Bacillus subtilis efficiently-induced expression system based on artificial series promoter

12098373 ยท 2024-09-24

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure discloses a Bacillus subtilis efficiently-induced expression system based on an artificial series promoter, and belongs to the technical field of gene engineering. According to the present disclosure, an efficient artificial series constitutive promoter is used, and by compositely designing the promoter and elements (a repressor and a binding site thereof) relevant to an operon, the activity of the constitutive promoter is regulated and controlled by an inducer to finally construct the B. subtilis efficiently-induced expression system induced by the inducer. The result indicates that compared with a P.sub.43 strongly constitutive promoter, the activity of the artificial series promoter in the system is about 15 times higher. The activity of the promoter can be accurately controlled by adding different concentrations of inducers. Therefore, the efficient expression system is simple in structure, high in activity and strict in regulating and controlling and has wide application prospects in heterologous protein efficient expression and synthetic biology research.

Claims

1. A method, comprising constructing a recombinant plasmid as a regulating and controlling element in an expression host of Bacillus subtilis (B. subtilis), wherein the recombinant plasmid comprises: (1) a vector, (2) an artificial series promoter, (3) a gene for coding a repressor, and (4) a repressor-binding DNA fragment located at downstream of a transcriptional start site of the artificial series promoter and capable of being bound to the repressor, and the artificial series promoter comprises P.sub.AWH-D30-106, P.sub.AH-D75-106 or P.sub.AH-D75-106 with nucleotide sequences that are set forth as SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively; wherein the constructing the recombinant plasmid comprises cloning the artificial series promoter, the gene for coding a repressor, and the repressor-binding DNA fragment into the vector that has a target gene of interest, and obtaining the recombinant plasmid; wherein the method further comprises transforming the recombinant plasmid into a culture of B. subtilis, growing the culture under a predetermined condition to obtain recombinant clones and inducing expression of the target gene and producing a target protein by growing the recombinant clones under a predetermined inducing condition, wherein adding different amounts of an inducer result in different levels of induced expression of the target gene.

2. The method according to claim 1, wherein the repressor is LacI, XylR, AraC or TetR.

3. The method according to claim 2, wherein when the repressor is LacI, the growing the recombinant clones under a predetermined inducing condition further comprises adding IPTG as the inducer and inducing the expression of the target gene.

4. The method according to claim 2, wherein when the repressor is XylR, and the growing the recombinant clones under a predetermined inducing condition further comprises adding xylose and inducing the expression of the target gene by xylose.

5. The method according to claim 2, wherein when the repressor is AraC, the growing the recombinant clones under a predetermined inducing condition further comprises adding arabinose as the inducer and inducing the expression of the target gene by arabinose.

6. The method according to claim 2, wherein when the repressor is TetR, the growing the recombinant clones under a predetermined inducing condition further comprises adding tetracycline as the inducer and inducing the expression of the target gene by tetracycline.

7. The method according to claim 1, wherein the vector is pHT-01.

8. The method according to claim 1, wherein the B. subtilis is B. subtilis 168, B. subtilis W1B400, B. subtilis WB600 or B. subtilis W1B800.

9. A recombinant DNA plasmid for regulating and controlling gene expression, comprising: (1) a vector, (2) an artificial series promoter, (3) a gene for coding a repressor, and (4) a DNA fragment located at downstream of a transcriptional start site of the promoter and capable of being bound to the repressor, wherein the artificial series promoter comprises P.sub.AWH-D30-106, P.sub.AH-D75-106 or P.sub.AH-D75-106 with nucleotide sequences that are set forth as SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively; wherein an expression host is Bacillus subtilis(B. subtilis).

10. The recombinant DNA plasmid of claim 9, wherein the vector comprises a target gene that is capable of expressing a target protein.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1: activity comparison of P.sub.AWH-D30-106, P.sub.AH-D75-106 and P.sub.WAH-D75-106 with a P.sub.43 promoter.

(2) FIG. 2A: IPTG induced system principle;

(3) FIG. 2B: IPTG induced system characterization;

(4) FIG. 2C: verification of sfGFP expression by SDS-PAGE.

(5) FIG. 3A: xylose induced system principle;

(6) FIG. 3B: xylose induced system characterization;

(7) FIG. 3C: verification of sfGFP expression by SDS-PAGE.

DETAILED DESCRIPTION

(8) 1. A construction method of a plasmid: A primer including a promoter sequence is designed, and PrimeSTAR MAX DNA polymerase (purchased from Takara with an article number of R045Q) is used for full plasmid PCR by taking a pHT01 plasmid as a skeleton template. PCR procedures are: pre-denaturation at 98? C. for 1 min, circulation including denaturation at 98? C. for 30 s, annealing at 50? C. for 30 s, and extending at 72? C. for 1 min for a total of 30 times, and final extending at 72? C. for 10 min. Then, the plasmid template is digested and removed with a restriction enzyme DpnI to purify a PCR product. Fragments needing to be cloned are amplified through the same method. Then, the plurality of fragments are assembled through an Infusion reassembling method to be transformed into E. coli JM109 competent cells.

(9) 2. A detection method of an sfGFP fluorescence intensity: A to-be-detected sample is centrifuged at 12000?g for 2 min, and bacteria are collected, washed with PBS 3 times, and then diluted with PBS to a certain concentration to obtain a bacterium suspension. 200 ?L of the bacterium suspension is taken to a 96-well ELISA plate, and the 96-well ELISA plate is placed into a fluorescence microplate reader for fluorescence detection. Fluorescence is detected with excitation light of 485 nm and absorbed light of 528 nm.

(10) 3. A medium: LB medium (L.sup.?1): 10 g of tryptone, 10 g of NaCl, 5 g of a yeast extract, pH 7.0, and 20 g of agar powder added when a solid medium is prepared.

(11) 4. A transformation method of B. subtilis 168: Single-colony B. subtilis 168 is picked to be inoculated into a 2 mL SPI medium and subjected to shaking culture at 37? C. for 12 h-14 h. 100 ?L of a culture is taken to be inoculated into a 5 mL SPI medium and subjected to shaking culture at 37? C. for 4-5 h till OD.sub.600 is about 1.0, and at this time, 200 ?L of a bacterium solution is pipetted to be transferred into a 2 mL SPII medium and subjected to shaking incubation at 37? C. and 100 r.Math.min.sup.?1 for 1.5 h. 20 ?L of a 100?EGTA (ethylene glycol-bis(?-aminoethyl ether)-N,N,N,N-tetraacetic acid) solution is added into a tube to be cultured in a shaking table at 37? C. and 100 r.Math.min.sup.?1 for 10 min, and then each centrifuge tube of 1.5 mL is filled with 500 ?L of a mixture. A proper quantity of plasmids verified to be correct by sequencing are added into the tubes, and subjected to blowing-suction uniform mixing to be placed into the shaking table at 37? C. and 100 r.Math.min.sup.?1 for 2 h. Culture is completed, and about 200 ?L of a bacterium solution is sucked to be uniformly smeared on a corresponding selective plate to be cultured at 37? C. for 12 h-14 h.

(12) 5. SDS-PAGE detection: 200 ?L of a bacterium solution is taken to be centrifuged at 12000?g for 2 min, and bacteria are collected. The bacteria are resuspended with 200 ?L of a 20 mM Tris-HCl (pH8.0) buffer solution containing lysozyme at a concentration of 20 ?g/mL, and incubated at 37? C. for 30 min to lyse cell walls. Then, 50 ?L of 10?Loading Buffer is added, cooked with boiling water for 10 min and then centrifuged at 12000?g for 5 min. 30 ?L of a supernatant sample is taken for electrophoresis detection, dyed with Coomassie brilliant blue R250 and destained with a destaining solution, and then an electrophoresis result is analyzed.

Example 1: Activity Identification of Artificial Series Promoters

(13) P.sub.AWH-D30-106, P.sub.AH-D75-106 and P.sub.WAH-D75-106 promoters are all artificially constructed core area series hybrid promoters.

(14) Sequences of the P.sub.AWH-D30-106, P.sub.AH-D75-106 and P.sub.AH-D75-106 promoters are respectively shown as SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

(15) The promoter P.sub.AWH-D30-106 shown as SEQ ID NO:1 is cloned onto a pHT01 vector through primers in Table 1 with an sfGFP (Genbank ID: AVR55189.1) expression cassette to substitute a P.sub.spac promoter sequence on an original vector. The expression vector is transformed into B. subtilis 168, recombinant bacteria are cultured for 20 h, and the expression level of sfGFP is detected.

(16) In the same way, the promoter P.sub.AH-D75-106 shown as SEQ ID NO:2 and the promoter P.sub.WAH-D75-106 shown as SEQ ID NO:3 are respectively adopted to be cloned onto the pHT01 vector with the sfGFP expression cassette to substitute P.sub.spac promoter sequences on the original vector. The vector is transformed into the B. subtilis 168 through the same method, recombinant bacteria are cultured for 24 h, and the expression level of sfGFP of recombinant bacterium culture solutions of recombinant plasmids containing P.sub.AH-D75-106 and P.sub.WAH-D75-106 is detected.

(17) By comparing with the situation that a common strongly constitutive promoter P.sub.43 expresses sfGFP, the result shows that the expression levels of the P.sub.AWH-D30-106, P.sub.AH-D75-106 and P.sub.WAH-D75-106 promoters for sfGFP are much higher than the expression level of the P.sub.43 promoter, and reach about 14 times the expression level of P.sub.43 (FIG. 1 and Table 2). It shows that the P.sub.AWH-D30-106, P.sub.AH-D75-106 and P.sub.WAH-D75-106 promoters are strongly constitutive promoters with very high activity.

(18) TABLE-US-00001 TABLE1 Primersforconstructingexpressionvector Sequencetable Primer Sequence(5-3).sup.a number PpHT- CTAACGGAAAAGGGATTTTTGAGTGATCTTCTCA SEQIDNO:6 AWH-i1 AAAAATAC PpHT- CCTCGTATGTTTCAAAGAGTGCACCATATGCGG SEQIDNO:7 AWH-i2 PpHT- CATATGGTGCACTCTTTGAAACATACGAGGCTAA SEQIDNO:8 AWH-v1 TATCGG PpHT- AAGATCACTCAAAAATCCCTTTTCCGTTAGCTTTT SEQIDNO:9 AWH-v2 TC

(19) TABLE-US-00002 TABLE 2 Activity of artificial series promoters Fluorescence intensity Promoter (a.u./OD.sub.600) P.sub.43 473 P.sub.AWH-D30-106 6635 P.sub.AH-D75-106 6782 P.sub.WAH-D75-106 6910

Example 2: Construction of an IPTG Induced Expression System

(20) A sequence of a binding site of lacI is GGAATTGTGAGCGGATAACAATTCC (SEQ ID NO:4), which is designed on primers P.sub.AWH-lacO-1 and P.sub.AWH-lacO-2 in Table 3. The sequence of the Lac protein binding site is cloned to the downstream of a transcriptional start site of a promoter P.sub.AWH-D30-106 through a full plasmid PCR method. Meanwhile, a repressor protein Lac is expressed through an lacI module on a pHT01 vector skeleton. The IPTG induced expression system (FIG. 2) is constructed.

(21) sfGFP serves as a target protein to characterize the magnitude of an expression quantity to construct a plasmid pHT-AWH-lac-sfGFP. The recombinant plasmid pHT-AWH-lac-sfGFP is transformed into B. subtilis 168. Recombinant bacteria are cultured in an LB medium at 37? C. and 200 rpm. After 24 h, the expression level of sfGFP is detected.

(22) In the absence of an IPTG inducer, the repressor protein Lac can be effectively bound to the downstream of a transcriptional start site of a promoter to prevent transcription of downstream genes by RNA polymerase, so that expression of the downstream genes is inhibited. When IPTG is added, the activity of the promoter is released. Within the range of not more than 1 mM, the higher the concentration of the added IPTG is, the stronger the activity of the promoter is. Therefore, expression intensities of the downstream genes with different intensities can be obtained by regulating the usage amount of the IPTG (FIG. 2 and Table 4). SDS-PAGE detection also proves that sfGFP expression with different intensities is obtained through addition of inducers IPTG of different concentrations (FIG. 2).

(23) TABLE-US-00003 TABLE3 PrimersforconstructingIPTGinducedexpressionvector Sequencetable Primer Sequence(5-3).sup.a number PAWH-lacO- GGAATTGTGAGCGGATAACAATTCCATGC SEQIDNO:10 1 TTTTATTCGAACATCATATTTAAAG PAWH-lacO- GGAATTGTTATCCGCTCACAATTCCTAGT SEQIDNO:11 2 GTATCAATTCCACGATTTTTTC

(24) TABLE-US-00004 TABLE 4 Expression situations of sfGFP induced by IPTG of different concentrations Fluorescence intensity Condition (a.u./OD.sub.600) pHT-01 179 pHT-AWH 6635 (uncombined operon) 0 mM IPTG 516 0.01 mM IPTG 929 0.05 mM IPTG 1993 0.1 mM IPTG 2665 0.5 mM IPTG 4132 1 mM IPTG 4163

Example 3: Construction of a Xylose Induced Expression System

(25) A binding site of a repressor protein XylR is cloned to the downstream of a transcriptional start site of a promoter P.sub.AWH-D30-106 through primers in Table 5. Meanwhile, an lacI gene on a pHT01 vector skeleton is substituted with an xylR gene. An XylR expression module and the xylose induced expression system are constructed. Specific steps are as follows:

(26) The plasmid pHT-AWH-lac-sfGFP constructed in Example 2 is taken as a template, a vector skeleton is amplified through the primer PAWH-xylR-v1/PAWH-xylR-v2 (Table 5), the xylR gene is amplified through the primer PAWH-xylR-i1/PAWH-xylR-i2, two amplified fragments are recombined, and a plasmid with xylR substituting lacI is obtained; then, through the primer PAWH-xylO-1/PAWH-xylO-2, a binding site of lacI is substituted with the binding site AGTTAGTTTATTGGATAAACAAACTAACT (SEQ ID NO:5) of xylR through a full plasmid PCR method; and finally, the plasmid pHT-AWH-xyl-sfGFP is constructed.

(27) The recombinant plasmid is transformed into B. subtilis 168. Recombinant bacteria are cultured in an LB medium at 37? C. and 200 rpm. After 24 h, the expression level of sfGFP is detected.

(28) In the absence of an inducer xylose, a repressor protein xylR can be effectively bound to the downstream of a transcriptional start site of a promoter to prevent transcription of the promoter by RNA polymerase, so that expression of downstream genes is inhibited (FIG. 3).

(29) When xylose of different concentrations is added, the activity of the promoter is released gradually, and therefore, expression intensities of the downstream genes with different intensities can be obtained by regulating the concentration of xylose. With the gradual increase of the concentration of xylose, a fluorescence signal generated through sfGFP expression is enhanced accordingly. When the concentration of xylose exceeds 1% (W/V), the expression level of sfGFP is even higher than a control pHT-AWH (FIG. 3 and Table 6) of constitutive expression sfGFP. Further, through SDS-PAGE detection, it is proven that sfGFP expression with different intensities is obtained through addition of inducers xylose of different concentrations (FIG. 3).

(30) TABLE-US-00005 TABLE5 Primersforconstructingxyloseinducedexpressionvector Sequencetable Primer Sequence(5-3).sup.a number PAWH-xylO-1 AGTTAGTTTATTGGATAAACAAACTAACTATGCTTT SEQIDNO:12 TATTCGAACATCATATTTAAAG PAWH-xylO-2 AGTTAGTTTGTTTATCCAATAAACTAACTTAGTGTA SEQIDNO:13 TCAATTCCACGATTTTTTC PAWH-xylR-i1 TTAATTGCGTTGCGCCTAACTTATAGGGGTAACAC SEQIDNO:14 TTAAAAAAG PAWH-xylR-i2 AGGGAGACGATTTTGATGGTTATTATTCAAATTGC SEQIDNO:15 AGATC PAWH-xylR-v1 TTGAATAATAACCATCAAAATCGTCTCCCTCC SEQIDNO:16 PAWH-xylR-v2 ACCCCTATAAGTTAGGCGCAACGCAATTAATG SEQIDNO:17

(31) TABLE-US-00006 TABLE 6 Expression situations of sfGFP under different concentrations of xylose Fluorescence intensity Condition (a.u./OD.sub.600) pHT-01 179 pHT-AWH 6635 (uncombined operon) 0% xylose 393 0.01% xylose 2263 0.05% xylose 3808 0.1% xylose 4322 0.5% xylose 5480 1% xylose 7326 2% xylose 9556

Example 4: Expression of a Target Gene by a Xylose Induced Expression System

(32) The same strategies as Examples 1-3 are adopted, and the difference is that sfGFP is substituted with other target genes, such as an endogenous gene or an exogenous gene participating in microbial metabolism, to construct a recombinant microorganism containing the xylose induced expression system. The constructed recombinant microorganism is cultured under a suitable condition and induced by inducers xylose of different concentrations. By detecting the gene expression level, it is found that target gene expression results at different intensities can be obtained through addition of the inducers xylose of different concentrations.

(33) Although the present disclosure has been disclosed as above as exemplary examples, it is not intended to limit the present disclosure. Any of those skilled in the art may make various alterations and modifications without departing from the spirit and scope of the present disclosure. Therefore, the protection scope of the present disclosure shall be as defined in the claims.