Therapeutic agent targeted to receptor protein, test agent, antibody that binds to receptor protein, and screening method for molecularly targeted drugs
12098205 ยท 2024-09-24
Assignee
Inventors
Cpc classification
C12N15/10
CHEMISTRY; METALLURGY
A61K45/00
HUMAN NECESSITIES
C12N15/1138
CHEMISTRY; METALLURGY
C07K2317/73
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
C07K16/286
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
G01N33/57492
PHYSICS
A61K31/711
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
G01N33/53
PHYSICS
C07K2317/34
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
International classification
C07K16/28
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
From gene expression analysis with a long-term recurrence-free group and a recurrence metastasis group of stomach cancer, CHRNB2 and NPTXR were identified as drug discovery targets. Tumor growth was successfully inhibited by an antibody medicine or a nucleic acid medicine targeting CHRNB2 or NPTXR. Furthermore, a polyclonal antibody and a monoclonal antibody linking to CHRNB2 or NPTXR are provided. Since these receptor molecules are novel molecular targets, treatment of cases which the existing therapeutic drugs have no effect on is made possible.
Claims
1. An isolated antibody that binds specifically to a neuronal pentraxin receptor (NPTXR) and inhibits NPTXR function, comprising three heavy chain complementarity determining regions (HCDR1, HCDR2, and HCDR3) and three light chain complementarity determining regions (LCDR1, LCDR2, and LCDR3) of an antibody produced by a hybridoma deposited with NITE Patent Microorganisms Depositary (NPMD) and assigned with Accession No. NITE BP-02856.
2. The anti-NPTXR antibody of claim 1, wherein the anti-NPTXR antibody recognizes an amino acid sequence selected from the group consisting of CESGLPRGLQGAGPRRDT (SEQ ID NO: 10), KERVALSHSSRRQRQEVE (SEQ ID NO: 11), and SEQ ID NO: 12 (GLPRGLQGAGPRRDT).
3. The anti-NPTXR antibody of claim 1, wherein the anti-NPTXR antibody comprises a heavy chain variable region (HCVR) and a light chain variable region (LCVR) of an antibody produced by a hybridoma deposited with NPMD and assigned with Accession No. NITE BP-02856.
4. The anti-NPTXR antibody of claim 1, wherein the anti-NPTXR antibody is produced by the hybridoma assigned with Accession No. NITE BP-02856.
5. A pharmaceutical composition comprising the anti-NPTXR antibody of claim 1 and optionally a pharmaceutically acceptable carrier or excipient.
6. A kit comprising the anti-NPTXR antibody of claim 1.
7. A molecular target therapeutic drug comprising the anti-NPTXR antibody of claim 1.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
DESCRIPTION OF EMBODIMENTS
(26) To identify a molecule involved in stomach cancer progression, the present inventors classified cases occurring after stomach resection in accordance with the progress and performed exhaustive expression analysis using a next-generation sequencer on mRNAs obtained from a stomach cancer primary lesion tissue. As a result, it was revealed that CHRNB2 and NPTXR that are receptor molecules are the molecules related to progression of stomach cancer.
(27) According to a public database GeneCards, both CHRNB2 and NPTXR are genes with high expression in a nervous system organ such as a brain. CHRNB2 less expresses in other organs including a stomach, and no difference in the expression is found between the other organs. Further, although expression of NPTXR is found equally in organs other than the nervous system, no difference in expression is found between organs. Further, although a result that implies involvement of NPTX/NPTXR in a neuroblastoma was reported for the function of these genes (non-Patent Literature 3), a relation to a tumor of a stomach cancer or the like or the role in a tumor has not been reported for CHRNB2 and thus is unknown. Further, also for the NPTXR, although there has been a report for a neuroblastoma as described above, there has been no report for other cancer types, and the role in an epithelial tumor is also unknown.
(28) As a result of analysis made by the present inventors, a relation between these receptor molecules and tumor development and an action in a tumor were revealed. Further, proliferation inhibition of tumor cells and antitumor activity were observed in a neutralizing antibody that neutralizes these molecules or a nucleic acid that inhibits expression of these molecules. Therefore, a substance that inhibits the function of CHRNB2 and NPTXR proteins or inhibits a gene expression functions as a molecular target therapeutic drug.
(29) As described below, in the Examples, an antibody or a siRNA is used as a substance that neutralizes or inhibits expression of CHRNB2 and NPTXR. However, not only such an antibody and siRNA but also any substance may be used as long as it is a substance that neutralizes or inhibits expression of CHRNB2 and NPTXR.
(30) Further, since proliferation inhibition and antitumor activity on tumor cells were observed in the substance that neutralizes or inhibits expression of CHRNB2 or NPTXR, it is possible to screen a therapeutic drug targeting CHRNB2 or NPTXR.
(31) Specifically, the binding to a region exposed on the cell surface of CHRNB2 or NPTXR may be evaluated. The region exposed on the cell surface of CHRNB2 or NPTXR can be predicted by using a program of analyzing the conformation of a protein. For example, since peptides represented by SEQ ID NOs: 8 to 11 are considered to be exposed on the cell surface, screening can be made by evaluating the binding to these peptides.
(32) Further, since the effect is observed in a substance that inhibits expression of CHRNB2 or NPTXR, the expression of CHRNB2 or NPTXR may be used as an index to screen molecular target drugs. Specifically, cells expressing CHRNB2 or NPTXR are cultured in the presence of a candidate substance, the mRNA or the protein of CHRNB2 or NPTXR is quantified, and the effect of the candidate substance can be examined. A known method can be used for measuring gene expression and protein expression, it is possible to determine gene expression by RT-PCR and determine protein expression by ELISA or the like, for example.
(33) In the present invention, an anti-CHRNB2 antibody and an anti-NPTXR antibody mean an immune globulin molecule binding to CHRNB2 or NPTXR. Furthermore, as illustrated below, the present inventors have already acquired not only polyclonal antibodies to CHRNB2 and NPTXR but also monoclonal antibodies thereto. The antibodies of the present invention also include a human chimera antibody, a humanized antibody made as a humanized CDR grafted antibody, and a human antibody using a genetically modified mouse obtained from these monoclonal antibodies by using a gene recombination technology. Humanized antibodies and human antibodies have less side effect than antibodies of animals other than human when administered to a human, and the therapeutic effect persists for a long time. Further, the scope of the present invention includes antibody fragments such as Fab, Fab, (Fab).sub.2, and Fv fragments, a linear antibody, single-strand Fv(scFv), a bispecific antibody, or the like.
(34) Furthermore, epitope analysis is also performed on an anti-NPTXR monoclonal antibody. The term epitope refers to a part of an antigen recognized by an antibody and means a site on an antigen to which a domain including antibody variable region disclosed in the present specification binds. When a polypeptide such as NPTXR is used as an antigen, the antibody may recognize a linear amino acid sequence or may recognize a three-dimensional conformation, and an epitope can be defined by the amino acid sequence or the antigen structure. Since it is considered that antibodies binding to the same epitope have the same characteristic feature, an anti-NPTXR monoclonal antibody can be defined by an epitope sequence.
(35) Further, a nucleic acid medicine may be not only a siRNA demonstrated in the following examples but also any medicine that inhibits expression of CHRNB2 or NPTXR genes and includes a medicine that inhibits mRNA expression, such as a miRNA or an antisense oligo without being limited to the siRNA. Further, a nucleic acid that binds to a CHRNB2 or NPTXR protein as with an antibody, such as an aptamer, a decoy, or the like and neutralizes the activity thereof is included.
(36) Furthermore, an agent that inhibits a signal cascade located in the downstream of CHRNB2 or NPTXR receptors and thereby disables the signal from these receptors may be used. For example, the existence of a PI3K/Akt signal pathway was identified as the downstream signaling pathway of NPTXR, as demonstrated below. Therefore, in treatment of a tumor with high NPTXR expression, the effect may be enhanced when a PI3K/Akt inhibitor is used alone or used in combination with a molecular target therapeutic drug that neutralizes or inhibits expression of NPTXR.
(37) Further, when a molecular target therapeutic drug that neutralizes or inhibits expression of CHRNB2 or NPTXR is administered, it is necessary to examine CHRNB2 or NPTXR expression in advance in order to avoid unnecessary treatment. Expression of CHRNB2 or NPTXR can be examined by PCR or immunohistochemical staining with an antibody, as demonstrated below. A primer set used in PCR or an antibody used for determining expression and a reagent required for determination may be combined to make a test kit. Since expression of CHRNB2 or NPTXR is deeply correlated to prognosis, such a test kit can be used to perform prognosis forecast.
(38) Although data demonstrated below was obtained from analysis of stomach cancer, a molecular target therapeutic drug targeting CHRNB2 or NPTXR can be applied not only to stomach cancer but also to various cancer types that express CHRNB2 or NPTXR at a high level or a disease that expresses CHRNB2 or NPTXR excessively.
(39) According to a cancer genome database, TCGA (The Cancer Genome Atlas), the expression of CHRNB2 in acute myelogenous leukemia, breast cancer, bile duct cancer, glioblastoma, glioma, lung cancer, malignant melanoma, malignant mesothelioma, pancreatic cancer, uterine cancer, uterine sarcoma, uveal melanoma, and renal cell cancer is higher than or equal to that in stomach cancer. Since, the expression of CHRNB2 is high even with a normal tissue in the cranial nervous system, it is considered that the high expression of CHRNB2 in glioblastoma and glioma reflects expression of the original tissue. However, the expression of CHRNB2 in the original organ in acute myelogenous leukemia, breast cancer, bile duct cancer, lung cancer, malignant melanoma, malignant mesothelioma, pancreatic cancer, uterine cancer, uterine sarcoma, and renal cell cancer is equal to or less than that in stomach. Therefore, the high expression of CHRNB2 in these cancer types is certainly correlated to carcinogenesis. Further, as demonstrated in the following examples, since proliferation of cancer cells is inhibited by neutralizing or inhibiting the expression of CHRNB2, a medicine targeting CHRNB2 is certainly to have the effect on these cancer types.
(40) Further, the expression of NPTXR in bladder cancer, breast cancer, esophageal cancer, glioblastoma, glioma, lung cancer, malignant melanoma, ovarian cancer, malignant pheochromocytoma, prostatic cancer, testicular germ cell tumor, thyroid cancer, pancreatic cancer, uterine cancer, and renal cell cancer is higher than or equal to that in stomach cancer. Therefore, also in these cancer types, a medicine targeting NPTXR is certainly to have the effect on these cancer types in the same manner as in stomach cancer.
(41) Further, although an antibody or a nucleic acid targeting CHRNB2 or NPTXR is used alone in the Examples demonstrated below, such an antibody or a nucleic acid can be used in combination. The inventors have found two regions that can be targeted by anti-CHRNB2 antibodies or anti-NPTXR antibodies, respectively. Therefore, these two types of antibodies against CHRNB2 or NPTXR may be used at the same time, or antibodies against the two molecules, CHRNB2 and NPTXR, may be used in combination. Further, it is possible to use these antibodies in combination with a chemotherapeutic agent or a target medicine such as trastuzumab, ramucirumab, nivolumab, or the like that have already been approved.
(42) Description will be provided below with reference to data.
(43) 1. Identification of CHRNB2 and NPTXR
(44) <Identification of a Molecule Involved in Stomach Cancer Progression that can be a Target Molecule>
(45) In Nagoya University, Faculty of Medicine, case histories in which curative resection was performed on stage III stomach cancer and internal use of S-1 was applied as post-operative adjuvant therapy have been grouped so far in accordance with the progress. Stomach cancer patients can be broadly categorized into a long-term recurrence-free group and a recurrence metastasis group. An over-five-year long-term recurrence-free group means stomach cancer that might be controlled by the current treatment, and this was used as a control and compared with the recurrence metastasis group. Further, since metastasis includes different types of metastasis such as peritoneal dissemination, liver metastasis, and lymph node metastasis, the recurrence metastasis group was categorized into a peritoneal dissemination recurrence group, a liver metastasis recurrence group, and a lymph node metastasis recurrence group, and expression profiling was performed by transcriptome analysis on RNAs obtained from each four stomach cancer primary lesion tissues for four groups including the above recurrence metastasis groups and the over-five-year long-term recurrence-free group.
(46) For surgery samples, RNAs were extracted by using RNeasy kit (by QIAGEN). For the extracted total RNA, the library for sequencing was prepared in accordance with a standard protocol by using TruSeq RNA Sample Prep Kit (By illumina).
(47) Next, Paired-End sequencing was performed by using a next-generation sequencer Hiseq (by illumina), and transcriptome analysis was performed. Data was acquired with a read base length of 100 bases/read, a reference acquisition read number of 100 million read pairs (200 million reads)/lane, and a reference acquisition data level of 20 Gb/lane.
(48) Analysis was conducted by performing a mapping process to a designated reference sequence by using HiSeq software, calculating the expression level of each gene based on a Fragments per kilobase of exon per million mapped sequence reads (FPKM) value, and creating an inter-subject comparison table.
(49) The expression level of 57749 molecules was analyzed exhaustively by transcriptome analysis, the over-five-year long-term recurrence-free group and the other three groups were compared with each other, and detection of a molecule which expressed at a high level in the recurrence metastasis group was performed. Analysis was performed by focusing on two points that expression increases in all the metastatic forms and that the molecule is a receptor molecule can be premised on an approach as an antibody medicine considering a roadmap to inhibitor development. As a result, CHRNB2 and NPTXR were selected as candidate molecules that meet criteria.
(50) TABLE-US-00001 TABLE 1 Group peritoneal dissemination liver metastasis lymph node metastasis recurrence group recurrence group recurrence group gene log.sub.2 p-value log.sub.2 p-value log.sub.2 p-value CHRNB2 2.45 0.0001 4.88 0.0001 6.36 <0.0001 NPTXR 4.39 <0.0001 2.26 0.0017 1.71 0.0183
(51) As indicated in Table 1, CHRNB2 and NPTXR significantly express at a high level in all the recurrence groups compared to the over-five-year long term recurrence-free group that is the control. Although the roles of both the molecules of CHRNB2 and NPTXR in a malignant tumor were unclear, further research was conducted since these molecules are receptor proteins and may be a target for drug discovery having a mechanism that is completely different from that of the existing molecular targeted drug for stomach cancer.
(52) <Quantitative Analysis of mRNA Expression Level of CHRNB2 and NPTXR in Stomach Cancer Cell Lines>
(53) The mRNA expression levels of CHRNB2 and NPTXR were quantified by quantitative PCR using 14 types of stomach cancer cell lines and FHS74 that is a non-neoplastic glandular ductal epithelial cell line (
(54) TABLE-US-00002 [CHRNB2] Forward: (SEQIDNO:1) AGCGAGGACGATGACCAG Reverse: (SEQIDNO:2) GGTGCCAAAGACACAGACAA [NPTXR] Forward: (SEQIDNO:3) TCATTCTGGAGCTGGAGGAC Reverse: (SEQIDNO:4) GGCAGCTGAGAGGTTCACA [ControlGAPDH] Forward: (SEQIDNO:5) GAAGGTGAAGGTCGGAGTC Reverse: (SEQIDNO:6) GAAGATGGTGATGGGATTTC Probe: (SEQIDNO:7) CAAGCTTCCCGTTCTCAGCC
(55) In FHS74 that is non-neoplastic glandular ductal epithelial cell line, both the expression levels of molecules of CHRNB2 and NPTXR were significantly low. In contrast, out of 14 types of stomach cancer cell lines, an increase in expression was observed in 11 cell lines (79%) for CHRNB2 and in 9 cell lines (64%) for NPTXR. That is, it was found that an increase in expression of CHRNB2 and NPTXR was observed in stomach cancer tissues of the patients of the recurrence metastasis group and stomach cancer cell lines.
(56) 2. Functional Analysis of CHRNB2 and NPTXR Using Cell Lines
(57) <Analysis Result Using Knockout Cell Lines>
(58) (1) Functional Analysis Using CHRNB2 Knockout Cell Lines
(59) MKN1 known as high malignant stomach cancer cell line was used to prepare knockout (KO) cells of CHRNB2 by genome editing by using CRISPR-CAS9 method (Gene Art Platinum Cas9 nuclease; by Thermo Fisher Scientific). Knockout cells were selected by single cell cloning, and the selected knockout cells were confirmed by a direct sequencing method or a Western blotting method. Comparison with the control cells (untreated MKN1) was made for the proliferative ability, the apoptotic ratio, the migratory ability, the invasive ability, and the adhesion ability (
(60) The proliferative ability of cells was analyzed by the following method. The cells were seeded in a 96-well plate so that 1?10.sup.4 cells were each placed thereon, and the cell proliferation was determined over time up to the fifth day in a DMEM medium added with 2% fetal bovine serum. In the measurement, 10 ?L Cell Counting Kit-8 (by Dojindo Molecular Technologies) was added and measure the absorbance, and the absorbance was displayed with the value at the start of determination being defined as 1 (
(61) The apoptotic cell ratio was analyzed as follows. Annexin V staining was performed by using Annexin V Alexa Fluor 568 conjugate (by Thermo Fisher Scientific). Ten ?L Annexin V reagent was added to 1?10.sup.6 cells, which were placed on a slide and let stand at the room temperature for 15 minutes, then the number of cells and the number of Annexin V positive cells were counted using a fluorescence microscope (FSX100, by Olympus).
(62) In KO-CHRNB2 cells, the apoptotic ratio increased significantly (
(63) The migratory ability of cells was evaluated by wound-healing assay. In a 12-well plate, 2?10.sup.4 cells were seeded respectively and forming a wound gap at a predetermined width by ibidi Culture insert method (by ibidi), and the seeded cells were cultured in a serum-free medium. The insert was removed after 24 hours from the seeding, and the wound width was measured at 200 ?m interval every 6 hours. In the measurement, 10 positions in each well were measured by using a microscope of 40 times magnification and obtained the mean and the standard deviation (
(64) The invasive ability of the control cells and KO-CHRNB2 cells was evaluated by Matrigel invasion assay. The assay was performed in accordance with a protocol by using BioCoat Matrigel invasion Chambers (by BD Biosciences). Specifically, 2.5?10.sup.4 cells were seeded in 1 well respectively, and after culture in a serum-free DMEM medium for 24 hours, the cells on a membrane bottom surface were fixed, stained by DiffQuick (by Sysmex), and observed under a microscope to count the number of cells. The microscope observation was performed at a magnification of 200 times, and the mean and the standard deviation were obtained of randomly selected five fields. Knockout of CHRNB2 also reduced the invasive ability significantly (
(65) The cell adhesion ability was analyzed as follows by using CytoSelect 48-Well Cell Adhesion Assay (by Cell Biolabs). On a plate coated with an adhesion factor, 7.5?10.sup.4 cells were seeded per 1 well respectively, and each absorbance was determined after one hour culture in a serum-free DMEM medium. The adhesion abilities to five types of cell adhesion factors were analyzed, which revealed that the adhesion ability was also reduced in KO-CHRNB2 cells (
(66) The above results revealed that, when expression of CHRNB2 is lost in the MKN1 cells, the characteristic features related to cancer progression, such as the proliferative ability, the apoptotic ratio, the migratory ability, the invasive ability, and the adhesion ability changed notably. Therefore, by inhibiting CHRNB2 function, it may be possible to inhibit cancer progression of stomach cancer.
(67) (2) Functional Analysis Using NPTXR Knockout Cell Lines
(68) Next, for NPTXR, similarly, knockout cells were prepared by using a CRISPR-CAS9 method with stomach cancer cell line MKN1, and the proliferative ability, the apoptotic ratio, the migratory ability, the invasive ability, and the adhesion ability were analyzed (
(69) As shown in
(70) The above result implied that NPTXR expression affected apoptosis and accelerated cell proliferation. Accordingly, NPTXR knockout cell lines were used to analyze the characteristic features associated with apoptosis. It is known that a mitochondrion is deeply related to apoptosis. It is known that a loss of a membrane potential of a mitochondrion facilitates release of cytochrome c, activation of caspase cascade, and apoptosis is induced. Accordingly, it was analyzed whether or not NPTXR expression is involved in apoptosis via a mitochondrion (
(71) First, the membrane potential of a mitochondrion was visualized, a living cell in which mitochondrial depolarization occurred, that is, a cell in which apoptosis was induced was visualized (
(72) In both the two cell lines in which NPTXR was knocked out, the ratio of living cells in which depolarization occurred increased by around 6.5 to 10 times compared to the MKN1 cells that are parental cells. The mitochondrial depolarization indicates that apoptosis induced via mitochondria. The above results indicate that NPTXR expression inhibits apoptosis induced via mitochondria.
(73) Next, in NPTXR knockout cells, activity of a caspase that is a protease that causes progress of apoptosis was analyzed. Each 1?10.sup.5 cells of cell lines were stained respectively by Muse MitoPotential kit (by Merck Millipore) and analyzed by a cell sorter. It was observed that, in all the knockout cell lines, caspase positive cells (Caspase+/Dead and Caspase+/Live subsets) increased. That is, it is considered that NPTXR expression inhibits caspase activity and inhibits apoptosis.
(74) Next, it was analyzed which caspase in the caspase family is activated by using Caspase Colorimetric Assay Kit (by BioVision) (
(75) It was found that the caspase 3 that is an effector caspase and the caspase 9 that is an initiator caspase are activated by knockout of NPTXR expression. The above results indicated that apoptosis induction on a mitochondrial pathway was inhibited by the NPTXR expression, and as a result, caspase activation was also inhibited.
(76) Next, characteristics related to cell proliferation were analyzed. First, effect of NPTXR expression on the cell cycle was analyzed. Analysis was performed using Muse Cell Cycle kit (by Merck Millipore) by a cell sorter (
(77) Cancer cells have characteristics of having a high proliferation ability, a resistance against apoptosis, and an invasion and metastasis ability as shown above. The cancer stem sell hypothesis has been proposed that not all the cancer cells have similar properties, but some of the cancer cells have properties of a stem cell, and a cancer develops. Activity of Aldehyde Dehydrogenase (ALDH) expressing in stem cells was used as an index to analyze the ratio of the stem cells. The ratio of ALDH positive cells was determined by ALDEFLOUR fluorescent reagent system (by Stem Cell Technologies) (
(78) Comparison between the value of cells before treatment (control) and after treatment of a reagent (test) indicated that, in the NPTXR knockout cells, the ALDH positive cells decreased compared to MKN1 cells that are parental cells. That is, it was indicated that the NPTXR expression also affected the stem cell property.
(79) Next, the proliferative property of cancer cells was analyzed (
(80) The activity of PI3K in the NPTXR knockout cells was determined by using Muse PI3K Activation Dual Detection Kit (by Millipore) (
(81) Furthermore, it was analyzed whether or not NPTXR expression affects the sensitivity to 5-FU that is an anticancer agent commonly used for stomach cancer (
(82) In all the NPTXR knockout cells, the sensitivity to 5-FU was increased. In particular, a significant difference in sensitivity was observed in the low concentration region such as 0.1 and 1 mg/L compared to the parent cells, MKN1.
(83) This result means that inhibition of NPTXR expression increases the sensitivity to 5-FU and implies a possibility that a higher effect may be obtained by a combined use of an NPTXR expression inhibitor and 5-FU.
(84) (3) Analysis Using Mouse Subcutaneous Tumor Models
(85) CHRNB2 or NPTXR knocked-out MKN1 cells and untreated MKN1 cells were implanted by 1?10.sup.6 cells subcutaneously in both shoulders of 9-week old nude mice (BALB c nu/nu, obtained from Japan SLC), and the tumor volume was determined over time. Note that three mice were used for each group, the tumor volume was measured and calculated by shorter diameter?shorter diameter?longer diameter/2.
(86) Mouse subcutaneous tumor models were made, and the tumorigenic abilities were compared, which revealed that, while a tumor increased over time in the control (untreated MKN1), a significant difference in the tumor volume (indicated by * in
(87) In mouse subcutaneous tumor models, the significant decrease in the growth of a tumor in the CHRNB2 or NPTXR knockout cells implies that medicines targeting these molecules have the inhibiting effect against the tumor. Accordingly, a neutralizing antibody and a nucleic acid medicine for these molecules were prepared, and the effects thereof were studied.
(88) 3. Preparation of CHRNB2 and NPTXR Molecular Target Drug
(89) (1) Preparation of Antibody Medicine
Example 1
(90) <Preparation of CHRNB2 Neutralizing Antibodies (Polyclonal Antibody)>
(91) It was verified whether or not the activity of stomach cancer cells can be inhibited by activating a CHRNB2 specific antibody to inhibit the activity thereof. Estimation of the hydrophilicity, the secondary structure, and the antigenicity and optimal antigen site search were performed by using an epitope search tool (by Cosmo Bio). The following two sequences were selected as target sequences, rabbits were immunized in accordance with a routine method, and two types of polyclonal antibodies against CHRNB2 (Accession NO: NP_000739) were prepared. Note that the CHRNB2 antibody-1 and the CHRNB2 antibody-2 were antibodies obtained by immunizing amino acid sequences at positions 94-111 (Target sequence 1, SEQ ID NO: 8) and at positions 490-502 (Target sequence 2, SEQ ID NO: 9), respectively.
(92) Target Sequences;
(93) TABLE-US-00003 CHRNB2antibody-1: (SEQIDNO:8) WKPEEFDNMKKVRLPSKH CHRNB2antibody-2: (SEQIDNO:9) TFLHSDHSAPSSK
(94) First, it was examined whether or not the antibodies against these target sequences inhibit in vitro proliferation of stomach cancer cell line MKN1. MKN1 cells were seeded in a 96-well plate so that 1?10.sup.4 cells were placed, each antibody was added to have a concentration of 0.7 ?g/mL, and the cell proliferation was determined over time by WST-1 assay (
Example 2
(95) <Preparation of NPTXR Neutralizing Antibody (Polyclonal Antibody)>
(96) To verify whether or not the activity of stomach cancer cells can be inhibited by an NPTXR specific antibody to inhibit the activity thereof, estimation of the hydrophilicity, the secondary structure, and the antigenicity and optimal antigen site search were performed similarly by using an epitope search tool. The following two sequences were selected as target sequences, rabbits were immunized in accordance with a routine method, and two types of polyclonal antibodies against NPTXR (Accession NO: NP_055108) were prepared. Note that the NPTXR antibody-1 and the NPTXR antibody-2 were antibodies against amino acid sequences at positions 161-178 (Target sequence 1, SEQ ID NO: 10) and at positions 251-268 (Target sequence 2, SEQ ID NO: 11), respectively.
(97) Target Sequences;
(98) TABLE-US-00004 NPTXRantibody-1: (SEQIDNO:10) CESGLPRGLQGAGPRRDT NPTXRantibody-2: (SEQIDNO:11) KERVALSHSSRRQRQEVE
(99) Analysis of in vitro cell proliferation inhibiting activity by antibodies against these target sequences was performed in the same manner (
Example 3
(100) <Study of the Effect of CHRNB2 Neutralizing Antibodies by Using Mouse Peritoneal Dissemination Model>
(101) Next, the effect of CHRNB2 antibodies that recognize the above two types of targets were analyzed by using mouse peritoneal dissemination models. The therapeutic effect was examined by intraperitoneally inoculating 1?10.sup.6 MKN1 cells to 8-week old nude mice (BALB c nu/nu, obtained from Japan SLC). Note that four mice were used for each group, the CHRNB2 antibodies (CHRNB2 antibody-1: 6.5 ?g/500 ?L, CHRNB2 antibody-2: 8.7 ?g/500 ?L) were intraperitoneally administered twice a week for six weeks, respectively, as indicated by the administration schedule illustrated in
(102) For laparotomy macroscopic findings in six weeks of the control group, the CHRNB2 antibody-1-treated group, and the CHRNB2 antibody-2-treated group are indicated (
(103) The dissemination nodules were retrieved from the mice subjected to laparotomy, and the total weight of the dissemination nodule in each mouse was determined (
Example 4
(104) <Examination of the Effect of NPTXR Neutralizing Antibodies by Using Mouse Peritoneal Dissemination Model>
(105) In the same manner as in Example 3, the effect of NPTXR antibodies that recognize the targets of two regions of NPTXR were analyzed by using mouse peritoneal dissemination models (
(106) Laparotomy macroscopic findings obtained after six-week treatment of the control group, the NPTXR antibody-1-treated group, and the NPTXR antibody-2-treated group are indicated (
(107) Further, the dissemination nodules were retrieved from the mice subjected to laparotomy, and the total weight of the dissemination nodule in each mouse was determined (
(108) As indicated both the in vitro systems shown in Examples 1 and 2 and the in vivo systems shown in Examples 3 and 4, it is possible to significantly inhibit proliferation of cancer cells by targeting CHRNB2 or NPTXR and neutralizing the expression thereof. Therefore, a use of an antibody that recognizes CHRNB2 or NPTXR as a medicine enables treatment of recurrent or metastatic stomach cancer.
(109) Furthermore, as described above, expression of CHRNB2 or NPTXR increases not only in the stomach cancer but also in many other cancers. There is a high likelihood that these cancers can be treated by using the neutralizing antibody of CHRNB2 or NPTXR in the same manner.
Example 5
(110) <Establishment of Anti-CHRNB2 Monoclonal Antibody>
(111) The peptide represented by SEQ ID NO: 9 was used as an antigen, and a monoclonal antibody against CHRNB2 was established by a routine method. Three clones were selected from the obtained hybridoma, and monoclonal antibodies were obtained. In the same manner as in Example 1, MKN1 cells were seeded in a 96-well plate so that 1?10.sup.4 cells were placed thereon, each antibody was added to have a concentration of 0.7 ?g/mL, and the cell proliferation was determined over time by WST-1 assay (
(112) Among the above, the clone 3 (hereafter, referred to as CH-01) has been deposited to National Institute of Technology and Evaluation (NITE), NITE Patent Microorganisms Depositary (NPMD) (Room 122, 2-5-8 Kazusa-Kamatari, Kisarazu City, Chiba, Japan) on Jan. 23, 2019 (depository date) as Accession No. NITE P-02857.
(113) <Effect of CH-01 Antibody on Mouse Peritoneal Dissemination Model>
(114) The therapeutic effect of the anti-CHRNB2 monoclonal antibody (clone 3, CH-01) on a mouse peritoneal dissemination model was examined (
(115) In the anti-CHRNB2 monoclonal antibody-treated group, clear inhibition of peritoneal dissemination progress was observed macroscopically (
Example 6
(116) <Establishment of Anti-NPTXR Monoclonal Antibody>
(117) The peptide represented by SEQ ID NO: 10 was used as an antigen, and a monoclonal antibody against NPTXR was established by a routine method. In the same manner as in Example 1, MKN1 cells were seeded in a 96-well plate so that 1?10.sup.4 cells were placed thereon, each antibody was added to have a concentration of 0.7 ?g/mL, and the cell proliferation was determined over time by WST-1 assay (
(118) Furthermore, the effect of anti-NPTXR monoclonal antibody clone 1 was analyzed on cancer cell lines derived from various organs. To respective cancer cell lines, the antibody was added in the same manner as described above, and the proliferative ratio of the fifth day antibody-treated group relative to the control was calculated (
(119) <Effect of Anti-NPTXR Monoclonal Antibody on Mouse Peritoneal Dissemination Model>
(120) The therapeutic effect of the anti-NPTXR monoclonal antibody on a mouse peritoneal dissemination model was examined (
(121) In the anti-NPTXR monoclonal antibody-treated group, clear inhibition of peritoneal dissemination progress was observed macroscopically (
(122) Note that the clone 1 (hereafter, referred to as NP-01) has been deposited to National Institute of Technology and Evaluation (NITE), NITE Patent Microorganisms Depositary (NPMD) (Room 122, 2-5-8 Kazusa-Kamatari, Kisarazu City, Chiba, Japan) on Mar. 12, 2019 (depository date under the Budapest Treaty) as Accession No. NITE P-02856.
(123) <Epitope Mapping of NP-01 Antibody>
(124) Epitope analysis of the NP-01 antibody was performed. In a region from positions 151 to 190 of NPTXR protein, the peptide consisting of 15 amino acids was synthesized while being shifted from the N-terminal to the C-terminal one by one, as shown in Table 2. Linkage to each peptide was determined by enzyme-linked immunosorbent assay, and epitopes were identified (Table 3). As a result, it was revealed that the amino acid sequence from positions 164 to 178, GLPRGLQGAGPRRDT (SEQ ID NO: 12) was intensively recognized as an epitope. Since it is considered that an antibody that recognizes the same epitope has a similar character, it is assumed that the antibody that recognizes the peptide represented by SEQ ID NO: 12 binds to NPTXR and has the effect of inhibiting proliferation of cancer cells.
(125) TABLE-US-00005 TABLE 2 Antigen No 1888-1 1888-2 1888-3 1888-4 Seq. Name NPTXR NPTXR NPTXR NPTXR (POS: 151-165) (POS: 152-166) (POS: (POS: 153-167) 154-168) Antigen No 1888-5 1888-6 1888-7 1888-8 Seq. Name NPTXR NPTXR NPTXR NPTXR (POS: 155-169) (POS: 156-170) (POS: (POS: 157-171) 158-172) Antigen No 1888-9 1888-10 1888-11 1888-12 Seq. Name NPTXR NPTXR NPTXR NPTXR (POS: 159-173) (POS: 160-174) (POS: (POS: 161-175) 162-176) Antigen No 1888-13 1888-14 1888-15 1888-16 Seq. Name NPTXR NPTXR NPTXR NPTXR (POS: 163-177) (POS: 164-178) (POS: (POS: 165-179) 166-180) Antigen No 1888-17 1888-18 1888-19 1888-20 Seq. Name NPTXR NPTXR NPTXR NPTXR (POS: 167-181) (POS: 168-182) (POS: (POS: 169-183) 170-184) Antigen No 1888-21 1888-22 1888-23 1888-24 Seq. Name NPTXR NPTXR NPTXR NPTXR (POS: 171-185) (POS: 172-186) (POS: (POS: 173-187) 174-188) Antigen No 1888-25 1888-26 Control Seq. Name NPTXR NPTXR Antigen (POS: 175-189) (POS: 176-190) peptide
(126) TABLE-US-00006 TABLE 3 1 2 3 4 5 6 7 8 Antigen No. 1888-1 1888-2 1888-3 1888-4 1888-5 1888-6 1888-7 1888-8 1 0.044 0.060 0.054 0.055 0.071 0.070 0.065 0.071 2 0.047 0.054 0.055 0.054 0.065 0.066 0.072 0.068 Average 0.046 0.057 0.055 0.055 0.068 0.068 0.069 0.070 Antigen No. 1888-9 1888-10 1888-11 1888-12 1888-13 1888-14 1888-15 1888-16 1 0.142 0.060 1.318 1.410 1.459 1.501 1.193 0.545 2 0.154 0.069 1.353 1.499 1.413 1.457 1.113 0.515 Average 0.148 0.065 1.336 1.455 1.436 1.479 1.153 0.530 Antigen No. 1888-17 1888-18 1888-19 1888-20 1888-21 1888-22 1888-23 1888-24 1 0.490 0.097 0.104 0.184 0.072 0.062 0.062 0.058 2 0.397 0.085 0.090 0.179 0.073 0.039 0.076 0.057 Average 0.444 0.091 0.097 0.182 0.073 0.066 0.069 0.058 Antigen No. 1888-25 1888-26 Control 1 0.047 0.055 1.457 2 0.061 0.064 1.506 Average 0.054 0.060 1.482
(2) Preparation of Nucleic Acid Medicine
Example 7
(127) <Study of Nucleic Acid Medicine Against CHRNB2>
(128) It was analyzed whether or not proliferation of stomach cancer cells can be inhibited by using a nucleic acid medicine to inhibit CHRNB2 expression. The siRNA specific to CHRNB2 was used to analyze in vitro the effect on the proliferative ability. Both the siRNA of CHRNB2 (siCHRNB2) and the control siRNA (siControl) were obtained from Hokkaido System Science. Further, the control represents proliferation of untreated cells.
(129) The siRNA was introduced to MKN1 cells by using LipoTrust (registered trademark) EX Oligo (by Hokkaido System Science), then cultured in a serum-free DMEM medium for 72 hours, and the proliferative ability thereof was evaluated (
(130) The left graph shows a result of analysis of the CHRNB2 mRNA expression level by quantitative PCR, and the right graph shows a result of the cell proliferation analyzed by Cell Counting Kit-8. The proliferative ability of stomach cancer cells was reduced significantly (*) by the siRNA specific to CHRNB2.
Example 8
(131) Study of Nucleic Acid Medicine Against NPTXR
(132) Next, the siRNA specific to NPTXR was used to analyze in vitro the effect on the proliferative ability in the same manner as in Example 7. The siRNA of NPTXR was introduced to MKN1 cells, then cultured in a serum-free DMEM medium for 72 hours, and the proliferative ability was then evaluated (
(133) The left graph shows a result of analysis of the NPTXR mRNA expression level by quantitative PCR, and the right graph shows a result of the cell proliferation analyzed by Cell Counting Kit-8. The proliferative ability of stomach cancer cells was reduced significantly (*) by the siRNA specific to NPTXR.
(134) The above results revealed that inhibition of mRNA expression enables inhibition of cell proliferation for both cases of CHRNB2 and NPTXR. As with antibody medicines, it is possible to inhibit the progression of cancers by using the nucleic acid medicine to inhibit expression of these molecules.
(135) 4. CHRNB2, NPTXR Expression Analysis Using Human Clinical Data
(136) In the case of clinical use of a medicine targeting CHRNB2 or NPTXR, unnecessary treatment may be avoided by confirming the expression of CHRNB2 or NPTXR in advance and treating only the patients having enhanced expression in their tumor tissues. The mRNA expression level of CHRNB2 or NPTXR in stomach cancer tissues was analyzed by resected specimens. Further, the correlation between prognosis and the mRNA expression level was evaluated by ROC curve analysis, and it was examined whether or not the mRNA expression level can be used in prognosis forecast.
Example 9
(137) <Quantitative Analysis of CHRNB2 Expression Level in Stomach Cancer Tissue>
(138) To confirm reproducibility of the exhaustive analysis data, the mRNA expression level of CHRNB2 in stomach cancer tissues obtained from 300 stomach cancer cases was examined by a quantitative PCR method. The CHRNB2 expression in the tissues obtained from normal gastric mucosa, 121 cases of stomach cancer of stages I and II, and 179 cases of stomach cancer of stages III and IV was determined by quantitative PCR (
(139) The expression of CHRNB2 was higher in the stomach cancer tissues than in the normal gastric mucosa and increased more significantly in stages III and IV than in stages I and II. From these data, it is understood that the expression of CHRNB2 is increased as the stage progresses.
(140) The cut-off value of the CHRNB2 mRNA expression level in the stomach cancer primary lesion tissue with respect to recurrence and death was found by ROC curve analysis. A result of the sensitivity of 54%, the specificity of 75%, and AUC=0.667 was obtained when the cut-off value was set at 0.0013 (
(141) Furthermore, the CHRNB2 protein in gastric tissues was detected by an immunohistochemical staining (
Example 10
(142) <Quantitative Analysis of NPTXR Expression Level in Stomach Cancer Tissue>
(143) The mRNA expression level of NPTXR in stomach cancer tissues obtained from 300 stomach cancer cases was examined by a quantitative PCR method in the same manner as in Example 9 (
(144) Furthermore, for NPTXR, the above 300 cases were classified in detail on a stage basis and were examined by the quantitative PCR method in the same manner as described above (
(145) Furthermore, the cut-off value of the NPTXR mRNA expression level in the stomach cancer primary lesion tissue with respect to recurrence and death was found by ROC curve analysis. A result of the sensitivity of 58%, the specificity of 66%, and AUC=0.638 was obtained when the cut-off value is set at 0.0086 (
(146) Furthermore, the NPTXR protein in gastric tissues was detected by an immunohistochemical staining (
(147) It was indicated that the CHRNB2 antibody or the NPTXR antibody can be applied to companion diagnosis that enables selection of applicable patients of molecular target treatment targeting CHRNB2 and NPTXR. Further, since CHRNB2 and NPTXR are proteins for which a difference in expression was observed in comparison with the long-term recurrence-free group and the recurrent metastasis group, CHRNB2 expression or NPTXR expression can also be used as a prognosis forecast marker. Immunohistochemical staining enables determination from a small amount of a tissue specimen and is thus applied not only to a surgery specimen but also to a biopsy specimen of endoscopic examination. Further, since immunohistochemical staining is a commonly performed clinical test, it is clinically significant to be able to confirm the expression of these proteins in a specimen by using an antibody.
Example 11
(148) <Expression Profile by Tissue Microarray>
(149) (1) Expression Profile in Various Organs and Normal Tissues
(150) As data used for considering safety in a case of using an antibody medicine binding to CHRNB2 or NPTXR or a medicine inhibiting the expression, the expression profiles in various organs and normal tissues of CHRNB2 and NPTXR were analyzed (
(151) The CHRNB2 expression and the NPTXR expression were analyzed by an immunohistochemical staining method by using a tissue microarray (by Provitro). As a result of tissue staining, the analyzed tissues are classified into no expression, low expression, and high expression, and the ratio thereof is indicated in the graph. Note that the number of analyzed tissues is represented as (n) on the graph. It is implied that both the CHRNB2 expression and the NPTXR expression are less in human normal tissues and it is suggested that the possibility of occurring an adverse event on an unintended organ is low.
(152) 2. Expression Profile in Cancers of Various Organs
(153) The CHRNB2 expression analysis and the NPTXR expression analysis in various cancers were performed by using a tissue microarray (by Provitro). In the same manner as described above, as a result of tissue staining, the analyzed tissues are classified into no expression, low expression, and high expression and indicated in the graph. The CHRNB2 expression analysis and the NPTXR expression analysis in colons were performed. The CHRNB2 expression was observed in approximately 70% of colorectal cancer, and the NPTXR expression was observed in approximately 50% of colorectal cancer (
(154) The CHRNB2 expression analysis and the NPTXR expression analysis in breast cancer were performed (
(155) According to the result of the tissue array described above, the CHRNB2 expression and the NPTXR expression are low in the normal tissue and are observed not only in the stomach cancer but also in various types of cancers such as breast cancer, lung cancer, pancreatic cancer, esophageal cancer, and the like. It was therefore implied that treatment can also be performed for these cancers by an inhibitor that inhibits CHRNB2 expression or NPTXR expression or an antibody medicine that binds to CHRNB2 or NPTXR.
INDUSTRIAL APPLICABILITY
(156) A high CHRNB2 expression group and a high NPTXR expression group were found from case groups in which S-1 post-operative supplemental therapy regarded as standard therapy was administered. Therefore, these two molecules are the molecules to be a key to overcome the situation that was unable to be controlled by the existing therapy. The medicine that neutralizes or inhibits expression of CHRNB2 or NPTXR is totally different in the target from the existing molecular target therapeutic drug mainly associated with growth factor receptors. Therefore, the medicine becomes a completely novel therapeutic drug. Further, such a medicine may be the medicine that has the effect on a tumor with high CHRNB2 or NPTXR expression without limited to stomach cancer.