Mutant of nitrile hydratase derived from <i>Caldalkalibacillus thermarum</i>
12104189 ยท 2024-10-01
Assignee
Inventors
- Zhemin ZHOU (Wuxi, CN)
- Zhongmei LIU (Wuxi, CN)
- Ting LI (Wuxi, CN)
- Dezhi CHEN (Wuxi, CN)
- Sailan ZHANG (Wuxi, CN)
- Li ZHOU (Wuxi, CN)
- Wenjing CUI (Wuxi, CN)
- Zhongyi CHENG (Wuxi, CN)
- Junling GUO (Wuxi, CN)
Cpc classification
International classification
Abstract
The disclosure discloses a mutant of nitrile hydratase derived from Caldalkalibacillus thermarum, and belongs to the technical field of enzyme engineering. The nitrile hydratase mutant Cal. t Nhase-A20V provided by the disclosure has a half-life of about 10 min at 70? C., which does not change much compared with the thermal stability of the wild enzyme. The specific enzyme activity of the mutant Cal. t Nhase-A20V is 128% of that of the wild enzyme. At the same time, the mutant also has better tolerance to a substrate and a product, and the final yield of nicotinamide produced by whole-cell catalysis reaches 598 g/L. Therefore, the nitrile hydratase mutant Cal. t Nhase-A20V provided by the disclosure has good enzymatic properties and is beneficial to future industrial production.
Claims
1. A mutant nitrile hydratase, comprising: a ? subunit, an ? subunit, and a regulatory protein, wherein the amino acid sequences of the ? subunit, the ? subunit, and the regulatory protein are SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively, wherein the nucleotide sequence of the mutant nitrile hydratase is SEQ ID NO:1, wherein the mutant nitrile hydratase has a specific activity of 650 U/mg, and wherein the mutant nitrile hydratase is capable of catalyzing formation of nicotinamide by whole-cell catalysis up to a concentration of 598 g/L.
2. A recombinant Escherichia coli (E. coli), wherein the recombinant E. coliexpresses the mutant nitrile hydratase according to claim 1.
3. The recombinant E. coli according to claim 2, wherein the E. coli is E. coli BL21, and wherein the recombinant E. coli comprises a pET-series plasmid encoding the mutant nitrile hydratase.
4. The recombinant E. coli according to claim 3, wherein the plasmid is pET?-24(+).
5. A method for producing nicotinamide or acrylamide, comprising, incubating the mutant nitrile hydratase of claim 1 with 3-cyanopyridine or acrylonitrile as a substrate to thereby produce nicotinamide or acrylamide.
6. A method for producing nicotinamide or acrylamide comprising: providing the recombinant E. coli of claim 2, fermenting the recombinant E. coli in a fermentation broth, and adding 3-cyanopyridine or acrylonitrile as a substrate to the fermentation broth, thereby producing nicotinamide or acrylamide.
7. The method according to claim 6, wherein OD.sub.600 of the fermentation broth after fermentation is 5 to 10, and the concentration of the substrate is 0.2 mol/L to 1 mol/L.
8. The method according to claim 6, wherein the fermentation is performed at 25? C. to 28? C., and wherein the mass ratio of the substrate 3-cyanopyridine to wet bacterial cells is 0.5 to 2.
9. The method according to claim 6, wherein the fermentation is performed at 25? C. to 28? C., and wherein the mass ratio of the substrate acrylonitrile to wet bacterial cells is 1 to 1.5.
10. The method according to claim 6, wherein the mutant nitrile hydratase is prepared as follows: inoculating the recombinant E. coli in Luria Broth (LB) culture medium, culturing at 35? C. to 37? C. until the OD.sub.600 is 0.6 to 0.8, and adding isopropyl-?-D-1-thiogalactopyranoside (IPTG) for induction at 20? C. to 30? C. for 12 hours to 18 hours.
Description
BRIEF DESCRIPTION OF FIGURES
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION
(6) Definition of enzyme activity (U): The amount of enzyme required to transform 3-cyanopyridine to 1 ?mol/L nicotinamide per minute is defined as 1 U.
(7) Specific enzyme activity (U/mg): The enzyme activity per milligram of NHase.
(8) Definition of relative enzyme activity: The enzyme activity of a mutant enzyme measured at a pH of 7.4 and a temperature of 30? C. for 10 min is defined as 100%.
(9) LB culture medium: Peptone 10 g/L, yeast extract 5 g/L, and NaCl 10 g/L.
(10) Reaction system of nitrile hydratase: The substrate is 490 ?L of 200 mM 3-cyanopyridine. 10 ?L of a pure enzyme solution with a concentration of 0.5 mg/mL or 10 ?L of a broth with an OD.sub.600 of 8 is added, and the reaction is carried out at 30? C. for 10 min. Then the reaction is stopped with 500 ?L of acetonitrile, and the reaction solution is centrifuged to remove precipitate. The supernatant is taken, filtered through a 0.22 ?m membrane, and used as a sample for liquid phase determination.
(11) Detection of nitrile hydratase: HPLC is used for detection; a mobile phase contains water and acetonitrile in a ratio of 1:2; the detection wavelength is 210 nm; the flow rate is 0.6 mL/min; and the chromatographic column is C18 column.
(12) Determination of temperature stability: The wild enzyme and mutant are treated in a KPB buffer with a pH of 7.4 at 70? C. for 10 min and 30 min respectively, and the residual enzyme activity is determined. The enzyme activity of the untreated enzyme is defined as 100%, and the thermostability result is obtained.
(13) Determination of tolerance to substrate: The wild enzyme and the mutant are diluted in a KPB buffer with a pH of 7.4 to form broths with an OD.sub.600 of 8. After incubation at 30? C. for 30 minutes in 3-cyanopyridine with the concentrations of 0 M and 1 M respectively, the residual enzyme activity is determined and the results of tolerance to the substrate are obtained.
(14) Determination of tolerance to product: The wild enzyme and the mutant are diluted in a KPB buffer with a pH of 7.4 to form broths with an OD.sub.600 of 8. After incubation at 30? C. for 30 minutes in nicotinamide with the concentrations of 0 M, 1 M and 2 M respectively, the residual enzyme activity is determined and the results of tolerance to the product are obtained.
Example 1
(15) Kinetic simulations of the nitrile hydratase (Pt NHase) derived from Pseudonocardia thermophila and the Cal. t NHase derived from Caldalkalibacillus thermarum found that some amino acids had higher RMSF values, and it was speculated that these amino acids might affect the thermal stability. Therefore, the following mutants were constructed: Cal. t NHase-A20V, Cal. t NHase-H150S (the histidine at position 150 of the ? subunit with an amino acid sequence as shown in SEQ ID NO. 2 was mutated to serine), Cal. t NHase-T104A (the threonine at position 104 of the ? subunit with an amino acid sequence as shown in SEQ ID NO. 2 was mutated to alanine), Cal. t NHase-S152K (the serine at position 152 of the ? subunit with an amino acid sequence as shown in SEQ ID NO. 2 was mutated to lysine), and Cal. t NHase-K185A (the lysine at position 185 of the ? subunit with an amino acid sequence as shown in SEQ ID NO. 2 was mutated to alanine).
(16) (1) Construction of Mutants:
(17) A Cal. t-NHase gene (as shown in SEQ ID NO. 1) was synthesized, and the gene was cloned at the Nde I and EcoR I restriction sites of a pET24a plasmid by Suzhou Genewiz, to obtain a pET24a-Cal. t NHase recombinant plasmid. Using pET24a-Cal. t NHase as a template, PCR was carried out with the primers shown in Table 1 under the conditions shown in Table 2. The PCR products were transformed into E. coli JM109 and sequenced by Suzhou Genewiz. The recombinant plasmids pET24a-NHase-A20V, pET24a-Cal. t Nhase-H150S, pET24a-Cal. t Nhase-T104A, pET24a-Cal. t Nhase-S152K, and pET24a-Cal. t Nhase-K185A carrying the gene encoding the mutant were obtained from the plasmids with correct sequencing results. The recombinant plasmids were transformed into E. coli BL21 strains for expression to obtain recombinant strains.
(18) TABLE-US-00001 TABLE1 Primers Primer Sequence SequenceNo. H150S-U AAGAACATCAGCCCGAGTGGTCATACCC SEQIDNO.6 H150S-D GACCACTCGGGCTGATGTTCTTGGTTTT SEQIDNO.7 CAC T104A-U CCAGCCGGATGCCCCGACCCCGCGCCGC SEQIDNO.8 GAAAAC T104A-D GGCGCGGGGTCGGGGCATCCGGCTGGGC SEQIDNO.9 CAG S152K-U TCCACCCGAAGGGTCATACCCGTCTG SEQIDNO.10 S152K-D GGGTATGACCCTTCGGGTGGATGTTCTT SEQIDNO.11 G K185A-U GCCCATGGCGCCGGCGAAAGCCCGCAG SEQIDNO.12 K185A-D GCTTTCGCCGGCGCCATGGGCATTGGCA SEQIDNO.13 T A20V-U TTTTGGAGCGTGCGTGCAAAGGCTTTAG SEQIDNO.14 A20V-D CCTTTGCACGCACGCTCCAAAAAGACTC SEQIDNO.15 C
(19) TABLE-US-00002 TABLE 2 Whole-plasmid PCR amplification reaction system Regent Amount ddH.sub.2O 32 ?L 5 ? PS Buffer (Mg.sup.2+ plus) 10 ?L dNTP Mixture (2 mmol/L) 4 ?L P1 (10 mmol/L) 1 ?L P2 (10 mmol/L) 1 ?L pET24a-Cal.t NHase 1 ?L Primer STAR HS DNA 1 ?L polymerase Total 50 ?L
(20) PCR Amplification Reaction Conditions:
(21) TABLE-US-00003 95? C. Initial denaturation 5 min 95? C. Denaturation 1 min {close oversize brace} 30 cycles 58? C. Annealing 30 s 72? C. Extension 2 min 72? C. Extension 10 min
(22) The PCR products were identified by agarose gel electrophoresis. Then the PCR products were purified, digested and transformed into E. coli BL21 competent cells.
(23) (2) 5 mL of LB culture medium (peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L) containing kanamycin with a concentration of 50 ?g/mL was inoculated with the recombinant E. coli strains BL21/pET24a-Cal. t NHase-A20V, BL21/pET24a-Cal. t Nhase-H150S, BL21/pET24a-Cal. t Nhase-T104A, BL21/pET24a-Cal. t Nhase-S152K, and BL21/pET24a-Cal. t Nhase-K185A obtained in step (1), and culturing was performed with shaking overnight at 37? C. and 200 r/min.
(24) 100 mL of LB expression culture medium (peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L) containing kanamycin with a concentration of 50 ?g/mL was inoculated with the overnight culture at an inoculum concentration of 1% (v/v), and culturing was performed at 37? C. and 200 r/min with shaking until the OD.sub.600 was 0.6-0.8. Then an inducer IPTG was added to 0.1 mM, and Co.sup.2+ was added to 0.1 mg/L to carry out induction at 25? C. for 12-18 h to obtain bacterial cells. The bacterial cells were centrifuged at 12,000 rpm and then collected.
(25) (3) The recombinant bacterial cells were concentrated with a binding buffer solution (20 mmol/L Na.sub.2HPO.sub.4, 280 mmol/L NaCl, 6 mmol/L KCl) 5 times, ultrasonically disrupted, and centrifuged at 12,000 rpm for 40 min. The supernatant was filtered with a 0.22 ?m filter membrane. A 1 mL strep Trap HP column was equilibrated with the binding buffer solution 10 times the column volume. Non-specifically adsorbed proteins were washed out with the binding buffer solution 15 times the column volume. The protein was eluted with 20 mM Na.sub.2HPO.sub.4, 280 mM NaCl, 6 mM KCl, and 2.5 mM dethiobiotin buffer 8 times the column volume. The samples were collected and analyzed and identified by SDS-PAGE.
Example 2
(26) 10 ?L of the 0.5 mg/mL mutant enzyme purified in Example 1 was added to a 500 pi buffer reaction system, and the reaction system was treated in a metal bath at 70? C. for 0 min, 10 min, 20 min, and 30 min respectively. The residual enzyme activity was determined, wherein the enzyme activity after treatment for 0 min is defined as 100%.
(27) As shown in
Example 3
(28) Solutions of the product nicotinamide with different concentrations of 0 M and 2 M were prepared. Broths of the wild enzyme and the mutant with an OD.sub.600 of 8 were treated in the substrate solutions with different concentrations at 30? C. for 30 min, and then the cells were resuspended in KPB and washed twice. 10 ?L of samples were taken to determine the residual enzyme activity. The enzyme activity treated with the nicotinamide solution of 0 M was defined as 100%.
(29) As shown in
Example 4
(30) Solutions of substrate with different concentrations of 0 M and 1 M were prepared: The broths of the wild enzyme and mutants with an OD.sub.600 of 8 were treated in solutions of substrate with different concentrations at 30? C. for 30 min. Then the cells were resuspended in KPB and washed twice. 10 ?L of samples were taken to determine the residual enzyme activity. The enzyme activity treated with the solution of 0 M is defined as 100%.
(31) As shown in
Example 5
(32) The BL21/pET24a-Cal. t NHase-A20V broth obtained in step (2) of Example 1 was centrifuged and collected, washed with water, and centrifuged and collected again. The temperature was adjusted to 25-28? C. 3-cyanopyridine was added to the broth with an OD.sub.600 of 8 at a final concentration of 0.4 mol/L, and stirred continuously. When the present batch of substrate reacted completely, the next batch of substrate was added. The content of each component in the reaction solution was detected by HPLC, and the concentration of nicotinamide was calculated as 598 g/L, as shown in
(33) While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.