Antisense targeting dynamin 2 and use for the treatment of centronuclear myopathies and neuropathies

11499154 · 2022-11-15

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention concerns the use of antisense oligonucleotides (AON) capable of inhibiting expression of dynamin 2, advantageously human dynamin 2, for use in the treatment of Charcot-Marie-Tooth disease (CMT) and centronuclear myopathies (CNM).

Claims

1. A method of treating Charcot-Marie-Tooth disease (CMT), comprising administering an antisense oligonucleotide (AON) capable of inhibiting expression of dynamin 2 to a subject in need thereof, wherein the AON: comprises a nucleic acid sequence TCAGGCCGCCCCATTTTACCTGTTT (SEQ ID NO: 3) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 3; or targets the region containing 100 nucleotides upstream of the ATG; or comprises a nucleic acid sequence CTGGACCATCCTATGAGGAAAAGGA (SEQ ID NO: 1) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 1; or enables skipping of exon 6 on the dynamin 2 pre-mRNA.

2. The method according to claim 1, wherein the CMT is dominant intermediate CMT (DI-CMTB), axonal CMT (CMT2M), dominant intermediate CMT 1 (CMTDI1), dominant intermediate CMT B (CMTDIB), or CMT type 4B (CMT4B).

3. The method according to claim 1, wherein the AON targets a junction between exon 6 and intron 6 on the dynamin 2 pre-mRNA enabling skipping of exon 6 on the dynamin 2 pre-mRNA.

4. The method according to claim 1, wherein the AON comprises a nucleic acid sequence GACCCTCAACGACCTGGCCCC (SEQ ID NO: 4) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 4.

5. The method according to claim 1, wherein the AON comprises a nucleic acid sequence CGTGCAAACCCTTGCAGTACCTGAT (SEQ ID NO: 2) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 2.

6. An antisense oligonucleotide (AON), capable of inhibiting expression of dynamin 2, wherein the AON: comprises a nucleic acid sequence TCAGGCCGCCCCATTTTACCTGTTT (SEQ ID NO: 3) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 3; or targets the region containing 100 nucleotides upstream of the ATG; or comprises a nucleic acid sequence CTGGACCATCCTATGAGGAAAAGGA (SEQ ID NO: 1) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 1; or enables skipping of exon 6 on the dynamin 2 pre-mRNA; wherein the AON is in the form of a morpholino oligonucleotide.

7. The antisense oligonucleotide according to claim 6 wherein the AON comprises a nucleic acid sequence GACCCTCAACGACCTGGCCCC (SEQ ID NO: 4) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 4.

8. The antisense oligonucleotide according to claim 6 wherein the AON targets the junction between exon 6 and intron 6 on the dynamin 2 pre-mRNA.

9. The antisense oligonucleotide according to claim 6 wherein the AON comprises a nucleic acid sequence CGTGCAAACCCTTGCAGTACCTGAT (SEQ ID NO: 2) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 2.

10. A method of treating a centronuclear myopathy (CNM) comprising administering an antisense oligonucleotide (AON) to a subject in need thereof, wherein the AON: comprises a nucleic acid sequence TCAGGCCGCCCCATTTTACCTGTTT (SEQ ID NO: 3) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 3; or targets the region containing 100 nucleotides upstream of the ATG; or comprises a nucleic acid sequence CTGGACCATCCTATGAGGAAAAGGA (SEQ ID NO: 1) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 1; or enables skipping of exon 6 on the dynamin 2 pre-mRNA.

11. A viral vector containing an antisense oligonucleotide (AON), wherein the AON: comprises a nucleic acid sequence TCAGGCCGCCCCATTTTACCTGTTT (SEQ ID NO: 3) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 3; or targets the region containing 100 nucleotides upstream of the ATG; or comprises a nucleic acid sequence CTGGACCATCCTATGAGGAAAAGGA (SEQ ID NO: 1) or a sequence exhibiting at least 90% identity with sequence SEQ ID NO: 1; or enables skipping of exon 6 on the dynamin 2 pre-mRNA.

12. A pharmaceutical composition comprising the antisense oligonucleotide according to claim 6 or the viral vector of claim 11.

13. The method according to claim 1, further comprising administering myotubularin.

14. A kit comprising the antisense oligonucleotide according to claim 6 or the viral vector of claim 11 and instructions for their use.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: Level of dynamin 2 protein expression after treatment of murine cells with PMO.

(2) (A) Representative images of western blots obtained with dynamin 2 (98 kDa) after treatment with PMO A, B, C, D, E, or F in C2C12 cells and (B) their quantification after normalisation with GAPDH. n=4, 2 independent experiments.

(3) FIG. 2: Level of dynamin 2 protein expression after treatment of TA (Tibialis Anterior) and QUA (Quadriceps) muscles in normal (A) or Mtm1-KO (B) mice with PMO.

(4) (A) Representative images of Western blots obtained with dynamin 2 (98 kDa) and the muscles of WT mice treated with PBS (n=4) or PMO C and D (n=2 for each condition), and their quantification after normalisation with GAPDH.

(5) (B) Quantification after normalisation with GAPDH of dynamin 2 levels in KO mice treated with PBS (n=10 for the TA and n=11 for the QUA) or with PMO C (n=6) and D (n=4 for the TA and n=5 for the QUA).

(6) FIG. 3: Measurement of muscle weight after treatment with the PMO.

(7) Histograms showing muscle weight of TA and QUA muscles

(8) (A) in normal (WT) mice treated with PBS (n=6) or with PMO C and D (n=2 for each condition)

(9) (B) in Mtm1-KO mice treated with PBS (n=20) or with PMO C (n=6) and D (n=5).

(10) FIG. 4: Distribution of muscle fibre diameter after treatment of the TA with the PMO.

(11) Graphs showing the percentage of fibres by diameter in the TA

(12) (A) in normal (WT) mice treated with PBS (n=4) or with PMO C and D (n=2 for each condition)

(13) (B) in Mtm1-KO mice treated with PBS (n=10) or with PMO C (n=6) and D (n=4).

(14) FIG. 5: Measurement of muscle fibre diameter after treatment of the TA with the PMO.

(15) Histograms showing mean fibre diameter under the conditions of FIG. 4.

(16) FIG. 6: HE staining of the TA after treatment with the PMO.

(17) Representative images of HE staining performed on transverse TA sections in normal mice (WT on the left) and Mtm1-KO mice (KO on the right) treated with PBS or with PMO C or PMO D. *: internalised nuclei.

(18) FIG. 7: NADH staining of the TA after treatment with the PMO.

(19) Representative images of NADH staining performed on transverse TA sections in normal mice (WT on the left) and Mtm1-KO mice (KO on the right) treated with PBS or with PMO C or PMO D.*: “necklace” (subsarcolemmal accumulation of mitochondria).

(20) FIG. 8: Measurement of total muscle force in the TA in situ after treatment of muscles with the PMO.

(21) Graphs showing total TA force in normal mice treated with PBS (n=6) and the TA of Mtm1-KO mice treated with PBS (n=18) or with PMO C (n=6) or D (n=4).

(22) FIG. 9: Measurement of specific TA force in situ after treatment of muscles with the PMO.

(23) Graphs showing the specific force of TA treated under the following conditions:

(24) (A) normal (WT) mice treated with PBS (n=6) or with PMO C (n=2) or D (n=2)

(25) (B) Mtm1-KO mice treated with PBS (n=18) or with PMO C (n=6) or D (n=4).

(26) Specific force is calculated as the ratio of total force to muscle weight.

(27) FIG. 10: Level of dynamin 2 protein expression after treatment of human cells with the PMO.

(28) Quantification, after GAPDH normalisation, of dynamin 2 levels after treatment with human antisense PMO 1, 2, 3, or 4 in KM155C25 cells.

A. MATERIALS AND METHODS

(29) 1/Morpholinos

(30) Six antisense morpholinos oligonucleotides targeting different murine Dnm2 pre-mRNA regions (NM_001253893.1) and four morpholinos antisense oligonucleotides targeting different human Dnm2 pre-mRNA regions (NM_001005360.2) were synthesised and conjugated to an octa-guanidine dendrimer promoting penetration into the cell (Vivo-Morpholino, Gene Tools, LLC) (Table 1).

(31) TABLE-US-00001 TABLE 1 Sequence of Vivo-Morpholinos oligonucleotides and target regions on the murine and human dynamin 2 pre-mRNA. * Position of the region with regard to the ATG. Name of Vivo- AON Target Target Morpholino sequence sequence region PMO A CGACTAAGACTC ACATCGGAACCG 5′ UTR TCGGTTCCGATG AGAGTCTTAGTC * -28/-53 T G (SEQ ID (SEQ ID NO: 5) NO: 11) PMO B TCATCCGGTTCT GGTGTCGCCTGA 5′ UTR CAGGCGACACC GAACCGGATGA * -152/-174 (SEQ ID (SEQ ID NO: 6) NO: 12) PMO C CCCTGAATTTCT AGGTATGAGAAA exon 2- ATTTCTCATACC TAGAAATTCAGG intron 2 T G (SEQ ID (SEQ ID NO: 7) NO: 13) PMO D GGTGGCCTCAAA GGTATAGCGGAG exon 6- CCTCCGCTATAC GTTTGAGGCCAC intron 6 C C (SEQ ID (SEQ ID NO: 8) NO: 14) PMO E TTGCCCATGGTG GAGGCGGACACC ATG TCCGCCTC (ATG)GGCAA (SEQ ID (SEQ ID NO: 9) NO: 15) PMO F TTGCTTCCTCCT GAGCAGAGCAGG 5′ UTR GCTCTGCTC AGGAAGCAA * -65/-90 (SEQ ID (SEQ ID NO: 10) NO: 16) PMO 1 GACCCTCAACGA GGGGCCAGGTCG 5′ UTR CCTGGCCCC TTGAGGGTC * -49/-70 (SEQ ID (SEQ ID NO: 4) NO: 17) PMO 2 TCGGCCGCCCCA AAACAGGTAAAA exon 2- TTTTACCTGTTT TGGGGCGGCCTG intron 2 (SEQ ID A NO: 3) (SEQ ID NO: 18) PMO 3 CGTGCAAACCCT ATCAGGTACTGC exon 6- TGCAGTACCTGA AAGGGTTTGCAC intron 6 T G (SEQ ID (SEQ ID NO: 2) NO: 19) PMO 4 CTGGACCATCCT TCCTTTTCCTCA exon 8- ATGAGGAAAAGG TAGGATGGTCCA intron 7 A G (SEQ ID (SEQ ID NO: 1) NO: 20)

(32) 2/Ex Vivo Screening

(33) Screening of Murine Vivo-Morpholinos:

(34) Murine C2C12 myoblasts are incubated for 48 hours at 37° C. in a DMEM medium (Thermo Fisher scientific) supplemented with foetal calf serum (FCS; Thermo Fisher scientific) at a concentration of 10%, containing 0, 1, 2 and 5 μM of each Vivo-Morpholino. The cells are collected by centrifugation at 4° C. (5 min; 800 rpm), washed in PBS (Phosphate Buffer Saline, Gibco®) and the cell pellets are then recovered by centrifugation at 4° C. (10 min; 12 000 rpm).

(35) Screening of Human Vivo-Morpholinos:

(36) KM155C25 myoblasts are incubated for 48 hours at 37° C. in a “Skeletal Muscle Cell Growth Medium” (Promo Cell) supplemented with foetal calf serum (FCS; Thermo Fisher scientific) at a concentration of 15%, containing 0, 1, 2 and 5 μM of each Vivo-Morpholino. The cells are collected by centrifugation at 4° C. (5 min; 800 rpm), washed in PBS (Phosphate Buffer Saline, Gibco®), collected by 2 successive centrifugations (5 min at 80 g) and the cell pellets are then recovered by centrifugation at 4° C. (10 min; 12000 rpm).

(37) 3/Murine Lines and Treatments

(38) KO (“Knock-out”) mice inactivated for the MTM1 gene (Mtm1-KO model), genetic background BS53d4-Pas, exhibit complete absence of myotubularin in all of their body tissues and have profound abnormalities of skeletal muscle mass, structure and function. The murine phenotype is similar to the phenotype seen in XLMTM human patients although unlike human beings in which the disease is congenital, it is progressive and only develops at around 3 weeks old. The mice survive on average for less than 2 months.

(39) The morpholinos are diluted to a concentration of 0.5 μg/μL in PBS and administered intramuscularly into the muscles of normal mice (WT: “Wild-type”) or Mtm1-KO (KO) mice aged 3 weeks old, at a dose of 10 μL (5 μg) into the left TA (Tibialis Anterior) muscles and 40 μL (20 μg) into the left QUA (Quadriceps) muscles. The contralateral right muscles received equivalent respective volumes of PBS.

(40) The mice are killed at the age of 5 weeks old, after assessment of their muscle function and samples of the TA and QUA muscles are taken. After being sampled, the whole muscles are weighed and then cut into two transversely. The proximal part of the muscle is weighed and frozen in liquid nitrogen whereas the distal part is frozen horizontally in cold isopentane. All of the muscles sampled are stored at −80° C.

(41) 4/Molecular Analyses

(42) Western-Blot

(43) The proteins are extracted in lysis buffer containing 10 mM Tris HCl pH 7.4, 150 mM NaCl, 5 mM EGTA, 2 mM sodium orthovanadate, 100 mM sodium fluoride (NaF), 4 mM sodium pyrophosphate, “Protease Inhibitor Cocktail” (Roche Applied Sciences), 1% Triton X-100 and 0.5% IGEPAL (Sigma-Aldrich). The muscle samples are also homogenised by grinding mechanically using the Fast-Prep® system (MP Biomedicals) and are then incubated on ice shaking occasionally for 30 (KM155C25 proteins) and 45 (C2C12 proteins and muscles) minutes, respectively. After centrifugation at 4° C. (10 min; 12,000 g), the supernatants are recovered for Western-Blot analysis. Protein concentrations are measured using the Bradford method (Bio-Rad). Total proteins are denatured for 10 min at 100° C. in a “Sample Buffer 4X” buffer (Bio-Rad) supplemented with 80 mM DTT (Dithiothreitol, Sigma-Aldrich), separated in NuPAGE® Bis-Tris gradient gels (Thermo Fisher Scientific) and then transferred onto PVDF membranes (GE Healthcare). The membranes are blocked overnight at 4° C. in a blocking buffer “Odyssey Blocking Buffer” (LI-COR) and are then incubated in the presence of a rabbit anti-dynamin 2 polyclonal antibody (Abcam) and a mouse anti-GAPDH monoclonal antibody (EMD Millipore). Detection is carried out using a secondary rabbit anti-IgG antibody bound to IRDye 800 nm (LI-COR) for dynamin 2 and a mouse secondary anti-IgG antibody bound to Alexa Fluor 680 nm (Life Technologies) for GAPDH. Signals are detected and quantified using the Odyssey infrared imaging system (LICOR).

(44) 5/Histological Analyses

(45) HE (Hematoxylin-Eosin) Staining

(46) Haematoxylin is a basic dye which has affinity for negatively charged cell components, particularly nucleic acids and therefore stain the nuclei blue. Eosin is an acid dye which has affinity for positively charged cell parts and the cytoplasm therefore is stained red. Transverse sections of muscles 8 μm thick are stained with haematoxylin-eosin (HE) using standard procedures (Autosteiner, Leica).

(47) NADH (Nicotinamide Adenine Dinucleotide) Staining

(48) NADH staining visualises the location of mitochondria and the endoplasmic reticulum. The sections are incubated for 10 min at 37° C. in 50 mM Tris buffer pH 7.2-7.4, 1.2 mM Nitroblue Tetrazolium (Sigma-Aldrich) and 0.6 mM DPNH (β-Nicotinamide Adenine Dinucleotide, reduced disodium salt hydrate, Sigma-Aldrich), washed in cold distilled water, dehydrated in the same way as for HE staining and Eukitt-mounted.

(49) Laminin Immunolabeling

(50) Laminin is a muscle cell basal membrane protein which delineates the fibre diameter. After blocking, the muscle sections are placed in contact with primary rabbit anti-laminin antibody (polyclonal, dilution 1/1000 in PBS, Dako) and rinsed 3 times in PBS before being incubated with the secondary antibody (Kit EnVision™ HRP Rabbit, Dako). The slides are rinsed again in PBS and then placed in contact for 2 to 5 min with DAB (Diaminobenzidine, Dako) and rinsed with tap water. They are passed successively through baths of 70%, 95% and 100% ethanol and then xylene, and subsequently bounded on Eukitt (Labonord).

(51) The HE, NADH and laminin slides are scanned at 10× magnification on an Axio Scan.Z1 (Zeiss) using the Genethon imaging platform. A plugin combined with ImageJ software developed by Genethon (Histoquant Version 4) is used to determine the number and diameter of fibres on the laminin labellings.

(52) 6/Analysis of Muscle Function

(53) This analysis is performed by in situ measurement of TA force in the mouse. It involves testing optimal stretching and optimal tetanus frequency (repeated electrical stimulations leading to summation and fusion of muscle twitching) at which the muscle develops its maximum force during a muscle contraction which does not require any movement.

(54) The distal TA tendon is isolated and connected to a force transducer whereas the sciatic nerve which has previously been isolated is attached to an electrode. An initial tetanus is performed at 70 Hertz-300 ms and the muscle is stretched until it reaches its maximum force. Maintaining this length (LO), the muscle is then subjected to increasing tetanus actions from 80 to 125 Hertz until its maximum force is obtained. The maximum muscle force (P0) is measured at its optimal stretching and frequency. The specific maximum force (sP0) is calculated as the ratio of the total force developed by the muscle to its weight.

(55) 7/Statistical Analyses

(56) Results have been expressed as mean±SEM (“Standard Error of the Mean”). Data were analysed for normal distributions using the Kolmogorov-Smirnoff test and individual mean values were compared using the non-parametric Mann-Whitney test. Differences were deemed to be statistically significant for P<0.05, P<0.01 and P<0.001.

B. RESULTS

(57) B-I/Study of the Murine PMO:

(58) In order to assess the therapeutic potential of the PMO targeting the Dnm2 gene, the reduction in dynamin 2 expression was measured in vitro and the best PMO were then tested in vivo on normal mice or mice suffering from myotubular myopathy (Mtm1 KO).

(59) 1/Inhibition of Dynamin 2 Expression by the PMO in C2C12 Myoblasts:

(60) In an initial stage, the effectiveness of the PMO targeting the Dnm2 gene was assessed in vitro on C2C12 cells exposed for 48 h to increasing concentrations of the six PMO targeting the Dnm2 gene (0, 1, 2 and 5 μM), respectively. From the cell protein extracts the levels of dynamin 2 expression were quantified using Western-blot (FIG. 1).

(61) Only PMO F appeared to be relatively ineffective in C2C12 cells. Although their effect was variable, expression of dynamin 2 was inhibited by the 5 other PMO: PMO A and B performed least, PMO-E had an intermediary effect whereas PMO C and PMO D which interfere with Dnm2 splicing were the most effective with approximately 50% inhibition at a concentration of 2 μM (with 90% inhibition of dynamin 2 expression at 5 μM).

(62) At the end of the in vitro test, the most effective PMO (PMO C and D) were selected to inhibit expression of dynamin 2 in vivo. The PMO were tested in two types of muscles: in a first stage, in normal mice (WT) muscles in order to establish the effective dose of PMO without toxic effects and once the dose had been defined, in muscles of Mtm1-KO mice in order to measure the therapeutic effects.

(63) 2/In Vivo Reduction of Dynamin 2 Expression by the PMO:

(64) The two PMO targeting the Dnm2 gene were injected into the left TA (5 μg) or QUA (20 μg) 3 week old normal (WT) mice and then 3 week old Mtm1-KO mice whereas the contralateral muscles received equivalent doses of PBS. After treatment for two weeks, dynamin 2 expression was quantified in these muscles using Western-blot (FIG. 2).

(65) TA and QUA of the normal mice were treated with PMO C and D to precisely define the dose to be used to avoid reducing the level of dynamin 2 excessively, as absence of dynamin 2 can be lethal in mice. At the doses tested both PMO reduced dynamin 2 expression below normal levels, reaching a minimum of 34% of the normal level in the QUA treated with PMO C.

(66) As expected, expression of dynamin 2 was greatly increased in the muscles of Mtm1-KO mice (approximately 2 and 3 times the normal level in the TA and QUA, respectively). As in the in vitro study, PMO C and D reduced dynamin 2 expression in the TA and QUA in these mice. PMO C was more effective than PMO D in the KO TA (49% of the dynamin 2 level in the TA of normal mice treated with PBS for PMO C compared to 72% for PMO D), whereas PMO D appeared to be more effective in the QUA (61% of the dynamin 2 level in the QUA of normal mice treated with PBS).

(67) 3/EFFECT of the PMO on Mouse Phenotype:

(68) 3-1 Analysis of the Physical Characteristics of Muscles:

(69) In order to determine the effect on muscle hypotrophy, the weight of the TA and QUA muscles (FIG. 3) and the diameter of the TA fibres (FIGS. 4 and 5) in both normal (WT) and Mtm1-KO mice PMO treated and PMO untreated were measured.

(70) The weight of the Mtm1-KO muscles (TA and QUA) treated with PBS was significantly less than the weight of the normal muscles (approximately 60% weight loss in the TA and 50% in the QUA), confirming the tissue hypotrophy. When the muscles were treated with PMO C and D, a large significant increase in weight is found both in the TA and in the QUA (average 50% increase in weight in the TA and 30% in the QUA). PMO C was slightly more effective than PMO D in both muscles (FIG. 3B).

(71) In order to establish whether the increase in muscle mass is due to an increase in fibre size, fibre diameter was measured after delineating the fibres by labelling with laminin, the major protein in the basal layer (FIG. 4).

(72) When the Mtm1-KO TA were treated with PMO C or D, the fibre diameter curves were shifted towards larger sized fibres (FIG. 4B) and a significant increase in mean fibre diameter was found compared to the mean diameter of KO TA treated with PBS (45% increase for PMO C and 34% for PMO D; FIG. 5B). On the other hand, the mean number of fibres remained the same (results not shown). The increase in muscle weight therefore correlated with an increase in mean fibre diameter and not with an increase in the number of fibres, reflecting a substantial reduction in the TA muscle hypotrophy in Mtm1-KO mice which was particularly high for PMO C.

(73) 3-2 Analysis of the Histological Characteristics of Muscles:

(74) The effect of treatments with the different PMO was then studied by muscle histology. To do this, the HE stains which reveal the general histology (fibre shape, position of the nuclei) were produced on transverse TA sections (FIG. 6). NADH stains which locate the mitochondria and sarcoplasmic reticulum (FIG. 7) were also prepared.

(75) The HE staining in the TA of Mtm1-KO mice treated with PBS showed hypotrophic skeletal muscle fibres which were variable in size with numerous internalised or centrally positioned nuclei.

(76) After treatment with the PMO, as seen above from measurement of fibre diameter, the muscle hypotrophy in the TA of Mtm1-KO mice was reduced. Moreover, the fibre size and the general muscle structure appeared more homogeneous (FIG. 6).

(77) However, for all of the PMO tested, no reduction was found in the number of centrally positioned nuclei under the conditions tested (results not shown).

(78) NADH labelling accumulated beneath the circumference of the fibres in the TA of Mtm1-KO mice treated with PBS, in the sub-sarcolemmal position forming “necklaces” which are characteristic of the disease. Labelling in the majority of fibres was distributed more homogeneously and less under the sarcolemma in the TA of Mtm1-KO mice treated with the PMO, reflecting relocation of the organelles (FIG. 7).

(79) 3-3 Analysis of the Functional Characteristics of Muscles

(80) In order to confirm that restoration of the main molecular and histological characteristics also restored muscle function, muscle force of the TA was measured in situ (FIGS. 8 and 9).

(81) A significant reduction in muscle force was found in the TA of Mtm1-KO mice (FIG. 9B) compared to the normal animals (WT) which received a PBS injection (95% loss in total force and 87% loss in specific force).

(82) With PMO C and D, the total and specific forces increased very considerably although the specific force increased less than total force (gain of approximately 600% and 250% for total and specific forces, respectively). In the same way as for the improvement in muscle hypotonia, PMO C was slightly more effective than PMO D.

(83) B-II/Study of Human PMO:

(84) In view of the efficacy found in mice, particularly for PMO C and PMO D, the sequences corresponding to sequences SEQ ID NO: 7 and SEQ ID NO: 8 and targeting the same regions on the human gene were obtained. The corresponding antisense (AON) intended for administration to humans were the following sequences: AON targeting the junction between exon 2 and intron 2 (PMO 2):

(85) TABLE-US-00002 (SEQ ID NO: 3) TCAGGCCGCCCCATTTTACCTGTTT; AON targeting the junction between exon 6 and intron 6 (PMO 3):

(86) TABLE-US-00003 (SEQ ID NO: 2) CGTGCAAACCCTTGCAGTACCTGAT.

(87) Furthermore, two additional human AON were tested on human myoblasts: AON targeting the 5′UTR region (PMO 1):

(88) TABLE-US-00004 (SEQ ID NO: 4) GACCCTCAACGACCTGGCCCC; AON targeting the junction between intron 7 and exon 8 (PMO 4):

(89) TABLE-US-00005 (SEQ ID NO: 1) CTGGACCATCCTATGAGGAAAAGGA.

(90) The results are shown in FIG. 10. The AON tested were effective resulting in a fall in the level of expression of human dynamin 2. Under the experimental conditions on this cell type, these Vivo-Morpholinos can be classified in the following order of efficacy: PMO 2>PMO 1>PMO 4>PMO 3.

CONCLUSIONS

(91) The PMO C and PMO D antisense agents selected after in vitro screening reduce levels of expression of dynamin 2 both in vitro and in vivo. The level of dynamin 2 should be regulated precisely as although a 50% reduction in DNM2.sup.+/− animals has no phenotypic consequences, complete absence of the protein (DNM2.sup.−/− mice) is lethal. At the end of the study, dynamin 2 levels were below normal levels in Mtm1-KO mouse muscles although expression was close to 50% of the normal level indicating that the dose and frequency of administration are appropriate.

(92) The treatment can produce a large increase in total and specific force. In addition, the weight and average size of the muscle fibres increased indicating a reduction in muscle hypotrophy. Moreover, the changes in the distribution of mitochondria and proteins associated with the triads, characteristic of the muscular phenotype of the disease were partially corrected after treatment.

(93) In conclusion, it has been shown in this study that the vivo-morpholinos tested, particularly PMO C and PMO D, are molecules with great therapeutic potential for myotubular myopathy at the doses used for effective in vivo injections, offering promising future treatment prospects in humans.

(94) In addition the human versions of the vivo-morpholinos tested confirmed that the genomic regions targeted were relevant in terms of reducing expression of human dynamin 2.

REFERENCES

(95) Bitoun, M. et al. Mutations in dynamin 2 cause dominant centronuclear myopathy. Nat Genet 37, 1207-1209, doi:10.1038/ng1657 (2005). Bolino A. et al. Charcot-Marie-Tooth type 4B is caused by mutations in the gene encoding myotubularin-related protein-2. Nat Genet. 25(1):17-9 (2000). Chen S. et al. Phenotype variability and histopathological findings in patients with a novel DNM2 mutation. Neuropathology 38(1):34-40 (2018). Cowling, B. S. et al. Increased expression of wild-type or a centronuclear myopathy mutant of dynamin 2 in skeletal muscle of adult mice leads to structural defects and muscle weakness. Am J Fathol 178, 2224-2235, doi:10.1016/j.ajpath.2011.01.054 (2011). Cowling, B. S. et al. Reducing dynamin 2 expression rescues X-linked centronuclearmyopathy. J Clin Invest 124, 1350-1363, doi:10.11723C171206 (2014). Ferguson, S. M. & De Camilli, P. Dynamin, a membrane-remodelling GTPase. Nat Rev Mol Cell Riot 13, 75-88, doi:10.1038/nrm3266 (2012). Jones, S. M., Howell, K. E., Henley, J. R., Cao, H. & McNiven, M. A. Role of dynamin in the formation of transport vesicles from the trans-Golgi network. Science 279, 573-577 (1998). Jungbluth, H., Wallgren-Pettersson, C. & Laporte, J. Centronuclear (myotubular) myopathy. Orphanet J Rare Dis 3, 26, doi:10.1186/1750-1172-3-26 (2008). Kojima, C. et al. Regulation of Bin1 SH3 domain binding by phosphoinositides. EMBO J 23, 4413-4422, doi:10.1038/sj.emboj.7600442 (2004). Laporte J. et al. A gene mutated in X-linked myotubular myopathy defines a new putative tyrosine phosphatase family conserved in yeast. Nat Genet. 13(2):175-82 (1996). Marks, B. et al. GTPase activity of dynamin and resulting conformation change are essential for endocytosis. Nature 410, 231-235, doi:10.1038/35065645 (2001). Nicot, A. S. et al. Mutations in amphiphysin 2 (BIN1) disrupt interaction with dynamin 2 and cause autosomal recessive centronuclear myopathy. Nat Genet. 39(9):1134-9 (2007). Pareyson D et al. New developments in Charcot-Marie-Tooth neuropathy and related diseases. Curr Opin Neurol. 30(5):471-480 (2017). Romero, N. B. Centronuclear myopathies: a widening concept. Neuromuscul Disord 20, 223-228, doi:10.1016/j.nmd.2010.01.014 (2010). Royer, B. et al. The myotubularin-amphiphysin 2 complex in membrane tubulation and centronuclear myopathies. EMBO Rep 14, 907-915, doi:10.1038/embor.2013.119 (2013). Schmid, S. L. & Frolov, V. A. Dynamin: functional design of a membrane fission catalyst. Annu Rev Cell Dev Biol 27, 79-105, doi:10.1146/annurev-cellbio-100109-104016 (2011). Züchner S, et al. Mutations in the pleckstrin homology domain of dynamin 2 cause dominant intermediate Charcot-Marie-Tooth disease. Nat Genet. 37(3):289-94 (2005). Züchner S, Tao F. DNM2-Related Intermediate Charcot-Marie-Tooth Neuropathy. In: Adam M P, Ardinger H H, Pagon R A, Wallace S E, Bean L J H, Stephens K, Amemiya A, editors. GeneReviews® [Internet]. Seattle (Wash.): University of Washington, Seattle; 1993-2018. 2010 Jul. 8 [updated 2015 Jun. 25].