A GENETICALLY ENGINEERED BACTERIUM AND ITS APPLICATION IN THE PREPARATION OF SIALYLLACTOSE

20240309416 ยท 2024-09-19

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention discloses a genetically engineered bacterium and its application in the preparation of sialyllactose. The genetically engineered bacterium has an N-acetylneuraminic acid biosynthesis pathway, includes multiple copies of a gene neuB for encoding sialic acid synthase, and the gene neuB is initiated for expression by a strong promoter. Using the genetically engineered bacteria of the invention to produce sialyllactose has the advantages of high yield and low overall cost.

Claims

1. A genetically engineered bacterium, wherein the genetically engineered bacterium contains multiple copies of a gene neuB encoding a sialic acid synthase, and the gene neuB is initiated for expression by a Tet promoter; wherein the genetically engineered bacterium further comprises a gene neuB encoding sialic acid synthase, a gene slr1975 encoding N-acetylglucosamine 2-epimerase, a gene YqaB encoding N-acetylglucosamine-6-phosphate phosphatase, a gene Gna1 encoding glucosamine-6-phosphate acetyltransferase, a gene glmS encoding L-glutamine-D-fructose-6-phosphate transaminase, and a gene ppsA encoding phosphoenolpyruvate synthase; the gene neuB, the gene slr1975, the gene YqaB, the gene Gna1, the gene glmS and the gene ppsA are linked in tandem in a plasmid vector 1; the multiple copies are achieved by means of insertion of an exogenous plasmid; the genetically engineered bacterium further comprises a gene encoding N-acylneuraminic acid cytidylyltransferase and a gene encoding a sialyltransferase, the sialyltransferase is ?-2,6-sialyltransferase or ?-2,3-sialyltransferase.

2. The genetically engineered bacterium of claim 1, wherein an N-acetylneuraminic acid catabolic pathway in the genetically engineered bacterium is disabled.

3. (canceled)

4. The genetically engineered bacterium of claim 1, wherein, the genes in the plasmid vector 1 meet one or more of the following conditions: the GenBank accession number of the gene neuB is AF305571; the GenBank accession number of the gene slr1975 is BAL35720; the gene YqaB is from the BL21 genome; the GenBank accession number of the gene Gna1 is NP_116637; the nucleic acid sequence of the gene glmS is set forth in SEQ ID NO: 66; the gene ppsA is from the BL21 genome.

5. The genetically engineered bacterium of claim 1, wherein the gene encoding N-acylneuraminic acid cytidylyltransferase and the gene encoding sialyltransferase are linked in tandem in a plasmid vector 2.

6. The genetically engineered bacterium of claim 1, wherein the starting bacterium is Escherichia coli BL21 (DE3).

7. (canceled)

8. A method for producing sialyllactose by fermentation, comprising using the genetically engineered bacterium of claim 1, adding lactose into a fermentation medium for fermentation, and extracting the sialyllactose from the fermentation broth; and optionally, obtaining 3-sialyllactose when the genetically engineered bacterium comprises a ?-2,3-sialyltransferase gene; obtaining 6-sialyllactose when the genetically engineered bacterium comprises ?-2,6-sialyltransferase gene.

9. The method of claim 8, wherein the fermentation medium is a TB medium; the TB medium comprises 12 g/L trypsin, 24 g/L yeast extract, 4 mL/L glycerol, 2.31 g/L KH.sub.2PO.sub.4 and 12.54 g/L K.sub.2HPO.sub.4.

10. The method of claim 8, comprising inducing culture with IPTG when cultured to OD value of 0.6 to 0.8; and/or, supplementing 2 g/L MgSO.sub.4.Math.7H.sub.2O, 20 g/L glycerol, 1 mL/L trace element stock solution and 5 g/L lactose after the induction culture; the trace element stock solution preferably comprises 54.4 g/L ferric ammonium citrate, 9.8 g/L MnCl.sub.2.Math.4H.sub.2O, 1.6 g/L CoCl.sub.2.Math.6H.sub.2O, 1 g/L CuCl.sub.2.Math.2H.sub.2O, 1.9 g/LH.sub.3BO.sub.3, 9 g/L ZnSO.sub.4.Math.7H.sub.2O, 1.1 g/L Na.sub.2MoO.sub.4.Math.2H.sub.2O, 1.5 g/L Na.sub.2SeO3 and 1.5 g/L NiSO.sub.4.Math.6H.sub.2O.

11. The method of claim 8, wherein the fermentation culture condition is culture with shaking at 250 rpm at 30? C.

12. The method of claim 2, wherein all or part of the genes in the N-acetylneuraminic acid catabolic pathway in the genetically engineered bacterium are knocked out; preferably one or more of a gene nanK encoding N-acetylmannosamine kinase, a gene nanE encoding N-acetylmannosamine-6-phosphate epimerase, and a gene nanA encoding N-acetylneuraminic acid aldolase are knocked out; and/or, a gene LacZ encoding a lactose operon beta-galactosidase in the genetically engineered bacterium is knocked out.

13. The method of claim 4, wherein the plasmid vector 1 is pACYCDuet.

14. The method of claim 5, wherein the N-acylneuraminic acid cytidylyltransferase has the NCBI accession number WP_003512903.1, or comprises the nucleic acid sequence set forth in SEQ ID NO: 61.

15. The method of claim 5, wherein the ?-2,6-sialyltransferase is an enzyme with NCBI accession number BAF91416, or comprises the nucleic acid sequence set forth in SEQ ID NO: 62; the ?-2,3-sialyltransferase is an enzyme with NCBI accession number AJC62560.1, or comprises the nucleic acid sequence set forth in SEQ ID NO: 63.

16. The method of claim 5, wherein the plasmid vector 2 is pET28a.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0042] FIG. 1 shows the mapping of lacZ-knockout validation.

[0043] FIG. 2 shows the mapping of pTargetF plasmid.

[0044] FIG. 3 shows the mapping of the expression plasmid SL006.

[0045] FIG. 4 shows the mapping of pET28a-neuB plasmid.

[0046] FIG. 5 shows the mapping of pTac-neuB plasmid.

[0047] FIG. 6 shows the mapping of pTet-neuB plasmid.

[0048] FIG. 7 shows the mapping of SL023 plasmid.

[0049] FIG. 8 shows the mapping of SL023-Tet plasmid.

[0050] FIG. 9 shows the mapping of SL023-Tac plasmid.

[0051] FIG. 10 shows the HPLC detection profile of Neu5Ac in fermentation broth when the expression of neuB was regulated by the Tet promoter.

[0052] FIG. 11 shows the detection profile of 6-SL standard, with the peak time of 17.818 min.

[0053] FIG. 12 shows the HPLC detection profile of 6-SL in fermentation broth when the expression of neuB was regulated by the Tet promoter.

[0054] FIG. 13 shows the SL037 plasmid map.

[0055] FIG. 14 shows the detection profile of 3-SL standard, with the peak time of 15.049 min.

[0056] FIG. 15 shows the HPLC detection profile of 3-SL in fermentation broth when the expression of neuB was regulated by the Tet promoter.

DETAILED DESCRIPTION

[0057] The present invention is further illustrated by the Examples below, but the present invention is not limited to the scope of the described Examples.

[0058] In order to further illustrate the technical means adopted in the present invention and its effects, they are described in detail in combination with the figures and the preferred embodiments of the present invention. The experimental methods in which the specific conditions are not indicated in the following examples are selected according to conventional methods and conditions, or according to the product instruction.

[0059] BL21 (DE3) strain was purchased from Novagen Company, with the article number of 69450-M; Escherichia coli Trans 10 competent cell was purchased from Beijing TransGen Biotech Co., Ltd.; plasmid extraction kit and gel recovery kit were purchased from Sangon Biotech (Shanghai) Co., Ltd., and the SDS-PAGE kit was purchased from Shanghai Yamei Biomedical Technology Co., Ltd.

[0060] HPLC detection method of sialyllactose: Chromatographic column: Sepax HP-Amide (250?4.6 mm, 5 um). Buffer salts: 10 mM ammonium formate (pH 3.0). Mobile phase: acetonitrile:buffer salts=70:30. Flow rate: 1.0 mL/min; concentration: 1 mg/mL; detection wavelength: 210 nm; injection volume: 10 ?l; column temperature: 35? C.

Example 1 Construction of Basic Strain SLIS026

1.1 Construction of a Plasmid Comprising the Small Guide RNA (sgRNA) Required for the CRISPR/Cas9 Knockout System

[0061] The specific amplification of each fragment is performed with primers designed according to Table 3 (synthesized by Tsingke) using pTargetF plasmid (see FIG. 2 for the mapping) or BL21 genome as a template, and high-fidelity enzyme Primer Star Mix from Takala was used for PCR reaction. The reaction system was as follows:

TABLE-US-00001 TABLE 1 PCR amplification reaction system Volume added into the Reagent PCR reaction system cDNA 1 ?l Primer F 1 ?l Primer R 1 ?l PCR Mix 12.5 ?l ddH.sub.2O 9.5 ?l [0062] The PCR amplification procedure was as follows:

TABLE-US-00002 TABLE 2 PCR reaction program Cycle Temperature Time number 98? C. Pre-denaturation for 3 min 98? C. Denaturation for 15 s 55? C. Annealing for 15 72? C. extension at 0.1 kb/s {close oversize brace} 34 cycles 72? C. extension for 5 min 12? C. hold

[0063] 5 ?l of the amplified product was subjected to 1% agarose electrophoresis to detect the amplification result. The target fragments were recovered by gel cutting using a gel recovery kit. The target fragments were ligated and recombined using a multi-fragment recombinase from NEB, and the ligation and recombination products were transformed into E. coli competent cells Trans 10. Sterilized LB liquid medium was added, shook and cultured with shaking at 250 rpm at 37? C. for 1 h ;

[0064] (2) Spots were picked to the LB solid plate with spectinomycin added in advance, and the plate was inverted overnight at 37? C.;

[0065] (3) After white single colonies have grown, the white single colonies was picked into centrifuge tubes containing 2 mL of LB liquid medium (containing 50 ?g/mL spectinomycin), and were cultured with shaking at 180 rpm for 6 h ours at 37? C.;

[0066] (4) The bacterium liquid was subjected to PCR assay, and 500 ?l of the positive bacteriuml liquid, which was verified to be positive, was sent to Tsingke Company for sequencing, and the remaining bacterium liquid was stored in 20% glycerol.

[0067] (5) The strains which were verified by sequencing to be correct, were expanded, and plasmid extraction was carried out by using a plasmid extraction kit from Sangon. The sgRNA plasmids comprising the BL21 genome were obtained, and named as pTargetF-?LacZ, pTargetF-?nanKE, and pTargetF-?nanA, respectively.

TABLE-US-00003 TABLE3 PrimerinformationforconstructionoflacZ,nanAKE-knockoutsgRNA plasmid SEQ Product Primer ID Size Plasmid Gene Name Sequence NO: Template (bp) pTargetF- pTargetF GA001- tgccgaccgtctagagtcgacctgcagaag 1 pTargetF 2000bp ?LacZ back- P1-F4 cttag bone1 GA001- aacTGGCGTTACCCAACTTA 2 P1-R4 ATCactagtattatacctaggactg PAM1 GA001- tagtGATTAAGTTGGGTAACG 3 pTargetF 150bp P1-F1 CCAgttttagagctagaaatagcaag GA001- gttccggaattcaaaaaaagcaccgactcg 4 P1-R1 gtgcc LF GA001- gctttttttgaattccggaacgggaaggcga 5 BL21 560bp LF ctggagtg GA001- ggtgcgggcctcgacggccagtgaatccgt 6 genome P1-LR aatcatg RF GA001- tcgactctagacggtcggcaaagaccagac 7 BL21 1800bp P1-RR cgttc GA001- ctggccgtcgaggcccgcaccgategccct 8 genome P1-RF tc pTargetF- Donor- pT14-F2 gctttttttgaattcgggaattccgcagacac 9 BL21 1000bp ?nanKE LF catctg pT-G08- ccaaaagttaatgatgggtgaagtacagtca 10 genome R1 ttac Donor- pT-G08- gtacttcacccatcattaacttttggttttgac 11 BL21 1000bp RF F2 pT-G08- gtcgactctagagcgtgcgctgttctttatcg 12 genome R2 g pTargetF pT-G08- cagcgcacgctctagagtcgacctgcagaa 13 pTargetF 1000bp back- F3 g bone pT-G08- acCACGCGTGGCTTGCAGAT 14 R3 TTactagtattatacctag PAM pT-G08- agtAAATCTGCAAGCCACGC 15 pTargetF 150bp F1 GTGgttttagagctagaaata pT4-1R1 ctaaaacCGATCGTCGTGAACT 16 TCCTAactagtattatacctagg pTargetF- Donor- pT15-F2 gctttttttgaattcgcagcgcctgaatcggc 17 BL21 1000bp ?nanA LF catgag genome pT15- gaggtatttgttgtttcccctcgctcgccccta 18 1000bp 1R2 cc Donor- pT15- gcgaggggaaacaacaaatacctctgaagt 19 BL21 RF 1F3 gatgcttg genome pT15-R3 caggtcgactctagaccgcccgctggcgc 20 gtaaaaaac PAM1 pT15-P1- actagtATCGACGGTTTATAC 21 pTargetF 150bp F1 GTGGGgttttagagctagaaatag pT15-R1 gcgaattcaaaaaaagcaccgactcggtgc 22 cac pTargetF pT15-F4 gcgggcggtctagagtcgacctgcagaag 23 pTargetF 2000bp back- cttag bone pT15- aacCCCACGTATAAACCGTC 24 1R4 GATactagtattatacctagg

1.2 Gene Knockout of lacZ and nanAKE

1.2.1 BL21 Strain lacZ (GA001) Gene Knockout

[0068] (1) Preparation of BL21 competent cells: the strain BL21 stored at ?80? C. was streaked and cultured to obtain single colonies; the single colonies were picked up and inoculated in 5 mL of LB medium, and cultured with shaking at 200 rpm at 37? C. until the OD reaches about 0.5 (for about 3 h ), then the culture was ice-bathed for 30 min; the bacterial broth was transferred to a pre-cooled sterile centrifuge tube and centrifuged at 4000 rpm for 10 min at 4? C., then the supernatant was discarded, and the bacteria were collected; the bacteria were resuspended with pre-cooled sterile water and centrifuged at 4000 rpm for 10 min at 4? C., then the supernatant was discarded; the bacteria were resuspended with a solution containing 0.1M CaCl.sub.2 twice, and centrifuged at 4000 rpm for 10 min at 4? C., then the supernatant was discarded; finally, the cells were resuspended with appropriate amount of 15% glycerol in 0.1M CaCl.sub.2 solution, divided into 1.5 mL centrifuge tubes with 100 ?l per tube, rapidly frozen in liquid nitrogen, and stored at ?80? C.

[0069] (2) 3 ?l pCas-sac plasmid was added to 100 ?L E.coli BL21 competent, placed on ice for 30 min, then heat-shocked at 42? C. for 45 s, and immediately placed on ice for 2-5 min; placed on a shaker at 30? C. and incubated for 45 min after adding 800 ?L LB, spread onto a plate (Km resistant, LB medium), inverted in an incubator at 30? C., and cultured overnight; the colony was picked out into LB medium (Kana resistant), and cultured for several hours followed by bacteria preservation (30% glycerol final concentration).

[0070] (3) The pCas-sac/BL21 transformants were picked and inoculated into LB sieve tubes (Kara-resistant), cultured at 30? C. until the OD reaches 0.2, and arabinose was added at a final concentration of 2 g/L for induction, and competent preparation was performed when the OD reaches 0.4, the preparation method was the same as operation (1);

[0071] (4) The correctly constructed pTargetF-?LacZ plasmid was transformed into pCas-sac/BL21 competent cells by heat shock method, spread onto LB plates (k+, spe+) after recovery, and cultured at 30? C. overnight;

[0072] (5) PCR validation was carried out on single colonies on the resistant plate. The primers for validation are shown in Table 4, and the mapping of sequencing validation is shown in FIG. 1. The strain with LacZ gene knockout was obtained by verification;

[0073] (6) The strains with LacZ gene knockout were selected and cultured with shaking, and induced by adding rhamnose at a final concentration of 10 mM for the loss treatment of the sgRNA plasmid pTargetF-?LacZ;

[0074] (7) The pTargetF-?LacZ plasmid was streaked to verify whether the loss occurred (see Table 4 for primers), and the strain with sgRNA loss and LacZ gene knocked out was named as SLSI020.

1.2.2 Knockout of Neu5Ac Degradation Related Gene nanKAE Gene Based on SLIS020 Strain

[0075] (1) Competent preparation and knockout operation of SLIS020 were the same as 1.2.1. The pTargetF-?nanA plasmid was used to knock out the nanA gene, and the method was the same as 1.2.1, to obtain the strain with nanA gene knockout, which was named as SLIS024.

[0076] (2) Knockout of nanKE gene was performed on SLIS024 strain, using pTargetF-?nanE plasmid for knockout, the method was the same as 1.2.1, and the strain with nanKE gene knockout completed was named as SLIS026.

[0077] (3) The SLIS026 strain was subjected to loss of sgRNA plasmid, and the method was the same as 1.2.1.

[0078] (4) The SLIS026 strain was subjected to loss of pCas-SAC plasmid: the SLIS026 strain with sgRNA loss was inoculated on non-resistant LB plate, cultured at 42? C., and verified by PCR with pCas-SAC validation primers in Table 4 to ensure that the chassis strain SLIS026 without pCas-SAC plasmid was obtained.

TABLE-US-00004 TABLE4 PrimersforvalidationofLacZ,nanAKEandothergeneknockouts Knockout SEQID Product Strain gene PrimerName Sequence NO: Size(bp) SLIS020 lacZ Lacz-YZ1-F cgcgctgttagcgggcccattaagttctg 25 2000bp LAC-YZ2-R ggtcttcatccacgcgcgcgtacatcgg 26 after knockout SLIS024 NanA nanA-YZ-F1 catggtgatgtagcctggcgcaaagcc 27 2.2kbafter nanA-YZ-R atgggccttatgaacgcatttgattcgc 28 knockout SLIS026 NanKE nanE-YZ-F gctcgtgcaattccgcttttttctcgac 29 1.5kbafter nanE-YZ-R cggttatttcgataccgaccagcgtgcag 30 knockout sgRNA CX-targetF-F cagcgagtcagtgagcgag 31 2000bp plasmid CX-targetF-R gacattgcactccaccgct 32 pCas-SAC Kan-F gaaggagaaaactcaccgag 33 3300bp Pcr4-R1 cagctgcataaaattgcgattggcaaaa 34 ccatc

Example 2 Construction of Expression Plasmid Related to N-Acetylneuraminic Acid (Neu5Ac) Synthesis and Preparation of Neu5Ac

2.1 Construction of Expression Plasmid for Neu5Ac Synthesis

[0079] (1) The gene glmS* (GA010) is a mutant version of Escherichia coli L-glutamine-D-fructose-6-phosphate transaminase gene (Metab Eng., 2005 May; 7(3):201-14), and its nucleic acid sequence is set forth in SEQ ID NO: 66; Gna1 (GA009, GenBank:NP_116637) encodes the glucosamine-6-phosphate acetyltransferase from Saccharomyces cerevisiae; the gene slr1975 (GA006, GenBank: BAL35720) encodes Synechocystis sp. PCC6803 N-acetylglucosamine 2-epimerase; the gene neuB (GA005, GenBank:AF305571) encodes the sialic acid synthase from Campylobacter jejuni; the gene ppsA encodes the phosphoenolpyruvate synthase of Escherichia coli BL21 (DE3); the gene YqaB encodes the N-acetylglucosamine-6-phosphate phosphatase. The slr1975, Gnal, glmS, neuB, and promoter Tet, Tac gene sequences were synthesized and ligated into the puc57 vector by Sangon Biotech (Shanghai) Co., Ltd., and YqaB and ppsA were all from the BL21 genome.

[0080] (2) PCR amplification was performed according to the primers and templates listed in Table 5 to obtain the target fragments. The PCR reaction system and conditions are the same as 1.1 in Example 1.

[0081] (3) The amplified DNA fragments were recovered by gel cutting using a gel recovery kit, and positive single colonies were obtained by recombination, transformation, and plate screening using the multi-fragment recombination kit of NEB Company, and then the correct plasmids were obtained by picking up the colony, shaking bacteria, and verifying via sequencing by Tsingke Biotechnology Co., Ltd.

TABLE-US-00005 TABLE5 Primersrequiredfortheplasmidconstructionofexpressionplasmids SL006,pET28a-neuBandothers Primer SEQID Product Plasmid Gene Name PrimerSequence NO: Template Size SL006 neuB ACY-GA5- aataaggagatataatgaaagaaatcaa 35 GA005 1kb (FIG.3) F1 aatcc ACY-GA5-R ggtgagcgatcatggtatatctccttttag 36 gcgaaatcttcataag slr1975 ACY-GA6-F accatgatcgctcaccgtcgtcaggaac 37 GA006 1.1kb tgg ACY-GA6-R gctcgtacatggtatatctccttttaagag 38 accggcagttg YqaB ACY-GA16- gatataccatgtacgagcgttatgcagg 39 BL21 567bp F AVY-GA16- cgggtaagctcatggtatatctcctttcac 40 genome R agcaagcgaacatcc Gnal ACY-GA9-F taccatgagcttacccgatggattttatat 41 GA009 480bp aag ACY-GA9-R cgataccgcacatggtatatctccttctatt 42 ttctaatttgc glms ACY-GA10- taccatgtgcggtatcgttggtgctatcg 43 GA010 1.8kb F ACY-GA10- gccattgttggacatggtatatctcctttta 44 R ttccacggtcacggatt ppsA ACY-GA28- ccatgtccaacaatggctcgtcaccgct 45 BL21 2.8kb F ggtg ACY-GA28- ccgcaagcttttatttcttcagttcagcca 46 genome R gg Back- ACY-F gaaataaaagcttgcggccgcataatgc 47 pACYC 4kb bone PACY-R gatttctttcattatatctccttattaaagtta 48 Duet aac pET28a- Back- 28a-G5F2 gatttcgcctaaGCTTGCGGCC 49 pET28a 5kb neuB bone GCACTCGAGCAC (FIG.4) 28a-G5R2 gatttctttcatATGGCTGCCGC 50 GCGGCACCAGG neuB 28a-G5F1 ctggattttgatttctttcatATGGCT 51 GA005 1kb GCCGC 28a-G5R1 CCGCAAGCttaggcgaaatcttca 52 taagacagctg pTac- Tac Tac-F1 GAAATttgacaattaatcatcggctc 53 Puc-Tac 136bp neuB promoter gtataatgtg (FIG.5) Tac-R1 GGCTGCTGCCCATgtatatct 54 ccttcttaaagttaaac neuB Tac-F2 gaaggagatatacATGGGCAGC 55 pET28a- 6.29kb AGCCATCATCATC neuB Tac-R2 gatgattaattgtcaaATTTCGCG 56 GGATCGAGATCTC pTet- Tet Tet-F1 GATCCCGCGAAATgttgaca 57 Puc-Tet 150bp neuB promoter ctctatcattgatag (FIG.6) Tet-R1 tgatttctttcatttgtatatctccttcttaaa 58 g neuB Tet-F2 gatatacaaatgaaagaaatcaaaatcc 59 pET28a- 6.29kb agaac neuB Tet-R2 gatagagtgtcaacATTTCGCGG 60 GATCGAGATCTCG

[0082] (4) Promoter sequence:

[0083] The sequence of the Tac promoter is set forth in SEQ ID NO: 64.

[0084] The sequence of the Tet promoter is set forth in SEQ ID NO: 65.

2.2 Preparation of N-Acetylneuraminic Acid (Neu5Ac)

2.2.1 Construction of N-Acetylneuraminic Acid (Neu5Ac)-Producing E. coli Strains

[0085] Competent cells were prepared on the basis of the gene knockout strain SLIS026, and the specific method was the same as 1.2.1. Then plasmid SL006 were transformed, alone, and together with pET28a-neuB, pTac-neuB, and pTet-neuB, into SLIS026 competent cells, and the correct clones were screened on LB plates (kanamycin 50 ?g/mL, chloramphenicol 25 ?g/mL). Four strains E. coli SLIS026-SA (SL006, SL006+pET28a-neuB, SL006+pTet-neuB, SL006+pTac-neuB) carrying Neu5Ac synthesis pathway were obtained correspondingly after validation by PCR.

2.2.2 Production of N-Acetylneuraminic Acid (Neu5Ac) by SLIS026-Neu5Ac Strain

[0086] (1) TB medium: 12 g of trypsin, 24 g of yeast extract, 4 mL of glycerol, 2.31 g KH.sub.2PO.sub.4, 12.54 g K.sub.2HPO.sub.4, supplemented to 1000 mL with deionized water, and finally dispensed into conical flasks at 100 mL/bottle and wrapped well, sterilized at 121? C. for 30 min, and stored at room temperature.

[0087] (2) LB medium: 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, and 15 g of agar were weighed respectively, and were dissolved with distilled water and mixed well, and were supplemented to 1 L after the pH was adjusted to 7.2 with 1 mol/L NaOH, and finally divided into conical flasks and wrapped well, sterilized at 121? C. for 30 min, and stored at 4? C. The LB liquid was withour agar.

[0088] (3) 200 g/L MgSO.sub.4.Math.7H.sub.2O stock solution: 10 g MgSO4.Math.7H2O solution was weighed and dissolved into deionized water, supplemented to 5 mL after completely dissolved, then sterilized at 121? C. for 30 minutes, and stored at room temperature.

[0089] (4) Trace element stock solution: 54.4 g/L ferric ammonium citrate, 9.8 g/L MnCl.sub.2.Math.4H.sub.2O, 1.6 g/L CoCl.sub.2.Math.6H.sub.2O, 1 g/L CuCl.sub.2.Math.2H.sub.2O, 1.9 g/L H.sub.3BO.sub.3, 9 g/L ZnSO.sub.4.Math.7H.sub.2O, 1.1 g/L Na.sub.2MoO.sub.4.Math.2H.sub.2O, 1.5 g/L Na.sub.2SeO.sub.3, 1.5 g/L NiSO.sub.4.Math.6H.sub.2O. The trace element stock solution was prepared according to the above concentrations, sterilized at 121? C. for 30 min, and stored at 4? C. for future use.

[0090] (5) 1000 g/L glycerol: 1000 g glycerol was weighed, supplemented to 1 L with deionized water, then sterilized at 121? C. for 30 minutes, and stored at room temperature.

[0091] (6) The strains were inoculated into 5 mL of LB medium (kanamycin 50 ?g/mL, chloramphenicol 25 ?g/mL), and cultured at 37? C. and 250 rpm for 4 h . Then the seed liquid was inoculated into fresh TB medium at a ratio of seed liquid: medium=1: 100, cultured at 37? C., 250 rpm to OD600=0.6-0.8, and IPTG was added to a final concentration of 0.1 mM and the medium was cultured under the condition of 25? C., 250 rpm for 15 h for the inducible expression of protein.

[0092] (7) After the inducible expression of protein, 1 mL of 200 g/L MgSO.sub.4.Math.7H.sub.2O (final concentration of 2 g/L), 1 mL of trace element stock solution (final concentration 0.1%), and 2 mL of 1000 g/L glycerol (final concentration of 20 g/L) were added to the shaking flask, and cultured at 30? C. and 250 rpm for 24 h, and then sampled to detect the content of Neu5Ac.

[0093] (8) Means of sample treatment: the fermented bacterial solution was sterilized at 121? C. for 20 min, then centrifuged (4? C., 4000 rpm for 15 min) to remove the precipitation and retain the supernatant, and supplemented to 100 ml with the sterilized TB medium for future use. 1 mL of the solution was sampled and passed through a 0.22 ?m filter membrane, and detected with ion-pair ion. The strains using the Tet promoter were detected to have the highest Neu5Ac yields, 2.9 g/L of Neu5Ac. FIG. 10 shows the Neu5Ac detection profile.

Example 3 Construction of 6-SL (6-Sialyllactose) Synthesis-Related Expression Plasmid and Preparation of 6-SL

3.1 Construction of 6-SL Synthesis Plasmid

[0094] (1) Total gene synthesis was performed on the gene SEQ ID NO: 61 of N-acylneuraminate cytidylyltransferase CSS (accession number WP_003512903.1) (GA031); the gene SEQ ID NO: 62 of ?-2,6-2,6-sialyltransferase (6ST, GA025) with accession number BAF91416.1, and both gene sequences were synthesized and ligated into the pET28a vector by Sangon Biotech (Shanghai) Co., Ltd.

[0095] (2) PCR amplification was performed according to the primers and templates listed in Table 6 to obtain the target fragments. The PCR reaction system and conditions were the same as 1.1 in Example 1.

[0096] (3) The amplified DNA fragments were recovered by gel cutting using a gel recovery kit, and positive single colonies were obtained by recombination, transformation, and plate screening using the multi-fragment recombination kit of NEB Company, and then the correct plasmids were obtained by picking up the colony, shaking bacteria, and verifying via sequencing by Tsingke Biotechnology Co., Ltd.

TABLE-US-00006 TABLE6 PrimersrequiredforconstructionofexpressionplasmidSL023 Primer SEQID Temp- Product Plasmid Gene Name PrimerSequence NO: late Size SL023 6ST SL23-F1 gatatacatatgaacgataatcaaaatacggtgg 67 GA025 1400bp (FIG.7) SL23-R1 CCATggtatatctccttttagcaccagaacagcac 68 atctttttc CSS SL23-F2 gtgctaaaaggagatataccATGGAAAAAC 69 GA031 687bp AGAACATCGCGG SL023- gtgcggccgcaagcttaAGATTCTTTGTG 70 R2 GTTCAGGATG F3 SL023- CAAAGAATCTtaagcttgcggccgcactcg 71 pET28a 5.2kb F3 agcacc SL23-R3 gattatcgttcatatgtatatctccttcttaaag 72 SL023- Tet Tet-F1 GATCCCGCGAAATgttgacactctatcatt 73 Puc- 150bp Tet promoter gatag Tet (FIG.8) SL023- tgattatcgttcatttgtatatctccttcttaaag 74 Tet-R1 Tet-F SL23- gatatacaaatgaacgataatcaaaatacggtgg 75 SL023 7.3kb Tet-F1 Tet-R2 gatagagtgtcaacATTTCGCGGGATCG 76 AGATCTCG SL023- Tac Tac-F1 cgcgaaatttgacaattaatcatcggctcgtataatgtg 77 Puc- 141bp Tac promoter SL023- tgattatcgttcatgtatatctccttcttaaag 78 tac (FIG.9) Tac-R1 Tac-F SL23- gagatatacatgaacgataatcaaaatacggtgg 79 SL023 7.3kb Tac-F1 Tac-R2 gatgattaattgtcaaatttcgcgggatcgagatctcg 80

3.2 Production of 6-SL Using Strain SLIS026

3.2.1 Construction of 6-SL E. coli Strains

[0097] Competent cells were prepared on the basis of the gene knockout strain SLIS026, and the specific method was the same as 1.2.1. Then the following plasmid combinations: SL006+pET28a-neuB+SL023, SL006+pET28a-neuB+SL023-Tet, SL006+pET28a-neuB+SL023-Tac, SL006+pTet-neuB+SL023, SL006+pTet-neuB+SL023-Tac, SL006+pTet-neuB+SL023-Tet, SL006+pTac-neuB+SL023, SL006+pTac-neuB+SL023-Tac, SL006+pTac-neuB+SL023-Tet were transformed into SLIS026 competent cells, respectively, and the correct clones were screened on LB plates (kanamycin 50 ?g/mL, chloramphenicol 25 ?g/mL, ampicillin 100 ?g/mL) to obtain a strain E. coli SLIS026-6SL carrying 6-SL synthesis pathway.

3.2.2 Production of 6-SL by SLIS026-6SL Strain

[0098] (1) TB medium: 12 g of trypsin, 24 g of yeast extract, 4 mL of glycerol, 2.31 g KH.sub.2PO.sub.4, 12.54 g K.sub.2HPO.sub.4, supplemented to 1000 mL with deionized water, and finally divided into conical flasks at 100 mL/bottle and wrapped well, sterilized at 121? C. for 30 min, and stored at room temperature.

[0099] (2) LB medium: 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, and 15 g of agar were weighed respectively, dissolved with distilled water and mixed well, and were supplemented to 1 L after the pH was adjusted to 7.2 with 1 mol/L NaOH, and finally divided into conical flasks and wrapped well, sterilized at 121? C. for 30 min, and stored at 4? C. The LB liquid was withour agar.

[0100] (3) 200 g/L MgSO.sub.4.Math.7H.sub.2O stock solution: 10 g MgSO4.Math.7H.sub.2O solution was weighed and added into deionized water, supplemented to 50 mL after completely dissolved, then sterilized at 121? C. for 30 minutes, and stored at room temperature.

[0101] (4) Trace element stock solution: 54.4 g/L ferric ammonium citrate, 9.8 g/L MnCl.sub.2.Math.4H.sub.2O, 1.6 g/L CoCl.sub.2.Math.6H.sub.2O, 1 g/L CuCl.sub.2.Math.2H.sub.2O, 1.9 g/L H.sub.3BO.sub.3, 9 g/L ZnSO.sub.4.Math.7H.sub.2O, 1.1 g/L N.sub.2MoO.sub.4.Math.2H.sub.2O, 1.5 g/L Na.sub.2SeO.sub.3, 1.5 g/L NiSO.sub.4.Math.6H.sub.2O. The trace element stock solution was prepared according to the above concentrations, sterilized at 121? C. for 30 min, and stored at 4? C. for future use.

[0102] (5) 1000 g/L glycerol: 1000 g glycerol was weighed, supplemented to 1 L with deionized water, then sterilized at 121? C. for 30 minutes, and stored at room temperature.

[0103] (6) 250 g/L lactose: 250 g of lactose was dissolved in deionized water (dissolved by heating), and supplemented to 1 L, then sterilized at 121? C. for 30 min, and stored at room temperature.

[0104] (7) The strains were inoculated into 5 mL of LB medium (kanamycin 50 ?g/mL, chloramphenicol 25 ?g/mL), and cultured at 37? C. and 250 rpm for 4 h . Then the seed liquid was inoculated into fresh TB medium at a ratio of seed liquid: medium=1: 100, cultured at 37? C., 250 rpm to OD600=0.6-0.8, and IPTG was added to a final concentration of 0.1 mM and the medium was cultured under the condition of 25? C., 250 rpm for 15 h for the inducible expression of protein.

[0105] (8) After the inducible expression of protein, 1 mL of 200 g/L MgSO.sub.4.Math.7H.sub.2O (final concentration of 2 g/L), 100 ?l of trace element stock solution (final concentration of 0.1%), 2 mL of 1000 g/L glycerol (final concentration of 20 g/L) and 2 mL of 250 g/L lactose (final concentration of 5 g/L) were added to the shaking flask, and cultured at 30? C. and 250 rpm for 24 h , and then sampled to detect the content of SL.

[0106] (9) Means of sample treatment: 2-3 mL of the fermentation broth was taken, and the cells were broken by repeated freezing and thawing, placed into boiling water and boiled for 20 minutes after broken, and then centrifuged (4? C., 12000 rpm for 5 minutes) to remove the precipitation and retain the supernatant, and passed through a 0.22 ?m filter membrane to detect the content of 6-SL. The content of 6-SL in each treatment at 24 h of fermentation is shown in Table 7, when the Tet promoter was used to regulate the expression of neuB, i.e., the combination of SL006+pTet-neuB+SL023, 6-SL content is the highest, which could reach 2.5 g/L. The SL detection results are shown in the accompanying drawings, FIG. 11 shows the detection profile of 6-SL standard, and FIG. 12 shows the detection profile of 6-SL fermentation broth.

TABLE-US-00007 TABLE 7 Detection results of 6-SL content 6-SL Content Colony (g/L) Host Treatment Number 24 h SLIS026 SL006 + pET28a ? neuB + SL023 A1 0.96 SL006 + pET28a ? neuB + SL023 ? Tet B1 0.82 SL006 + pET28a ? neuB + SL023 ? Tac C1 0.92 SL006 + pTet ? neuB + SL023 D1 2.51 SL006 + pTet ? neuB + SL023 ? Tac E1 1.23 SL006 + pTet ? neuB + SL023 ? Tet F1 1.42 SL006 + pTac ? neuB + SL023 G1 1.30 SL006 + pTac ? neuB + SL023 ? Tac H1 1.25 SL006 + pTac ? neuB + SL023 ? Tet I1 1.32

Example 4 Production of 3-SL Using SLIS026 Strain

4.1 Construction of Expression Plasmids Related to 3-SL Synthesis

[0107] (1) Total gene synthesis was performed on gene SEQ ID NO: 63 encoding ?-2,3-sialyltransferase (3ST, GA040) with accession number AJC62560.1, which was synthesized and ligated into the pET28a vector by Sangon Biotech (Shanghai) Co., Ltd.

[0108] (2) PCR amplification was performed according to the primers and templates listed in Table 8 to obtain the target fragments. The PCR reaction system and conditions were the same as 1.1 in Example 1.

[0109] (3) The amplified DNA fragments were recovered by gel cutting using a gel recovery kit, and positive single colonies were obtained by recombination, transformation, and plate screening using the multi-fragment recombination kit of NEB Company, and then the correct plasmids were obtained by picking up the colony, shaking bacteria, and verifying via sequencing by Tsingke Biotechnology Co., Ltd.

TABLE-US-00008 TABLE8 PrimersrequiredforconstructionofexpressionplasmidSL037 Primer SEQID Product Plasmid Gene Name PrimerSequence NO: Template Size SL037 3ST SL37-F1 tcgcctaaaaggagatataccATGGGCCT 81 pET28a- 1100bp (FIG.13) (GA040) GAAAAAAGCGTGCCT 3ST SL37-R1 TTTCCATggtatatctccttTTAGTTT 82 TTATCGTCGAAGGTCAGG F2 SL37-F2 aaggagatataccATGGAAAAACAG 83 SL023 7.2kb AACATCGCGGTTATCC SL37-R2 ggtatatctccttttaggcgaaatcttcataagaca 84 gctgc

4.2 Production of 3-SL During Fermentation

4.2.1 Construction of 3-SL E. coli Strains

[0110] Competent cells were prepared on the basis of the gene knockout strain SLIS026, the specific method was the same as 1.2.1, and then the plasmid combination SL006+pTet-neuB+SL037 was transformed into SLIS026 competent cells with reference to the plasmid combination with the best 6-SL fermentation result, and the correct clones were screened on LB plates (kanamycin 50 ?g/mL, chloramphenicol 25 ?g/mL, ampicillin 100 ?g/mL) to obtain a strain E. coli SLIS026-3SL carrying the 3-SL synthesis pathway.

4.2.2 Production of 3-SL by SLIS026-3SL Strain

[0111] (1) The type and preparation of the medium required during the experiment are the same as 3.2.

[0112] (2) The strains were inoculated into 5 mL of LB medium (kanamycin 50 ?g/mL, chloramphenicol 25 ?g/mL), and cultured at 37? C. and 250 rpm for 4 h . Then the seed liquid was inoculated into fresh TB medium at a ratio of seed liquid: medium=1: 100, cultured at 37? C., 250 rpm to OD600=0.6-0.8, and IPTG was added to a final concentration of 0.1 mM and the medium was cultured under the condition of 25? C., 250 rpm for 15 h for the inducible expression of protein.

[0113] (3) After the inducible expression of protein, 1 mL of 200 g/L MgSO.sub.4.Math.7H.sub.2O (final concentration of 2 g/L), 1 mL of trace element stock solution (final concentration of 0.1%), 2 mL of 1000 g/L glycerol (final concentration of 20 g/L) and 2 mL of 250 g/L lactose (final concentration of 5 g/L) were added to the shaking flask, and cultured at 30? C. and 250 rpm for 24 h , and then sampled to detect the content of SL.

[0114] (4) Means of sample treatment: Means of sample treatment were the same as 3.2. Quantitative detection of 3-SL was carried out, and the results showed that the content of 3-SL can reach 3 g/L at 24 h ours of fermentation. FIG. 14 shows the detection profile of 3-SL standard. FIG. 15 shows the detection profile of 3-SL fermentation broth.