Nanovesicles derived from bacteria of <i>Lactococcus </i>genus and use thereof
12097227 ยท 2024-09-24
Assignee
Inventors
Cpc classification
A61K8/99
HUMAN NECESSITIES
G01N2800/324
PHYSICS
A61P25/18
HUMAN NECESSITIES
A61K9/0073
HUMAN NECESSITIES
G01N2800/2871
PHYSICS
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61P9/10
HUMAN NECESSITIES
G01N2800/2835
PHYSICS
A61K35/744
HUMAN NECESSITIES
G01N2800/347
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
A23L33/135
HUMAN NECESSITIES
International classification
A61K35/744
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
Provided are vesicles derived from bacteria of the genus Lactococcus and a use thereof, and the inventors experimentally confirmed that the vesicles were significantly reduced in samples obtained from patients with diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease and depression, compared with a normal individual, and the vesicles inhibited the secretion of inflammation mediators caused by pathogenic vesicles. Therefore, it is expected that the vesicles derived from bacteria of the genus Lactococcus can be effectively used for a method of diagnosing diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease or depression, and a composition for preventing or treating the disease or inflammatory disease.
Claims
1. A method of alleviating or treating inflammatory disease, the method comprising administering to a subject in need thereof a composition comprising an effective amount of vesicles derived from Lactococcus lactis, wherein the inflammatory disease is mediated by interleukin-6 (IL-6) or tumor necrosis factor-? (TNF-?).
2. The method of claim 1, wherein the vesicles have an average diameter of 10 to 200 nm.
3. The method of claim 1, wherein the composition is a pharmaceutical composition, a food composition, or a cosmetic composition.
4. The method of claim 1, wherein the composition is an inhalant composition.
Description
DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
MODES OF THE INVENTION
(13) The present invention relates to vesicles derived from bacteria of the genus Lactococcus and a use thereof.
(14) The inventors confirmed, through metagenomic analysis, that the content of vesicles derived from bacteria of the genus Lactococcus significantly decreases in samples obtained from patients with diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease and depression, compared with a normal individual. Based on this, the present invention was completed.
(15) In the present invention, it was confirmed that the vesicles derived from bacteria of the genus Lactococcus are significantly reduced in patients with diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease and depression, compared with a normal individual, and also confirmed that, by identifying characteristics of vesicles isolated from a Lactococcus lactis (L. lactis) strain, which is one species of bacteria in the genus Lactococcus, the vesicles can be used for a composition for preventing or treating the diseases or inflammatory disease.
(16) Thus, the present invention provides a method of providing information for diagnosing diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease, or depression, the method comprising the following steps: (a) extracting DNAs from extracellular vesicles isolated from samples of a normal individual and a subject; (b) performing polymerase chain reaction (PCR) on the extracted DNA using a pair of primers prepared based on a gene sequence present in 16S rDNA to obtain each PCR product; and (c) determining a case in which a content of vesicles derived from bacteria of the genus Lactococcus is lower than that of the normal individual sample, as diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease, or depression, through quantitative analysis of the PCR product.
(17) The term diagnosis as used herein refers to determination of a condition of a disease of a patient over all aspects, in a broad sense. The contents of the determination are the disease entity, the etiology, the pathogenesis, the severity, the detailed aspects of a disease, the presence and absence of complications, the prognosis, and the like. The diagnosis in the present invention means determining whether diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease, and depression occur, the level of the disease, and the like.
(18) The term metabolic disease used herein refers to a disease accompanied by complications in various organs due to metabolic disorders in the body of a mammal, for example, metabolic disorders such as hyperlipidemia and diabetes, and their complications. In the present invention, the metabolic disease preferably includes diabetes, but the present invention is not limited thereto.
(19) The term cardiovascular disease used herein refers to a disease occurring in the cardiovascular system in a mammal, for example, cardiac diseases such as myocardial infarction, cardiomyopathy, angina pectoris and arrhythmia; vasculitis; and cerebrovascular diseases such as dementia and stroke. In the present invention, the cardiovascular disease preferably includes myocardial infarction, atrial fibrillation or stroke, but the present invention is not limited thereto.
(20) The term neuropsychiatric disease used herein refers to a disease occurring in the nervous system and the brain of a mammal, for example, brain diseases such as Parkinson's disease and dementia; and metal disorders such as depression, obsessive-compulsive disorder and schizophrenia. In the present invention, the neuropsychiatric disease preferably includes Parkinson's disease or depression, but the present invention is not limited thereto.
(21) The term inflammatory disease used herein refers to a disease induced by an inflammatory response in a mammalian body, and in the present invention, the inflammatory disease may be one or more selected from the group consisting of atopic dermatitis, acne, psoriasis, sinusitis, rhinitis, conjunctivitis, asthma, dermatitis, an inflammatory collagen vascular disease, glomerulonephritis, encephalitis, inflammatory enteritis, chronic obstructive pulmonary disease, sepsis, septic shock, pulmonary fibrosis, undifferentiated spondylosis, undifferentiated arthrosis, arthritis, inflammatory osteolysis, chronic inflammatory diseases caused by viral or bacterial infections, colitis, ulcerative colitis, inflammatory bowel disease, rheumatoid arthritis, reactive arthritis, osteoarthritis, scleroderma, osteoporosis, atherosclerosis, myocarditis, endocarditis, pericarditis, cystic fibrosis, Hashimoto's thyroiditis, Graves' disease, leprosy, syphilis, Lyme disease, borreliosis, neuroborreliosis, tuberculosis, sarcoidosis, lupus, lupus pernio, lupus tuberculosis, lupus nephritis, systemic lupus erythematosus, macular degeneration, uveitis, irritable bowel syndrome, Crohn's disease, Sjogren's syndrome, fibromyalgia, chronic fatigue syndrome, chronic fatigue immunodeficiency syndrome, myalgic encephalomyelitis, amyotrophic lateral sclerosis, Parkinson's disease, and multiple sclerosis, but is not limited thereto.
(22) The term nanovesicle or vesicle refers to a structure formed with a nano-scale membrane, released from various bacteria. Vesicles derived from gram-positive bacteria such as Lactococcus include peptidoglycan and lipoteichoic acid, which are components of the bacterial cell wall, and various low-molecular compounds in the vesicle, as well as a protein and a nucleic acid. In the present invention, nanovesicles or vesicles are naturally secreted or artificially produced from bacteria of the genus Lacotobacillus, are in the form of a sphere, and have an average diameter of 10 to 200 nm.
(23) The vesicles may be isolated from a culturing solution comprising bacteria of the genus Lacotobacillus by using one or more methods selected from the group consisting of centrifugation, ultra-high speed centrifugation, high pressure treatment, extrusion, sonication, cell lysis, homogenization, freezing-thawing, electroporation, mechanical decomposition, chemical treatment, filtration by a filter, gel filtration chromatography, free-flow electrophoresis, and capillary electrophoresis. Further, a process such as washing for removing impurities and concentration of obtained vesicles may be further included.
(24) The term metagenome as used herein also refers to a microbiome, and refers to a total of genomes including all viruses, bacteria, fungi, and the like in an isolated region such as soil and an animal's intestines, and is typically used as a concept of genomes explaining identification of a large number of microorganisms at one time by using a sequence analyzer in order to analyze uncultivated microorganisms. In particular, the metagenome does not refer to a genome of one species, but refers to a kind of mixed genome as a genome of all species of one environmental unit. The metagenome is, when one species is defined in the development process of omics biology, a term derived from the viewpoint of making a complete species is made by various species interacting with each other as well as one kind of functionally existing species. Technically, the metagenome is an object of a technique to identify all species in one environment and investigate interactions and metabolism by analyzing all DNAs and RNAs regardless of species using a rapid sequence analysis method.
(25) In the present invention, the sample in Step (a) may be blood, urine, or saliva, but is not limited thereto.
(26) In the present invention, the primer pair in Step (b) may be primers of SEQ ID Nos. 1 and 2.
(27) As another aspect of the present invention, the present invention provides a composition for preventing or treating one or more diseases selected from the group consisting of diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease, depression, and inflammatory disease, comprising vesicles derived from bacteria of the genus Lacotobacillus as an active ingredient. In the present invention, the composition may include a pharmaceutical composition, an oral composition, oral spray, or an inhalant composition.
(28) As another aspect of the present invention, the present invention provides a food composition for preventing or alleviating one or more diseases selected from the group consisting of diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease, depression, and inflammatory disease, comprising vesicles derived from bacteria of the genus Lacotobacillus as an active ingredient.
(29) In the present invention, the inflammatory disease may be a disease mediated by IL-6 or TNF-?, but is not limited thereto.
(30) As another aspect of the present invention, the present invention provides a cosmetic composition for preventing or alleviating inflammatory disease, comprising vesicles derived from bacteria of the genus Lacotobacillus as an active ingredient.
(31) In the present invention, the cosmetic composition may be used to prevent or alleviate an inflammatory disease selected from the group consisting of atopic dermatitis, acne and psoriasis, but the present invention is not limited thereto.
(32) The term prevention as used herein refers to all actions that suppress diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease, depression, or inflammatory disease or delay the onset thereof via administration of the composition according to the present invention.
(33) The term treatment as used herein refers to all actions that alleviate or beneficially change symptoms of diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease, depression, and inflammatory disease via administration of composition according to the present invention.
(34) The term alleviation used as used herein refers to all actions that at least reduce a parameter associated with a condition to be treated, for example, the degree of symptoms.
(35) In one embodiment of the present invention, as a result of orally administering bacteria and bacteria-derived vesicles to mice and observing in vivo absorption, distribution, and excretion patterns of the bacteria and the vesicles, it was confirmed that, while the bacteria were not absorbed via the intestinal mucous membrane, the bacteria-derived vesicles were absorbed within 5 minutes after administration and systemically distributed, and excreted via the kidneys, liver, and the like (see Example 1).
(36) In another embodiment of the present invention, metagenomic analysis was performed on saliva of a patient with diabetes and a normal individual. As a result, compared with the saliva of the normal individual, it was confirmed that bacteria of the genus Lactococcus and vesicles derived from the bacteria of the genus Lactococcus are significantly reduced in the saliva of the patient with diabetes (see Example 3).
(37) In another embodiment of the present invention, metagenomic analysis was performed on blood of a patient with diabetes and a normal individual. As a result, compared with the blood of the normal individual, it was confirmed that vesicles derived from the bacteria of the genus Lactococcus are significantly reduced in the blood of the patient with diabetes (see Example 4).
(38) In another embodiment of the present invention, metagenomic analysis was performed on blood of a patient with myocardial infarction and a normal individual. As a result, compared with the blood of the normal individual, it was confirmed that vesicles derived from the bacteria of the genus Lactococcus are significantly reduced in the blood of the patient with myocardial infarction (see Example 5).
(39) In another embodiment of the present invention, metagenomic analysis was performed on blood of a patient with atrial fibrillation and a normal individual. As a result, compared with the blood of the normal individual, it was confirmed that vesicles derived from the bacteria of the genus Lactococcus are significantly reduced in the blood of the patient with atrial fibrillation (see Example 6).
(40) In another embodiment of the present invention, metagenomic analysis was performed on blood of a patient with stroke and a normal individual. As a result, compared with the blood of the normal individual, it was confirmed that vesicles derived from the bacteria of the genus Lactococcus are significantly reduced in the blood of the patient with stroke (see Example 7).
(41) In another embodiment of the present invention, metagenomic analysis was performed on blood of a patient with renal failure and a normal individual. As a result, compared with the blood of the normal individual, it was confirmed that vesicles derived from the bacteria of the genus Lactococcus are significantly reduced in the blood of the patient with renal failure (see Example 8).
(42) In another embodiment of the present invention, metagenomic analysis was performed on urine of a patient with Parkinson's disease and a normal individual. As a result, compared with the urine of the normal individual, it was confirmed that vesicles derived from the bacteria of the genus Lactococcus are significantly reduced in the urine of the patient with Parkinson's disease (see Example 9).
(43) In another embodiment of the present invention, metagenomic analysis was performed on urine of a patient with depression and a normal individual. As a result, compared with the urine of the normal individual, it was confirmed that vesicles derived from the bacteria of the genus Lactococcus are significantly reduced in the urine of the patient with depression (see Example 10).
(44) In another embodiment of the present invention, a Lactococcus lactis strain belonging to the genus Lactococcus was cultured, and an inflammation-inducing effect of vesicles released from the bacterial cells was evaluated. Macrophages were treated with various concentrations of the Lactococcus lactis-derived vesicles, and then with E. coli-derived vesicles, which are representative pathogenic vesicles, to make a comparison of the degree of secreting inflammation mediators. As a result, it was seen that, compared with the secretion of IL-6 and TNF-? by E. coli-derived vesicles, the secretion capability of the Lactococcus lactis-derived vesicles was significantly reduced (see Example 12).
(45) In another embodiment of the present invention, to evaluate an anti-inflammatory effect of vesicles derived from the Lactococcus lactis strain, macrophages were treated with various concentrations of the Lactococcus lactis-derived vesicles, and then the secretion of inflammation mediators were evaluated, and as a result of evaluating the secretion of inflammation mediators by treating E. coli-derived vesicles, which are pathogenic vesicles, it was confirmed that the IL-6 and TNF-? secretion by E. coli-derived vesicles are effectively inhibited by the Lactococcus lactis-derived vesicles (see Example 13).
(46) The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is typically used in formulation, and includes saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, a dextrose solution, a maltodextrin solution, glycerol, ethanol, liposomes, and the like, but is not limited thereto, and may further include other typical additives such as an antioxidant and a buffer, if necessary. Further, the composition may be formulated into an injectable formulation, such as an aqueous solution, a suspension, and an emulsion, a pill, a capsule, a granule, or a tablet by additionally adding a diluent, a dispersant, a surfactant, a binder, a lubricant, and the like. With regard to suitable pharmaceutically acceptable carriers and formulations, the composition may be preferably formulated according to each ingredient by using the method disclosed in the Remington's literature. The pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated into an injection, an inhalant, an external preparation for skin, an oral ingestion, or the like.
(47) The pharmaceutical composition of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intradermally, intranasally or intratracheally) according to a desired method, and a dose may vary according to the condition and body weight of a patient, the severity of a disease, a drug formulation, an administration route, and duration, but may be suitably selected by those of ordinary skill in the art.
(48) The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, the pharmaceutically effective amount refers to an amount sufficient to treat diseases at a reasonable benefit/risk ratio applicable to medical treatment, and an effective dosage level may be determined according to factors including types of diseases of patients, the severity of disease, the activity of drugs, sensitivity to drugs, administration time, administration route, excretion rate, treatment period, and simultaneously used drugs, and factors well known in other medical fields. The composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with therapeutic agents in the related art, and may be administered in a single dose or multiple doses. It is important to administer the composition in a minimum amount that can obtain the maximum effect without any side effects, in consideration of all the aforementioned factors, and this may be easily determined by those of ordinary skill in the art.
(49) Specifically, an effective amount of the pharmaceutical composition according to the present invention may vary according to a patient's age, gender and body weight, and generally, the pharmaceutical composition may be administered at 0.001 to 150 mg, and preferably, 0.01 to 100 mg per kg of body weight daily or every two days, or 1 to 3 times daily. However, as the dose may be increased or decreased by an administration route, the severity of obesity, gender, a body weight or an age, the above-mentioned dose does not limit the scope of the present invention in any way.
(50) The food composition of the present invention includes a health functional food composition. The food composition according to the present invention may be used by adding an active ingredient as is to food or may be used together with other foods or food ingredients, but may be appropriately used according to a typical method. The mixed amount of the active ingredient may be suitably determined depending on the purpose of use thereof (for prevention or alleviation). In general, when a food or beverage is prepared, the composition of the present invention is added in an amount of 15 wt % or less, preferably 10 wt % or less based on the raw materials. However, for long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above-mentioned range.
(51) Other ingredients are not particularly limited, except that the food composition of the present invention contains the active ingredient as an essential ingredient at the indicated ratio, and the food composition of the present invention may contain various flavorants, natural carbohydrates, and the like, like a typical beverage, as an additional ingredient. Examples of the above-described natural carbohydrate include common sugars such as monosaccharides, for example, glucose, fructose and the like; disaccharides, for example, maltose, sucrose and the like; and polysaccharides, for example, dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavorant other than those described above, a natural flavorant (thaumatin, stevia extract, for example, rebaudioside A, glycyrrhizin and the like), and a synthetic flavorant (saccharin, aspartame and the like) may be advantageously used. The proportion of the natural carbohydrate may be appropriately determined by the choice of those of ordinary skill in the art.
(52) The food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, colorants and fillers (cheese, chocolate, and the like), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in a carbonated beverage, or the like, in addition to the additives. These ingredients may be used either alone or in combinations thereof. The ratio of these additives may also be appropriately selected by those of ordinary skill in the art.
(53) In the inhalant composition of the present invention, the active ingredient may be used as it is or used with other ingredients, and may be suitably used according to a conventional method. A mixing content of the active ingredient may be appropriately determined according to its purpose of use (for prevention or treatment).
(54) The cosmetic composition of the present invention may include ingredients conventionally used in a cosmetic composition as well as vesicles derived from bacteria of the genus Lactococcus, and may include, for example, a conventional additive such as an antioxidant, a stabilizer, a solubilizer, a vitamin, a pigment and a flavor, and a carrier.
(55) In addition, the composition of the present invention may also be used by mixing a conventionally used organic sunscreen as long as it does not impair a skin protection effect by reaction with the vesicles derived from bacteria of the genus Lactococcus, in addition to vesicles derived from bacteria of the genus Lactococcus. The organic sunscreen may be one or more selected from the group consisting of glyceryl PABA, drometrizole trisiloxane, drometrizole, digalloyl trioleate, disodium phenyl dibenzimidazole tetrasulfonate, diethylhexyl butamidotriazone, diethylamino hydroxybenzoyl hexylbenzoate, DEA-methoxycinnamate, a Lawson/dihydroxyacetone mixture, methylenebis-benzotriazolyltetramethylbutylphenol, 4-methylbenzylidene camphor, methyl anthranilate, benzophenone-3(oxybenzone), benzophenone-4, benzophenone-8(dioxyphebenzone), butyl methoxydibenzoylmethane, bisethylhexyloxyphenol methoxyphenyl triazine, cinoxate, ethyl dihydroxypropyl PABA, octocrylene, ethylhexyldimethyl PABA, ethylhexyl methoxycinnamate, ethylhexyl salicylate, ethylhexyl triazone, isoamyl-p-methoxycinnamate, polysilicon-15 (dimethicodiethylbenzal malonate), terephthalylidene dicamphor sulfonic acid and a salt thereof, TEA-salicylate and aminobenzoic acid (PABA).
(56) Products that can contain the cosmetic composition of the present invention include, for example, cosmetics such as an astringent, a skin toner, a nourishing toner, various types of creams, essences, packs and foundations, cleansers, face washes, soaps, treatments, and tonics. Specific formulations of the cosmetic composition of the present invention include a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nourishing lotion, a massage cream, a nourishing cream, a moisturizing cream, a hand cream, an essence, a nourishing essence, a pack, a soap, a shampoo, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, an emulsion, a lipstick, a makeup base, a foundation, a pressed powder, a loose powder, and an eyeshadow.
MODES OF THE INVENTION
(57) Hereinafter, preferred Examples for helping the understanding of the present invention will be suggested. However, the following Examples are provided only to more easily understand the present invention, and the contents of the present invention are not limited by the following Examples.
EXAMPLES
Example 1. Analysis of In Vivo Absorption, Distribution, and Excretion Patterns of Bacteria and Vesicles Derived from Bacteria
(58) In order to evaluate whether intestinal bacteria and bacteria-derived vesicles were systemically absorbed through the gastrointestinal tract, an experiment was performed with the following method. First, a dose of 50 ?g of each of fluorescence-labeled intestinal bacteria and intestinal bacteria-derived vesicles was administered through the gastrointestinal tract to the stomach of a mouse, and fluorescence was measured after 0 minute, 5 minutes, 3 hours, 6 hours, and 12 hours. As a result of observing the entire image of the mouse, as illustrated in
(59) In order to evaluate the pattern in which the intestinal bacteria and the vesicles derived from the intestinal bacteria infiltrated into various organs after they were systemically absorbed, 50 ?g of bacteria and vesicles derived from bacteria labeled with fluorescence were administered in the same manner as described above, and then the blood, heart, liver, kidneys, spleen, fat, and muscle were collected 12 hours after administration. As a result of observing fluorescence in the collected tissues, as illustrated in
Example 2. Metagenomic Analysis of Vesicles Derived from Bacteria in Clinical Sample
(60) After clinical samples such as blood, urine, saliva, and the like was first put into a 10-ml tube and suspended matter was allowed to settle by a centrifuge (3,500?g, 10 min, 4? C.), only the supernatant was transferred to a new 10-ml tube. After bacteria and impurities were removed by using a 0.22-?m filter, they were transferred to a Centriprep tube (centrifugal filters 50 kD) and centrifuged at 1,500?g and 4? C. for 15 minutes, materials smaller than 50 kD were discarded, and the residue was concentrated to 10 ml. After bacteria and impurities were removed once again by using a 0.22-?m filter, the supernatant was discarded by using a ultra-high speed centrifugation at 150,000?g and 4? C. for 3 hours with a Type 90Ti rotor, and an aggregated pellet was dissolved in physiological saline (PBS).
(61) Internal DNA was extracted out of the lipid by boiling 100 ?l of the vesicles isolated by the above method at 100? C., and then cooled on ice for 5 minutes. And then, in order to remove the remaining suspended matter, the DNA was centrifuged at 10,000?g and 4? C. for 30 minutes, and only the supernatant was collected. And, the amount of DNA was quantified by using Nanodrop. Thereafter, in order to confirm whether the DNA derived from bacteria was present in the extracted DNA, PCR was performed with 16s rDNA primers shown in the following Table 1 and it was confirmed that genes derived from bacteria were present in the extracted genes.
(62) TABLE-US-00001 TABLE1 SEQID primer Sequence No. 16S 16S_V3_F 5-TCGTCGGCAGCGTCAGAT 1 rDNA GTGTATAAGAGACAGCCTACG GGNGGCWGCAG-3 165_V4_R 5-GTCTCGTGGGCTCGGAGA 2 TGTGTATAAGAGACAGGACTA CHVGGGTATCTAATCC
(63) The DNA extracted by the above method was amplified using the 16S rDNA primers, and then sequencing was performed (Illumina MiSeq sequencer), the results were output as a standard flowgram format (SFF) file, the SFF file was converted into a sequence file (.fasta) and a nucleotide quality score file using GS FLX software (v2.9), and then the reliability estimation for the reads was confirmed, and a portion in which the window (20 bps) average base call accuracy was less than 99% (Phred score<20) was removed. For the OTU (operational taxonomy unit) analysis, clustering was performed according to sequence similarity by using UCLUST and USEARCH, the genus, family, order, class, and phylum were clustered based on 94%, 90%, 85%, 80%, and 75% sequence similarity, respectively, classification was performed at the phylum, class, order, family, and genus levels of each OUT, and bacteria having a sequence similarity of 97% or more at the genus level were profiled by using the 16S RNA sequence database (108,453 sequences) of BLASTN and GreenGenes (QIIME).
Example 3. Metagenomic Analysis of Bacteria and Bacteria-Derived Vesicles in Saliva of Patient with Diabetes and Normal Individual
(64) After a metagenomic analysis was performed using the method of Example 2 on the saliva from 47 patients with diabetes, and 277 normal individuals who were matched in age and sex by extracting genes from bacteria and vesicles present in the saliva, the distribution of bacteria of the genus Lactococcus and vesicles derived from bacteria of the genus Lactococcus was evaluated. As a result, it was confirmed that bacteria of the genus Lactococcus and vesicles derived from bacteria of the genus Lactococcus were significantly decreased in the saliva from the patients with diabetes as compared to the saliva from the normal individuals (see Table 2, 3, and
(65) TABLE-US-00002 TABLE 2 Bacteria Control Diabetes t-test in saliva Mean SD Mean SD p-value Ratio g_Lactococcus 0.00003 0.00006 0.00001 0.00002 0.00001 0.30
(66) TABLE-US-00003 TABLE 3 Vesicles Control Diabetes t-test in saliva Mean SD Mean SD p-value Ratio g_Lactococcus 0.0013 0.0052 0.0006 0.0010 0.0135 0.49
Example 4. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Diabetes and Normal Individual
(67) After a metagenomic analysis was performed using the method of Example 2 on the blood from 61 patients with diabetes, and 122 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Lactococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Lactococcus were significantly decreased in the blood from the patients with diabetes as compared to the blood from the normal individuals (see Table 4 and
(68) TABLE-US-00004 TABLE 4 Control Diabetes t-test Blood Mean SD Mean SD p-value Ratio g_Lactococcus 0.0025 0.0050 0.0001 0.0002 <0.0001 0.06
Example 5. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Myocardial Infarction and Normal Individual
(69) After a metagenomic analysis was performed using the method of Example 2 on the blood from 57 patients with myocardial infarction, and 163 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Lactococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Lactococcus were significantly decreased in the blood from the patients with myocardial infarction as compared to the blood from the normal individuals (see Table 5 and
(70) TABLE-US-00005 TABLE 5 Blood Myocardial Control infarction t-test Taxon Mean SD Mean SD p-value Ratio g_Lactococcus 0.0020 0.0038 0.0000 0.0000 0.0001 0.00
Example 6. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Atrial Fibrillation and Normal Individual
(71) After a metagenomic analysis was performed using the method of Example 2 on the blood from 32 patients with atrial fibrillation, and 64 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Lactococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Lactococcus were significantly decreased in the blood from the patients with atrial fibrillation as compared to the blood from the normal individuals (see Table 6 and
(72) TABLE-US-00006 TABLE 6 Blood Atrial Control fibrillation t-test Taxon Mean SD Mean SD p-value Ratio g_Lactococcus 0.0012 0.0033 0.0001 0.0002 0.0064 0.05
Example 7. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Stroke and Normal Individual
(73) After a metagenomic analysis was performed using the method of Example 2 on the blood from 115 patients with stroke, and 109 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Lactococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Lactococcus were significantly decreased in the blood from the patients with stroke as compared to the blood from the normal individuals (see Table 7 and
(74) TABLE-US-00007 TABLE 7 Blood Control Stroke t-test Taxon Mean SD Mean SD p-value Ratio g_Lactococcus 0.0019 0.0048 0.0009 0.0090 0.0318 0.48
Example 8. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Renal Failure and Normal Individual
(75) After a metagenomic analysis was performed using the method of Example 2 on the blood from 21 patients with renal failure, and 20 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Lactococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Lactococcus were significantly decreased in the blood from the patients with renal failure as compared to the blood from the normal individuals (see Table 8 and
(76) TABLE-US-00008 TABLE 8 Blood Renal Control failure t-test Taxon Mean SD Mean SD p-value Ratio g_Lactococcus 0.0052 0.0081 0.0000 0.0001 0.01 0.01
Example 9. Metagenomic Analysis of Bacteria-Derived Vesicles in Urine of Patient with Parkinson's Disease and Normal Individual
(77) After a metagenomic analysis was performed using the method of Example 2 on the urine from 39 patients with Parkinson's disease, and 79 normal individuals who were matched in age and sex by extracting genes from vesicles present in the urine, the distribution of vesicles derived from bacteria of the genus Lactococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Lactococcus were significantly decreased in the urine from the patients with Parkinson's disease as compared to the urine from the normal individuals (see Table 9 and
(78) TABLE-US-00009 TABLE 9 Urine Parkinson's Control disease t-test Taxon Mean SD Mean SD p-value Ratio g_Lactococcus 0.0048 0.0064 0.0005 0.0009 <0.0001 0.10
Example 10. Metagenomic Analysis of Bacteria-Derived Vesicles in Urine of Patient with Depression and Normal Individual
(79) After a metagenomic analysis was performed using the method of Example 2 on the urine from 20 patients with depression, and 20 normal individuals who were matched in age and sex by extracting genes from vesicles present in the urine, the distribution of vesicles derived from bacteria of the genus Lactococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Lactococcus were significantly decreased in the urine from the patients with depression as compared to the urine from the normal individuals (see Table 10 and
(80) TABLE-US-00010 TABLE 10 Urine Control Depression t-test Taxon Mean SD Mean SD p-value Ratio g_Lactococcus 0.0036 0.0081 0.0002 0.0002 0.04 0.05
Example 11. Isolation of Vesicles from Lactococcus lactis Cell Culture
(81) Based on the above-described examples, the Lactococcus lactis strain (L. lactis) was cultured, and vesicles isolated therefrom were characterized. The Lactococcus lactis strain was cultured in a de Man-Rogosa and Sharpe (MRS) medium until an absorbance (OD 600) reached 1.0 to 1.5 (OD.sub.600) reached 1.0 to 1.5 at 37? C. under an aerobic condition, and then sub-cultured in a Luria-Bertani (LB) medium. Subsequently, the medium containing the strain was recovered, and then centrifuged at 10,000 g and 4? C. for 20 minutes to remove the strain, followed by filtration through a 0.22 ?m filter. The filtered supernatant was concentrated to a volume of 50 mL through a 100 kDa Pellicon 2 Cassette filter membrane (Merck Millipore, US) by microfiltration using a MasterFlex pump system (Cole-Parmer, US). The concentrated supernatant was filtered again using a 0.22 ?m filter. Afterward, a protein was quantified by BCA assay, and the following experiment was performed on the obtained vesicles.
Example 12. Inhibition Effect of Inflammation-Inducing of Lactococcus lactis-Derived Vesicles
(82) To examine the influence of Lactococcus lactis-derived vesicles (L. lactis EV) on the secretion of inflammation mediators (IL-6 and TNF-?) in inflammatory cells, a mouse macrophage cell line, that is, Raw 264.7 cells, was treated with various concentrations (0.1, 1 and 10 ?g/mL) of the Lactococcus lactis-derived vesicles, and then cell death was induced, followed by ELISA. More specifically, the Raw 264.7 cells seeded at 4?10.sup.4 cells/well in a 48-well cell culture plate were treated with various concentrations of Lactococcus lactis-derived vesicles suspended in a serum-free DMEM, and then incubated for 12 hours. Subsequently, cell death was measured using EZ-CYTOX (cell viability, proliferation, cytotoxicity assay kit by Dogen, Korea), the cell culture was collected in a 1.5 ml tube and centrifuged at 3000 g for 5 minutes, and the supernatant was stored at ?80? C. for subsequent ELISA.
(83) To perform ELISA, capture antibodies were diluted in PBS, and 50 ?L of the resultant dilution was dispensed into a 96 well polystyrene plate according to a working concentration, followed by an overnight reaction at 4? C. Subsequently, the resultant was washed three times with 100 ?L of a 0.05% TWEEN? 20 (Polyethylene glycol sorbitan monolaurate) containing PBS (PBST) solution, 100 ?L of a 1% BSA-containing PBS (RD) solution was dispensed for blocking at room temperature for 1 hour. 50 ?L each of the sample and the standard were dispensed according to a concentration, followed by a reaction at room temperature for 2 hours. The resultant was washed three times with 100 ?L of PBST, and detection antibodies were diluted in RD and dispensed at 50 ?L according to a working concentration, followed by a reaction at room temperature for 2 hours. The resultant was washed three times with 100 ?L of PBST, and Streptavidin-HRP (R&D Systems, USA) was diluted in RD at 1/40 and dispensed at 50 ?L, followed by a reaction at room temperature for 20 minutes. Finally, the resultant was washed three times with 100 ?L of PBST, 50 ?L of a TMB substrate (SurModics, USA) was dispensed, and when color development progressed for 5 to 20 minutes, 50 ?L of a 1M sulfuric acid solution was dispensed to stop the reaction, and then absorbance was measured at 450 nm using a SpectraMax M3 microplate reader (Molecular Devices, USA).
(84) As a result, as shown in
Example 13. Anti-Inflammatory Effects of Lactococcus lactis-Derived Vesicles
(85) Based on the above results, to evaluate the anti-inflammatory effect of the Lactococcus lactis-derived vesicles, the mouse macrophage cell line was pre-treated with various concentrations (0.1, 1 and 10 ?g/mL) of the Lactococcus lactis-derived vesicles for 12 hours, and then treated with 1 ?g/mL of the pathogenic vesicles, that is, E. coli-derived vesicles, and after 12 hours, the secretion of inflammatory cytokines was measured by ELISA. As a result, it was confirmed that, when the Lactococcus lactis-derived vesicles were pre-treated, the secretion of IL-6 and TNF-? by E. coli-derived vesicles was significantly inhibited (see
(86) The above-described description of the present invention is provided for illustrative purposes, and those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the above-described Examples are illustrative only in all aspects and are not restrictive.
INDUSTRIAL APPLICABILITY
(87) Vesicles derived from bacteria of the genus Lactococcus according to the present invention is expected to be effectively used for a method of diagnosing diabetes, myocardial infarction, atrial fibrillation, stroke, renal failure, Parkinson's disease, and depression, and a food or drug composition for preventing or treating the above-mentioned diseases or an inflammatory disease.