary variable: one v two, n = 92 (as one subject did not receive a NL, and only two subjects were administered >2 different NLs). .sup.iBinary variable: no versus yes, n = 92 (as three subjects had not received <48 hours of VPA treatment). .sup.jBinary variable: none versus one, n = 93 (as only two subjects were administered >1 mood stabilizers).
TABLE-US-00004 TABLE 4 Prediction of Negative Symptoms from Proline Level and COMT in Psychiatric Patients Test Coefficient SE statistic.sup.a Prob Wald test Schizophrenia Models (DV = Total SANS Score, n = 95) Full Model.sup.b Proline 0.1050 0.0333 9.94 0.0016* COMT (ValVal, ValMet, MetMet) 13.0179 4.2452 9.40 0.0022* Interaction (Proline = COMT) 0.0744 0.0169 19.48 <.0001* Alcohol Use Alcohol Abuse v None 4.2178 4.2706 0.98 0.3233 Alcohol Dependence v None 9.0807 3.5632 6.49 0.0108* Gender 1.0466 2.3795 0.19 0.6600 Ethnicity African-American v Caucasian 3.0258 3.0258 1.14 0.2866 African-American v Hispanic 4.6703 2.8214 2.74 0.0979 p = 0.517.sup.c Final Model.sup.b Proline 0.0804 0.0321 6.28 0.0122* COMT (ValVal, ValMet, MetMet) 9.6576 4.0300 5.74 0.0166* Interaction (Proline COMT) 0.0651 0.0161 16.39 <.0001* Alcohol Use Alcohol Abuse v None 5.1234 3.9854 1.65 0.1986 Alcohol Dependence v None 9.7478 3.3526 8.45 0.0036* p = 0.020.sup.d Bipolar Disorder Models (DV = % Change in BPRS Negative Symptoms Scale, n = 43) Full Model Proline 0.0012 0.0006 2.09 0.044* COMT (Met/Met v ValVal) 0.4281 0.1650 2.60 0.014* Interaction (Proline COMT) 0.0017 0.0007 2.42 0.022* Gender 0.1960 0.0656 2.99 0.005* Ethnicity African-American v Caucasian 0.0186 0.0839 0.22 0.826 African-American v Hispanic 0.1528 0.1052 1.45 0.156 Duration (days) between Assessments 0.0049 0.0070 0.69 0.492 Neuroleptic Type Atypical Neuroleptic v None 0.0802 0.0818 0.98 0.334 Typical Neuroleptic v None 0.1401 0.2087 0.67 0.507 Both v None 0.1531 0.1184 1.29 0.206 Benzodiazepines 0.0840 0.0714 1.18 0.249 p = 0.056.sup.e Final Model Proline 0.0016 0.0006 2.55 0.015* COMT (Met/Met v ValVal) 0.5029 0.1766 2.85 0.007* Interaction (Proline COMT) 0.0021 0.0007 2.83 0.007* Gender 0.1856 0.0656 2.83 0.007* p = 0.0074.sup.f .sup.a.sup.2 (Schizophrenia models using Robust linear regression) or t (Bipolar models using linear regression) .sup.bRobust regression, MM Estimation Method (28). .sup.cRobust Wald tests canonical linear hypothesis that combined effect of non-significant covariates (Gender and Ethnicity) is zero. .sup.dRobust Wald tests hypothesis that covariate effect (Alcohol use) is zero. .sup.eWald tests canonical linear hypothesis that combined effect of non-significant covariates (Ethnicity, Duration, Neuroleptic Type and use of Benzodiazepines) is zero. .sup.fWald tests hypothesis that covariate effect (Gender) is zero.
Example 3
[0164] Valproate Treated COMT Val/Val Schizophrenia Patients have Significantly Lower Negative Symptoms than Met Allele Carriers:
[0165] An effect of VPA on plasma proline has been reported (Jacquet et al., 2005) and VPA-treated schizophrenia patients in the current study had significantly higher proline (mean=299.2994.76, n=28) than those who did not receive VPA (mean=215.8463, n=64) (z=3.97, p=0.0001). Considering the finding of an interaction between COMT and proline on negative symptoms, the hypothesis was that VPA treated Val/Val patients would respond differently to the concomitant high levels of proline, with respect to their negative symptoms, as compared to Met carriers. As shown in
Example 4
COMT Genotype Modifies the Relationship Between Proline and Negative Symptom Change in in Bipolar Disorder:
[0166] The hypothesis that COMT genotype modifies the relationship between proline and negative symptoms across psychiatric illnesses was explored, employing a second patient sample: 43 subjects with bipolar disorder who had completed a BPRS assessment upon admission to the psychiatric ER (visit 1) plus a second BPRS assessment and fasting blood draw during their follow-up visit (mean duration between assessments=9.54.6 days). Thus, for this sample the relationship between COMT and proline on the change in symptoms was calculated by the percent reduction in negative symptoms from admission to follow-up.
[0167] As for the schizophrenia cohort, recruitment of the bipolar sample was not targeted by COMT genotype, but subjects were matched on demographic characteristics (Table 5) and medication use at both study visits (Table 6). The distribution of COMT genotypes was in HWE (.sup.2=0.387, df=1, p>0.05). Due to the finding in schizophrenia that Met allele carriers have a similar response to high proline, and because of the smaller bipolar sample size, Met/Met and Val/Met bipolar groups were pooled for further analysis.
TABLE-US-00005 TABLE 5 Demographic and Clinical Characteristics of Bipolar Disorder Patients, n = 43 Met/Met Val/Met Val/Val Characteristic n = 5 n = 22 n = 16 Prob.sup.a Gender, n (row %) 0.328 Female 1 (6.2) 11 (68.8) 4 (25.0) Male 4 (14.8) 11 (40.7) 12 (44.4) Ethnicity, n (row %) 0.450 African American 0 4 (57.1) 3 (42.9) Asian 0 0 1 (100) Caucasian 3 (11.5) 13 (50.0) 10 (38.5) Hispanic 2 (22.2) 5 (55.6) 2 (22.2) Age (years), mean SD 34 9.7 32.8 8.4 33.2 11.2 0.933 Smoking Status.sup.b, n (row %) 1.000 Current or Previous 4 (13.3) 15 (50.0) 11 (36.7) Never Smoked 1 (8.3) 6 (50.0) 5 (41.7) History of Alcoholism, n (row %) 1.000 Abuse 1 (7.1) 8 (57.1) 5 (35.7) Dependence 1 (12.5) 4 (50.0) 3 (37.5) Neither 3 (14.3) 10 (47.6) 8 (38.1) Education.sup.c, mean SD 4.2 2.0 3.8 1.6 4.2 2.0 0.709 Fasting Plasma Proline.sup.d, umol/L 213.6 72.7 205.5 63.2 245.8 123.4 0.669 Age at Onset, mean SD 25.8 2.8 26.4 8.3 24.1 7.8 0.207 Age at First Hospitalization, mean SD.sup.a 26 3.2 26.8 9.3 22.9 7.4 0.112 Days between Symptom Assessments, 10.2 6.2 9.4 3.7 9.5 5.1 0.382 mean SD .sup.aP-value values when comparing Met allele carriers to Val/Val patients, calculated by Satterthwaite t-test, Mann-Whitney, Chi-Square or Fisher exact test. .sup.bn = 42, one subject not reported. .sup.cRecorded as a continuous variable from the SCID (range 2-8). .sup.dSampled at visit 2.
TABLE-US-00006 TABLE 6 Clinical Characteristics of Bipolar Disorder Patients, n = 43 Admission (Visit 1) Follow-up (Visit 2) Met/Met Val/Met Val/Val MetMet Val/Met ValVal Characteristic n = 5 n = 22 n = 16 Prob.sup.a n = 5 n = 22 n = 16 Prob.sup.a Brief Psychiatric Rating Scale.sup.b Total Symptoms, 42 7.3 36.3 5.9 36.4 4.7 0.592 34.8 8.8 25.9 5.8 27.4 5.2 0.772 mean SD Negative Symptoms.sup.c, 9.0 5.1 6.3 2.2 6.2 1.7 0.872 6.0 1.4 5.6 0.9 5.6 1.0 0.711 mean SD Positive Symptoms.sup.d, 24.6 5.0 18.7 6.2 18.2 6.2 0.457 18.4 5.3 12.4 4.8 13.7 4.2 0.553 mean SD Psychosis.sup.e: yes, n 4 (13.3) 14 (46.7) 12 (40) 0.735 (row %) Neuroleptic (NL) Medications NL Type, n (row %) 1.000 0.745 Typical only 2 (22.2) 4 (44.4) 3 (33.3) 0 0 1 (100) Atypical only 1 (12.5) 4 (50.0) 3 (37.5) 3 (9.7) 17 (54.8) 11 (35.5) Both 0 3 (75) 1 (25) 2 (40.0) 1 (20.0) 2 (40.0) None 2 (9.1) 11 (50.0) 9 (40.9) 0 4 (66.7) 2 (33.3) Daily CPZE dose.sup.f, 282.3 202.1 284.1 109.7 239.3 81.5 0.403 566.7 372.1 344.4 162.6 362.3 202.6 0.863 mean SD Total number of NLs, 0.906 0.731 n (row %) 0 2 (9.1) 11 (50) 9 (40.9) 0 4 (66.7) 2 (33.3) 1 3 (17.6) 8 (47.1) 6 (35.3) 2 (7.1) 16 (57.1) 10 (35.7) 2 0 3 (75.0) 1 (25.0) 3 (37.5) 2 (25) 3 (37.5) Mood Stabilizing Medications Total number of 0.282 0.785 mood stabilizers, n (row %) 0 5 (12.5) 19 (47.5) 16 (40.0) 0 1 (100) 0 1 0 3 (100) 0 3 (8.3) 20 (55.6) 13 (36.1) 2 0 0 0 2 (33.3) 1 (16.7) 3 (50) VPA: yes, n (row %) 0 1 (100) 0 1.000 2 (9.5) 11 (52.4) 8 (38.1) 1.000 Other Medications Benzodiazapines: 3 (15.8) 10 (52.6) 6 (31.6) 0.542 4 (22.2) 4 (22.2) 10 (55.6) 0.055 yes, n (row %) Antidepressants: yes, 0 2 (66.7) 1 (33.3) 1.000 1 (5.6) 7 (38.9) 10 (55.6) 0.055 n (row %) .sup.aP-value values when comparing M allele carriers to ValVal patients, calculated by Satterthwaite t-test, Mann-Whitney, Chi-Square or Fisher exact test. .sup.bBPRS = Brief Psychiatric Rating Scale. .sup.cNegative Symptoms (BPRS items 3 + 13 + 14 + 16 + 18) .sup.dPositive Symptoms (BPRS items 4 + 7 + 8 + 10 + 11 + 12 + 15 + 17) .sup.ePsychosis determined as current or previous psychotic illness at admission only. .sup.fChlorpromazine (CPZ) equivalent dose.
[0168] A significant interaction was observed between COMT and fasting peripheral proline on the percent change in negative symptoms (n=43, interaction coefficient=0.0017, p=0.04). As shown in
[0169] As found with the schizophrenia sample, bipolar VPA-treated patients had significantly higher fasting plasma proline than those who did not receive VPA (
TABLE-US-00007 TABLE 7 Bivariate Association Between Bipolar Disorder Patient Demographic and Clinical Characteristics, with Percent Change in Negative Symptoms, n = 43 Characteristic (at Visit 2) (95% CI) Prob.sup.a Gender.sup.b 1.359 (0.003, 0.268) 0.045* Ethnicity.sup.c African American v Caucasian.sup.d 0.048 (0.022, 0.121) 0.566 African American v Hispanic 0.272 (0.473, 0.071) 0.009* Age 0.003 (0.004, 0.010) 0.369 Education.sup.e 0.013 (0.026, 0.051) 0.513 Alcohol Dependence/abuse.sup.b None v Abuse 0.020 (0.174, 0.133) 0.790 None v Dependence 0.055 (0.240, 0.130) 0.554 Smoking Status.sup.f 0.104 (0.045, 0.253) 0.165 Duration (days) between 0.013 (0.002, 0.028) 0.082* symptom assessments Daily CPZE dose.sup.g 0.000 (0.000, 0.000) 0.607 Neuroleptic (NL) Type.sup.b None v Atypical 0.091 (0.285, 0.103) 0.348 None v Typical 0.006 (0.476, 0.465) 0.981 None v both 0.230 (0.494, 0.033) 0.085* Total Number of NLs Administered.sup.h 0.074 (0.192, 0.043) 0.209 Total Number of Mood Stabilizers 0.050 (0.154, 0.054) 0.338 Administered.sup.i VPA Treatment 0.013 (0.148, 0.122) 0.845 Benzodiazapines 0.120 (0.251, 0.011) 0.072* Antidepressants 0.004 (0.133, 0.140) 0.958 .sup.a*Taken forward into multivariate model. .sup.bBinary variable: Male v female. .sup.cFor categorical analysis the reference category is the first level listed for each variable. .sup.dIncludes n = 1 Asian subject. Parameter estimates did not change following the removal of this subject, and so they were included in all final models. .sup.eRecorded as a continuous variable from the SCID (range 2-8). .sup.fBinary variable: Never v current or previous smokers, n = 42 (as one subject did not report smoking status). .sup.gChlorpromazine (CPZ) equivalent dose, n = 37 (as six subjects did not receive a NL). .sup.hContinuous variable with three levels (none, one or two), n = 42 (as only subject was administered >two NLs). .sup.iBinary variable: one v two, n = 42 (as one subject did not receive a mood stabilizer).
Example 5
Discussion
[0170] The data presented herein demonstrate that fasting peripheral proline and COMT Val.sup.158Met genotype predict negative symptom severity across psychiatric diagnoses. Specifically, evidence is presented that in schizophrenia patients with the Val/Val genotype (encoding the high activity COMT enzyme), high proline was associated with lower levels of negative symptoms. As proline rose across the Val/Val patient sample, negative symptoms decreased. Conversely, Met allele carriers displayed the opposite relationship, exhibiting significantly more negative symptoms as proline levels rose. Over the range of fasting proline in the schizophrenia sample (87-502 M), this represents a significant and clinically relevant difference in negative symptoms between COMT genotype groups.
[0171] VPA upregulates circulating proline (Jacquet et al., 2005) and VPA-treated schizophrenia Val/Val patients had significantly less negative symptoms than VPA-treated Met allele patients, likely due to the impact of VPA on proline level. Interestingly, the relationship between proline, COMT and negative symptoms was consistent across the entire schizophrenia sample, whether subjects received VPA or not, suggesting that the source of circulating proline is less important than the actual level in predicting symptoms. This data has implications for treatment decisions, because proline-modulating medications such as VPA, which is very commonly used to treat bipolar disorder and also schizophrenia, may have differential benefits on negative symptoms and conversely, detrimental effects, based upon the Val.sup.158Met genotype.
[0172] In a second sample, the interaction between COMT and proline on negative symptom change was explored in patients with bipolar disorder (using the BPRS negative symptom subscale). Supporting the earlier schizophrenia finding, a significant interaction was observed between proline and COMT: high proline was associated with improvement of negative symptoms in homozygous Val/Val bipolar patients, while high proline in Met allele carriers was associated with less improvement or an increase in negative symptom severity. This finding was not confounded by medication use, the duration of time between assessments, or demographic characteristics of the bipolar sample. Interestingly, the bipolar patients did not have proline levels significantly higher than controls, suggesting that proline may impact negative symptoms and their severity, but not bipolar disorder risk.
[0173] The present disclosure is believed to be the first to document that proline and COMT interact to predict negative symptom outcomes in psychiatric and other disorders. The finding of a detrimental effect of high proline in combination with the COMT Met allele on schizophrenia and bipolar disorder negative symptoms, is in part supported by studies of 22q11DS patients, who have an increased risk of psychosis (albeit exhibiting positive symptoms (Raux et al., 2007)) plus a neurophysiological visual sensory deficit (Vorstman et al., 2009), when carrying the Met allele in the presence of high proline.
[0174] This finding that high proline is protective in Val/Val patients with schizophrenia and bipolar disorder is novel and significant. Intriguingly, Zarchi et al. (2013), reported the protective effect of a PRODH variant (the Tryptophan (Trp) allele of the Arg.sup.185Trp polymorphism) on a neurophysiological measure (MMN) in COMT Val 22q11DS patients. Since the Trp allele exhibits decreased PDX activity in vitro (Bender et al., 2005), Zarchi et al., discussed either an opposite effect of this allele in vivo, or alternatively that the Arg.sup.185Trp polymorphism is in linkage disequilibrium with another functional SNP; in each circumstance likely resulting in increased PDX activity and low peripheral proline. The data disclosed herein suggests the opposite to that interpretation: that high proline is actually protective in hemizygous 22q11DS patients with the Val genotype, with regards to MMN.
[0175] Putative CNS roles of proline have been described both in terms of its potential as a neurotransmitter, suggested by its uptake into and direct synthesis within synaptosomes and its release at the synapse after K+ induced depolarization (Phang et al., 2001; Nickolson, 1982; Yoneda and Roberts, 1982; Nadler, 1987), as well as a neuromodulator of neurotransmitter systems, suggested by the presence of high-affinity proline transporters in glutamatergic neurons (Phang et al., 2001; Renick et al., 1999; Cohen and Nadler, 1997a; Cohen and Nadler, 1997b), and the enhancements of glutamatergic and prefrontal DA transmission in the presence of Prodh deficiency and elevated proline (Paterlini et al., 2005). Although the mechanism by which proline elevation may impact neurotransmission requires further investigation, it is apparent from the Prodh null model (Gogos et al., 1999; Paterlini et al., 2005) and the human hyperprolinemias (Phang et al., 2001) that elevated proline can be detrimental in the CNS. In schizophrenia and bipolar disorder, carrying the Met allele may further accentuate proline's toxicity. In this model, enhanced DA-transmission in the PFC as a result of excess proline is exacerbated by low COMT activity and concomitant higher prefrontal DA availability, ultimately resulting in a frontal hyperdopaminergic state that mimics that of the Prodh null mouse (Paterlini et al., 2005; and as reviewed in Drew et al., 2011).
[0176] A hyperdopaminergic model influencing negative symptom severity is somewhat counterintuitive, given that negative symptoms are generally considered to arise from deficient mesocortical DA stimulation. However, COMT is involved in maintaining PFC cognitive stability (Bilder et al., 2004; Turnbridge et al., 2006), and in situations of high cortical DA concentrations and D.sub.1 receptor stimulation (likely present in Met/Met and to a lesser degree Val/Met psychiatric patients), enhanced cognitive stability of neuronal network activation has been theorized by Bilder et al. (2004) to result in a cognitive rigidity that may increase the likelihood of negative symptoms. Thus, the Met allele may be less effective in alleviating the increased dopaminergic tone in schizophrenia and bipolar disorder patients with elevated proline, significantly impacting negative symptoms or at least the persistence of negative symptoms and their improvement after treatment.
[0177] Conversely, as disclosed herein, proline elevation beneficially influences negative symptom severity in Val/Val patients. In a COMT Val homozygous state, high enzymatic activity in the PFC would likely reduce prefrontal DA, limiting D.sub.1 receptor-mediated excitation (Bilder et al., 2004; Turnbridge et al., 2006). Speculatively, proline elevation may increase prefrontal DA signaling, through interference with glutamatergic pathways (Paterlini et al., 2005), reducing vulnerability to a prefrontal hypodopaminergic state in Val/Val patients (Bilder et al., 2004). Taken together these models suggest that negative symptoms are significantly impacted in conditions of both hyper- or hypo-DA activity.
[0178] Interestingly, no relationship was found between COMT and proline on positive symptoms. Positive symptoms are considered to arise from hyperactive subcortical mesolimbic projections, and the current finding is consistent with the action of proline in murine cortical but not striatal DA potentiation (Paterlini et al., 2005). Additionally, DA transporters are relatively sparse in the PFC (Lewis et al., 2001), and the removal of DA there may be more impacted by COMT activity and the interaction with proline, as compared to subcortical regions.
[0179] Some study limitations exist: in the schizophrenia sample, proline was measured and symptoms assessed cross-sectionally. Thus the findings may be confounded by enrollment differences across genotypes. However, negative symptoms were not significantly different between genotypes, there was no significant main effect of COMT on negative symptoms, and the length of hospitalization prior to symptom assessment had no relationship with negative symptoms, suggesting that the cross-sectional nature of the study did not confound the results. Additionally, while the bipolar study allowed investigation of symptom change, the bipolar sample size was smaller and negative symptoms assessed using only a subscale of the BPRS. Further research would therefore benefit from a longitudinal approach, investigating the interaction between proline and COMT on the change in negative symptoms assessed via the SANS, in a large sample of both schizophrenia and bipolar disorder patients.
[0180] Nonetheless, there are currently no medications approved for the treatment of negative symptoms in psychiatric illness, which are associated with poor functional outcomes and quality of life, are highly persistent, and are a great burden for caregivers (Blanchard et al., 2011). The finding of a beneficial effect on negative symptoms of high proline in Val/Val patients suggests that personalization of treatments based upon a patient's COMT genotype, for the purpose of up- or down-regulating proline level, holds promise as a pharmacogenomics approach to intervene and target this unaddressed symptom domain.
Example 6
Relationship Between Change in Proline and Negative Symptoms:
[0181] Preliminary data also suggests that a change in proline level is directly related to change in negative symptoms. Specifically, twelve bipolar disorder patients had a pre- and post-medication fasting blood draw (with proline measured), plus pre- and post-assessment. Of these, ten were Met allele carriers (Met/Met or Val/Met). Findings suggest that high proline is associated with no improvement or a worsening of symptoms in the presence of high proline. Thus, it was expected that for these subjects, an increase in proline would be related to a worsening of symptoms. Testing this hypothesis, a strong positive relationship was found between the change in proline and the percent change in negative symptoms (see
[0182] Only two subjects were Val/Val homozygotes with both pre- and post-medication values. Interestingly, one subject whose proline went down (from 167 M to 119 M) had no change in negative symptoms. However, the other subject, whose proline went up (from 206 M to 332 M), had a corresponding decrease in negative symptoms (from a score of 8 to 6). Again, this supports the hypothesis that high proline is good for Val/Val homozygotes.
[0183] However, valproate increases peripheral proline, so it can be assumed that all Val/Val patients treated with Valproate (n=8) had an increase in peripheral proline between blood draws (regardless of whether the blood draw at visit one was fasting). Therefore, using this subsample, there was seen a negative relationship between the change in proline and symptoms (spearman's rho=0.4), although this result again did not reach significance likely due to the small sample size (p=0.3).
Example 7
Proline and COMT in Other Disorders:
[0184] Pomara et al. (1992) showed elevated cerebrospinal fluid (CSF) proline level in Alzheimers disease (AD). Patients with AD are also known to display negative symptoms. Treatment to modulate proline levels based upon COMT Val.sup.158Met genotype would be beneficial to control those symptoms in AD.
[0185] Ethanol increases circulating proline levels, and comorbid alcohol use disorder is the most common comorbidity in schizophrenia (Drake and Mueser, 2002), and is also common in bipolar disorder (Sonne and Brady, 2002). Up- or down-regulation of proline level may exacerbate negative symptoms or conversely improve them, depending on COMT genotype. Alcohol use may be a form of self-medication that could be replaced by other proline modulation methods/treatments. Recently, differential effects were found of alcohol abuse or dependence frequency based on genotype (COMT Val/Val subjects were 2.4 times more likely to report alcohol abuse and/or dependence than Met allele patients, p=0.09, unpublished).
[0186] Susceptibility to alcohol abuse and/or dependence may be related to differential effects on mood and/or pleasure-ability based upon proline level and COMT genotype. Treatments to alter proline level based on COMT genotype may be useful for the treatment of alcohol use disorders and potentially for gambling disorders (Guillot et al., 2015).
Example 8
Proline and COMT in Alcohol Use Disorder (AUD):
[0187] Comorbidity of Alcohol Use Disorder (AUD) with schizophrenia (SZ) is highly prevalent at over 33% of SZ patients. Comorbidity is associated with particularly unfavorable outcomes including raising mortality risk and treatment non-adherence. Of particular relevance, some SZ patients have reported a decrease of symptoms, including negative symptoms, following alcohol ingestion. This is important because the negative symptoms of SZ (loss of motivation, flattening of emotional responses, decreased speech and activity, and social withdrawal), are disabling and persistent, and significantly contribute to the immense personal and economic costs of SZ. No medications are FDA-approved for treatment of negative symptoms in SZ.
[0188] Proline is a precursor of the neurotransmitter glutamate and may function as a CNS neuromodulator. Elevated proline stimulates dopamine signaling in murine models. Catechol-O-methyltransferase (COMT) catalyzes deactivation of neurotransmitters including dopamine. In our recent, replicated, study we found that fasting plasma proline levels (which reflect CNS levels) and the COMT Val158Met functional polymorphism (high/low enzyme activity) significantly interact, predicting negative symptom outcomes in patients with severe psychiatric illness. Specifically, in Val/Val patients, high proline is protective with low negative symptom severity or a greater negative symptom reduction over time. Conversely, COMT Met carriers demonstrated the opposite: significantly more negative symptoms or less symptom improvement as proline increased.
[0189] Alcohol ingestion upregulates circulating proline, in those with a current or past AUD, and thus we hypothesized that comorbid patients self-medicate with alcohol to relieve their negative symptoms; predicting more frequent comorbid AUD in Val/Val SZ patients. In a preliminary study we indeed found a strong trend as compared to Met allele carriers for whom alcohol-induced proline elevation would be detrimental (p=0.06, 2-tailed). This finding is important because sodium valproate (VPA), prescribed to 35% of SZ inpatients, is also a strong up-regulator of proline levels. We found a strong trend towards significance for an interaction between VPA treatment and AUD on cross-sectional proline levels (interaction p=0.050); with VPA vastly boosting proline levels in Val/Val patients with AUD, but not significantly in VPA-treated patients without an AUD (data not shown). We propose personalized VPA treatment or treatment with proline or modulators that increase proline levels, for negative symptoms in comorbid AUD and neuropsychiatric disorders including schizophrenia patients who carry the Val/Val genotype, to relieve negative symptoms and assist in maintaining abstinence.
Example 9
Proline and COMT in Alzheimer's Disease (AD)/Traumatic Brain Injury (TBI):
[0190] Neuropsychiatric symptoms such as apathy are frequently described in patients with Alzheimer's disease (AD), as well as those who have sustained a traumatic brain injury (TBI). In fact, reports have suggested that close to one half of all AD and TBI patients' exhibit apathy (Brodaty et al. 2015; Karttunen et al. 2011; Hwang et al. 2004; Lyketsos et al. 2011), which is characterized by the loss of motivation to participate in activities, social withdrawal, and emotional indifference and these symptoms often present in incipient AD (including MCI) (Leoutsakos et al. 2015; Van Dam et al. 2016) or within the first year after brain injury (Stfan et al. 2016). Apathy and related symptoms contribute substantially to the huge personal and economic costs for individuals living with AD and TBI: Apathy can disrupt patients' participation in family life and social integration, and can lead to more intensive utilization of health care services (Arnould et al. 2015; Cattelani et al. 2008). Furthermore, apathy in AD is associated with a rapid course of functional and cognitive decline (Benoit et al. 2008; Lechowski et al. 2009; Landes et al. 2005; Leoutsakos et al. 2015), and in TBI patients, negatively impacts rehabilitation (Starkstein et al. 2014). Of relevance, substantial caregiver burden and distress have been significantly associated with the presence and severity of apathy (Karttunen et al. 2011; Lyketsos et al. 2011; Starkstein et al. 2014; Arnould et al. 2015; Fauth et al. 2014).
[0191] Apathy is a negative neuropsychiatric symptom. Although commonly considered a major symptom domain of psychiatric illness, the full spectrum of negative symptoms can also present in patients with dementia (Reichman et al. 1996; Galynker et al. 1997; Negron et al. 2000; Galynker et al. 2000; Vercelletto et al. 2002; de Jonghe et al. 2003) and constitutes an independent behavioral dimension that is not an outcome of depression and/or cognitive status (Reichman et al. 1996; Galynker et al. 1997; de Jonghe et al. 2003).
[0192] Intriguingly, it has been suggested that targeting of these symptoms in AD may extend the time to conversion from MCI (Ismail et al. 2016) and possibly positively alter the trajectory of the disease process (Forlenza et al. 2017). However, there are no approved treatments for negative symptoms in AD or TBI, and thus there is clearly a need for new research into interventions that target neuropsychiatric symptoms of AD and TBI, in particular negative symptoms, to improve the quality of life for individuals living with TBI and AD, and also to alleviate the burden on their caregivers.
[0193] There is evidence of increased CNS and peripheral proline levels in patients with AD (Pomara et al. 1992; Molina et al. 1998; Trushina et al. 2013). We propose and will investigate that the prolineCOMT interaction and its impact on negative symptoms, either beneficial or detrimental, as previously observed in psychiatric disorders, is generalizable across neuropsychiatric diseases including AD and TBI.
Example 10
Relationship Between Negative Symptoms and VPA Level:
[0194] The relationship between blood levels of VPA and negative symptoms was investigated by COMT genotype. It was hypothesized that those with the Met allele and high levels of blood VPA would have a lower % negative symptom change, i.e. a positive % change, indicating increased negative symptoms, due to exacerbation by increased proline level. Conversely, Val/Val patients would be expected to have a greater % decrease in negative symptoms as levels of VPA rose. As hypothesized, and as shown in
Example 11
[0195] Proline may function as a neuromodulator via stimulation or alteration of neuronal glutamate and/or GABA signaling, which may underlie its effect on negative and other neuropsychiatric symptoms (Clelland et al., 2016; Crabtree et al., 2016). Molecules that can modulate neuronal glutamate signaling including NMDA receptor and/or glutamatergic signaling functions, and have been considered and/or tested in clinical trials in psychiatric disorders include glycine, D-serine, D-cycloserine and bitopterin (Roche RG1678; RO-4917838), sarcosine, SSR103800, Org 25935 and betaine. These are thought to alter glutamate receptor activity or function either directly or indirectly via modulation of the concentration of glycine and/or function of the glycine binding site.
[0196] Considering that clinical studies of molecules also thought to influence glutamate signaling have had mixed results, an initial exploratory analysis was performed of fasting plasma glycine and 1-serine and an interaction with COMT genotype on negative symptoms of schizophrenia. Plasma glycine concentrations reflect CNS levels (Jimnez-Jimnez et al., 1998; Scholl-Brgi et al., 2008; Luykx et al., 2013) and CSF D-serine, which is derived from L-serine via serine racemase, is significantly correlated with plasma L-serine (Luykx et al., 2013; Hashimoto et al., 2003).
[0197] In a sample of schizophrenia patients (n=95), fasting plasma glycine and 1-serine significantly predicted increased negative symptoms in those subjects with the COMT Val/Met or Met/Met genotypes (glycine r=0.48, p=0.0003, n=53; 1-serine r=0.32, p=0.02, n=53), but not in Val/Val carriers (glycine r=0.05, p=0.78, n=42; 1-serine r=0.12, p=0.46, n=42). Following on from this, in regression analysis any significant effect of glycine was tested for after adjusting for the potential confounding effect of proline. A significant effect of glycine on negative symptoms remained (p=0.013) with medium effect size (partial eta.sup.2=0.116). As for proline, as glycine increased, so did negative symptoms in Met allele carrier patients.
[0198] In addition, analysis of valproate versus non-valproate-treated subjects indicated that valproate significantly upregulates fasting glycine levels (268 uM no valp n=64, 361 uM valp n=31, p=0.0007) and L-serine levels (103 uM no valp n=64, 117 uM valp n=31, p=0.004).
[0199] Given these findings of glycine and serine interactions with COMT, the interaction of COMT Val.sup.158Met genotype with glycine on negative symptoms therefore also likely occurs when glycine modulators, including those listed above, are used in psychiatric and neuropsychiatric disorders.
[0200] As some of the molecules listed above have been extensively tested in clinical trials, reanalysis of the trial data and/or new trials accounting for COMT genotype when determining efficacy, may lead to evidence of therapeutic efficacy that has been previously undetected.
[0201] Trials of the molecules listed above for the treatment of psychiatric, neuropsychiatric, psychotic, mood and personality disorders, and symptoms thereof such as negative symptoms, should therefore be analyzed to account for the interaction of individuals' COMT Val.sup.158Met genotype with glycine and (L- and/or D-) serine levels (and/or with potentially glutamate and/or GABA), with the expectation that COMT Val/Val genotype individuals will respond differently from Met allele carriers, and the failure of clinical trials to achieve efficacy may be due to patients not being chosen based on their COMT genotype (and thus whether they would benefit or be harmed by such treatment). In recent studies, we have identified that the proline modulator, LX6171, an SLC6A7 (PROT) transporter inhibitor, may be useful for treatment of COMT Val.sup.158/Val, or for COMT Met.sup.158Met or COMT Val.sup.158Met carriers, and may act via increased synaptic proline and/or decreased gamma-aminobutyric acid (GABA) synthesis (data not shown).
[0202] All patents, patent applications, and publications cited herein are incorporated herein by reference in their entirety as if recited in full herein.
[0203] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention and all such modifications are intended to be included within the scope of the following claims.
CITED DOCUMENTS
[0204] 1. Allen N C, et al. Systematic meta-analyses and field synopsis of genetic association studies in schizophrenia: the SzGene database. Nat Genet 2008; 40(7):827-34 [0205] 2. Arnould A, Rochat L, Azouvi P, Van der Linden M. (2015) Apathetic symptom presentations in patients with severe traumatic brain injury: Assessment, heterogeneity and relationships with psychosocial functioning and caregivers' burden. Brain Inj. 29(13-14): 1597-603. [0206] 3. Baker K D, Skuse D H. Adolescents and young adults with 22q11 deletion syndrome: psychopathology in an at-risk group. Br J Psychiatry 2005; 186:115-20 [0207] 4. Baxter C F, et al. High proline levels in the brains of mice as related to specific learning deficits. Pharmacol Biochem Behav 1985; 22(6):1053-9 [0208] 5. Bender H U, et al. Functional consequences of PRODH missense mutations. Am J Hum Genet 2005; 76:409-20 [0209] 6. Benoit M, Andrieu S, Lechowski L, Gillette-Guyonnet S, Robert P H, Vellas B; REAL-FR group. (2008) Apathy and depression in Alzheimer's disease are associated with functional deficit and psychotropic prescription. Int J Geriatr Psychiatry. 23(4):409-14. [0210] 7. Bilder R M, et al. The catechol-O-methyltransferase polymorphism: relations to the tonic-phasic dopamine hypothesis and neuropsychiatric phenotypes. Neuropsychopharmacology 2004; 29(11):1943-61 [0211] 8. Blanchard J J, et al. Toward the next generation of negative symptom assessments: the collaboration to advance negative symptom assessment in schizophrenia. Schizophr Bull 2011; 37(2):291-9 [0212] 9. Brodaty H, Connors M H, Xu J, Woodward M, Ames D. (2015) The course of neuropsychiatric symptoms in dementia: a 3-year longitudinal study. J Am Med Dir Assoc. 16(5):380-7. [0213] 10. Cattelani R, Roberti R, Lombardi F. (2008) Adverse effects of apathy and neurobehavioral deficits on the community integration of traumatic brain injury subjects. Eur J Phys Rehabil Med. September; 44(3):245-51. [0214] 11. Chen J, et al. Functional analysis of genetic variation in catechol-O-methyltransferase (COMT): effects on mRNA, protein, and enzyme activity in postmortem human brain. Am J Hum Genet 2004; 75(5):807-21 [0215] 12. Clelland C L, et al. Evidence for association of hyperprolinemia with schizophrenia and a measure of clinical outcome. Schizophr Res 2011; 131(1-3):139-45 [0216] 13. Clelland C L, et al. Evidence that COMT genotype and proline interact on negative-symptom outcomes in schizophrenia and bipolar disorder. Translational Psychiatry 2016. In press [0217] 14. Cohen S M, Nadler J V. Proline-induced inhibition of glutamate release in hippocampal area CA1. Brain Res 1997; 769:333-9 [0218] 15. Cohen S M, Nadler J V. Proline-induced potentiation of glutamate transmission. Brain Res 1997; 761:271-82 [0219] 16. Crabtree G W, et al. Cytosolic Accumulation of L-Proline Disrupts GABA-Ergic Transmission through GAD Blockade. Cell Rep 2016 Oct. 4; 17(2):570-582 [0220] 17. de Jonghe J F, Goedhart A W, Ooms M E, Kat M G, Kalisvaart K J, van Ewijk W M, Ribbe M W. (2003) Negative symptoms in Alzheimer's disease: a confirmatory factor analysis. Int J Geriatr Psychiatry; 18(8):748-53. [0221] 18. Dingman W, Sporn M B. The penetration of proline and proline derivatives into brain. J Neurochem 1959; 4(2):148-53 [0222] 19. Drake R E, Mueser K T. Co-occurring alcohol use disorder and schizophrenia. Alcohol Research & Health 2002; 26(2): 99-102 [0223] 20. Drew L J, et al. The 22q11.2 microdeletion: fifteen years of insights into the genetic and neural complexity of psychiatric disorders. Int J Dev Neurosci 2011; 29(3):259-81 [0224] 21. Efrom M L. Familial hyperprolinemia. Report of a second case, associated with congenital renal malformations, hereditary hematuria and mild mental retardation, with demonstration of an enzyme defect. N Engl J Med 1965; 272:1243-54 [0225] 22. Fauth E B, Gibbons A. (2014) Which behavioral and psychological symptoms of dementia are the most problematic? Variability by prevalence, intensity, distress ratings, and associations with caregiver depressive symptoms. Int J Geriatr Psychiatry. 29(3):263-71. [0226] 23. Fernandez-Garcimartin H, et al. Is it possible to combine different psychotic symptom scales in bipolar disorder? Psychiatry Res 2014; 220(3):1090-3 [0227] 24. Fine S E, et al. Autism spectrum disorders and symptoms in children with molecularly confirmed 22q11.2 deletion syndrome. J Autism Dev Disord 2005; 35(4):461-70 [0228] 25. Forlenza O V, Loureiro J C, Pais M V, Stella F. (2017) Recent advances in the management of neuropsychiatric symptoms in dementia. Curr Opin Psychiatry. 2017 March; 30(2): 151-158. [0229] 26. Galynker I, leronimo C, Miner C, Rosenblum J, Vilkas N, Rosenthal R. (1997) Methylphenidate treatment of negative symptoms in patients with dementia. J Neuropsychiatry Clin Neurosci. 9(2):231-9. Review. [0230] 27. Galynker I I, Dutta E, Vilkas N, Ongseng F, Finestone H, Gallagher R, Serseni D, Rosenthal R N. (2000) Hypofrontality and negative symptoms in patients with dementia of Alzheimer type. Neuropsychiatry Neuropsychol Behav Neurol. 13(1):53-9. [0231] 28. Goghari V M, Sponheim S R. Differential association of the COMT Val158Met polymorphism with clinical phenotypes in schizophrenia and bipolar disorder. Schizophr Res 2008; 103(1-3):186-91 [0232] 29. Gogos J A, et al. The gene encoding proline dehydrogenase modulates sensorimotor gating in mice. Nat Genet 1999; 21(4):434-9 [0233] 30. Gothelf D, et al. Obsessive-compulsive disorder in patients with velocardiofacial (22q11 deletion) syndrome. Am J Med Genet B Neuropsychiatr Genet. 2004; 126B(1):99-105 [0234] 31. Grainger D J, Aitken S. A microtitre format assay for proline in human serum or plasma. Clin Chim Acta. 2004; 343(1-2):1 13-8 [0235] 32. Guillot C R, et al. COMT Associations with Disordered Gambling and Drinking Measures. J Gambl Stud. 2015 June; 31(2): 513-524 [0236] 33. Hashimoto K, et al. Decreased serum levels of D-serine in patients with schizophrenia: evidence in support of the N-methyl-D-aspartate receptor hypofunction hypothesis of schizophrenia. Arch Gen Psychiatry 2003 June; 60(6):572-6 [0237] 34. Hwang T J, Masterman D L, Ortiz F, Fairbanks L A, Cummings J L. (2004) Mild cognitive impairment is associated with characteristic neuropsychiatric symptoms. Alzheimer Dis Assoc Disord. 18(1):17-21. [0238] 35. Inoue H, et al. Determination of total hydroxyproline and proline in human serum and urine by HPLC with fluorescence detection. Biol Pharm Bull. 1996; 19(2):163-6 [0239] 36. Ismail Z, Smith E E, Geda Y, Sultzer D, Brodaty H, Smith G, AgUera-Ortiz L, Sweet R, Miller D, Lyketsos C G; ISTAART Neuropsychiatric Symptoms Professional Interest Area. (2016) Neuropsychiatric symptoms as early manifestations of emergent dementia: Provisional diagnostic criteria for mild behavioral impairment. Alzheimers Dement. February; 12(2): 195-202. [0240] 37. Jacquet H, et al. Hyperprolinemia is a risk factor for schizoaffective disorder. Mol Psychiatry 2005; 10(5):479-85 [0241] 38. Jimnez-Jimnez F J, et al. Neurotransmitter amino acids in cerebrospinal fluid of patients with Alzheimer's disease. J Neural Transm (Vienna) 1998; 105(2-3):269-77 [0242] 39. Joober R, et al. Catechol-O-methyltransferase Val-108/158-Met gene variants associated with performance on the Wisconsin Card Sorting Test. Arch Gen Psychiatry 2002; 59(7):662-3 [0243] 40. Kane J, et al. Clozapine for the treatment-resistant schizophrenic. A double-blind comparison with chlorpromazine. Arch Gen Psychiatry 1988; 45(9):789-96 [0244] 41. Karayiorgou M, et al. 22q11.2 microdeletions: linking DNA structural variation to brain dysfunction and schizophrenia. Nat Rev Neurosci 2010; 11:402-16 [0245] 42. Karttunen K, Karppi P, Hiltunen A, Vanhanen M, Vlimki T, Martikainen J, Valtonen H, Sivenius J, Soininen H, Hartikainen S, Suhonen J, Pirttil T. (2011) Neuropsychiatric symptoms and quality of life in patients with very mild and mild Alzheimer's disease. Int J Geriatr Psychiatry. 26(5):473-82. [0246] 43. Lachman H M, et al. Human catechol-O-methyltransferase pharmacogenetics: description of a functional polymorphism and its potential application to neuropsychiatric disorders. Pharmacogenetics 1996; 6(3):243-50 [0247] 44. Landes A M, Sperry S D, Strauss M E. (2005) Prevalence of apathy, dysphoria, and depression in relation to dementia severity in Alzheimer's disease. J Neuropsychiatry Clin Neurosci. 17(3):342-9. [0248] 45. Le Boucher J, Charret C, Coudray-Lucas C, Giboudeau J, Cynober L. Amino acid determination in biological fluids by automated ion-exchange chromatography: performance of Hitachi L-8500A. Clin Chem. 1997; 43(8 Pt 1):1421-8 [0249] 46. Lechowski L, Benoit M, Chassagne P, Vedel I, Tortrat D, Teillet L, Vellas B. (2009) Persistent apathy in Alzheimer's disease as an independent factor of rapid functional decline: the REAL longitudinal cohort study. Int J Geriatr Psychiatry. 24(4):341-6. [0250] 47. Leoutsakos J M, Forrester S N, Lyketsos C G, Smith G S. (2015) Latent Classes of Neuropsychiatric Symptoms in NACC Controls and Conversion to Mild Cognitive Impairment or Dementia. J Alzheimers Dis. 48(2):483-93. doi: 10.3233/JAD-150421. [0251] 48. Lewis D A, et al. Dopamine transporter immunoreactivity in monkey cerebral cortex: regional, laminar, and ultrastructural localization. J Comp Neurol 2001; 432(1):119-36 [0252] 49. Liang S, et al. Determination of proline in human serum by a robust LC-MS/MS method: application to identification of human metabolites as candidate biomarkers for esophageal cancer early detection and risk stratification. Biomed. Chromatogr. 2015, 29: 570-577 [0253] 50. Lindenmayer J P, et al. Dimensions of psychosis in patients with bipolar mania as measured by the positive and negative syndrome scale. Psychopathology 2008; 41(4):264-70 [0254] 51. Luykx J J, et al. D-amino acid aberrations in cerebrospinal fluid and plasma of smokers. Neuropsychopharmacology 2013 September; 38(10):2019-26 [0255] 52. Luykx J J, et al. Genome-wide association study of NMDA receptor coagonists in human cerebrospinal fluid and plasma. Mol Psychiatry. 2015; doi: 10.1038/mp.2014.190 [0256] 53. Lyketsos C G, Carrillo M C, Ryan J M, Khachaturian A S, Trzepacz P, Amatniek J, Cedarbaum J, Brashear R, Miller D S. (2011) Neuropsychiatric symptoms in Alzheimer's disease. Alzheimers Dement. 7(5):532-9. [0257] 54. Molina J A, Jimnez-Jimnez F J, Vargas C, Gomez P, de Bustos F, Orti-Pareja M, Tallon-Barranco A, Benito-Leon J, Arenas J, Enriquez-de-Salamanca R. (1998) Cerebrospinal fluid levels of non-neurotransmitter amino acids in patients with Alzheimer's disease. J Neural Transm (Vienna); 105(2-3):279-86. [0258] 55. Nadler J V. Sodium-dependent proline uptake in the rat hippocampal formation: [0259] association with ipsilateral-commissural projections of CA3 pyramidal cells. J Neurochem 1987; 49:1155-60 [0260] 56. Negrn A E, Reichman W E. (2000) Risperidone in the treatment of patients with Alzheimer's disease with negative symptoms. Int Psychogeriatr. 12(4):527-36. [0261] 57. Nickolson V J. On and off responses of K+-induced synaptosomal proline release: involvement of the sodium pump. J Neurochem 1982; 38:289-92 [0262] 58. Orei M, et al. Metabolome in schizophrenia and other psychotic disorders: a general population-based study. Genome Med 2011; 3(3):19 [0263] 59. Paterlini M, et al. Transcriptional and behavioral interaction between 22q11.2 orthologs modulates schizophrenia-related phenotypes in mice. Nat Neurosci 2005; 8(11):1586-94 [0264] 60. Phang J M, et al. Disorders of proline and hydroxyproline metabolism, in Metabolic and molecular basis of inherited disease. New York, McGraw-Hill Press, 2001, pp 1821-1838 [0265] 61. Pomara N, et al. Glutamate and other CSF amino acids in Alzheimer's disease. Am J Psychiatry 1992 February; 149(2):251-4 [0266] 62. Pomara N, Singh R, Deptula D, Chou J C, Schwartz M B, LeWitt P A. (1992) Glutamate and other CSF amino acids in Alzheimer's disease. Am J Psychiatry. 149(2):251-4. [0267] 63. Raux G, et al. Involvement of hyperprolinemia in cognitive and psychiatric features of the 22q11 deletion syndrome. Hum Mol Genet 2007; 16(1):83-91 [0268] 64. Reichman W E, Coyne A C, Amirneni S, Molino B Jr, Egan S. (1996) Negative symptoms in Alzheimer's disease. Am J Psychiatry. 153(3):424-6. [0269] 65. Renick S E, et al. The mammalian brain high-affinity L-proline transporter is enriched preferentially in synaptic vesicles in a subpopulation of excitatory nerve terminals in rat forebrain. J Neurosci 1999; 19:21-33 [0270] 66. Scholl-Brgi S, et al. The relation of cerebrospinal fluid and plasma glycine levels in propionic acidaemia, a ketotic hyperglycinaemia. J Inherit Metab Dis 2008 June; 31(3):395-8 [0271] 67. Shifman S, et al. A highly significant association between a COMT haplotype and schizophrenia. Am J Hum Genet 2002; 71(6):1296-302 [0272] 68. Shifman S, et al. COMT: a common susceptibility gene in bipolar disorder and schizophrenia. Am J Med Genet B Neuropsychiatr Genet 2004; 128B(1):61-4 [0273] 69. Sonne S C, Brady K T. Bipolar Disorder and Alcoholism. NIAAA publication 2002 November; http://pubs.niaaa.nih.gov/publications/arh26-2/103-108.htm [0274] 70. Starkstein S E, Pahissa J. (2014) Apathy following traumatic brain injury. Psychiatr Clin North Am. 37(1):103-12. Review. [0275] 71. Stfan A, Math J F; SOFMER group. (2016) What are the disruptive symptoms of behavioral disorders after traumatic brain injury? A systematic review leading to recommendations for good practices. Ann Phys Rehabil Med. February; 59(1):5-17. [0276] 72. Tomiya M, et al. Alterations in serum amino acid concentrations in male and female schizophrenic patients. Clin Chim Acta 2007; 380(1-2):186-90 [0277] 73. Trushina E, Dutta T, Persson X M, Mielke M M, Petersen R C. (2013) Identification of altered metabolic pathways in plasma and CSF in mild cognitive impairment and Alzheimer's disease using metabolomics. PLoS One. May 20; 8(5):e63644. doi: 10.1371/journal.pone.0063644. [0278] 74. Tunbridge E M, et al. Catechol-o-methyltransferase, cognition, and psychosis: Val158Met and beyond. Biol Psychiatry 2006; 60:141-151 [0279] 75. Van Dam D, Vermeiren Y, Dekker A D, Naud P J, Deyn P P. (2016) Neuropsychiatric Disturbances in Alzheimer's Disease: What Have We Learned from Neuropathological Studies? Curr Alzheimer Res. 13(10):1145-64. [0280] 76. Vercelletto M, Martinez F, Lanier S, Magne C, Jaulin P, Bourin M. (2002) Negative symptoms, depression and Alzheimer's disease. Int J Geriatr Psychiatry. 17(4):383-7. [0281] 77. Vorstman J A, et al. Proline affects brain function in 22q11DS children with the low activity COMT 158 allele. Neuropsychopharmacology 2009; 34(3):739-46 [0282] 78. Wu, G. Determination of proline by reversed-phase high-performance liquid chromatography with automated pre-column o-phthaldialdehyde derivatization. Journal of Chromatography A. Volume 641, Issue 1, 1993, Pages 168-175. [0283] 79. Yoneda Y, Roberts E. A new synaptosomal biosynthetic pathway of proline from ornithine and its negative feedback inhibition by proline. Brain Res 1982; 239:479-88 [0284] 80. Zarchi O, et al. Schizophrenia-like neurophysiological abnormalities in 22q11.2 deletion syndrome and their association to COMT and PRODH genotypes. J Psychiatr Res 2013; 47(11):1623-9