A GENETICALLY ENGINEERED BACTERIUM AND A PREPARATION METHOD AND USE THEREOF
20240318214 ยท 2024-09-26
Assignee
Inventors
- Yan Wu (Shanghai, CN)
- Jing TANG (Shanghai, CN)
- Jin ZHAO (Shanghai, CN)
- Shu Wang (Shanghai, CN)
- Zhenhua Tian (Shanghai, CN)
- Fei YAO (Shanghai, CN)
- MIAO LI (Shanghai, CN)
- Hong Xu (Shanghai, CN)
- Chenxi HUANG (Shanghai, CN)
- Yurou LIU (Shanghai, CN)
Cpc classification
C12P19/04
CHEMISTRY; METALLURGY
C07K2319/35
CHEMISTRY; METALLURGY
C12P19/18
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C07K2319/24
CHEMISTRY; METALLURGY
C12Y204/01069
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12P19/04
CHEMISTRY; METALLURGY
C12P19/18
CHEMISTRY; METALLURGY
Abstract
A genetically engineered bacterium and a preparation method and use thereof are disclosed. The genetically engineered bacteria contain a gene encoding ?-1,2-fucosyltransferase, and a gene encoding a protein tag is connected to the gene encoding ?-1,2-fucosyltransferase; the protein tag is MBP, SUMO1, SUMO2 or TrxA, the amino acid sequence of the MBP is shown in SEQ ID NO: 2, the amino acid sequence of the SUMO1 is shown in SEQ ID NO: 3, the amino acid sequence of the SUMO2 is shown in SEQ ID NO: 4, the amino acid sequence of the TrxA is shown in SEQ ID NO: 5. Fermentation with the genetically engineered bacteria can greatly increase the yield of 2-fucosyllactose compared to the genetically engineered bacteria that only expresses ?-1,2-fucosyltransferase exogenously, and the yield can be more than doubled in a preferred case.
Claims
1. A genetically engineered bacterium, characterized in containing a gene encoding ?-1,2-fucosyltransferase, and a gene encoding a protein tag is connected to the gene encoding ?-1,2-fucosyltransferase, wherein the amino acid sequence of the ?-1,2-fucosyl transferase is shown in SEQ ID NO: 1; the protein tag is MBP or TrxA, the amino acid sequence of the MBP is shown in SEQ ID NO: 2, and the amino acid sequence of the TrxA is shown in SEQ ID NO: 5.
2. The genetically engineered bacteria as claimed in claim 1, wherein the nucleotide sequence of the gene encoding the ?-1,2-fucosyltransferase is shown in SEQ ID NO: 6; and/or, the nucleotide sequence of the gene encoding the MBP is shown in SEQ ID NO: 7, and the nucleotide sequence of the gene encoding the TrxA is shown in SEQ ID NO: 10.
3. The genetically engineered bacteria as claimed in claim 1, wherein the GDP-fucose degradation pathway of the genetically engineered bacteria is blocked; preferably, all or part of the genes in the GDP-fucose degradation pathway of the genetically engineered bacteria are knocked out; more preferably, wcaJ gene of the genetically engineered bacteria is knocked out; and/or, the GDP-mannose degradation pathway of the genetically engineered bacteria is blocked; preferably, all or part of the genes in the GDP-mannose degradation pathway of the genetically engineered bacteria are knocked out; more preferably, nudD and/or nudK genes of the genetically engineered bacteria are knocked out; and/or, LacZ gene encoding the lactose operon s-galactosidase of the genetically engineered bacteria is knocked out; and/or, the starting bacteria of the genetically engineered bacteria is Escherichia coli, preferably BL21 strain; and/or, the genetically engineered bacteria overexpress one or more of manC, manB, gmd and wcaG genes, and the amino acid sequences encoded by the manC, manB, gmd and wcaG genes are respectively shown in SEQ ID NOs: 95-98; preferably, the nucleotide sequences of the manC, manB, gmd and wcaG genes are respectively shown in SEQ ID NOs: 91-94.
4. A preparation method of 2-fucosyllactose, comprising: taking lactose as a substrate, glycerol or glucose as a carbon source, fermenting the genetically engineered bacteria as claimed in claim 1 to obtain the 2-fucosyllactose; preferably, the fermentation medium is TB medium.
5. The preparation method as claimed in claim 4, wherein the genetically engineered bacteria are fermented until OD600 is 0.6-0.8, IPTG with a final concentration of 0.1-0.5 mM is added to the reaction system.
6. The preparation method as claimed in claim 5, wherein the concentration of the glycerol or glucose is 5-50 g/L, and the concentration of lactose is 5-20 g/L; and/or, when the IPTG is added, the temperature of the fermentation is adjusted to 20-30? C., and stirring is performed at a rotational speed of 150-300 rpm.
7. A recombinant expression vector comprising a gene encoding a protein tag and a gene encoding ?-1,2-fucosyltransferase, the protein tag is MBP or TrxA, the amino acid sequence of the MBP is shown in SEQ ID NO: 2, and the amino acid sequence of the TrxA is shown in SEQ ID NO: 5, and the nucleotide sequence of the gene encoding the ?-1,2-fucosyltransferase is shown in SEQ ID NO: 6; preferably, the amino acid sequence of the ?-1,2-fucosyltransferase is shown in SEQ ID NO: 1.
8. The recombinant expression vector as claimed in claim 7, wherein the nucleotide sequence of the gene encoding the MBP is shown in SEQ ID NO: 7, and the nucleotide sequence of the gene encoding the TrxA is shown in SEQ ID NO: 10; preferably, the starting vector of the recombinant expression vector is pET28a plasmid vector.
9. A method for preparing the genetically engineered bacteria, comprising: transferring the recombinant expression vector as claimed in claim 7 into Escherichia coli to obtain the genetically engineered bacteria; preferably, the method further comprises: knocking out the LacZ, wcaJ, nudD and/or nudK genes in the Escherichia coli; and/or, the method further comprises: overexpressing manC, manB, gmd and/or wcaG gene in the Escherichia coli, the amino acid sequences encoded by manC, manB, gmd and wcaG genes are respectively shown in SEQ ID NOs: 95-98.
10. Use of the genetically engineered bacteria as claimed in claim 1 in the preparation of fucosyllactose, the fucosyllactose is preferably 2-fucosyllactose.
11. A preparation method of 2-fucosyllactose, comprising: taking lactose as a substrate, glycerol or glucose as a carbon source, fermenting the genetically engineered bacteria as claimed in claim 2 to obtain the 2-fucosyllactose; preferably, the fermentation medium is TB medium.
12. A preparation method of 2-fucosyllactose, comprising: taking lactose as a substrate, glycerol or glucose as a carbon source, fermenting the genetically engineered bacteria as claimed in claim 3 to obtain the 2-fucosyllactose; preferably, the fermentation medium is TB medium.
13. A method for preparing the genetically engineered bacteria, comprising: transferring the recombinant expression vector as claimed in claim 8 into Escherichia coli to obtain the genetically engineered bacteria; preferably, the method further comprises: knocking out the LacZ, wcaJ, nudD and/or nudK genes in the Escherichia coli; and/or, the method further comprises: overexpressing manC, manB, gmd and/or wcaG gene in the Escherichia coli, the amino acid sequences encoded by manC, manB, gmd and wcaG genes are respectively shown in SEQ ID NOs: 95-98.
14. Use of the genetically engineered bacteria as claimed in claim 2 in the preparation of fucosyllactose, the fucosyllactose is preferably 2-fucosyllactose.
15. Use of the genetically engineered bacteria as claimed in claim 3 in the preparation of fucosyllactose, the fucosyllactose is preferably 2-fucosyllactose.
16. Use of the recombinant expression vector as claimed in claim 7 in the preparation of fucosyllactose, the fucosyllactose is preferably 2-fucosyllactose.
17. Use of the recombinant expression vector as claimed in claim 8 in the preparation of fucosyllactose, the fucosyllactose is preferably 2-fucosyllactose.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION
[0047] In order to further illustrate the technical means adopted by the present invention and effects thereof, the following detailed description is given in conjunction with the accompanying drawings and the preferred examples of the present invention. The experimental methods in the following examples with no specific conditions are selected according to conventional methods and conditions, or according to the product insert.
[0048] BL21 (DE3) strain was purchased from Novagen Company, Cat. #69450-M; Escherichia coli Trans 10 competent cells were purchased from Beijing TransGen Biotech Co., Ltd.; plasmid extraction kit and gel recovery kit were purchased from Sangon Biotech (Shanghai) Co., Ltd., and SDS-PAGE kit was purchased from Shanghai Epizyme Biomedical Technology Co., Ltd.
[0049] In the examples, a high performance liquid chromatography (HPLC) system (SHIMADZU LC-20AD XR) was used to quantitatively detect the synthesis of 2-FL in the fermentation broth of recombinant Escherichia coli, and the concentrations of 2-FL and the substrate lactose in the fermentation broth were determined by HP-Amide column (Sepax, 4.6?250 mm 5 ?m). The HPLC detector was a differential detector, the detection temperature of the chromatographic column was set to 35? C., the mobile phase was eluted by acetonitrile:water=68:32, and the detection flow rate was 1.4 ml/min.
Example 1 Construction of Chassis Strain FLIS009
1.1 Construction of Small Guide RNA (sgRNA) Plasmid for CRISPR/Cas9 Knockout System [0050] (1) The primers designed according to Table 3 (synthesized by Tsingke) were used for the specific amplification of each fragment using the pTargetF plasmid (see
TABLE-US-00001 TABLE 1 PCR amplification reaction system Volume added to the Agent PCR reaction system cDNA 1 ?l Primer F 1 ?l Primer R 1 ?l PCR Mix 12.5 ?l ddH.sub.2O 9.5 ?l
[0051] The PCR amplification procedure is shown in the following Table 2:
TABLE-US-00002 TABLE 2 PCR reaction procedure Temperature Time Cycles 98? C. Pre-denaturation 3 min 98? C. Denaturation 15 s 55? C. Annealing 15 {close oversize brace} 34 cycles 72? C. Extension 0.1 kb/s 72? C. Extension 5 min 12? C. Insulation
[0052] 5 ?l of the amplified product was subjected to 1% agarose electrophoresis to detect the amplification result. The target fragments were recovered by cutting gel using a gel recovery kit. The target fragments were ligated and recombined using NEB's multi-fragment recombinase, and the ligated recombination products were transformed into E. coli competent cells Trans 10. Sterilized LB liquid medium was added, cultured at 37? C. with shaking at 250 rpm for 1 h; [0053] (2) The spot was picked onto the LB solid plate with spectinomycin added in advance, and inverted overnight at 37? C.; [0054] (3) After the white single colony has grown, the white single colony was picked into a centrifuge tube containing 2 ml of LB liquid medium (containing 50 ?g/ml spectinomycin), and cultured at 37? C. with shaking at 180 rpm for 6 hours; [0055] (4) PCR detection was carried out on the bacterial liquid, 500 ?l of the bacterial liquid verified as positive was sent to Tsingke Company for sequencing, and the remaining bacterial liquid was stored in 20% glycerol. [0056] (5) The strains that were verified through sequencing were subjected to expanded culturing, and plasmid extraction was carried out by a plasmid extraction kit from Sangon. The sgRNA plasmids containing the BL21 genome were obtained and named as pTargetF-?LacZ, pTargetF-?nudK, pTargetF-?nudD, pTargetF-?wcaJ, respectively.
TABLE-US-00003 TABLE3 PrimerinformationforlacZ,nudK,nudD,wcaJ,etcgeneknockoutsgRNA plasmidconstruction Product Primer SEQID Size Plasmid Gene Name Sequence NO: Template (bp) pTarget pTarget GA001- tgccgaccgtctagagtcgacctgca 11 pTargetF 2000bp F- F P1-F4 gaagcttag ?LacZ Backbone GA001- aacTGGCGTTACCCAACT 12 1 P1-R4 TAATCactagtattatacctaggac tg PAM1 GA001- tagtGATTAAGTTGGGTA 13 pTargetF 150bp P1-F1 ACGCCAgttttagagctagaaata gcaag GA001- gttccggaattcaaaaaaagcaccga 14 P1-R1 ctcggtgcc LF GA001- gctttttttgaattccggaacgggaagg 15 BL21 560bp LF cgactggagtg Genome GA001- ggtgcgggcctcgacggccagtgaat 16 P1-LR ccgtaatcatg RF GA001- tcgactctagacggtcggcaaagacc 17 BL21 1800bp P1-RR agaccgttc Genome GA001- ctggccgtcgaggcccgcaccgatc 18 P1-RF gcccttc pTarget Donor- nudK- tgaattcttcccttcctgaatcatctgca 19 BL21 500bp F- LF f2 aaaac Genome ?nudK nudK- gtggagtcggtaaaataacaataatatt 20 R2 tcgttg Donor- nudK- attgttattttaccgactccacagcgcg 21 BL21 500bp RF F3 aaatgaac Genome nudK- ctagaccggaagagccgtttatcaata 22 R3 cc pTarget nudK- gataaacggctcttccggtctagagtc 23 pTargetF 2000bp F F4 gacctgcagaag Backbone nudK- ctaaaacGCGCAGCTTTCA 24 R4 ATCAGCTGactagtattatacct aggactgag PAM nudK- ctagtCAGCTGATTGAAA 25 pTargetF 150bp F1 GCTGCGCgttttagagctagaaa tagcaagttaa nudK- gattcaggaagggaagaattcaaaaa 26 R1 aagcaccgactcggtgccac pTarget Donor- pT- gctttttttgaattccacttcgtaatcctg 27 BL21 500bp F- LF nudD- aatatgcag Genome ?nudD F2 PT- cgctccactgattaccactggctgacg 28 nudD- ccggacgcac R2 Donor- PT- ccagtggtaatcagtggagcgcacta 29 BL21 500bp RF nudD- ccgtggcaaagtcttcc Genome F3 pT- cgactctagagacaacttccacccga 30 nudD- gtaattcgcatgtg R3 PAM1 pT- ctagtgtgagtggtgaaatccgtgcgtt 31 pTargetF 150bp nudD- ttagagctagaaatagcaag F1 pT gattacgaagtggaattcaaaaaaagc 32 nudD- accgactcgg R1 pTarget pT- ggtggaagttgtctctagagtcgacct 33 pTargetF 2000bp F nudD- gcagaagcttag Backbone F4 PT- ctaaaacgcacggatttcaccactcac 34 nudD- actagtattatacctaggactgagc R4 pTarget Donor- wcaJ-F2 cgagtcggtgctttttttgaattcgacag 35 BL21 550bp F- LF cggcatgatcccgtggctg Genome ?wcaJ wcaJ-R2 cgccacgccagcccaacaggtgcat 36 gtagaggaatg Donor- wcaJ-F3 catgcacctgttgggctggcgtggcg 37 BL21 550bp RF aaaccgacacg Genome wcaJ-R3 cagggtaatagatctaagcttgcgcgg 38 aactgctgtccgtgggg PAM1 wcaJ-F1 gtcctaggtataatactagtcatcgccg 39 pTargetF 150bp cagcggtttcaggttttagaget wcaJ-R1 cagccacgggatcatgccgctgtcga 40 attcaaaaaaagcaccgactcg pTarget wcaJ-F4 ccccacggacagcagttccgcgcaa 41 pTargetF 2000bp F gcttagatctattaccctg Backbone wcaJ-R4 gctctaaaacctgaaaccgctgcggc 42 gatgactagtattatacct [0057] (1) Preparation of BL21 competent cells: single colony streak culture was performed on the strain BL21 stored at ?80? C.; a single colony was picked and inoculated to 5 ml of LB medium, and cultured at 37? C. with shaking at 200 rpm until the OD was about 0.5 (about 3 h), then the culture was ice-bathed for 30 min; the bacterial liquid was transferred to a pre-cooled sterile centrifuge tube, centrifuged at 4000 rpm for 10 min at 4? C., the supernatant was discarded, and the bacteria was collected; the cells were resuspended with pre-cooled sterile water, centrifuged at 4000 rpm for 10 min at 4? C., the supernatant was discarded; the cells were resuspended twice with a solution containing 0.1 M CaCl.sub.2), centrifuged at 4000 rpm for 10 min at 4? C., and the supernatant was discarded; finally, the cells were resuspended with an appropriate amount of 0.1 M CaCl.sub.2) solution containing 15% glycerol, dispensed into 1.5 ml centrifuge tubes with 100 ul per tube, quickly frozen in liquid nitrogen, and stored at ?80? C. [0058] (2) 3 ul pCas-sac plasmid was added to 100 ?L E. coli BL21 competent, placed on ice for 30 min, then heat-shocked at 42? C. for 45 s, and immediately placed on ice for 2-5 min; after adding 800 ?L of LB, it was placed on a shaker at 30? C. and incubated for 45 min, followed by plating (Km resistant, LB medium), and was placed upside down in a 30? C. incubator, and cultured overnight; spots were picked to LB medium (Kana resistant), cultured for several hours before bacteria preservation (final concentration of glycerol 30%). [0059] (3) The pCas-sac/BL21 transformants were picked and inoculated into LB sieve tubes (Kana resistant) and cultured at 30? C. until OD=0.2, then arabinose with a final concentration of 2 g/L was added for induction, and at OD=0.4, the competent preparation was carried out, the preparation method is the same as operation (1); [0060] (4) The correctly constructed pTargetF-?LacZ plasmids were transformed into pCas-sac/BL21 competent cells by heat shock method, coated on LB plates (k+, spe+) after recovery, and cultured at 30? C. overnight; [0061] (5) PCR verification was carried out on a single colony on the resistant plate, with verification primers shown in Table 4, and the sequencing verification profile shown in
1.2.2 Knockout of GDP-Fucose Degradation Related Gene wcaJ Based on FLIS001 Strain
[0064] FLIS001 competent preparation and knockout were the same as in 1.2.1. The pTargetF-?wcaJ plasmid was used to knock out the wcaJ gene. The method was the same as that in 1.2.1, the wcaJ gene knockout strain was obtained and named as FLIS007.
1.2.3 Knockout of GDP-Mannose Degradation Related Genes nudD and nudK Based on FLIS007 Strain [0065] (1) The nudD gene in the FLIS007 strain was knocked out using the pTargetF-?nudD plasmid, and the method is the same as that in (1), the knockout strain was named as FLIS008. [0066] (2) The nudK gene was knocked out on the basis of the FLIS008 strain using the pTargetF-?nudK plasmid, and the method is the same as that in 1.2.1, the knockout strain was named as as FLIS009. [0067] (3) Loss of sgRNA plasmid was performed in FLIS009 strain, the method is the same as that in 1.2.1. [0068] (4) Loss of pCas-SAC plasmid was performed in FLIS009 strain: the FLIS009 strain with sgRNA loss was inoculated on an antibiotic free LB plate containing 10 g/L sucrose, cultured at 37? C., and PCR validation was performed with pCas-SAC verification primers in Table 4 to ensure that the pCas-SAC plasmid free chassis strain FLIS009 was obtained.
TABLE-US-00004 TABLE4 GeneknockoutvalidationprimersforLacZ,wcaJ,nudD,nudKandthelike SEQ Product Knockout Primer ID Size Strain Gene Name PrimerSequence NO: (bp) FLIS001 LacZ LacZ-YZ1- cgcgctgttagcgggcccattaagttctg 43 2000bpafter F knockout LacZ-YZ2- ggtcttcatccacgcgcgcgtacatcgg 44 R FLIS007 wcaJ wcaJ-YZ- gtcggcctgttggcagaagcattc 45 1.5kbafter for knockout wcaJ-YZ- gtagccaaacagcagcgttcttaccgcac 46 R FLIS008 nudD nudD-YZ-F ccgtcgccagctgtgccactttg 47 1.2kbafter nudD-YZ-R caaactgtgcgaatcttacaatcgcc 48 knockout FLIS009 nudK nudK-YZ-F gctgagcatcaataaacaacaacgctg 49 1.4kbafter nudK-YZ-R atgaagatgcgccgggcgtttatg 50 knockout sgRNA CX-targetF- cagcgagtcagtgagcgag 51 2000bp Plasmid F CX-targetF- gacattgcactccaccgct 52 R pCas- Kan-F gaaggagaaaactcaccgag 53 3300bp SAC Pcr4-R1 cagctgcataaaattgcgattggcaaaacc 54 atc
Example 2 Production of 2-FL Using FLIS009 Strain
2.1 Construction of Expression Plasmid for 2-FL Synthesis
2.1.1 Construction of Plasmid pRSF-CBDG
[0069] manC gene is a mannose-1-phosphate guanylyltransferase gene; manB gene is a phosphomannose mutase gene; gmd gene is a GDP-D-mannose-4,6-dehydratase gene; wcaG is a GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase gene.
[0070] The primers designed according to Table 5 (synthesized by Tsingke) were used for the specific amplification of each fragment using the pRSFDuet plasmid or the BL21 genome as the template. See 1.1 for the amplification method. [0071] (2) The recovery, ligation and recombination, competent transformation and ampicillin resistance screening of amplified products were carried out according to the method in 1.1; [0072] (3) Positive colonies were selected for PCR verification, 500 ?l of the bacterial liquid verified as positive was sent to Tsingke Company for sequencing, and the remaining bacterial solution was stored in 20% glycerol. [0073] (4) The strains that were verified through sequencing were subjected to expanded culturing, and plasmid extraction was carried out by a plasmid extraction kit from Sangon to obtain a plasmid containing manC, manB, gmd, and wcaG genes, which is named as pRSF-CBDG plasmid (see
TABLE-US-00005 TABLE5 PrimerinformationforplasmidRSF-CBDGconstruction SEQ Product Primer ID Size Plasmid Gene Name PrimerSequence NO: Template (bp) pRSF- manC CBGW- taaggagatataccatggcgcagtcgaa 55 BL21 1437bp CBDG manC-F actcta Genome CBGW- gttaattttttcatggtatatctccttttacacc 56 manC-R cgtccgtagcg manB CBGW- cggacgggtgtaaaaggagatataccat 57 BL21 1371bp manB-F gaaaaaattaacctgctttaaag Genome CBGW- gagctcgaattcttactcgttcagcaacgt 58 manB-R cag gmd CBGW- gaaggagatatacaatgtcaaaagtcgct 59 BL21 1122bp gmd-F ctcat Genome CBGW- gttgtttactcatggtatatctccttttatgac 60 gmd-R tccagcgcgatcg wcaG CBGW- ctggagtcataaaaggagatataccatga 61 BL21 966bp wcaG-F gtaaacaacgagtttttattg Genome CBGW- tggcagcagcctaggttacccccgaaag 62 wcaG-R cggtct pRSF CBGW- gctttcgggggtaacctaggctgctgcca 63 pRSFDuet 3395bp Duet F1 ccg Backbone CBGW- cgactgcgccatggtatatctccttattaaa 64 1 R1 gttaaac pRSF CBGW- ttgctgaacgagtaagaattcgagctcgg 65 pRSFDuet 187bp Duet F2 cgcg Backbone CBGW- gcgacttttgacattgtatatctccttcttata 66 2 R2 cttaac
[0074] The amino acid sequences of manC, manB, gmd and wcaG are respectively shown in SEQ ID NOs: 95-98, and the nucleotide sequences are respectively shown in SEQ ID NOs: 91-94.
2.1.2 Construction of ?-1,2-Fucosyltransferase futC Expression Plasmid
[0075] ?-1,2-fucosyltransferase futC (GT007), MBP, SUMO1, SUMO2, TrxA sequences (amino acid sequences are respectively shown in SEQ ID NOs: 1-5, nucleotide sequences are respectively shown in SEQ ID NOs: 6-10) were synthesized by Sangon Company. The primers designed according to Table 6 (synthesized by Tsingke) were used for the specific amplification of each fragment using the pET28a plasmid or the BL21 genome as the template. See 1.1 for the amplification method. [0076] (1) The recovery of amplified products, ligation and recombination, competent transformation and Kana resistance screening were carried out according to the method in 1.1; [0077] (2) Positive colonies were selected for PCR verification, 500 ?l of the bacterial liquid that was verified to be positive was sent to Tsingke Company for sequencing, and the remaining bacterial solution was stored in 20% glycerol. [0078] (3) The strains that were verified through sequencing were subjected to expanded culturing, and plasmid extraction was carried out by a plasmid extraction kit from Sangon to obtain futC expression plasmids with different tags, which are named as pET-MBP-futC, pET-SUMO1-futC, pET-SUMO2-futC, pET-TrxA-futC plasmid, pET-futC, respectively.
TABLE-US-00006 TABLE6 PrimerinformationforfutCexpressionplasmidconstruction SEQ Product Primer ID Size Plasmid Gene Name PrimerSequence NO: Template (bp) pET- MBP FL121- AAGGAGATATACCATGaaaatc 67 MBP 1203bp MBP- MBP-F gaagaaggtaa futC FL121- GATGCTCATatGGAATTcggatc 68 MBP-R cctgaaaat futC FL121- cagggatccgAATTCCatATGAGC 69 GT007 897bp futC-F ATCATCCGTCT FL121- GTGCGGCCGCAAGCttaGCAG 70 futC-R CTGCTGTGTTTATCAAC pET FL121-F ACAGCAGCTGCtaaGCTTGCG 71 pET28a 5246bp Back- GCCGCACTCGAGCAC bone FL121-R tcttcgattttCATGGTATATCTCCT 72 TCTTAAAGTTA pET- SUMO1 FL122- AAGGAGATATACCatgtcggactc 73 SUMO1 294bp SUMO1- SUMO1-F agaagtcaa futC FL122- GATGCTCATatGaccaccaatctgttc 74 SUMO1-R tctgt futC FL122- acagattggtggtCatATGAGCATCA 75 GT007 897bp futC-F TCCGTCT FL122- GTGCGGCCGCAAGCttaGCAG 76 futC-R CTGCTGTGTTTATCAAC pET FL122-F ACAGCAGCTGCtaaGCTTGCG 71 pET28a 5246bp Back- GCCGCACTCGAGCAC bone FL122-R ctgagtccgacatGGTATATCTCCT 77 TCTTAAAGT pET- SUMO2 FL123- gGAAGGAGATATACCATGG 78 SUMO2 306bp SUMO2- SUMO2-F GCCATCATCATCACCA futC FL123- TGATGCTCATatGACCACCGG 79 SUMO2-R TCTGTTGCTGA futC FL123- ACAGACCGGTGGTCatATGA 80 GT007 897bp futC-F GCATCATCCGTCTG FL123- GTGCGGCCGCAAGCttaGCAG 81 futC-R CTGCTGTGTTTATCAAC pET FL123-F ACAGCAGCTGCtaaGCTTGCG 71 pET28a 5246bp Back- GCCGCACTCGAGCAC bone FL123-R ATGATGATGGCCCATGGTAT 82 ATCTCCTTCTTAAAGTTA pET- TrxA FL124- AGGAGATATACCatgagcgataaa 83 TrxA 567bp TrxA- TrxA-F attattca futC FL124- TGATGCTCATatGgaatteggatccc 84 TrxA-R tgaaaat futC FL124- agggatccgaattcCatATGAGCATC 85 GT007 897bp futC-F ATCCGTCT FL124- GTGCGGCCGCAAGCttaGCAG 86 futC-R CTGCTGTGTTTATCAAC pET FL124-F ACAGCAGCTGCtaaGCTTGCG 71 pET28a 5246bp Back- GCCGCACTCGAGCAC bone FL124-R ttttatcgctcatGGTATATCTCCTT 87 CTTAAAG pET- futC FAB- CGCGCGGCAGCCATCatATG 88 GT007 897bp futC futC-F AGCATCATCCGTCTGCA 28A- GTGCGGCCGCAAGCttaGCAG 89 GT008-R CTGCTGTGTTTATCAAC pET 28A- ACAGCAGCTGCtaaGCTTGCG 71 pET28a 5246bp Back- GT008- GCCGCACTCGAGCAC bone F2 FAB-R1 GATGATGCTCATatGATGGCT 90 GCCGCGCGGCAC
2.2 Production of 2-FL During Fermentation
2.2.1 Construction of 2-FL Producing E. coli Strains
[0079] Competent cells were prepared based on the gene knockout strain FLIS009, the specific method was the same as that in 1.2.1, and then the plasmids pRSF-CBDG+pET-MBP-futC, pRSF-CBDG+pET-SUMO1-futC, pRSF-CBDG+pET-SUMO2-futC, pRSF-CBDG+pET-TrxA-futC, pRSF-CBDG+pET-futC were respectively transferred into FLIS009 competent cells, and screened for correct clones on LB plate (100 ?g/ml ampicillin, 50 ?g/ml kana antibiotics). The strain E. coli FLIS009-FL carrying the 2-FL synthesis pathway was verified by PCR and named as FLIS201, FLIS202, FLIS203, FLIS204, FLIS205, respectively.
2.2.2 Producing 2-FL with FLIS009-FL Strain [0080] (1) TB medium: trypton 12 g (Trypton Oxoid LP0042 73049-73-7 BR), yeast extract 24 g, glycerol 4 ml, 2.31 g KH.sub.2PO.sub.4 and 12.54 g K.sub.2HPO.sub.4 were diluted to 1000 ml with deionized water, sterilized at 121? C. for 30 min, and stored at room temperature. [0081] (2) LB medium: 10 g of tryptone was weighed respectively, distilled water was added at a ratio of 1:4 (mass to volume ratio, g/mL) to dissolve and mix, the pH was adjusted to 7.2 with 1 mol/L NaOH, and the liquid was diluted to 1 L, sterilized at 121? C. for 30 min, and stored at 4? C. without adding agar to the LB liquid. [0082] (3) 1000 g/L glycerol: 1000 g glycerol was weighed, diluted to 1 L with deionized water, sterilized at 121? C. for 30 min, and stored at room temperature. [0083] (4) 250 g/L lactose: 250 g lactose was dissolved in deionized water (dissolve by heating), diluted to 1 L, sterilized at 121? C. for 30 minutes, and stored at room temperature. [0084] (5) Preparation of seed solution: the strains were inoculated into 5 mL of LB medium (containing 100 ?g/ml ampicillin and 50 ?g/ml kana antibiotics), and cultured at 37? C., 250 rpm for 4 hours. [0085] (6) Fermentation culture: the seed liquid was inoculated into fresh fermentation medium (TB medium) with a ratio of seed liquid:medium=1:100 (v/v), cultivated at 37? C., 220 rpm until OD600 is 0.8, then IPTG (to a final concentration of 0.2 mM), 2 ml of 1000 g/L glycerol (to a final concentration of 20 g/L) and 4 ml of 250 g/L lactose (to a final concentration of 10 g/L) were added, the resultant was cultured at 25? C., 220 rpm to induce protein expression and fermentation culture. [0086] (7) Sample processing method: 2-3 ml of fermentation broth was taken to lyse the cells by repeatedly freezing and thawing, the resultant was put in boiling water for 20 minutes after lysis, and then centrifuged (4? C., 12000 rpm for 5 minutes), the pellet was removed and the supernatant was kept and passed through a 0.22 ?m filter membrane, and the content of 2-FL in each treatment was detected by differential detection method.
2.3 Shake Flask Fermentation Validation
[0087] The strain obtained in 2.2.2 (1) was inoculated into TB medium according to 2.2.2(5), and cultured under the conditions of 25? C. and 220 rpm to induce protein expression and fermentation. [0088] (2) The fermentation broth was taken for sample processing and 2-FL content detection according to the method in 2.2.2 (6). The results are shown in Table 7.
TABLE-US-00007 TABLE 7 2-FL yield 2-FL Strain Plasmid Yield (g/L) FLIS201 RSF-CBDG + pET-MBP-futC 4.79 FLIS202 RSF-CBDG + pET-SUMO1-futC 4.92 FLIS203 RSF-CBDG + pET-SUMO2-futC 4.28 FLIS204 RSF-CBDG + pET-TrxA-futC 4.09 FLIS205 RSF-CBDG + pET-futC 2.25 [0089] (3) From Table 7, it can be seen that the 2-FL yield of tagged FLIS202 is significantly higher than that of untagged FLIS205, as shown in