PREPARATION METHOD FOR AND APPLICATION OF IMMOBILIZED CELLS FOR MANNOSE PRODUCTION

Abstract

A method for preparing immobilized cells for producing mannose, and a method using same for producing mannose, comprising: fermenting to separately obtain fermentation broths of Escherichia coli or Bacillus subtilis expressing a-glucan phosphorylase, phosphoglucomutase, glucose phosphoisomerase, mannose-6-phosphate isomerase and mannose-6-phosphate phosphatase, and mixing the fermentation broths to obtain a mixed fermentation broth.

Claims

1. A method for preparing immobilized cells for mannose production, characterized in that the method comprises the steps of: fermenting to obtain fermentation broths comprising an Escherichia coli or Bacillus subtilis expressing ?-glucan phosphorylase, phosphoglucomutase, phosphoglucose isomerase, mannose 6-phosphate isomerase, or mannose 6-phosphate phosphatase respectively, and mixing the above fermentation broths to obtain a fermentation mixture; adding an inorganic soil to the fermentation mixture, and stirring homogeneously; further adding a flocculant to the fermentation mixture to flocculate bacteria, and then adding a cross-linking agent for cross-linking; filtering under vacuum to obtain a filter cake, extruding the filter cake to granulate into a strip with a rotary granulator, and then breaking into particles having a uniform length with a spherical shot blasting machine; and subjecting the resulting particles to drying by boiling to obtain the immobilized cells for mannose production.

2. The method according to claim 1, characterized in that the method comprises the steps of: fermenting to obtain fermentation broths comprising an Escherichia coli or Bacillus subtilis expressing ?-glucan phosphorylase, phosphoglucomutase, phosphoglucose isomerase, mannose 6-phosphate isomerase, or mannose 6-phosphate phosphatase respectively, and mixing the above fermentation broths to obtain a fermentation mixture; adding 1-10% w/v of an inorganic soil to the fermentation mixture, and stirring homogeneously; further adding 0.1-2% w/v of a flocculant to the fermentation mixture to flocculate bacteria, then adding 0.05-3% v/v of a cross-linking agent, and cross-linking for 1-4 hours; filtering under vacuum to obtain a filter cake, extruding the filter cake to granulate into a strip with a rotary granulator, and then breaking into particles having a uniform length with a spherical shot blasting machine; and subjecting the resulting particles to drying by boiling to obtain the immobilized cells for mannose production, wherein the temperature at an air inlet for the drying by boiling is controlled at 60-90? C.

3. The method according to claim 1, characterized in that the ?-glucan phosphorylase, the phosphoglucomutase, the phosphoglucose isomerase, the mannose 6-phosphate isomerase, or the mannose 6-phosphate phosphatase is thermostable glucan phosphorylase, thermostable phosphoglucomutase, thermostable phosphoglucose isomerase, thermostable mannose 6-phosphate isomerase, or thermostable mannose 6-phosphate phosphatase respectively.

4. The method according to claim 3, characterized in that the thermostable refers to having an enzymatic activity at 40? C. or above.

5. The method according to claim 3, characterized in that the wet bacteria expressing the thermostable ?-glucan phosphorylase, the thermostable phosphoglucomutase, the thermostable phosphoglucose isomerase, the thermostable mannose 6-phosphate isomerase, and the thermostable mannose 6-phosphate phosphatase respectively are mixed in a ratio of (0.1-10):(0.1-10):(0.1-10):(0.1-10):(0.1-10), and the bacteria suspension obtained by mixing has an OD600 of 10-150.

6. The method according to claim 1, characterized in that the inorganic soil is selected from montmorillonite, diatomite, kaolin or bentonite.

7. The method according to claim 1, characterized in that the flocculant is selected from polyethyleneimine, chitosan, poly(diallyldimethylammonium chloride), or polyacrylamide.

8. The method of claim 7, characterized in that the flocculant is polyethyleneimine having a molecular weight of 600-70,000, or PDADMAC.

9. The method according to claim 1, characterized in that the cross-linking agent is selected from glutaraldehyde, tris(hydroxymethyl)phosphine, N,N-methylenebisacrylamide, or epichlorohydrin.

10. The method according to claim 1, characterized in that the method further comprises a step of sieving the obtained immobilized cells to obtain morphologically uniform immobilized cells.

11. A method for producing mannose with an immobilized cell, characterized in that the method comprises converting starch or a starch derivative into mannose with the immobilized cells obtained by the method according to claim 1.

12. The method according to claim 11, characterized in that the method further comprises a step of filtering and recovering the immobilized cell after reaction is completed.

13. The method according to claim 11, characterized in that a reaction system for biological conversion comprises 50-300 g/L of starch or starch derivative, a buffer at pH 5.0-8.0, 10-50 mM inorganic phosphate, 3-7 mM divalent magnesium ions, and the immobilized cell.

14. The method according to claim 11, characterized in that the buffer is an HEPES buffer, a phosphate buffer, a Tris buffer, or an acetate buffer; the inorganic phosphate is sodium phosphate or potassium phosphate.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIG. 1 shows a schematic diagram of a specific process of preparing immobilized cells according to the present disclosure.

[0040] FIG. 2 shows the SDS-PAGE analysis of the various enzymes in Example 1, wherein M indicates the protein marker, S indicates the supernatant of the cell lysate, and T indicates the total protein.

[0041] FIG. 3 shows the SDS-PAGE analysis of the various enzymes in Example 9, wherein M indicates the protein marker, S indicates the supernatant of the cell lysate, and T indicates the total protein.

[0042] FIG. 4 shows the effect of the immobilized Bacillus subtilis in producing mannose in Example 3.

[0043] FIG. 5 shows the effect of the immobilized Escherichia coli in producing mannose in Example 11.

[0044] FIG. 6 shows the effect of the Bacillus subtilis in producing mannose in Comparative Example 1.

[0045] FIG. 7 shows the effect of the Escherichia coli in producing mannose in Comparative Example 2.

DETAILED DESCRIPTION OF THE INVENTION

[0046] In order to further illustrate the technical solutions adopted by the present disclosure and the effects thereof, the technical solutions of the present disclosure are further described through specific Examples below. However, it should be understood that the described Examples are exemplary only and do not pose any limitation to the scope of the present disclosure. It is understood by one skilled in the art that the details and forms of the technical solutions of the present disclosure can be modified or substituted without departing from the spirit and scope of the present disclosure, and these modifications or substitutions fall within the protection scope of the present disclosure.

Example 1: Preparation of fermentation broths comprising Bacillus subtilis expressing enzyme

(1) Construction of pMA5-Pylb-aGP

[0047] In this Example, the sequence of the agp gene encoding the thermostable ?-glucan phosphorylase (NCBI-ProteinlD: BAD85595) was synthesized and spliced into a common plasmid by Suzhou Genewiz Biotechnology Co., Ltd. The agp gene was obtained by PCR using a pair of primers (1-IF and 1-IR). The pMA5-Pylb linear backbone was obtained by PCR using another pair of primers (1-VF and 1-VR). Then, the thermostable ?-glucan phosphorylase gene fragment and the pMA5-Pylb vector backbone were assembled by POE-PCR. The product obtained through ligation was transferred into a competent SCK6 cell using the calcium chloride method. A transformant was selected and subjected to colony PCR, identification via double enzyme digestion and sequence verification to obtain an expression vector, which was named pMA5-Pylb-aGP.

TABLE-US-00001 1-IF: (SEQIDNO:1) AGAAACAACAAAGGGGGAGATTTGTatggtgaacgtttccaatgccgttg 1-IR: (SEQIDNO:2) gcttgagctcgactctagaggatcctcagtcaagtcccttccacttgacca 1-VF: (SEQIDNO:3) tggtcaagtggaagggacttgactgaggatcctctagagtcgagctcaagc 1-VR: (SEQIDNO:4) caacggcattggaaacgttcaccatACAAATCTCCCCCTTTGTTGTTTCT
(2) Construction of pMA5-Pylb-P GM

[0048] In this Example, the sequence of the pgm gene encoding the thermostable phosphoglucomutase (NCBI-ProteinID: BAD85297) was synthesized and spliced into a common plasmid by Suzhou Genewiz Biotechnology Co., Ltd. The pgm gene was obtained by PCR using a pair of primers (2-IF and 2-IR). The pMA5-Pylb linear backbone was obtained by PCR using another pair of primers (2-VF and 2-VR). Then, the thermostable phosphoglucomutase gene fragment and the pMA5-Pylb vector backbone were assembled by POE-PCR. The product obtained through ligation was transferred into a competent SCK6 cell using the calcium chloride method. A transformant was selected and subjected to colony PCR, identification via double enzyme digestion and sequence verification to obtain an expression vector, which was named pMA5-Pylb-PGM.

TABLE-US-00002 2-IF: (SEQIDNO:5) AGAAACAACAAAGGGGGAGATTTGTatgggcaaactgtttggtaccttcg 2-IR: (SEQIDNO:6) gcttgagctcgactctagaggatccTTAacctttcagtgcttcttccagc 2-VF: (SEQIDNO:7) gctggaagaagcactgaaaggtTAAggatcctctagagtcgagctcaagct 2-VR: (SEQIDNO:8) cgaaggtaccaaacagtttgcccatACAAATCTCCCCCTTTGTTGTTTCT
(3) Construction of pMA5-Pylb-PGI

[0049] In this Example, the sequence of the pgi gene encoding the thermostable phosphoglucose isomerase (NCBI-ProteinID: AAS82052) was synthesized and spliced into a common plasmid by Suzhou Genewiz Biotechnology Co., Ltd. The pgi gene was obtained by PCR using a pair of primers (3-IF and 4-IR). The pMA5-Pylb linear backbone was obtained by PCR using another pair of primers (3-VF and 3-VR). Then, the thermostable phosphoglucose isomerase gene fragment and the pMA5-Pylb vector backbone were assembled by POE-PCR. The product obtained through ligation was transferred into a competent SCK6 cell using the calcium chloride method. A transformant was selected and subjected to colony PCR, identification via double enzyme digestion and sequence verification to obtain an expression vector, which was named pMA5-Pylb-PGI.

TABLE-US-00003 3-IF: (SEQIDNO:9) AGAAACAACAAAGGGGGAGATTTGTATGCTGCGTCTGGATACTCGCTTTC 3-IR: (SEQIDNO:10) agcttgagctcgactctagaggatccTTAACCAGCCAGGCGTTTACGAGTC 3-VF: (SEQIDNO:11) GACTCGTAAACGCCTGGCTGGTTAAggatcctctagagtcgagctcaagct 3-VR: (SEQIDNO:12) GAAAGCGAGTATCCAGACGCAGCATACAAATCTCCCCCTTTGTTGTTTCT
(4) Construction of pMA5-Pylb-MPI

[0050] In this Example, the sequence of the mpi gene encoding the thermostable mannose 6-phosphate isomerase (NCBI-ProteinlD: AAS81322) was synthesized and spliced into a common plasmid by Suzhou Genewiz Biotechnology Co., Ltd. The mpi gene was obtained by PCR using a pair of primers (4-IF and 4-IR). The pMA5-Pylb linear backbone was obtained by PCR using another pair of primers (4-VF and 4-VR). Then, the thermostable mannose 6-phosphate isomerase gene fragment and the pMA5-Pylb vector backbone were assembled by POE-PCR. The product obtained through ligation was transferred into a competent SCK6 cell using the calcium chloride method. A transformant was selected and subjected to colony PCR, identification via double enzyme digestion and sequence verification to obtain an expression vector, which was named pMA5-Pylb-MPI.

TABLE-US-00004 4-IF: (SEQIDNO:13) GTAGAAACAACAAAGGGGGAGATTTGTatgaggcggttggagcccaaacc cgtggc 4-VF: (SEQIDNO:14) ccacgggtttgggctccaaccgcctcatACAAATCTCCCCCTTTGTTGTT TCTAC 4-VR: (SEQIDNO:15) tgccgccctggccaaggagggggcgtgaggatcctctagagtcgagctca agc 4-IR: (SEQIDNO:16) gcttgagctcgactctagaggatcctcacgccccctccttggccagggcg gca
(5) Construction of pMA5-Pylb-M6PP

[0051] In this Example, the sequence of the m6pp gene encoding the thermostable mannose 6-phosphate phosphatase (NCBI-ProteinID: NP_228460) was synthesized and spliced into a common plasmid by Suzhou Genewiz Biotechnology Co., Ltd. The m6pp gene was obtained by PCR using a pair of primers (5-IF and 5-IR). The pMA5-Pylb linear backbone was obtained by PCR using another pair of primers (5-VF and 5-VR). Then, the thermostable mannose 6-phosphate phosphatase gene fragment and the pMA5-Pylb vector backbone were assembled by POE-PCR. The product obtained through ligation was transferred into a competent SCK6 cell using the calcium chloride method. A transformant was selected and subjected to colony PCR, identification via double enzyme digestion and sequence verification to obtain an expression vector, which was named pMA5-Pylb-M6PP.

TABLE-US-00005 5-IF: (SEQIDNO:17) GTAGAAACAACAAAGGGGGAGATTTGTATGTACCGCGTTTTTGTTTTTGA TC 5-VF: (SEQIDNO:18) GATCAAAAACAAAAACGCGGTACATACAAATCTCCCCCTTTGTTGTTTCT AC 5-VR: (SEQIDNO:19) AGCACCGATTGTCTGGATGAAtgaggatcctctagagtcgagctcaagc 5-IR: (SEQIDNO:20) gcttgagctcgactctagaggatcctcaTTCATCCAGACAATCGGTGCT

(6) Preparation of Fermentation Broths

[0052] Recombinantly engineered Bacillus subtilis strains (SCK6 was selected as the starting strain, see CN112342179B) which expressing a gene of the thermostable ?-glucan phosphorylase, a gene of the thermostable phosphoglucomutase, a gene of the thermostable phosphoglucose isomerase, a gene of the thermostable mannose 6-phosphate isomerase, or a gene of the thermostable mannose 6-phosphate phosphatase were selected respectively, inoculated into LB medium respectively, and cultured overnight at 37? C. with shaking. Then the respective culture was transferred to LB medium at an inoculum volume of 1%, and cultured overnight at 37? C. with shaking to obtain a fermentation broth of Bacillus subtilis expressing thermostable ?-glucan phosphorylase, a fermentation broth of Bacillus subtilis expressing thermostable phosphoglucomutase, a fermentation broth of Bacillus subtilis expressing thermostable phosphoglucose isomerase, a fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate isomerase, and a fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate phosphatase, respectively. The analysis of expression of the thermostable ?-glucan phosphorylase, the thermostable phosphoglucomutase, the thermostable phosphoglucose isomerase, the thermostable mannose 6-phosphate isomerase, and the thermostable mannose 6-phosphate phosphatase in Bacillus subtilis were shown in FIG. 2.

Example 2: Production of Mannose with Immobilized Bacillus subtilis

[0053] The fermentation broth of Bacillus subtilis expressing thermostable ?-glucan phosphorylase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucomutase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucose isomerase, the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate phosphatase prepared in Example 1 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 2% w/v of montmorillonite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 1% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 600 was added and flocculation was carried out at room temperature. Then, 0.5% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 3.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 70? C. to obtain immobilized cells.

[0054] In a reaction system having a volume of 1 L, starch at a final concentration of 100 g/L, a 50 mM sodium phosphate buffer (pH 7.0) and the immobilized Bacillus subtilis were respectively added to achieve OD600=20. Reaction was allowed to carried out in a water bath in a shaker at 70? C. During reaction, the content of mannose was analyzed by HPLC. After the reaction was completed, the immobilized Bacillus subtilis was collected by simple filtration and washed with buffer solution before proceeding to the next batch of reaction. Experimental results showed that when the immobilized Bacillus subtilis were used to catalyze consecutive rounds of reactions, the initial product yield reached up to 60%, and as the catalysis was carried out for 20 consecutive batches, the product yield was still maintained at 40%.

Example 3: Production of Mannose with Immobilized Bacillus subtilis

[0055] The fermentation broth of Bacillus subtilis expressing thermostable ?-glucan phosphorylase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucomutase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucose isomerase, the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate phosphatase prepared in Example 1 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 5% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.5% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 70,000 was added and flocculation was carried out at room temperature. Then, 0.5% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 0.4 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 60? C. to obtain immobilized cells.

[0056] Mannose was produced using the method of Example 2. Experimental results as shown in FIG. 4 demonstrated that when the immobilized Bacillus subtilis was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 65%, and as the catalysis was carried out for 25 consecutive batches, the product yield was still maintained at 45%.

Example 4: Production of Mannose with Immobilized Bacillus Subtilis

[0057] The fermentation broth of Bacillus subtilis expressing thermostable ?-glucan phosphorylase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucomutase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucose isomerase, the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate phosphatase prepared in Example 1 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 2% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.5% w/v of poly(diallyldimethylammonium chloride) (PDADMAC) aqueous solution was added and flocculation was carried out at room temperature. Then, 0.5% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 3 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 90? C. to obtain immobilized cells.

[0058] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Bacillus subtilis was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 63%, and as the catalysis was carried out for 25 consecutive batches, the product yield was still maintained at 43%.

Example 5: Production of Mannose with Immobilized Bacillus subtilis

[0059] The fermentation broth of Bacillus subtilis expressing thermostable ?-glucan phosphorylase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucomutase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucose isomerase, the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate phosphatase prepared in Example 1 were mixed in a ratio of 1:1:1:2:2 according to OD600, so that the OD600=100. And 4% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 1% w/v of poly(diallyldimethylammonium chloride) (PDADMAC) aqueous solution was added and flocculation was carried out at room temperature. Then, 1% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 3 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 70? C. to obtain immobilized cells.

[0060] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Bacillus subtilis was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 63%, and as the catalysis was carried out for 25 consecutive batches, the product yield was still maintained at 40%.

Example 6: Production of Mannose with Immobilized Bacillus subtilis

[0061] The fermentation broth of Bacillus subtilis expressing thermostable ?-glucan phosphorylase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucomutase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucose isomerase, the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate phosphatase prepared in Example 1 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 6% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.8% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 70,000 was added and flocculation was carried out at room temperature. Then, 0.5% v/v of tris(hydroxymethyl)phosphine aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 0.4 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 70? C. to obtain immobilized cells.

[0062] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Bacillus subtilis was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 64%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 41%.

Example 7: Production of Mannose with Immobilized Bacillus subtilis

[0063] The fermentation broth of Bacillus subtilis expressing thermostable ?-glucan phosphorylase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucomutase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucose isomerase, the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate phosphatase prepared in Example 1 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 3% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.5% w/v of polyacrylamide aqueous solution was added and flocculation was carried out at room temperature. Then, 2.0% v/v of N,N-methylenebisacrylamide aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 90? C. to obtain immobilized cells.

[0064] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Bacillus subtilis was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 65%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 42%.

Example 8: Production of Mannose with Immobilized Bacillus subtilis

[0065] The fermentation broth of Bacillus subtilis expressing thermostable ?-glucan phosphorylase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucomutase, the fermentation broth of Bacillus subtilis expressing thermostable phosphoglucose isomerase, the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Bacillus subtilis expressing thermostable mannose 6-phosphate phosphatase prepared in Example 1 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 1% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.1% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 70,000 was added and flocculation was carried out at room temperature. Then, 0.3% v/v of epichlorohydrin aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 70? C. to obtain immobilized cells.

[0066] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Bacillus subtilis was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 63%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 40%.

Example 9: Preparation of Fermentation Broths Comprising Escherichia coli Expressing Enzyme

[0067] A plasmid comprising a gene of the thermostable ?-glucan phosphorylase, a gene of the thermostable phosphoglucomutase, a gene of the thermostable phosphoglucose isomerase, a gene of the thermostable mannose 6-phosphate isomerase, or a gene of the thermostable mannose 6-phosphate phosphatase was constructed using the method as described in the patent CN 109750011 A. The respective gene of the thermostable ?-glucan phosphorylase, the thermostable phosphoglucomutase, the thermostable phosphoglucose isomerase, the thermostable mannose 6-phosphate isomerase, or the thermostable mannose 6-phosphate phosphatase was directly synthesized between the restriction sites of NdeI and XhoI on the vector pET-21a. The resulting recombinant plasmid was named pET-21a-aGP, pET-21a-PGM, pET-21a-PGI, pET-21a-MPI, or pET-21a-M6PP respectively.

[0068] The recombinant plasmids pET-21a-aGP, pET-21a-PGM, pET-21a-PGI, pET-21a-MPI, and pET-21a-M6PP were respectively transferred into the Escherichia coli strain BL21 (DE3) to obtain a recombinantly engineered bacteria. Single clones were picked respectively and cultured in the LB medium overnight at 37? C. with shaking. Then the culture was transferred to LB medium at an inoculum volume of 1%, added with IPTG for induction at 18? C. and cultured overnight with shaking to obtain a fermentation broth of Escherichia coli expressing thermostable ?-glucan phosphorylase, a fermentation broth of Escherichia coli expressing thermostable phosphoglucomutase, a fermentation broth of Escherichia coli expressing thermostable phosphoglucose isomerase, a fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate isomerase, and a fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate phosphatase, respectively. The analysis of expression of the thermostable ?-glucan phosphorylase, the thermostable phosphoglucomutase, the thermostable phosphoglucose isomerase, the thermostable mannose 6-phosphate isomerase, and the thermostable mannose 6-phosphate phosphatase in Escherichia coli was shown in FIG. 3.

Example 10: Production of Mannose with Immobilized Escherichia coli

[0069] The fermentation broth of Escherichia coli expressing thermostable ?-glucan phosphorylase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucomutase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucose isomerase, the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate phosphatase prepared in Example 9 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 1% w/v of montmorillonite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.2% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 600 was added and flocculation was carried out at room temperature. Then, 0.2% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 0.8 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 60? C. to obtain immobilized cells.

[0070] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Escherichia coli was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 60%, and as the catalysis was carried out for 20 consecutive batches, the product yield was maintained at more than 40%.

Example 11: Production of Mannose with Immobilized Escherichia coli

[0071] The fermentation broth of Escherichia coli expressing thermostable ?-glucan phosphorylase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucomutase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucose isomerase, the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate phosphatase prepared in Example 9 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 1% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.5% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 70,000 was added and flocculation was carried out at room temperature. Then, 1% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 70? C. to obtain immobilized cells.

[0072] Mannose was produced using the method of Example 2. Experimental results as shown in FIG. 5 demonstrated that when the immobilized Escherichia coli were used to catalyze consecutive rounds of reactions, the initial product yield reached up to 65%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 44%.

Example 12: Production of Mannose with Immobilized Escherichia coli

[0073] The fermentation broth of Escherichia coli expressing thermostable ?-glucan phosphorylase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucomutase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucose isomerase, the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate phosphatase prepared in Example 9 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 2% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.5% w/v of poly(diallyldimethylammonium chloride) (PDADMAC) aqueous solution was added and flocculation was carried out at room temperature. Then, 0.5% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 3 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 3.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 90? C. to obtain immobilized cells.

[0074] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Escherichia coli was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 60%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 40%.

Example 13: Production of Mannose with Immobilized Escherichia coli

[0075] The fermentation broth of Escherichia coli expressing thermostable ?-glucan phosphorylase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucomutase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucose isomerase, the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate phosphatase prepared in Example 9 were mixed in a ratio of 1:1:1:2:2 according to OD600, so that the OD600=100. And 3% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.4% w/v of poly(diallyldimethylammonium chloride) (PDADMAC) aqueous solution was added and flocculation was carried out at room temperature. Then, 1% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 3 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 70? C. to obtain immobilized cells.

[0076] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Escherichia coli were used to catalyze consecutive rounds of reactions, the initial product yield reached up to 60%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 41%.

Example 14: Production of Mannose with Immobilized Escherichia coli

[0077] The fermentation broth of Escherichia coli expressing thermostable ?-glucan phosphorylase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucomutase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucose isomerase, the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate phosphatase prepared in Example 9 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 3% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.5% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 70,000 was added and flocculation was carried out at room temperature. Then, 1.0% v/v of tris(hydroxymethyl)phosphine aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 70? C. to obtain immobilized cells.

[0078] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Escherichia coli were used to catalyze consecutive rounds of reactions, the initial product yield reached up to 61%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 40%.

Example 15: Production of Mannose with Immobilized Escherichia coli

[0079] The fermentation broth of Escherichia coli expressing thermostable ?-glucan phosphorylase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucomutase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucose isomerase, the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate phosphatase prepared in Example 9 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 5% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.8% w/v of polyacrylamide aqueous solution was added and flocculation was carried out at room temperature. Then, 0.8% v/v of N,N-methylenebisacrylamide aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 90? C. to obtain immobilized cells.

[0080] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Escherichia coli was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 63%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 41%.

Example 16: Production of Mannose with Immobilized Escherichia coli

[0081] The fermentation broth of Escherichia coli expressing thermostable ?-glucan phosphorylase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucomutase, the fermentation broth of Escherichia coli expressing thermostable phosphoglucose isomerase, the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate isomerase, and the fermentation broth of Escherichia coli expressing thermostable mannose 6-phosphate phosphatase prepared in Example 9 were mixed in a ratio of 1:1:1:1:1 according to OD600, so that the OD600=100. And 1% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.4% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 600 was added and flocculation was carried out at room temperature. Then, 0.4% v/v of epichlorohydrin aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into strips having a particle size of 1.0 mm with a rotary granulator. Then the strips were broken into particles having a uniform length with a spherical shot blasting machine. The resulting immobilized cell particles were subjected to drying by boiling at 70? C. to obtain immobilized cells.

[0082] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized Escherichia col was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 61%, and as the catalysis was carried out for 25 consecutive batches, the product yield was maintained at 39%.

Comparative Example 1: Production of Mannose with Bacillus subtilis

[0083] The fermentation broths prepared in Example 1 were centrifuged at 5,500 rpm for 10 min. The supernatants were discarded to obtain whole cells expressing thermostable ?-glucan phosphorylase, whole cells expressing thermostable phosphoglucomutase, whole cells expressing thermostable phosphoglucose isomerase, whole cells expressing thermostable mannose 6-phosphate isomerase, and whole cells expressing thermostable mannose 6-phosphate phosphatase respectively. A 50 mM sodium phosphate buffer (pH 7.5) was added to the above cells respectively to resuspend the bacterial to OD600=200. The resuspended bacterial were heated at 75? C. for 90 min. The above whole cells were mixed in a sodium phosphate buffer (pH 7.0) in a ratio of 1:1:1:1:1, so that OD600=200.

[0084] In a reaction system having a volume of 1 L, starch at a final concentration of 100 g/L, a 50 mM sodium phosphate buffer (pH 7.0) and the above mixed Bacillus subtilis were respectively added to achieve OD600=20. Reaction was allowed to carried out in a water bath in a shaker at 70? C. During reaction, the content of mannose was analyzed by HPLC. After the reaction was completed, the cells were precipitated by centrifugation, washed with a buffer and then used in reactions for the next batch. Experimental results as shown in FIG. 6 demonstrated that when the immobilized Bacillus subtilis were used to catalyze consecutive rounds of reactions, the initial product yield reached up to 65%, but as the catalysis was carried out for 2 consecutive batches, the product yield was lowered to only 15%.

Comparative Example 2: Production of Mannose with Escherichia coli

[0085] The fermentation broths prepared in Example 9 were centrifuged at 5,500 rpm for 10 min. The supernatants were discarded to obtain whole cells expressing thermostable ?-glucan phosphorylase, whole cells expressing thermostable phosphoglucomutase, whole cells expressing thermostable phosphoglucose isomerase, whole cells expressing thermostable mannose 6-phosphate isomerase, and whole cells expressing thermostable mannose 6-phosphate phosphatase respectively. A 50 mM sodium phosphate buffer (pH 7.5) was added to the above cells respectively to resuspend the bacterial to OD600=200. The resuspended bacterial were heated at 75? C. for 90 min. The above whole cells were mixed in a sodium phosphate buffer (pH 7.0) in a ratio of 1:1:1:1:1, so that OD600=200.

[0086] In a reaction system having a volume of 1 L, starch at a final concentration of 100 g/L, a 50 mM sodium phosphate buffer (pH 7.0) and the above mixed Escherichia coli were respectively added to achieve OD600=20. Reaction was allowed to carried out in a water bath in a shaker at 70? C. During reaction, the content of mannose was analyzed by HPLC. After the reaction was completed, the cells were precipitated by centrifugation, washed with a buffer and then used in reactions for the next batch. Experimental results as shown in FIG. 7 demonstrated that when the Escherichia coli were used to catalyze consecutive rounds of reactions, the initial product yield reached up to 63%, but as the catalysis was carried out for 2 consecutive batches, the product yield was lowered to only 12%.

Comparative Example 3: Production of Mannose with Immobilized Permeable Bacillus subtilis

[0087] Recombinant Bacillus subtilis strains expressing a gene of thermostable ?-glucan phosphorylase, a gene of thermostable phosphoglucomutase, a gene of thermostable phosphoglucose isomerase, a gene of thermostable mannose 6-phosphate isomerase, or a gene of thermostable mannose 6-phosphate phosphatase were selected respectively, inoculated into LB medium respectively, and cultured overnight at 37? C. with shaking. Then the culture was transferred to LB medium at an inoculum volume of 1%, and cultured overnight at 37? C. with shaking, centrifuged at 5,500 rpm for 10 min then with the supernatants discarded to obtain whole cells expressing thermostable ?-glucan phosphorylase, whole cells expressing thermostable phosphoglucomutase, whole cells expressing thermostable phosphoglucose isomerase, whole cells expressing thermostable mannose 6-phosphate isomerase, and whole cells expressing thermostable mannose 6-phosphate phosphatase, respectively. A 50 mM sodium phosphate buffer (pH 7.5) was added to the above cells respectively to resuspend the bacteria to OD600=200. The resuspended bacteria were heated at 75? C. for 90 min.

[0088] The above permeable whole cells were mixed in a sodium phosphate buffer (pH 7.0) in a ratio of 1:1:1:1:1, so that OD600=100. And 5% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.5% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 70,000 was added and flocculation was carried out at room temperature. Then, 0.5% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into particles having a particle size of 0.4 mm with a rotary granulator. The resulting immobilized cell particles were dried at 30? C. to obtain immobilized cells.

[0089] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized permeable Bacillus subtilis were used to catalyze consecutive rounds of reactions, the initial product yield reached up to 55%, and as the catalysis was carried out for 25 consecutive batches, the product yield was 27%.

Comparative Example 4: Production of Mannose with Immobilized Permeable Escherichia coli

[0090] Recombinant Escherichia coli strains expressing a gene of thermostable ?-glucan phosphorylase, a gene of thermostable phosphoglucomutase, a gene of thermostable phosphoglucose isomerase, a gene of thermostable mannose 6-phosphate isomerase, or a gene of thermostable mannose 6-phosphate phosphatase were selected respectively, inoculated into LB medium respectively, and cultured overnight at 37? C. with shaking. Then the culture was transferred to LB medium at an inoculum volume of 1%, added with IPTG for induction at 18? C. and cultured overnight with shaking, centrifuged at 5,500 rpm for 10 min then with the supernatants discarded to obtain whole cells expressing thermostable ?-glucan phosphorylase, whole cells expressing thermostable phosphoglucomutase, whole cells expressing thermostable phosphoglucose isomerase, whole cells expressing thermostable mannose 6-phosphate isomerase, and whole cells expressing thermostable mannose 6-phosphate phosphatase, respectively. A 50 mM sodium phosphate buffer (pH 7.5) was added to the above cells respectively to resuspend the bacteria to OD600=200. The resuspended bacteria were heated at 75? C. for 90 min.

[0091] The above permeable whole cells were mixed in a sodium phosphate buffer (pH 7.0) in a ratio of 1:1:1:1:1, so that OD600=100. And 1% w/v of diatomite was added to the bacteria suspension, and stirred homogeneously. Subsequently, 0.5% w/v of the aqueous solution of polyethyleneimine having a molecular weight of 70,000 was added and flocculation was carried out at room temperature. Then, 1% v/v of glutaraldehyde aqueous solution was added and cross-linking was carried out at room temperature for 2 hours. Filtration was carried out under vacuum to obtain a filter cake. The filter cake was extruded and thus granulated into particles having a particle size of 1.0 mm with a rotary granulator. The resulting immobilized cell particles were dried at 30? C. to obtain immobilized cells.

[0092] Mannose was produced using the method of Example 2. Experimental results showed that when the immobilized permeable Escherichia coli was used to catalyze consecutive rounds of reactions, the initial product yield reached up to 56%, and as the catalysis was carried out for 25 consecutive batches, the product yield was 26%.