Serotonin 5-HT2A, 5-HT2B, and 5-HT2C Receptor Inverse Agonists
20240327353 ยท 2024-10-03
Inventors
Cpc classification
A61K31/4409
HUMAN NECESSITIES
C07D213/38
CHEMISTRY; METALLURGY
A61K31/135
HUMAN NECESSITIES
C07D307/52
CHEMISTRY; METALLURGY
C07C211/49
CHEMISTRY; METALLURGY
C07C211/42
CHEMISTRY; METALLURGY
A61K31/341
HUMAN NECESSITIES
International classification
C07D213/38
CHEMISTRY; METALLURGY
C07C211/42
CHEMISTRY; METALLURGY
C07C211/49
CHEMISTRY; METALLURGY
C07D307/52
CHEMISTRY; METALLURGY
A61K31/135
HUMAN NECESSITIES
A61K31/341
HUMAN NECESSITIES
Abstract
4-phenyl-2-dimethylaminotetralin compounds, formulations, and methods are provided for selective modulation of serotonin 5-HT2A and 5-HT2C receptors without causing sedation at doses that are antipsychotic. Mechanisms for selective modulation are shown to involve inverse agonism at one or more of the 5-HT2A-2C receptors based on stereochemistry and substituents. The technology can be targeted to receptors inside or outside the central nervous system.
Claims
1. A compound for selective modulation of one or more of serotonin 5-HT2A and 5-HT2C receptors, the compound having a structure according to Formula I: ##STR00085## wherein Y is selected from the group consisting of ##STR00086## wherein covalent bond z is attached at any carbon atom of Y; wherein Y is unsubstituted or is substituted with one or more moieties V, each of the one or more moieties V independently selected from the group consisting F, Cl, Br, I, NH.sub.2, NH(CH.sub.3), N(CH.sub.3).sub.2, NH(CH.sub.2CH.sub.3), N(CH.sub.2CH.sub.3).sub.2, C?NH, C?NNH.sub.2, C?ONH.sub.2, NO.sub.2, NO, CN, N.sub.3, N?C?O, CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, C?OOH, CH.sub.2C?OOH, S?OCH.sub.3, S(?O).sub.2CH.sub.3, S(?O).sub.2OH, S(?O).sub.2NH.sub.2, S(?O).sub.2N(CH.sub.3).sub.2, OH, OCN, OCH.sub.3, OCH.sub.2CH.sub.3, CH.sub.2OH, CH.sub.2CH.sub.2OH, CHOHCH.sub.2OH, CHOHCH.sub.3, SH, SCN, SCH.sub.3, SCH.sub.2CH.sub.3, CH.sub.2SH, CH.sub.2CH.sub.2SH, CHSHCH.sub.2SH, CHSHCH.sub.3, and substituted or unsubstituted thiophene, furanyl, phenyl and pyridyl; and wherein the compound comprises at least 50% of a single stereoisomer selected from the group of stereoisomers consisting of 2R4R, 2S4S, 2R4S, and 2S4R; or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
2. The compound of claim 1, wherein one or more moieties V are independently selected from the group consisting of ##STR00087## wherein V is attached to Y via a covalent bond to any one of carbons 5-7 of V; and wherein V is substituted with one or more substituents W, each of the one or more substituents W independently selected from the group consisting of F, Cl, Br, I, NH.sub.2, NH(CH.sub.3), N(CH.sub.3).sub.2, NH(CH.sub.2CH.sub.3), N(CH.sub.2CH.sub.3).sub.2, C?NH, C?NNH.sub.2, C?ONH.sub.2, NO.sub.2, NO, CN, N.sub.3, N?C?O, CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, C?OOH, CH.sub.2C?OOH, S?OCH.sub.3, S(?O).sub.2CH.sub.3, S(?O).sub.2OH, S(?O).sub.2NH.sub.2, S(?O).sub.2N(CH.sub.3).sub.2, OH, OCN, OCH.sub.3, OCH.sub.2CH.sub.3, CH.sub.2OH, CH.sub.2CH.sub.2OH, CHOHCH.sub.2OH, CHOHCH.sub.3, SH, SCN, SCH.sub.3, SCH.sub.2CH.sub.3, CH.sub.2SH, CH.sub.2CH.sub.2SH, CHSHCH.sub.2SH and CHSHCH.sub.3.
3. The compound of claim 1, wherein the compound comprises at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of said single stereoisomer.
4. The compound of claim 1, wherein Y is bound to C through the bond z attached at carbon atom x of Y.
5. The compound of claim 1, wherein the compound is selected from the group consisting of the following compounds: ##STR00088## ##STR00089## ##STR00090## ##STR00091## ##STR00092## ##STR00093## ##STR00094## ##STR00095## ##STR00096## ##STR00097## ##STR00098## or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
6. The compound of claim 1, wherein the compound is a neutral antagonist or an inverse agonist at one or more of the 5-HT2A and 5-HT2C receptors.
7. The compound of claim 1, wherein the compound does not cause sedation when administered to a subject at physiologically relevant levels.
8. The compound of claim 1, wherein the compound comprises a greater binding affinity at 5-HT2A receptor and/or 5-HT2C receptor than at 5-HT2B receptor.
9. The compound of claim 1, wherein the compound has a greater binding affinity for 5-HT2A receptor and 5-HT2C receptor than for 5-HT1A, 5-HT2B, 5-HT7, D2, D3, alpha1A, and/or alpha1B receptors.
10. The compound of claim 1, wherein the compound is a neutral antagonist or an inverse agonist at a histamine (H1) receptor at physiologically relevant levels.
11. The compound of claim 1, wherein the compound comprises a greater binding affinity at 5-HT2A receptors and/or 5-HT2C receptors than at the H1 receptor.
12. The compound of claim 1, wherein the one or more moieties V and/or W comprise a positive and/or a negative charge at a physiological pH.
13. The compound of claim 12, comprising a pharmaceutically acceptable anion comprising acetate, adipate, aspartate, benzenesulfonate, benzoate, besylate, bicarbonate, bitartrate, bromide, camsylate, caprate, caproate, caprylate, carbonate, chloride, citrate, decanoate, dodecylsulfate, edetate, esylate, formate, fumarate, gluceptate, gluconate, glutamate, glycolate, hexanoate, hydroxynaphthoate, iodide, isethionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylsulfate, mucate, napsylate, nitrate, octanoate, oleate, oxalate, palmitate, pamoate, pantothenate, phosphate, dihydrogen phosphate dodecahydrate, dihydrogen phosphate dihydrate, polygalacturonate, propionate, sabacate, salicylate, stearate, acetate, succinate, sulfate, tartrate, teoclate, thiocyanate, tosylate, or undecylenate.
14. The compound of claim 12, comprising a pharmaceutically acceptable cation comprising aluminum, arginine, benzathine, calcium, chloroprocaine, choline, diethanolamine, ethanolamine, ethylenediamine, lysine, magnesium, histidine, lithium, meglumine, potassium, procaine, sodium, triethylamine, or zinc.
15. The compound of claim 1, wherein the compound comprises a hydrate or a solvate comprising one or more water molecules and/or one or more solvent molecules associated via hydrogen bonding and/or ionic bonding to the compound and/or to an anion or cation associated with the compound.
16. The compound of claim 1, wherein the compound comprises one or more of .sup.18F, .sup.19F, .sup.75Br, .sup.76Br, .sup.123I, .sup.124I, .sup.125I, .sup.131I, .sup.11C, .sup.13C, .sup.13N, .sup.15O, or .sup.3H.
17. The compound of claim 1, wherein the compound selectively modulates a physiological activity of 5-HT2A and/or 5-HT2C receptors over a physiological activity of one or more of 5-HT1A, 5-HT2B, 5HT7, D2, D3, ?1A, and ?1B receptors.
18. The compound of claim 17, wherein said selective modulation is associated with a difference in binding affinity, inverse agonism, agonism, partial agonism, allosteric agonism, antagonism, partial antagonism, or allosteric antagonism.
19. A pharmaceutical composition comprising a therapeutically effective amount of a compound of claim 1 and an excipient.
20. The pharmaceutical composition of claim 19 comprising an amount of said compound that aids in treating psychosis, fragile X syndrome, autism, substance use disorder, or an impulsive behavior.
21. The pharmaceutical composition of claim 19 comprising an amount of said compound that aids in treating hypertension, migraine, obesity, irritable bowel syndrome, Parkinson's disease, attention deficit hyperactivity disorder, anxiety or generalized anxiety, depression, schizophrenia, binge eating, opioid use disorder, amphetamine use disorder, panic disorder, social anxiety disorder, obsessive-compulsive disorder, pain, Alzheimer's disease, or Huntington's disease.
22. The pharmaceutical composition of claim 19, wherein the compound comprises (2R,4S)-(trans)-4-(3-(thiophen-2-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, (2R,4S)-(trans)-4-(3-(furan-2-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, or (2S,4S)-(cis)-4-([1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine.
23. A method to aid in treating a disease or disorder, the method comprising administering an effective amount of a compound of any of claims 1-18 to a mammalian subject in need thereof.
24. The method of claim 23, wherein the compound is administered as the pharmaceutical composition of claim 19.
25. The method of claim 23, wherein said administering does not cause sedation, dizziness, and/or orthostatic hypotension.
26. The method of claim 23, wherein the disease or disorder is a neuropsychiatric disorder is selected from the group consisting of psychosis, fragile X syndrome, autism, substance use disorder, and impulsive behaviors.
27. The method of claim 23, wherein the disease or disorder is selected from the group consisting of hypertension, migraine, obesity, irritable bowel syndrome, Parkinson's disease, attention deficit hyperactivity disorder, anxiety or generalized anxiety, depression, schizophrenia, binge eating, opioid use disorder, amphetamine use disorder, panic disorder, social anxiety disorder, obsessive-compulsive disorder, pain, Alzheimer's disease, or Huntington's disease.
28. The method of claim 23, wherein said administering results in selective modulation of a serotonin 5-HT2A or 5-HT2C receptor in the subject.
29. The method of claim 18, wherein the selective modulation comprises inverse agonism, agonism, partial agonism, allosteric agonism, antagonism, partial antagonism, allosteric antagonism, or a difference in binding affinity compared to a different receptor type.
30. Use of the compound of claim 1 to treat or prevent psychosis, fragile X syndrome, autism, substance use disorder, impulsive behaviors, hypertension, migraine, obesity, irritable bowel syndrome, Parkinson's disease, attention deficit hyperactivity disorder, anxiety or generalized anxiety, depression, schizophrenia, binge eating, opioid use disorder, amphetamine use disorder, panic disorder, social anxiety disorder, obsessive-compulsive disorder, pain, Alzheimer's disease, and/or Huntington's disease in a mammalian subject.
31. The use of claim 30, wherein said use does not cause sedation in the subject.
32. The use of claim 30, wherein said use does not agonize 5-HT2B receptors and/or does not antagonize H1 receptors in the subject.
33. A compound for selective modulation of one or more of peripheral serotonin 5-HT2A, 5-HT2B, and 5-HT2C receptors, the compound having a structure according to Formula I: ##STR00099## wherein E is a quaternary amine selected from the group consisting of N.sup.+(CH.sub.3).sub.3, N.sup.+(CH.sub.3).sub.2(CH.sub.2CH.sub.3), N.sup.+(CH.sub.3)(CH.sub.2CH.sub.3).sub.2, and N.sup.+(CH.sub.2CH.sub.3).sub.3; wherein Y is selected from the group consisting of: ##STR00100## wherein covalent bond z is attached at any carbon atom of Y; wherein Y is unsubstituted or is substituted with one or more moieties V, each of the one or more moieties V independently selected from the group consisting F, Cl, Br, I, NH.sub.2, NH(CH.sub.3), N(CH.sub.3).sub.2, NH(CH.sub.2CH.sub.3), N(CH.sub.2CH.sub.3).sub.2, C?NH, C?NNH.sub.2, C?ONH.sub.2, NO.sub.2, NO, CN, N.sub.3, N?C?O, CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, C?OOH, CH.sub.2C?OOH, S?OCH.sub.3, S(?O).sub.2CH.sub.3, S(?O).sub.2OH, S(?O).sub.2NH.sub.2, S(?O).sub.2N(CH.sub.3).sub.2, OH, OCN, OCH.sub.3, OCH.sub.2CH.sub.3, CH.sub.2OH, CH.sub.2CH.sub.2OH, CHOHCH.sub.2OH, CHOHCH.sub.3, SH, SCN, SCH.sub.3, SCH.sub.2CH.sub.3, CH.sub.2SH, CH.sub.2CH.sub.2SH, CHSHCH.sub.2SH, CHSHCH.sub.3, and substituted or unsubstituted thiophene, furanyl, phenyl and pyridyl; and wherein the compound comprises at least 50% of a single stereoisomer selected from the group of stereoisomers consisting of 2R4R, 2S4S, 2R4S, and 2S4R; or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
34. The compound of claim 33, wherein one or more moieties V are independently selected from the group consisting of: ##STR00101## wherein V is attached to Y via a covalent bond to any one of carbons 5-7 of V; and wherein V is substituted with one or more substituents W, each of the one or more substituents W independently selected from the group consisting of F, Cl, Br, I, NH.sub.2, NH(CH.sub.3), N(CH.sub.3).sub.2, NH(CH.sub.2CH.sub.3), N(CH.sub.2CH.sub.3).sub.2, C?NH, C?NNH.sub.2, C?ONH.sub.2, NO.sub.2, NO, CN, N.sub.3, N?C?O, CH.sub.3, CH.sub.2CH.sub.3, CH(CH.sub.3).sub.2, C?OOH, CH.sub.2C?OOH, S?OCH.sub.3, S(?O).sub.2CH.sub.3, S(?O).sub.2OH, S(?O).sub.2NH.sub.2, S(?O).sub.2N(CH.sub.3).sub.2, OH, OCN, OCH.sub.3, OCH.sub.2CH.sub.3, CH.sub.2OH, CH.sub.2CH.sub.2OH, CHOHCH.sub.2OH, CHOHCH.sub.3, SH, SCN, SCH.sub.3, SCH.sub.2CH.sub.3, CH.sub.2SH, CH.sub.2CH.sub.2SH, CHSHCH.sub.2SH and CHSHCH.sub.3.
35. The compound of claim 33, wherein the compound comprises at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of said single stereoisomer.
36. The compound of claim 33, wherein Y is bound to C through the bond z attached at the carbon atom x of Y.
37. The compound of claim 33, wherein the compound is selected from the group consisting of: ##STR00102## ##STR00103## ##STR00104## ##STR00105## ##STR00106## ##STR00107## ##STR00108## ##STR00109## or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
38. The compound of claim 33, wherein the compound is an antagonist, a neutral antagonist or an inverse agonist at one or more of the 5-HT2A, 5-HT2B, and 5-HT2C receptors.
39. The compound of claim 33, wherein the compound has a greater binding affinity for 5-HT2A, 5-HT2B, and/or 5-HT2C receptors than for 5-HT1A, 5-HT7, D2, D3, alpha1A, and/or alpha1B receptors.
40. The compound of claim 33, comprising a pharmaceutically acceptable anion selected from the group consisting of acetate, adipate, aspartate, benzenesulfonate, benzoate, besylate, bicarbonate, bitartrate, bromide, camsylate, caprate, caproate, caprylate, carbonate, chloride, citrate, decanoate, dodecylsulfate, edetate, esylate, formate, fumarate, gluceptate, gluconate, glutamate, glycolate, hexanoate, hydroxynaphthoate, iodide, isethionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylsulfate, mucate, napsylate, nitrate, octanoate, oleate, oxalate, palmitate, pamoate, pantothenate, phosphate, dihydrogen phosphate dodecahydrate, dihydrogen phosphate dihydrate, polygalacturonate, propionate, sabacate, salicylate, stearate, acetate, succinate, sulfate, tartrate, teoclate, thiocyanate, tosylate, and undecylenate.
41. The compound of claim 33, wherein the compound comprises one or more of .sup.18F, .sup.19F, .sup.75Br, .sup.76Br, .sup.123I, .sup.124I, .sup.125I, .sup.131I, .sup.11C, .sup.13C, .sup.13N, .sup.15O, or .sup.3H.
42. The compound of claim 33, wherein the compound selectively modulates a physiological activity of 5-HT2A, 5-HT2B, and/or 5-HT2C receptors over a physiological activity of one or more of 5-HT1A, 5HT7, D2, D3, ?1A, and ?1B receptors.
43. The compound of claim 42, wherein said selective modulation is associated with a difference in binding affinity, inverse agonism, agonism, partial agonism, allosteric agonism, antagonism, partial antagonism, or allosteric antagonism.
44. A pharmaceutical composition comprising a compound of claim 33 and an excipient.
45. The pharmaceutical composition of claim 44, wherein the compound comprises (2R,4S)-(trans)-4-(3-(thiophen-2-yl)phenyl)-N,N,N-trimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, (2R,4S)-(trans)-4-(3-(furan-2-yl)phenyl)-N,N,N-trimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, or (2S,4S)-(cis)-4-([1,1-biphenyl]-3-yl)-N,N,N-trimethyl-1,2,3,4-tetrahydronaphthalen-2-amine.
46. A method to aid in treating a disease or disorder, the method comprising administering an effective amount of a compound of 33 to a mammalian subject in need thereof.
47. The method of claim 46, wherein the disease or disorder is selected from the group consisting of hypertension, thrombosis, deep vein thrombosis, pulmonary embolus, atrial fibrillation, atherosclerosis, valvular atherosclerosis, cardiac fibrosis, obesity, irritable bowel syndrome, and lack of bladder control.
48. The method of claim 47, wherein the subject further suffers from a neuropsychiatric disease or disorder, such as depression.
49. The method of claim 46, wherein the method results in inverse agonism, antagonism, partial antagonism, or allosteric antagonism at a peripheral 5-HT-2A, 5-HT2B, and/or 5-HT2C receptor.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
DETAILED DESCRIPTION
[0044] The present technology provides novel 4-phenyl-2-dimethylaminotetralin (4-PAT) compounds that can be utilized in treating or preventing neuropsychiatric disorders. Similar to other 5HT.sub.2C agonists with 5HT.sub.2A/2B antagonist/inverse agonist compounds of the 2-aminotetralin chemotype, which are active in rodent and monkey models of psychosis, the present 4-PAT compounds can be used to treat, for example, fragile X syndrome, autism, impulsive behaviors such as occur with attention deficit hyperactivity disorder and binge eating, and substance use disorder (particularly, opioid use disorder and amphetamines use disorder). There are no drugs currently approved to treat psychosis associated with the neurodevelopmental disorder fragile X syndrome (orphan therapeutic indication) or autism. Current approved antipsychotic medications cause sedation (in non-fragile X patients) or other neurological side effects. The present 4-PAT compounds do not cause sedation.
[0045] The present technology provides examples of at least 42 new chemical entities that are single enantiomer drug compounds. The examples of at least 42 new chemical entities that are single enantiomer drug compounds can optionally be configured so that the compound or composition does not substantially accumulate in the human brain (e.g., Scheme 11,
[0046] The present technology provides novel 4-phenyl-2-dimethylaminotetralin (4-PAT) compounds and compositions that can be utilized in treating or preventing a variety of disorders of the periphery, in particular because their distribution within the body of the subject is restricted to the periphery, i.e., the compound does not substantially accumulate in the human brain. The E group shown in
[0047] The compound or composition is not rapidly metabolized in the periphery. In various examples, the compounds and compositions, or formulations thereof, deliver a physiological amount of the present compound or composition to the periphery for at least about 6 hours, or at least about 9 hours, or at least about 12 hours, or at least about 15 hours, or at least about 18 hours, or at least about 21 hours, or at least about 24 hours. In various examples, the compounds and compositions, or formulations thereof, deliver a physiological amount of the present compound or composition to the periphery for about 6 hours, or about 9 hours, or about 12 hours, or about 15 hours, or about 18 hours, or about 21 hours, or about 24 hours.
[0048] The centrally-acting 4-PAT compounds of the present technology can be used to aid in treating or preventing, for example, migraine, Parkinson's disease, attention deficit hyperactivity disorder, anxiety or generalized anxiety, depression, schizophrenia, binge eating, opioid use disorder, fragile X syndrome, amphetamine use disorder, panic disorder, social anxiety disorder, obsessive-compulsive disorder, pain, Alzheimer's disease, or Huntington's disease.
[0049] The peripherally acting 4-PAT compounds of the present technology can be used to aid in treating or preventing, for example, hypertension, thrombosis, deep vein thrombosis, pulmonary embolus, atrial fibrillation, atherosclerosis, valvular atherosclerosis, cardiac fibrosis, obesity, irritable bowel syndrome, and lack of bladder control.
[0050] 5HT.sub.2C agonists with 5HT.sub.2A/2B antagonist/inverse agonist activity of the 2-aminotetralin chemotype demonstrate high efficacy and safety in rodent and monkey animal models of psychoses and substance use disorders (amphetamines and opioids), as described in U.S. Pat. No. 8,586,634B2, U.S. Pat. No. 9,024,071B2, U.S. Pat. No. 9,862,674B2 and U.S. Ser. No. 10/017,458B2, each of which is hereby incorporated by reference in its entirety. There are no drugs approved to treat psychosis associated with the neurodevelopmental disorder fragile X syndrome (an orphan therapeutic indication) or autism, and the 4-PAT chemotypes disclosed herein demonstrate outstanding potential for these therapeutic indications.
[0051] Synthetic methods described herein include Friedel-Crafts cycli-acyl/alkylation of the commercially available 3-bromostyrene and phenylacetyl chloride to give the intermediate tetralone. The tetralone is subjected to reductive amination to afford a separable mixture of 3-Br-4-phenyl-2-aminotetralin diastereomers. Reductive amination produces racemic cis or trans-4-phenyl-2-aminotetralins that are separated via silica gel column chromatography. Substituents are introduced at the 3-position via Suzuki-Miyaura coupling of the 3-Br-4-PAT diastereomers with the corresponding boronic acids. The bench-top stable MIDA ester is used successfully to introduce thiophen-2-yl and furan-2-yl fragments into the 3-Br-4-PATs. The racemic mixtures of trans-analogs are separated by a semi-preparative chiral HPLC column using conditions and solvents specific to each analog to elute the trans-(2R,4S) and trans-(2S,4R) enantiomers at representative retention times t1 and t2, respectively, with absolute stereochemistry assigned according to retention time of the previously published trans-3CI-4-PAT analog. Chiral HPLC separation yields the (2R,4S)-trans-4-(3-(thiophen-2-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine and (2R,4S)-trans-4-(3-(furan-2-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine.
[0052] The compounds presented herein are water soluble and can be administered as oral formulations. The technology includes pharmaceutical compositions and formulations including the compounds. Examples of formulations can include drug in capsule with or without excipients additives or buffers, subcutaneous and IV formulations, mixtures with citric acid, lactic acid, solvents, propylene glycol, osmolality adjusting salts or sugars, purified water, or other excipients.
[0053] The centrally acting (e.g., uncharged) compounds presented herein cross into the brain when administered to rodents and engage serotonin 5HT2 receptors to produce antipsychotic effects. The compounds do not cause neurological side effects at doses that are antipsychotic. The 5-HT receptor (5-HTR) subtypes 5-HT.sub.2A and 5-HT.sub.2C are important neurotherapeutic targets, though, obtaining selectivity over 5-HT.sub.2B and closely related histamine H.sub.1Rs is challenging. Herein are delineated molecular determinants of selective binding to 5-HT.sub.2A and 5-HT.sub.2CRs using novel 4-PATs.
[0054] Example compounds are compared to 5-HT, HIS, DOX, RIT and PIMA in exploratory functional screening at 5-HT.sub.2-type receptors (Rs) 5-HT.sub.2A, 5-HT.sub.2B, 5-HT.sub.2C and H.sub.1Rs in
[0055] Most 4-PAT diastereomers in the (2S,4R)-configuration bind non-selectively to 5-HT.sub.2A, 5-HT.sub.2C, and H.sub.1Rs, with >100-fold selectivity over 5-HT.sub.2BRs, whereas diastereomers in the (2R,4R)-configuration bind preferentially to 5-HT.sub.2A over 5-HT.sub.2CRs and have >100-fold selectivity over 5-HT.sub.2B and H.sub.1Rs. Results suggest that G238.sup.5.42 and V235.sup.5.39 (
[0056] The novel 4-PAT chemotype can yield selective 5-HT.sub.2A/5-HT.sub.2CR inverse agonists for antipsychotic drug development by optimizing ligand-receptor interactions in transmembrane domain 5. It is shown that chirality can be exploited to attain selectivity over H.sub.1Rs to help circumvent sedative effects. High homology between 5-HT.sub.2-type and histamine H.sub.1Rs could prevent development of antipsychotics without sedative effects.
[0057] The 4-phenyl-2-dimethylaminotetralin (4-PAT,
TABLE-US-00001 TABLE 1 Affinity (pK.sub.i) of reference ligands and novel 2-aminotetralins at 5-HT.sub.2A, 5-HT .sub.2B, 5-HT.sub.2C, and H.sub.1Rs.sup.a. pK.sub.i.sup.(n) Stereo- Range Cmpd Y chemistry 5-HT .sub.2AR 5-HT.sub.2BR 5-HT.sub.2CR H.sub.1R PIMA 9.62.sup.(2) 6.36 ? 0.50.sup.(5) 8.56.sup.(2) 5.50.sup.(2) 9.64-9.60 6.86-5.68 8.67-8.46 5.76-5.25 Risperidone 9.53.sup.(2) 7.81.sup.(2) 7.72.sup.(2) 7.74.sup.(2) 9.54-9.52 7.9-7.71 7.76-7.68 7.8-7.68 3a
[0058] Structure-activity relationships (SAR) for 4-PATs acting at 5-HT.sub.2-type and H.sub.1Rs are developed using competitive radioligand displacement and functional assays. The data reveal that aryl substituted 4-PATs are potent 5-HT.sub.2A-preferring 5-HT.sub.2A/5-HT.sub.2CR inverse agonists with selectivity over 5-HT.sub.2B and H.sub.1Rs. To understand the molecular determinants for selectivity and inverse agonism at 5-HT.sub.2ARs, in silico molecular modeling is performed and used to guide site-directed mutagenesis of residues in receptor transmembrane (TM) domains 4 and 5. The potency and selectivity of certain aryl substituted 4-PATs at 5-HT.sub.2A and 5-HT.sub.2CRs (e.g., [2S,4R]-2k, and [2R,4R]-3h) resemble PIMA, thus, a comparison is made of 4-PATs to PIMA in vitro and in silico. Comparative in vivo assessments in mice are also performed, utilizing the (?)-2,5-dimethoxy-4-iodoamphetamine (DOI)-elicited head twitch response as a model to screen for central 5-HT.sub.2AR engagement and antipsychotic-like activity, and locomotor activity assays to assess behavioral disruption and untoward motor effects.
[0059] The optimized synthetic methods demonstrated herein generate novel cis- and trans-4-PAT enantiomers separable by chiral-HPLC. Competitive radioligand binding studies at 5-HT.sub.2-type and H.sub.1Rs indicate that small meta-halo substituents (e.g., F, Cl, Br) on ring C (
[0060] The affinity (pK.sub.i) of the FDA-approved antipsychotic drugs PIMA and risperidone under that same assay conditions used for 4-PATs are assessed in Table 1. Notably, while the 4-PAT leads (2S,4R)-2k and (2R,4R)-3h, as well as PIMA and risperidone, have moderate to high selectivity over 5-HT.sub.2B (?50-3,000-fold) and H.sub.1Rs (?40-15,000-fold), only risperidone displays high affinity at all receptors tested. The 4-PAT leads (2S,4R)-2k and (2R,4R)-3h have high affinity and inverse agonist activity at 5-HT.sub.2A and 5-HT.sub.2CRs comparable to PIMA and risperidone. While (2S,4R)-2k trends toward agonist activity at 5-HT.sub.2BRs, this ligand may not pose cardiovascular concerns given its low potency and efficacy (Unett, et al., 2013).
[0061] At 5-HT.sub.2ARs, no rank order in the radioligand-derived affinity (pKi) is observed. However, when comparing the functionally derived affinity (pKb), a clear rank order in potency appears (i.e., PIMA >[2S,4R]-2k>[2R,4R]-3h). The observed discontinuities are not investigated further but may involve differences in the biological milieu between experimental formats using a membrane preparation (radioligand binding assays) and whole live cells (functional assays). Biological milieu, including the membrane environment and effector expression, may vary between cell lines (Symons, et al., 2021; Zhang, et al., 2017) and transfections (Lee, et al., 2019) to impact functional signaling (Gutierrez, et al., 2016; Lefkowitz, et al., 2002). The results highlight the necessity of implementing orthogonal assays and reference ligands (e.g., PIMA and risperidone) to characterize ligand affinity and function (Tran, et al., 2019).
[0062] Comparing the affinity of 4-PATs at 5-HT.sub.2-type and H.sub.1Rs in Table 1, previous lab work shows that meta-halo substituted trans-4-PATs, including (2S,4R)-2a, display higher affinity at 5-HT.sub.2-type receptors than the parent unsubstituted analog (2S,4R)-1 (Sakhuja, et al., 2015). However, the impact of meta-halo substitution on the affinity of cis-4-PATs at 5-HT.sub.2-type receptors has not been reported. Here, it is shown that cis-diastereomers of the previously reported meta-Br substituted 4-PAT, 2a, and its meta-CI and meta-F congeners (3a, 3b and 3b, respectively) demonstrate moderate (pK.sub.i=6.5-7.5) to low (pK.sub.i<6.5) affinity at 5-HT.sub.2-type receptors in the (2R,4R)-configuration. These values resemble those for the unsubstituted cis-4-PATs previously reported (Booth, Fang et al., 2009), though larger, more polarizable substituents have higher affinity (pK.sub.i 3a>3b>3b). The corresponding (2S,4S)-enantiomers, on the other hand, exhibit high affinity (pK.sub.i>7.5) at H.sub.1Rs, with robust selectivity (40-280-fold) over 5-HT.sub.2-type receptors. Due to their unimpressive affinity at, and selectivity for, 5-HT.sub.2-type receptors, analogs 3a, 3b or 3b are not explored further (Table 1).
[0063] It is hypothesized that the chiral nature of the 4-PAT chemotype combined with steric bulk at the meta-position of ring C (
[0064] Heteroaromatic substitution on ring C (i.e., 2c-e and 3c-e) yields five-membered heterocycles (2c-d, 3c-d) which bind to 5-HT.sub.2A, 5-HT.sub.2C, and H.sub.1Rs in the (2S,4R)-configuration with high affinity and moderate selectivity for 5-HT.sub.2A and 5-HT.sub.2C over 5-HT.sub.2BRs (?20-40-fold). In contrast to analogs (2S,4S)-3a-b, the (2S,4S)-3c meta-thiophen-2-yl analog has low affinity at, and no selectivity for, H.sub.1Rs. Meanwhile, (2R,4R)-3c preferentially binds to 5-HT.sub.2A and 5-HT.sub.2CRs, with highest affinity at 5-HT.sub.2ARs and moderate selectivity (?30-60-fold) over 5-HT.sub.2B and H.sub.1Rs. The meta-pyridin-2-yl (2e, 3e) analogs have moderate to low affinity at 5-HT.sub.2-type receptors, however, (2S,4R)-2e and (2R,4R)-3e have high affinity at H.sub.1Rs, thus, 2e, 3e are not pursued in further investigation.
[0065] The reassessment of (2S,4R)-2f indicates that, contrary to a 2015 report where the ligand displayed high affinity and selectivity for 5-HT.sub.2CRs (Sakhuja, et al., 2015), it binds non-selectively to 5-HT.sub.2A, 5-HT.sub.2C, and H.sub.1Rs, with moderate selectivity over 5-HT.sub.2BRs (70-fold). Substitution effects on phenyl ring D are then investigated using a fluorine-walk approach, wherein, fluorine is mono-substituted at each position (2g-i and 3g-i). The 3-FC.sub.6H4 substituted diastereomer, (2R,4R)-3h, shows highest affinity at 5-HT.sub.2ARs, with 33-fold selectivity over 5-HT.sub.2CRs, 415-fold selectivity over 5-HT.sub.2BRs, and ?1,300-fold selectivity over H.sub.1Rs, making it the most 5-HT.sub.2AR-selective 4-PAT-type compound reported herein. Its diastereomer, (2S,4R)-2h, exhibits high affinity at 5-HT.sub.2A and 5-HT.sub.2CRs, with ?30-fold selectivity over 5-HT.sub.2BRs, and no selectivity over H.sub.1Rs. Thus, (2R,4R)-3h is chosen as a lead for further characterization in vivo, as well as in vitro and in silico to identify molecular determinants for selective binding to 5-HT.sub.2ARs.
[0066] The 4-FC.sub.6H.sub.4 substituted analog (2S,4R)-2i has high affinity at 5-HT.sub.2A and 5-HT.sub.2CRs, 140-fold selectivity for 5-HT.sub.2ARs over 5-HT.sub.2BRs, though, selectivity over H.sub.1Rs is modest (5-fold). Similarly, the 4-CIC.sub.6H.sub.4 substituted analog (2S,4R)-2j has 143-fold selectivity for 5-HT.sub.2ARs over 5-HT.sub.2BRs, and no selectivity over H.sub.1Rs. The diastereomer, (2R,4R)-3j, retains high affinity for 5-HT.sub.2A and 5-HT.sub.2CRs, and shows ?100- and ?225-fold selectivity for 5-HT.sub.2ARs over 5-HT.sub.2B and H.sub.1Rs, respectively.
[0067] To explore electronic and steric effects, a 4-NMe.sub.2C.sub.6H.sub.4 substituent is introduced on ring C (2k, 3k), yielding stereoisomers with a computationally determined log P?5.69 (log D?3.77). Notably, these are slightly lower than that of 2i, 3i (log P?5.85, log D?3.86), 2j, 3j (log P?6.36, log D?4.41), and the other lead, (2R,4R)-3h (log P?5.85, log D?3.79). Like other aryl substituted 4-PATs in the (2R,4R)-configuration (i.e., 3c-3k), compound (2R,4R)-3k shows modest selectivity to bind 5-HT.sub.2ARs over 5-HT.sub.2CRs (?7-fold) and high selectivity over 5-HT.sub.2B and H.sub.1Rs (>350-fold). In contrast, (2S,4R)-2k has similarly high affinity at both 5-HT.sub.2A and 5-HT.sub.2CRs, with high selectivity over 5-HT.sub.2BRs (?180-fold) and moderate selectivity over H.sub.1Rs (?38-fold). Since (2S,4R)-2k portrays dual 5-HT.sub.2A/5-HT.sub.2CR activity with selectivity over 5-HT.sub.2B and H.sub.1Rs, (2S,4R)-2k is selected, along with the 5-HT.sub.2AR selective analog (2R,4R)-3h (above), for further investigation in vitro, in vivo, and in silico.
[0068] To compare the affinity of 4-PATs with FDA-approved antipsychotic drugs, an assessment is made of the affinity of PIMA and risperidone at 5-HT.sub.2-type and H.sub.1Rs. In this work, PIMA exhibited high affinity for 5-HT.sub.2ARs, with modest selectivity (12-fold) over 5-HT.sub.2CRs, and high selectivity over 5-HT.sub.2B and H.sub.1Rs (>3,000-fold). Risperidone is equipotent to PIMA at 5-HT.sub.2ARs and has high affinity at the other receptors. The results are consistent with those in the literature (Vanover, et al., 2006; Chopko & Lindsley, 2018).
[0069] Investigations of the functional activity of 4-PATs and PIMA at 5-HT.sub.2Rs and H.sub.1Rs are conducted with the exploratory functional screening presented in
[0070] The binding and functional screening results indicate that PIMA, (2S,4R)-2k, and (2R,4R)-3h exhibit similar affinity, and inverse agonist efficacy, at therapeutically favorable 5-HT.sub.2A and 5-HT.sub.2CRs. Therefore, these compounds are comparatively assessed in concentration-response assays using clonal cells (
TABLE-US-00002 TABLE 2 Functional potencies of reference and 2-aminotetralin antagonists (pK.sub.b), and 5-HT (pEC.sub.50), at 5-HT.sub.2AR variants.sup.a, b. Wild type I210V.sup.4.60 F213K.sup.4.63 D231F.sup.5.35 V235M.sup.5.39 G238S.sup.5.42 S242A.sup.5.46 pK.sub.b (n) PIMA 8.24 ? 0.31 8.25 ? 0.31 8.56 ? 0.35 NC.sup.c 8.62 ? 0.14* 4.61 ? 0.50* 8.22 ? 0.44 (16) (5) (5) (5) (5) (5) Risperidone 8.88 ? 0.17 8.81 ? 0.31 8.83 ? 0.19 NC 8.93 ? 0.13 8.69 ? 0.09* 8.95 ? 0.23 (14) (5) (5) (5) (5) (5) (2S,4R)-2a 6.97 ? 0.27 7.1 ? 0.31 6.82 ? 0.25 NC 7.25 ? 0.51 5.87 ? 0.13* 6.90 ? 0.38 (16) (5) (5) (5) (5) (5) (2S,4R)-2k 7.91 ? 0.26 8.06 ? 0.17 7.94 ? 0.34 NC 8.35 ? 0.11* 4.92 ? 0.31* 7.95 ? 0.42 (18) (5) (5) (5) (5) (5) (2R,4R)-3h 6.97 ? 0.37 7.18 ? 0.22 7.04 ? 0.17 NC 7.02 ? 0.26 4.59 ? 0.48* 6.85 ? 0.36 (16) (5) (5) (5) (5) (5) pEC.sub.50 (n) 5-HT 7.53 ? 0.16 7.44 ? 0.24 7.21 ? 0.16* NC (5) 7.34 ? 0.13* 6.37 ? 0.24* 7.29 ? 0.17* (19) (6) (5) (5) (7) (6) .sup.aThe equilibrium dissociation constant (pK.sub.b) of 5-HT.sub.2AR antagonists is determined in the presence of 1 ?M 5-HT. .sup.bData are presented as the pK.sub.b ? SD or pEC.sub.50 ? SD for the number of independent experiments indicated in parenthesis, see FIGS. 11A-11G for data visualization. .sup.cNot calculable. Asterisk * indicates statistical significance (p < 0.05) between the wild-type and mutant receptor parameters using an unpaired t-test.
[0071] In
[0072] This leads to the question if the apparent greater effect of 0.3 mg*kg.sup.?1 PIMA in the DOI-assay might result from behaviorally disruptive effects on locomotor activity. Thus, each compound is administered alone at 3 mg*kg.sup.?1, and it is found that PIMA, but not (2S,4R)-2k or (2R,4R)-3h, elicits locomotor suppression (
[0073] Some 2-aminotetralins substituted at the C(5)- or C(8)-position have high affinity at 5-HT.sub.1A and 5-HT.sub.7Rs (Perry, et al., 2020), while others target D.sub.2-like receptors (Seiler & Markstein, 1984). Furthermore, affinity at 5-HT.sub.2B and ?.sub.1B-adrenergic receptors may predict ligand promiscuity (Peters, et al., 2012), and high affinity antagonism of central ?.sub.1A/1B-adrenergic receptors is associated with adverse events such as orthostatic hypotension, dizziness, and sedation (Andersson & Gratzke, 2007). Similarly, antagonism of central H.sub.1Rs is linked to sedation in humans (Nicholson, et al., 1991; Stahl, 2008; Valk & Simons, 2009). The lead 4-PATs from this study, (2S,4R)-2k and (2R,4R)-3h, display high selectivity to bind 5-HT.sub.2A/5-HT.sub.2CRs over 5-HT.sub.1A, 5HT.sub.2B, 5HT.sub.7, D.sub.2, D.sub.3, ?.sub.1A- and ?.sub.1B-adrenergic receptors (>100-fold), whereas selectivity over H.sub.1Rs is moderate for (2S,4R)-2k (?38-fold).
[0074] To understand how aryl substituted 4-PATs and PIMA bind to 5-HT.sub.2ARs, molecular modeling studies are performed using a model of the 5-HT.sub.2AR (
[0075]
[0076] Site-directed mutagenesis is used to validate the proposed ligand-receptor interactions. Indeed, the mutagenesis studies reveal that (2S,4R)-2k and (2R,4R)-3h have nil affinity (pK.sub.b) at G238S.sup.5.42 5-HT.sub.2ARs, whereas the affinity of (2S,4R)-2a, which lacks aryl ring D, is less affected. Confounding is that 5-HT.sub.2BRs also present G.sup.5.42, yet aryl substituted 4-PATs do not bind with high affinity to 5-HT.sub.2BRs. The molecular modeling results with the 5-HT.sub.2AR bound to inverse agonists PIMA, (2S,4R)-2k and (2R,4R)-3h reveal similar binding modes for each ligand (
[0077] Interestingly, aryl substituted 4-PATs in the (2S,4R)-configuration have high affinity for H.sub.1Rs (Table 1), despite the presence of T194.sup.5.42, which possesses a bulkier side chain than serine. The molecular modeling results suggest that W158.sup.4.56, a residue unique to H.sub.1Rs, might form stereospecific aromatic interactions with 4-PATs to impart high affinity (
[0078] Overall, PIMA, (2S,4R)-2k, and (2R,4R)-3h stabilize an inactive-like conformation of the 5-HT.sub.2AR, typified by an ionic lock between R173.sup.3.50 and E318.sup.6.30 within the E/DRY domain (
[0079] The models also indicate that the isobutoxybenzyl moiety of PIMA and aryl ring D of (2S,4R)-2k and (2R,4R)-3h occupy a side cavity between TM4 and TM5, unimpeded by the small side chain of G238.sup.5.42, a residue unique to 5-HT.sub.2-type receptors among aminergic GPCRs. Furthermore, in all models, F234.sup.5.38 assumes a rotamer conformation oriented away from G238.sup.5.42, which is suggested to extend the side cavity (Kimura, et al., 2019). Several amphipathic and hydrophobic side chains in this region of the binding pocket (I210.sup.4.60, V235.sup.5.39, G238.sup.5.42, and S242.sup.5.46) are close enough to the isobutoxybenzyl of PIMA and aryl ring D of (2S,4R)-2k and (2R,4R)-3h to facilitate interactions (Table 3), thus providing a potential structural basis for the observed selectivity of these ligands to bind 5-HT.sub.2ARs. In Table 3, conserved residues are highlighted in parenthesis; results for point-mutated 5-HT.sub.2AR residues in bold (with quotation marks) are reported herein.
TABLE-US-00003 TABLE 3 Residues within 4.0 ? of docked PIMA, (2S,4R)-2k, or (2R,4R)- 3h at 5-HT.sub.2ARs following molecular dynamics simulations, and equivalent residues at 5-HT.sub.2B, 5-HT.sub.2C, and H.sub.1 GPCRs. 5-HT.sub.2A 5-HT.sub.2B 5-HT.sub.2C H.sub.1 D155.sup.3.32 (D) (D) (D) V156.sup.3.33 (V) (V) (Y) S159.sup.3.36 (S) (S) (S) T160.sup.3.37 (T) (T) (T) I163.sup.3.40 (I) (I) (I) I206.sup.4.56 (I) V W S207.sup.4.57 A (S) V P209.sup.4.59 (P) (P) (P) I210.sup.4.60 V (I) (I) C227.sup.45.50a (C) (C) (C) L229.sup.45.52 (L) (L) T F234.sup.5.38 (F) (F) (F) V235.sup.5.39 M (M) K I237.sup.5.41b F (I) M G238.sup.5.42 (G) (G) T S239.sup.5.43 (S) (S) A V241.sup.5.45b A (M) I S242.sup.5.46 A A N F243.sup.5.47 (F) (F) (F) F332.sup.6.44 (F) (F) F) W336.sup.6.48 (W) (W) (W) F339.sup.6.51 (F) (F) (Y) F340.sup.6.52 (F) (F) (F) V366.sup.7.39 (V) (V) I Y370.sup.7.43c (Y) (Y) Y .sup.aWithin 4 ? of only (2S,4R)-2k .sup.bOnly within 4 ? of PIMA .sup.cOnly within 4 ? of (2R,4R)-3h
[0080] To validate the molecular modeling results, residues are point-mutated in and around the 5-HT.sub.2AR side-extended cavity (Kimura, et al., 2019) and quantified the antagonist affinity (pK.sub.b) of (2S,4R)-2k and (2R,4R)-3h, as well as (2S,4R)-2a (which lacks 5-HT.sub.2R subtype selectivity) at 5-HT.sub.2AR variants to understand how stereochemistry and aryl ring D impact ligand-receptor interactions. Notably, like PIMA, (2S,4R)-2k, and (2R,4R)-3h, key analog (2S,4R)-2a demonstrate inverse agonist activity at C322K.sup.6.34 5-HT.sub.2ARs (
[0081] A G238S.sup.5.42 5-HT.sub.2AR is generated to test the hypothesis that the large side chain of serine precludes ligand access to the side extended cavity, as suggested by the molecular modeling results (
[0082] The experiments are extended by asking if the attenuated affinity of (2S,4R)-2a, (2S,4R)-2k, and (2R,4R)-3h at G238S.sup.5.42 5-HT.sub.2ARs translates to aminergic GPCRs natively presenting S.sup.5.42. Table 4 shows that (2S,4R)-2k and (2R,4R)-3h have >1,000-fold selectivity for 5-HT.sub.2ARs over 5-HT.sub.1A, 5-HT.sub.7, D.sub.2L, ?.sub.1A- and ?.sub.1B-adrenergic GPCRs. It is noted that (2S,4R)-2k has 270-fold selectivity over D.sub.3Rs, whereas (2R,4R)-3h has >1,000-fold selectivity. In contrast, (2S,4R)-2a exhibits moderate-to-high affinity for 5-HT.sub.7, D.sub.2L, D.sub.3, and ?.sub.1A-adrenergic receptors.
TABLE-US-00004 TABLE 4 Affinities (pK.sub.i) of (2S,4R)-2a, (2S,4R)-2k, and (2R,4R)- 3h at aminergic GPCRs natively presenting S.sup.5.42a 5-HT.sub.1A 5-HT.sub.7 D.sub.2L D.sub.3 ?.sub.1A ?.sub.1B (2S,4R)-2a <5.0.sup.(2) 7.38.sup.(3) 7.16.sup.(3) 6.92.sup.(2) 7.99.sup.(3) 5.49.sup.(3) 7.47-7.23 7.18-7.14 6.90-6.93 8.30-7.77 5.76-5.22 (2S,4R)-2k 5.58.sup.(3) 6.28.sup.(3) 5.70.sup.(3) 6.92.sup.(3) 6.21 .sup.(2) 6.19.sup.(2) 5.81-5.32 6.42-6.17 6.05-5.60 7.21-6.75 6.31-6.10 6.21-6.17 (2R,4R)-3h <5.0.sup.(3) 6.29.sup.(4) <5.0.sup.(3) 6.21 .sup.(3) 6.13.sup.(2) 6.10.sup.(2) 6.66-6.11 6.63-5.94 6.20-6.06 6.14-6.07 .sup.aData are presented as the mean pK.sub.i and range for n independent experiments, shown in superscript.
[0083] Alignment of 5-HT.sub.2A, 5-HT.sub.2B and 5-HT.sub.2CR crystal structures (
[0084] Further inspection of the 5-HT.sub.2-type receptor crystal structures reveals that one helical turn above F.sup.5.38 in 5-HT.sub.2A and 5-HT.sub.2CRs exists a non-conserved residue in 5-HT.sub.2BRs (D2315.35 D211.sup.5.35, and F214.sup.535, respectively). The root-mean-square deviation (RMSD) of the F.sup.5.38 side chain in WT 5-HT.sub.2A and 5-HT.sub.2BRs is tracked in silico and found that F.sup.5.38 exhibited large transient variations in RMSD in WT 5-HT.sub.2ARs. Interestingly, the RMSD of F.sup.5.38 in D231F.sup.5.35 5-HT.sub.2ARs recapitulates the restricted pattern observed in silico for WT 5-HT.sub.2BRs, indicating that D231.sup.5.35 may facilitate flexibility in the side chain of F.sup.5.38 (
[0085] It is therefore hypothesized that D231.sup.5.35 may modulate the side chain rotamer of F234.sup.5.38 in 5-HT.sub.2ARs to mediate subtype selective binding. To test this hypothesis, a D231F.sup.5.35 5-HT.sub.2AR is generated, however, D231F.sup.5.35 5-HT.sub.2ARs are insufficiently responsive to 5-HT for competitive antagonism studies (
[0086] Residues in TM4 and TM5 lining the side-extended cavity of 5-HT.sub.2ARs and in proximity to PIMA, (2S,4R)-2k, and (2R,4R)-3h (Table 3) are then investigated. Among these are the side chains of I210.sup.4.60, V235.sup.5.39, and S242.sup.5.46. Importantly, the side chains of I210.sup.4.60 and V235.sup.5.39 are conserved in 5-HT.sub.2CRs, while S242.sup.5.46 is unique to 5-HT.sub.2ARs. It is hypothesized that selectivity to bind 5-HT.sub.2A and 5-HT.sub.2CRs over 5-HT.sub.2BRs may involve interactions with the side chains of I.sup.4.60, V.sup.5.39, or the 5-HT.sub.2AR-specific residue S242.sup.5.46. In fact, a significant increase in the affinity of PIMA and (2S,4R)-2k at V235M.sup.5.39 5-HT.sub.2ARs is observed, with no change in affinity for any antagonist at I210V.sup.4.60 or S242A.sup.5.46 5-HT.sub.2ARs (Table 2,
[0087] To explain the observed selectivity of PIMA, (2S,4R)-2k, and (2R,4R)-3h to bind 5-HT.sub.2ARs over 5-HT.sub.2BRs, the focus is made on non-conserved residues which line the 5-HT.sub.2AR side extended cavity. The results indicate that the affinity and selectivity of inverse agonists to bind 5-HT.sub.2ARs does not individually involve the side chains of I210.sup.4.60, F213.sup.4.63, V235.sup.5.39, or S242.sup.5.46, since point mutation to the equivalent residues in 5-HT.sub.2BRs does not attenuate their affinity. Importantly, the finding that selective inverse agonists have similar affinity at F213K.sup.4.63 and WT 5-HT.sub.2ARs suggests a refinement to the current understanding of subtype selective binding at 5-HT.sub.2ARs (Kimura, et al., 2019). An attempt is made to identify a 5-HT.sub.2AR residue other than F213.sup.4.63 which may impact the side chain rotamer of F.sup.5.38, and the computational results directed this work to D231.3.sup.5. However, D231F.sup.5.35 5-HT.sub.2ARs lack sufficient Ga.sub.q functionality and cannot bind various radioligands, which, to the best of knowledge of the literature, is reported here for the first time. Each ligand is 9-10 ? from D231.sup.5.35 in the molecular models herein, thus, direct interactions are unlikely. Instead, it is speculated that D231F.sup.5.35 may hinder proper protein folding and trafficking of the receptor to the membrane.
[0088] In an embodiment, the 4-NMe.sub.2C.sub.6H.sub.4 substituent introduced on ring C (2k, 3k) in the stereoisomers is utilized to determine molecular determinants of selective binding to 5-HT.sub.2A and 5-HT.sub.2CRs including substituents of a length about that of NMe.sub.2 on ring D (
[0089] Like the observations with 5-HT.sub.2BRs, the selectivity of some aryl substituted 4-PATs to bind 5-HT.sub.2A over H.sub.1Rs cannot be explained by the results with G238S.sup.5.42 5-HT.sub.2ARs. For example, H.sub.1Rs present T194.sup.5.42, yet aryl substituted 4-PATs in the (2S,4R)-configuration, but not the (2R,4R)-configuration, bind to H.sub.1Rs with high affinity. Molecular dynamics studies revealing the structural basis of 4-PAT stereoselectivity at histamine H.sub.1Rs are shown in
[0090] The research disclosed here details the discovery of a novel series of selective 5-HT.sub.2A/5-HT.sub.2CR inverse agonists (i.e., aryl substituted 4-PATs), which are behaviorally active at comparable doses to PIMA, an FDA-approved drug. Efforts to detail the mechanism of their selectivity over 5-HT.sub.2BRs are challenging, though evidence is provided herein that F213.sup.4.63 is not a molecular determinant of subtype-selective inverse agonist binding at 5-HT.sub.2ARs. Also G228S.sup.5.42 5-HT.sub.2ARs are identified as a point mutated 5-HT.sub.2AR which may predict ligand selectivity over several aminergic GPCRs. In most cases, the mutagenesis studies reveal only minor changes in antagonist affinity, i.e., ?(pK.sub.b)?0.5. Therefore, it is surmised that ensembles of non-conserved residues, rather than individual residues, mediate subtype-selective antagonist or inverse agonist binding at 5-HT.sub.2ARs. In line with this, herein is reported a non-conserved, stereochemically sensitive molecular ensemble for H.sub.1R recognition. Taken together, the results warrant further investigation into the ability of aryl substituted 4-PAT diastereomers to unlock the molecular determinants of subtype-selective binding at 5-HT.sub.2ARs, and preclinical characterization of analogs like (2S,4R)-2k in animal models of psychosis.
[0091] These data show that antagonist activity at G238S.sup.5.42 5-HT.sub.2ARs is predictive of ligand selectivity over several aminergic GPCRs, and non-conserved residues in transmembrane domains 4 and 5 of the H.sub.1R mediate stereoselective ligand binding. The clinical significance is relevant because understanding the molecular determinants of selective binding over H.sub.1Rs may yield non-sedating antipsychotic medications, and aryl substituted 4-PATs demonstrate pharmacology like PIMA yet do not alter locomotor activity in mice.
Examples of psychiatric therapeutic indications
1. Schizophrenia.
[0092] An example of psychiatric therapeutic indications for 5-HT.sub.2A and 5-HT.sub.2C inverse agonists or antagonists is schizophrenia. As documented in Casey, et al., 2022 and references therein, reduction of serotonin 5-HT.sub.2A receptor signaling via receptor antagonism and/or inverse agonism reported for the compounds in Casey, et al., 2022 is associated with clinical drug efficacy to treat schizophrenia and other conditions involving psychosis characterized by hallucinations and delusions (references in Casey, et al., 2022: Hacksell, et al., 2014; Meltzer, 1999 and Weiner, et al., 2001).
[0093] In addition, reduction of serotonin 5-HT.sub.2C receptor signaling via receptor antagonism and/or inverse agonism reported for the novel compounds in Casey et al., 2022 also is associated clinically with drug efficacy to treat schizophrenia (references in Casey, et al., 2022: Chagraoui, et al., 2016).
2. Psychoses.
[0094] Regarding psychoses, as documented in Casey, et al., 2022, inverse agonist activity at the serotonin 5-HT.sub.2C receptor reported for the novel compounds in Casey, et al., 2022 is associated clinically with treatment of psychoses (reference in Casey, et al., 2022: Chagraoui, et al., 2016). For example, the selective 5-HT.sub.2A/5-HT.sub.2C receptor inverse agonist PIMA (Zuplazid?) is FDA approved to treat hallucinations and delusions associated with Parkinson's disease psychosis (reference in Casey, et al., 2022: Cummings, et al., 2014).
[0095] In addition, the novel compounds reported in Casey, et al., 2022 likely will be effective to treat psychosis and dementia associated with Alzheimer's disease and other disorders characterized dementia. For example, the selective 5-HT.sub.2A/5-HT.sub.2C receptor inverse agonist PIMA is undergoing clinical assessment for efficacy to treat psychosis in Alzheimer's disease (Caraci, et al., 2020; Ballard, et al., 2020; Ballard, et al., 2018; Tariot, et al., 2021).
3. Depression.
[0096] As documented in Casey, et al., 2022, the novel compounds reported demonstrate inverse agonism of 5-HT.sub.2C receptors which is thought to be pharmacotherapeutic for major depression (reference in Casey, et al., 2022; Demireva et al., 2018).
4. Anxiety.
[0097] Regarding anxiety, as documented in Casey, et al., 2022, the novel compounds reported demonstrate inverse agonism of 5-HT.sub.2C receptors which is thought to be pharmacotherapeutic for generalized anxiety (reference in Casey, et al., 2022: Demireva, et al., 2018). Note that anxiety behavior is associated with a wide variety of neuropsychiatric (including substance use disorder), neurodegenerative (AD, PD), and neurodevelopmental (autism) disorders, all of which may be therapeutic indications for the novel compounds reported in Casey, et al., 2022 and analogs thereof (Fluyau, et al., 2022; Simonoff, et al., 2008; El Haj, et al., 2020; Wen, et al., 2016).
Examples of non-psychiatric therapeutic indications:
B. Thrombosis
[0098] Thrombosis or the prevention thereof (which can be referred to as blood thinners) is most often treated with drugs that affect the blood clotting cascade such as heparin (a natural product used intravenously) and warfarin (an orally-active natural product anticoagulant) and the newer synthetic and much more expensive blood thinning drugs apixaban (Eliquis), dabigatran (Pradaxa), edoxaban (Savaysa), and rivaroxaban (Xarelto). They are used to prevent blood clots associated with deep vein thrombosis, pulmonary emboli, atrial fibrillation and other heart and cardiovascular system disorders where pathophysiology involves blood clots. Activation of 5HT2.sub.A receptors on platelets activates membrane bound phospholipase C to produce the second messengers inositol phosphates and diacylgylcerol which cause the platelets to become stickythe platelets adhere to each other and form a clot.
[0099] Although thrombosis pathophysiology and potential pharmacotherapy involving 5HT2.sub.A receptor antagonism is known (e.g., Lin, et al., 2014), most 5HT2.sub.A antagonists also enter the brain to produce psychopharmacological effects that are not necessary and may be counterproductive for cardiovascular disorders. In Lin, the authors note that the 5HT2.sub.A antagonists they mention are antidepressants (not commonly used as such because there are much better ones such as the SSRIs that work differently) thus they suggest the therapeutic indication should be depressed patients who have thrombosis disorders. A 4PAT-type 5HT2.sub.A antagonist or inverse agonist is claimed to prevent this thrombosis or reverse it in patients where psychotropic actions are not needed.
C. 5HT2B Inverse Agonists/Antagonists to Treat Cardiac Fibrosis-Related Conditions.
[0100] 5-HT.sub.2B inverse agonists/antagonists can be utilized for treatment of atherosclerosis. Activation of 5HT.sub.2B causes atherosclerosis of cardiac valves. In Janssen, et al., 2015, for example, 5-HT.sub.2B receptor antagonists have been investigated to inhibit fibrosis and protect from RV (right ventricular) heart failure. The present technology can provide selectivity between the CNS and the periphery with ligand specificity.
D. Hypertension treatment by 5-HT2A antagonists
[0101] It is reported in Casey, et al., 2022 that the new chemical entities are potent 5-HT.sub.2A antagonists. It is known for several decades that antagonism of 5-HT.sub.2A receptor leads to beneficial cardiovascular effects including reduced platelet aggregation and vasodilation. For example, the 5-HT.sub.2A antagonist ketanserin is approved to treat hypertension (Hedner & Persson, 1988; Bellos, et al., 2020; Nagatomo, et al., 2004).
E. Migraine treatment by 5-HT2B antagonists.
[0102] It is reported in Casey, et al., 2022 that the new chemical entities are potent 5-HT.sub.2B antagonists and inverse agonists. Exploiting their expression in the CNS vascular system, 5-HT2B antagonists are proposed to treat migraine headache (Padhariya, et al., 2017).
F. Obesity treatment by 5-HT2B antagonists
[0103] It is reported in Casey, et al., 2022 that the new chemical entities are potent 5-HT.sub.2B antagonists and inverse agonists. Exploiting their expression in the gastrointestinal system, 5-HT.sub.2B antagonists are proposed to obesity (Padhariya, et al., 2017).
G. Irritable bowel syndrome (IBS) treatment by 5-HT2B antagonists
[0104] It is reported in Casey, et al., 2022 that the new chemical entities are potent 5-HT.sub.2B antagonists and inverse agonists. Exploiting their expression in the gastrointestinal system, 5-HT.sub.2B antagonists are proposed to treat irritable bowel syndrome (IBS) (Padhariya, et al., 2017).
H. Safety of the novel chemical entities reported in Casey et al., 2022.
[0105] The novel chemical entities reported in Casey, et al., 2022 and analogs thereof are unlikely to demonstrate untoward cardiovascular effects because it is documented in the paper that the compounds are inverse agonists at the serotonin 5-HT.sub.2B receptor. Agonists at 5-HT.sub.2B receptors have potential to cause valvular heart disease and other untoward cardiovascular effects (references in Casey, et al., 2022: Ayme-Dietrich, et al., 2017; Rothman, et al., 2000).
[0106] Also as reported in Casey et al., 2022, the novel compounds did not demonstrate inhibition of locomotor activity (bradykinesia) indicating it is unlikely the compounds and analogs thereof will cause sedation or neurological disorders (Berardelli, et al., 2001).
EXAMPLES
Example 1. Chemical Syntheses
[0107] All commercially available regents and solvents were purchased and used without purification, unless otherwise specified. Flash column chromatography was performed with the use of Agela Technologies 230-400 mesh silica gel. Analytical thin-layer chromatography (TLC) was carried out on Agela Technologies silica gel 60F254 plates. Final compounds were converted from free base to HCl salt either before or after NMR analysis, as noted. All spectra were recorded by a Varian 500 MHz, 400 MHz NMR in CDCl.sub.3 or CD.sub.3OD as noted and are expressed as chemical shift (6) values in parts per million (ppm). Coupling constants (J) are presented in Hertz. Abbreviations used in the reporting of NMR spectra include s=singlet, bs=broad singlet, d=doublet, t=triplet, q=quartet, dd=doublet of doublets, qd=quartet of doublets, dt=doublet of triplets, m=multiplets. High resolution mass spectrometry (HRMS) was performed with an LTQ Orbitrap XL (Thermo Fisher Scientific) instrument using electron spray ionization (ESI). Sample data were acquired with MS1 scan (m/z 50-500) at 30,000 resolution using the Orbitrap as the MS detector. HPLC separation of both enantiomers was determined by UV Trace 220/254 nm on a Shimadzu? instrument equipped with a semi-preparative (s-prep)-RegisCell? (5 ?m, 25 cm?10 mm i.d.) chiral (polysaccharide-based) column.
[0108] To efficiently produce novel 4-PAT derivatives, designing and implementing an improved synthetic route than reported earlier was accomplished (Sakhuja, et al., 2015). Previously, key compounds like 2a were synthesized using a four-step procedure from commercially available 3-bromostyrene and trifluoroacetyl phenylacetyl anhydride (Canal, et al., 2014; Sakhuja, et al., 2015). The overall yield for this pathway, however, was low, and reproducibility in large scale was unreliable. The modified synthetic pathway utilized here involved Friedel-Crafts cycli-acylalkylation of the commercially available 3-bromostyrene and phenylacetyl chloride to give the intermediate tetralone 6a (Scheme 1). The tetralone was subjected to reductive amination to afford a separable mixture of 3-Br-4-PAT diastereomers with improved overall yields (2a 32% yield, 3a 25% yield). The reductive amination step was further optimized to obtain racemic cis-4-PATs (e.g., [2S,4S], [2R,4R]) as the major isomer. The modified protocol involved reduction of a preformed enamine with sodium borohydride (Scheme 2).
##STR00037##
TABLE-US-00005 SCHEME 2 Optimized synthesis of 4-PAT analogs (3a, 3b, 3b).
[0109] Diastereomeric 3-Br-4-PATs 2a and 3a (Scheme 1,
TABLE-US-00006 SCHEME 3 Synthesis of aryl substituted analogs 2c-k and 3c-k.
[0110] The absolute stereochemistry of optically pure cis-4-PAT isomers (separated by chiral HPLC) was determined using X-ray crystallography on crystals of (2R,4R)-3b and (2S,4S)-3b (
[0111] 4-(3-bromophenyl)-3,4-dihydronaphthalen-2(1H)-one 6a: To an oven dried 100 mL round bottom flask with stir bar was added anhydrous AlCl.sub.3 (800 mg, 6.0 mmol) and CH.sub.2Cl.sub.2 (20 ml) under nitrogen atmosphere. The resulting suspension was transferred to an ice bath and cooled for 10 minutes. To the reaction flask was slowly added phenylacetyl chloride 5 (661 ?L, 5.0 mmol). The resulting mixture was stirred for 10 minutes under nitrogen atmosphere in an ice bath. To the reaction mixture was then added 3-bromostyrene 4 (664 ?L, 5.1 mmol) and the resulting solution was stirred for 30 minutes on ice bath. Water (50 mL) was added to the flask and the organic layer was separated. The aqueous layer was extracted with CH.sub.2Cl.sub.2 (20 mL?3). The combined organic layer was washed with saturated aq NaHCO.sub.3 (30 mL?2) followed by brine (30 mL) and dried over Na.sub.2SO.sub.4. After evaporation of solvent the crude reaction mixture was purified by silica gel column chromatography (97:3 hexanes: ethyl acetate) to afford 4-(3-bromophenyl)-3,4-dihydronaphthalen-2(1H)-one 6a as colorless solid with 60% yield.
[0112] Trans-4-(3-bromophenyl)-N, N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine 2a and cis-4-(3-bromophenyl)-N, N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine 3a: To an oven dried 100 mL round bottom flask with stir bar was added ketone 6 (1.12 g, 3.72 mmol), dimethylamine hydrochloride (3.0 g, 37.2 mmol), Tetrahydrofuran (28 mL) and methanol (37 mL). The resulting mixture was stirred at room temperature under nitrogen atmosphere until all solid dissolved. To the reaction mixture was added sodium cyanoborohydride (1.18 g, 18.8 mmol) and the flask was transferred to an oil bath. The resulting reaction mixture was stirred for 16 h under nitrogen atmosphere at 50? C. The solvent was evaporated and to the residue was added saturated aq NaHCO.sub.3 (50 mL) and ethyl acetate (25 mL). The organic layer was separated, and the aqueous layer was extracted with ethyl acetate (25 mL?4). The combined organic layer was washed with brine (30 mL) and dried over Na.sub.2SO.sub.4. After evaporation of solvent the crude reaction mixture was purified by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) to afford cis-3a as colorless oil with 42% yield and trans-2a as colorless oil with 54% isolated yield.
[0113] General procedure to synthesize amine 3a, 3b and 3b: To an oven dried 10 mL round bottom flask with stir bar was added ketone 6 (1.0 mmol), 10M solution of dimethylamine in ethanol (130 ?L, 1.3 mmol), 4 ? molecular sieves and toluene (1.0 mL). To the resulting mixture was added glacial acetic acid (11 ?L, 0.2 mmol). The reaction mixture was stirred at room temperature for 24 h under nitrogen atmosphere (Scheme 4). In an another over dried flask with stir bar was added sodium borohydride (95 mg, 2.5 mmol) and methanol (3 mL). The flask was cooled to ?78? C. under nitrogen atmosphere. To the cooled mixture was added previously formed imine reaction mixture through a filter syringe. Resulting reaction mixture was stirred at ?78? C. for 3 h, then the reaction flask was slowly warmed to rt. The reaction mixture was stirred overnight at rt under nitrogen atmosphere. The solvent was evaporated and to the residue was added saturated aq NaHCO.sub.3 (15 mL) and ethyl acetate (10 mL). The organic layer was separated, and the aqueous layer was extracted with ethyl acetate (10 mL?4). The combined organic layer was washed with brine (15 mL) and dried over Na.sub.2SO.sub.4. After evaporation of solvent the crude reaction mixture was purified by silica gel column chromatography to afford cis-amines as colorless oil.
TABLE-US-00007 SCHEME 4 Optimized synthesis of Cis-analogues (3a, 3b, 3b).
[0114] The racemic mixtures of cis-analogs were separated by semi-preparative chiral HPLC Regiscell? column using conditions and solvents specific to each analog to elute the cis-(2S,4S) and -(2R,4R) enantiomers at retention time t.sub.1 at t.sub.2, respectively. The absolute stereochemistry was assigned by correlating retention time to the x-ray crystal structure of (2R,4R)-cis-3-CI-4-PAT, 3b and (2S,4S)-cis-3-F-4-PAT, 3b analogs (
[0115] Cis-4-(3-bromophenyl)-N, N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3a: amine 3a was synthesized from ketone 6a following the general procedure as described above. The crude reaction mixture (cis:trans 10:1) was purified by silica gel column chromatography (4:2:0.1 hexanes: ethyl acetate: triethylamine) to afford racemic cis-4-(3-bromophenyl)-N, N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine 3a as colorless oil with 45% isolated yield. .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.38 (d, J=7.9 Hz, 1H), 7.33 (s, 1H), 7.19 (t, J=7.8 Hz, 1H), 7.15-7.10 (m, 3H), 7.03 (t, J=7.3 Hz, 1H), 6.73 (d, J=7.8 Hz, 1H), 4.07 (dd, J=12.2, 5.2 Hz, 1H), 3.04-3.00 (m, 1H), 2.95-2.90 (m, 1H), 2.80 (tdd, J=11.5, 4.7, 2.3 Hz, 1H), 2.37 (s, 6H), 2.33 (ddd, J=9.9, 5.2, 2.5 Hz, 1H), 1.68 (q, J=12.1 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl3): ? 149.14, 138.64, 136.49, 131.86, 130.29, 129.68, 129.63, 129.28, 127.57, 126.46, 126.17, 122.74, 60.56, 47.10, 41.60, 36.93, 33.08.
[0116] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 13.01 (s, 1H), 7.42 (d, J=8.0 Hz, 1H), 7.31 (s, 1H), 7.23-7.17 (m, 3H), 7.13-7.10 (m, 2H), 6.77 (d, J=7.8 Hz, 1H), 4.19 (dd, J=12.1, 5.2 Hz, 1H), 3.65-3.59 (m, 1H), 3.43-3.39 (m, 1H), 3.31-3.26 (m, J=13.6 Hz, 1H), 2.85-2.84 (m, 6H), 2.69 (dt, J=12.2, 2.6 Hz, 1H), 2.00 (q, J=12.2 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 146.64, 137.05, 132.01, 131.67, 130.58, 130.47, 129.52, 129.38, 127.57, 127.42, 127.33, 122.95, 61.76, 45.82, 39.76, 39.44, 34.24, 30.19. Calculated C1.sub.8H.sub.21BrN for [M+H].sup.+: 330.0858. Found: 330.0859. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (85:10:5) 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=1.5 mL/min; t.sub.1=14.41 min, t.sub.2=19.71 min.
[0117] 4-(3-chlorophenyl)-3,4-dihydronaphthalen-2(1H)-one 6b: Ketone 6b was synthesized from 3-chlorostyrene 4b and phenylacetyl chloride 5 in presence of AlCl.sub.3 following the procedure as described above for 6a. The crude reaction mixture was purified by silica gel column chromatography (95:5 hexanes: ethyl acetate) to afford 4-(3-chlorophenyl)-3,4-dihydronaphthalen-2(1)-one 6b as colorless oil with 60% isolated yield. .sup.1H and .sup.13C NMRs are in agreement with previously published data (Vincek & Booth, 2009).
[0118] Cis-4-(3-chlorophenyl)-N, N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3b: amine 3b was synthesized from ketone 6b following the general procedure as described above. The crude reaction mixture (cis:trans 7:1) was purified by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) to afford racemic cis-4-(3-chlorophenyl)-N, N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine 6b as colorless oil with 40% isolated yield. .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.25-7.21 (m, 2H), 7.17-7.12 (m, 3H), 7.07 (d, J=7.1 Hz, 1H), 7.03 (t, J=7.2 Hz, 1H), 6.73 (d, J=7.8 Hz, 1H), 4.08 (dd, J=12.2, 5.1 Hz, 1H), 3.03 (ddd, J=15.6, 4.5, 1.9 Hz, 1H), 2.93 (dd, J=12.4, 11.4 Hz, 1H), 2.81 (tdd, J=11.5, 4.6, 2.3 Hz, 1H), 2.38 (s, 6H), 2.35-2.31 (m, J=2.6 Hz, 1H), 1.69 (q, J=12.1 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 148.80, 138.62, 136.43, 134.42, 129.93, 129.60, 129.24, 128.92, 127.07, 126.72, 126.43, 126.13, 60.54, 47.08, 41.55, 36.87, 33.02.
[0119] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.88 (s, 1H), 7.29-7.27 (m, 2H), 7.21-7.15 (m, 3H), 7.12-7.07 (m, 2H), 6.77 (d, J=7.7 Hz, 1H), 4.21 (dd, J=12.0, 5.1 Hz, 1H), 3.64 (td, J=11.0, 1.9 Hz, 1H), 3.42-3.39 (m, 1H), 3.31-3.26 (m, 1H), 2.85 (s, 6H), 2.70-2.67 (m, 1H), 2.00 (q, J=12.2 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 146.36, 137.06, 134.67, 132.03, 130.24, 129.48, 129.33, 128.76, 127.48, 127.34, 127.26, 127.08, 61.72, 45.79, 39.75, 39.43, 34.16, 30.19. Calculated C.sub.18H.sub.21ClN for [M+H].sup.+: 286.1363. Found: 286.1359. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH:.sup.nPrOH (80:10:5:5) 0.1% TEA (modifier) 0.1% TFA (modifier); flow rate=1.5 mL/min; t.sub.1=11.0 min, t.sub.2=13.0 min.
[0120] 4-(3-fluorophenyl)-3,4-dihydronaphthalen-2(1H)-one 6b: Ketone 6b was synthesized from 3-fluorostyrene 4b and phenylacetyl chloride 5 in presence of AlCl.sub.3 following the procedure as described above for 6a. The crude reaction mixture was purified by silica gel column chromatography (95:5 hexanes: ethyl acetate) to afford 4-(3-fluorophenyl)-3,4-dihydronaphthalen-2(1)-one 6b as colorless oil with 50% isolated yield. .sup.1H and .sup.13C NMRs are in agreement with previously published data (Vincek & Booth, 2009).
[0121] Cis-4-(3-fluorophenyl)-N, N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3b: amine 3b was synthesized from ketone 6b following the general procedure as described above. The crude reaction mixture (cis:trans 10:1) was purified by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) to afford racemic cis-4-(3-fluorophenyl)-N, N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine 6b as colorless oil with 35% isolated yield. .sup.1H-NMR (500 MHz; CDCl.sub.3): 7.26-7.23 (m, 1H), 7.15-7.12 (m, 2H), 7.08-7.04 (m, 1H), 6.95-6.91 (m, 2H), 6.80 (d, J=9.3 Hz, 1H), 6.71 (d, J=7.7 Hz, 1H), 4.09 (dd, J=12.2, 5.2 Hz, 1H), 3.06-3.02 (m, 1H), 2.94 (dd, J=12.4, 11.2 Hz, 1H), 2.79-2.74 (m, 1H), 2.39 (s, 6H), 2.34-2.31 (m, 1H), 1.69 (q, J=12.2 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 164.18, 166.66, 148.95, 148.88, 138.71, 133.94, 130.47, 130.39, 129.35, 129.04, 126.71, 126.95, 124.07, 114.75, 114.53, 113.42, 113.21, 60.75, 47.92, 41.53, 36.53, 33.19.
[0122] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.70 (brs, 1H), 7.31-7.26 (m, 1H), 7.18-7.15 (m, 2H), 7.10-7.06 (m, 1H), 6.98-6.94 (m, 2H), 6.84 (d, J=9.4 Hz, 1H), 6.75 (d, J=7.7 Hz, 1H), 4.22 (br d, J=9.1 Hz, 1H), 3.68-3.60 (m, 1H), 3.38 (d, J=14.0 Hz, 1H), 3.29-3.24 (m, 1H), 2.84 (s, 6H), 2.67 (d, J=9.5 Hz, 1H), 2.03-1.96 (m, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 164.39, 161.93, 146.82, 146.75, 137.16, 131.95, 130.58, 130.50, 129.57, 129.42, 127.41, 127.35, 124.67, 115.77, 115.55, 114.44, 114.23, 61.98, 45.99, 39.81, 39.47, 34.33, 30.37. Calculated C1.sub.8H.sub.21FN for [M+H].sup.+: 270.1659. Found: 270.1655. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH:.sup.nPrOH (80:10:5:5) 0.1% TEA (modifier) flow rate=1.5 mL/min; t.sub.1=11.77 min, t.sub.2=13.14 min.
[0123] Racemic 2f-k were prepared. To an oven dried 25 mL round bottom flask with stir bar was added racemic trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), Aryl boronic acid (0.3 mmol) and toluene (1.5 mL). The resulting mixture was degassed by sparging with N.sub.2 gas for 45 minutes. To the reaction mixture was added potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol). The flask was fitted with a reflux condenser and the reaction mixture was heated to 110? C. for 4 h under nitrogen atmosphere (Scheme 5). The reaction was quenched with 1N NaOH aq (3 mL) and ethyl acetate (4 mL). The organic layer was separated, and the aqueous layer was extracted with ethyl acetate (5 mL?4). The combined organic layer was washed with brine (10 mL) and dried over Na.sub.2SO.sub.4. After evaporation of solvent the crude reaction mixture was purified by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) to afford racemic 2f-k.
##STR00046##
[0124] The racemic mixtures of trans-analogs were separated by semi-preparative chiral HPLC Regiscell column using conditions and solvents specific to each analog to elute the trans-(2R,4S) and -(2S,4R) enantiomers at retention time t.sub.1 at t.sub.2, respectively, with absolute stereochemistry assigned according to retention time of the previously published trans-3-CI-4-PAT analog (Sakhuja, et al., 2015). Both enantiomers were converted to HCl salts for use in pharmacological assays by adding 2M HCl solution in ether to the solution of free amine in ether.
[0125] Trans-4-([1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 2f: trans-amine 2f was synthesized from trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), phenylboronic acid (37 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic trans-amine 2f as colorless oil with 82% isolated yield.
[0126] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.52 (d, J=7.3 Hz, 2H), 7.41 (dd, J=7.5, 7.5 Hz, 3H), 7.32 (dd, J=7.7, 7.7 Hz, 2H), 7.27 (s, 1H), 7.20-7.16 (m, 2H), 7.11 (t, J=6.9 Hz, 1H), 6.98 (dd, J=14.5, 7.6 Hz, 2H), 4.44 (t, J=5.1 Hz, 1H), 3.07 (dd, J=16.2, 4.7 Hz, 1H), 2.90 (dd, J=16.1, 9.5 Hz, 1H), 2.75 (tt, J=9.1, 4.5 Hz, 1H), 2.32 (s, 6H), 2.23-2.15 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 147.27, 141.37, 141.25, 137.79, 136.14, 130.15, 129.49, 128.83, 128.72, 127.81, 127.62, 127.34, 127.32, 126.57, 126.29, 125.12, 56.64, 44.20, 41.83, 34.83, 32.25. .sup.1H and .sup.13C NMRs are in agreement with previously published data (Sakhuja, et al., 2015).
[0127] Trans-4-(2-fluoro-[1,1-biphenyl]-3-yl)-N, N-dimethyl-1,2,3,4-tetrahydronaphtha-len-2-amine, 2g: trans-amine 2g was synthesized from trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), 2-fluorophenylboronic acid (42 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic trans-amine 2g as colorless oil with 98% isolated yield.
[0128] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.39-7.36 (m, 2H), 7.32 (t, J=7.7 Hz, 1H), 7.29-7.24 (m, 2H), 7.18-7.15 (m, 3H), 7.13-7.09 (m, 2H), 6.99 (d, J=7.5 Hz, 2H), 4.43 (t, J=5.2 Hz, 1H), 3.05 (dd, J=16.2, 4.8 Hz, 1H), 2.88 (dd, J=16.2, 9.5 Hz, 1H), 2.71 (tt, J=9.1, 4.5 Hz, 1H), 2.28 (s, 6H), 2.21-2.13 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 161.10, 158.63, 147.08, 137.91, 136.45, 135.75, 130.91, 130.87, 130.15, 129.54, 129.51, 129.48, 129.35, 129.21, 129.01, 128.93, 128.35, 128.19, 126.88, 126.85, 126.48, 126.18, 124.40, 124.37, 116.29, 116.06, 56.44, 44.22, 41.97, 35.04, 32.40.
[0129] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.65 (br s, 1H), 7.39-7.30 (m, 4H), 7.26-7.25 (m, 2H), 7.22-7.18 (m, 3H), 7.15-7.10 (m, 1H), 7.07 (d, J=7.5 Hz, 1H), 6.88 (d, J=6.9 Hz, 1H), 4.59 (br s, 1H), 3.53 (br d, J=13.7 Hz, 1H), 3.42 (br s, 1H), 3.29-3.24 (m, 1H), 2.73 (s, 6H), 2.48 (br s, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 160.90, 158.44, 144.62, 136.15, 135.39, 132.76, 130.73, 130.70, 130.14, 129.47, 129.30, 129.22, 128.97, 128.94, 128.88, 128.66, 128.53, 127.69, 127.57, 127.55, 127.45, 127.25, 124.55, 124.51, 116.23, 116.00, 58.75, 43.61, 40.99, 38.93, 31.57, 30.73. Calculated C.sub.24H.sub.25FN for [M+H].sup.+: 346.1971. Found: 346.1969. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (85:10:5) 0.1% TEA (modifier), 0.1% TFA (modifier) flow rate=3.0 mL/min; t, =8.0 min, t.sub.2=17.65 min.
[0130] Trans-4-(3-fluoro-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphtha-len-2-amine, 2h: trans-amine 2h was synthesized from trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), 3-fluorophenylboronic acid (42 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic trans-amine 2h as colorless oil with 98% isolated yield.
[0131] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.39-7.37 (m, 1H), 7.35-7.29 (m, 3H), 7.27 (s, 1H), 7.23-7.16 (m, 3H), 7.12-7.09 (m, 1H), 7.03-6.96 (m, 3H), 4.43 (t, J=5.3 Hz, 1H), 3.04 (dd, J=16.3, 4.8 Hz, 1H), 2.88 (dd, J=16.2, 9.3 Hz, 1H), 2.70-2.64 (m, 1H), 2.28 (s, 6H), 2.17 (t, J=6.1 Hz, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 164.46, 162.01, 147.75, 143.75, 143.67, 139.95, 139.93, 137.92, 136.54, 130.28, 130.19, 130.06, 129.52, 128.79, 128.45, 127.55, 126.51, 126.18, 124.97, 122.91, 122.89, 114.25, 114.16, 114.03, 113.95, 56.45, 44.23, 42.06, 35.28, 32.39. HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.75 (s, 1H), 7.43 (d, J=7.6 Hz, 1H), 7.43-7.34 (m, 2H), 7.29-7.26 (m, 3H), 7.23-7.17 (m, 3H), 7.06-7.02 (m, 2H), 6.89 (d, J=7.6 Hz, 1H), 4.60 (br s, 1H), 3.53 (dd, J=15.5, 4.2 Hz, 1H), 3.41-3.40 (m, 1H), 3.24 (dd, J=14.9, 11.7 Hz, 1H), 2.72 (br s, 6H), 2.49-2.44 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 164.32, 161.88, 145.18, 143.00, 142.92, 140.35, 140.33, 135.40, 132.70, 130.37, 130.29, 130.06, 129.45, 129.24, 127.87, 127.48, 127.27, 126.97, 125.73, 122.86, 122.83, 114.36, 114.15, 114.11, 113.89, 58.63, 43.60, 40.67, 38.98, 31.53, 30.45. Calculated C.sub.24H.sub.25FN for [M+H].sup.+: 346.1971. Found: 346.1969. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (85:10:5) 0.1% TEA (modifier), 0.1% TFA (modifier) flow rate=3.0 mL/min; t.sub.1=8.23 min, t.sub.2=13.42 min.
[0132] Trans-4-(4-fluoro-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphtha-len-2-amine, 2i: trans-amine 2i was synthesized from trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), 4-fluorophenylboronic acid (42 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic trans-amine 2i as colorless oil with 92% isolated yield.
[0133] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.47 (td, J=6.0, 2.7 Hz, 2H), 7.35 (d, J=7.8 Hz, 1H), 7.31 (dd, J=7.6, 7.6 Hz, 1H), 7.23 (br s, 1H), 7.20-7.16 (m, 2H), 7.12-7.07 (m, 3H), 6.97 (t, J=7.6 Hz, 2H), 4.43 (t, J=5.3 Hz, 1H), 3.06 (dd, J=16.2, 4.8 Hz, 1H), 2.89 (dd, J=16.2, 9.4 Hz, 1H), 2.74-2.69 (m, 1H), 2.31 (s, 6H), 2.20-2.17 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 163.76, 161.30, 147.66, 140.24, 138.02, 137.55, 137.52, 136.55, 130.09, 129.51, 128.86, 128.79, 128.73, 127.88, 127.50, 126.49, 126.17, 124.89, 115.76, 115.55, 56.47, 44.26, 42.05, 35.27, 32.38.
[0134] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.76 (s, 1H), 7.46 (dd, J=8.6, 5.3 Hz, 2H), 7.40 (d, J=7.7 Hz, 1H), 7.34 (t, J=7.6 Hz, 1H), 7.29-7.20 (m, 3H), 7.14-7.09 (m, 3H), 7.06 (d, J=7.6 Hz, 1H), 6.86 (d, J=7.5 Hz, 1H), 4.60 (br s, 1H), 3.52 (dd, J=15.5, 3.1 Hz, 1H), 3.45-3.38 (m, 1H), 3.24 (dd, J=14.4, 12.0, 1H), 2.72 (br s, 6H), 2.52-2.44 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 163.84, 161.38, 145.12, 140.75, 136.89, 136.85, 135.50, 132.72, 130.17, 129.52, 129.23, 128.87, 128.79, 127.54, 127.33, 126.98, 125.72, 115.85, 115.64, 58.70, 43.70, 40.75, 39.11, 31.63, 30.49. Calculated C.sub.24H.sub.25FN for [M+H].sup.+: 346.1971. Found: 346.1968. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (85:10:5) 0.1% TEA (modifier), 0.1% TFA (modifier) flow rate=3.0 mL/min; t, =9.96 min, t.sub.2=16.64 min.
[0135] Trans-4-(4-chloro-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphtha-len-2-amine, 2j: trans-amine 2j was synthesized from trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), 4-chlorophenylboronic acid (47 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic trans-amine 2j as colorless oil with 97% isolated yield.
[0136] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.45 (d, J=8.5 Hz, 2H), 7.37 (d, J=8.6 Hz, 3H), 7.31 (t, J=7.6 Hz, 1H), 7.24 (s, 1H), 7.26-7.20 (m, 2H), 7.10 (t, J=7.1 Hz, 1H), 6.97 (t, J=7.9 Hz, 2H), 4.42 (t, J=5.3 Hz, 1H), 3.04 (dd, J=16.3, 4.8 Hz, 1H), 2.87 (dd, J=16.2, 9.3 Hz, 1H), 2.68-2.65 (m, 1H), 2.28 (s, 6H), 2.17 (t, J=6.0 Hz, 2H).
[0137] .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 147.74, 139.98, 139.86, 137.95, 136.54, 133.40, 130.08, 129.52, 128.96, 128.80, 128.54, 128.20, 127.46, 126.51, 126.18, 124.86, 56.44, 44.24, 42.06, 35.29, 32.34.
[0138] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.77 (br s, 1H), 7.44-7.38 (m, 5H), 7.34 (t, J=7.6 Hz, 1H), 7.29-7.26 (m, 2H), 7.25-7.20 (m, 1H), 7.15 (s, 1H), 7.05 (d, J=7.5 Hz, 1H), 6.87 (d, J=7.5 Hz, 1H), 4.60 (br s, 1H), 3.51 (dd, J=15.4, 4.5 Hz, 1H), 3.47-3.43 (m, 1H), 3.23 (dd, J=15.0, 11.7 Hz, 1H), 2.71 (d, J=4.6 Hz, 6H), 2.52-2.43 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 145.19, 140.48, 139.19, 135.45, 133.67, 132.70, 130.15, 129.51, 129.28, 129.00, 128.49, 127.63, 127.54, 127.33, 126.93, 125.67, 58.65, 43.66, 40.57, 39.04, 31.59, 30.40. Calculated C.sub.24H.sub.25ClN for [M+H].sup.+: 362.1676. Found: 362.1673. HPLC (s-prep): Solvent System: hexanes: .sup.iPrOH (98:2) 0.1% TEA (modifier), flow rate=2.0 mL/min; t, =12.42 min, t.sub.2=14.52 min.
[0139] Trans-4-(4-(dimethylamino)-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetra-hydronaph-thalen-2-amine, 2k: trans-amine 2k was synthesized from trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), 4-(dimethylamino)phenylboronic acid (50 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic trans-amine 2k as colorless oil with 90% isolated yield.
[0140] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.43 (d, J=8.7 Hz, 2H), 7.37 (d, J=7.7 Hz, 1H), 7.28-7.23 (m, 2H), 7.18-7.14 (m, 2H), 7.09 (t, J=7.1 Hz, 1H), 6.99 (d, J=7.6 Hz, 1H), 6.88 (d, J=7.6 Hz, 1H), 6.77 (d, J=8.7 Hz, 2H), 4.40 (t, J=5.1 Hz, 1H), 3.04 (dd, J=16.2, 4.7 Hz, 1H), 2.97 (s, 6H), 2.86 (dd, J=16.2, 9.5 Hz, 1H), 2.71-2.66 (m, 1H), 2.28 (s, 6H), 2.20-2.11 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 150.07, 147.28, 141.14, 138.26, 136.51, 130.16, 129.48, 129.39, 128.53, 127.85, 126.89, 126.61, 126.36, 126.11, 124.14, 112.87, 56.51, 44.30, 42.07, 40.72, 35.06, 32.60.
[0141] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.67 (s, 1H), 7.84 (d, J=8.2 Hz, 2H), 7.66 (d, J=8.1 Hz, 2H), 7.39 (dt, J=15.2, 7.6 Hz, 2H), 7.31-7.22 (m, 3H), 7.15 (s, 1H), 7.07 (d, J=7.5 Hz, 1H), 6.94 (d, J=7.3 Hz, 1H), 4.62 (br s, 1H), 3.50-3.43 (m, 2H), 3.21-3.11 (m, 7H), 2.73 (dd, J=8.0, 4.8 Hz, 6H), 2.62 (br d, J=12.0 Hz, 1H), 2.44 (td, J=11.9, 5.3 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 164.93, 145.28, 139.70, 135.38, 132.64, 130.14, 129.54, 129.36, 129.36, 129.11, 128.11, 127.57, 127.31, 127.17, 125.73, 120.66, 58.51, 46.19, 45.97, 43.54, 40.14, 39.29, 31.60, 30.00. Calculated C2.sub.6H3.sub.1N.sub.2 for [M+H]*: 371.2487. Found: 371.2483. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH:.sup.nPrOH (80:10:5:5) 0.1% TEA (modifier), flow rate=1.7 mL/min; t, =11.55 min, t.sub.2=12.93 min.
[0142] The cis analogues 3f-3k (Scheme 6) were synthesized from racemic cis-3Br-4-PAT 3a and corresponding Aryl boronic acid following the general procedure as described above for trans 2f-k. The racemic mixtures of cis-analogs were separated by semi-preparative chiral HPLC Regiscell column using conditions and solvents specific to each analog to elute the cis-(2S,4S) and -(2R,4R) enantiomers at retention time t.sub.1 at t.sub.2, respectively. The absolute stereochemistry was assigned by correlating retention time to the x-ray crystal structure of (2R,4R)-cis-3CI-4-PAT, 3b and (2S,4S)-cis-3F-4-PAT, 3b analogs. Both enantiomers were converted to HCl salts for use in pharmacological assays by adding 2M HCl solution in ether to the solution of free amine in ether.
##STR00047##
[0143] Cis-4-([1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3f: cis-amine 3f was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol), phenylboronic acid (37 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic cis-amine 3f as colorless oil with 85% isolated yield.
[0144] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.58-7.56 (m, 2H), 7.48 (d, J=7.7 Hz, 1H), 7.47-7.37 (m, 4H), 7.37-7.30 (m, 1H), 7.16 (d, J=8.2 Hz, 2H), 7.12 (t, J=7.3 Hz, 1H), 7.02 (t, J=7.4 Hz, 1H), 6.82 (d, J=7.8 Hz, 1H), 4.16 (dd, J=12.2, 5.1 Hz, 1H), 3.05 (dd, J=15.6, 2.9 Hz, 1H), 2.96 (dd, J=15.6, 11.3 Hz, 1H), 2.84 (tdd, J=11.4, 4.8, 2.3 Hz, 1H), 2.42-2.38 (m, 7H), 1.79 (q, J=12.1 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 147.21, 141.63, 141.29, 139.35, 136.39, 129.53, 129.40, 129.12, 128.83, 127.84, 127.77, 127.37, 127.33, 126.26, 126.07, 125.41, 60.72, 47.45, 41.60, 36.99, 33.18.
[0145] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.93 (s, 1H), 7.55 (d, J=7.4 Hz, 2H), 7.52 (d, J=7.6 Hz, 1H), 7.44-7.35 (m, 4H), 7.36-7.33 (m, 1H), 7.20-7.19 (m, 2H), 7.16-7.10 (m, 2H), 6.86 (d, J=7.8 Hz, 1H), 4.28 (d, J=9.2 Hz, 1H), 3.70-3.63 (m, 1H), 3.47-3.44 (m, 1H), 3.34-3.29 (m, 1H), 2.86 (s, 6H), 2.73-2.71 (m, 1H), 2.08 (q, J=11.8 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 144.83, 142.00, 140.90, 137.77, 132.03, 129.52, 129.44, 128.89, 127.71, 127.60, 127.58, 127.30, 127.14, 126.15, 62.02, 46.31, 39.86, 39.67, 34.29, 30.45. Calculated C.sub.24H.sub.26N for [M+H]*: 328.2066. Found: 328.2059. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (90:5:5) 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=3.0 mL/min; t, =10.17 min, t2=24.59 min.
[0146] Cis-4-(2-fluoro-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3g: cis-amine 3g was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol), 2-fluorophenylboronic acid (42 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic cis-amine 3g as colorless oil with 96% isolated yield.
[0147] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.45-7.38 (m, 4H), 7.31-7.27 (m, 1H), 7.19-7.11 (m, 5H), 7.03 (t, J=7.3 Hz, 1H), 6.83 (d, J=7.8 Hz, 1H), 4.16 (dd, J=12.2, 5.0 Hz, 1H), 3.04 (dd, J=15.5, 2.6 Hz, 1H), 2.95 (dd, J=15.5, 11.4 Hz, 1H), 2.83 (tdd, J=11.5, 4.7, 2.2 Hz, 1H), 2.42-2.38 (m, 7H), 1.78 (q, J=12.1 Hz, 1H). .sup.13C NMR (100 MHz; CDCl.sub.3): ? 161.10, 158.60, 146.9, 139.30, 136.40, 136.10, 130.95, 130.91, 129.65, 129.62, 129.52, 129.42, 129.09, 129.00, 128.80, 128.20, 127.28, 127.25, 126.30, 126.10, 124.43, 124.39, 116.30, 116.10, 60.70, 47.40, 41.60, 37.00, 33.20.
[0148] HCl salt: .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.69 (s, 1H), 7.46 (d, J=7.5 Hz, 1H), 7.41 (t, J=7.1 Hz, 2H), 7.35 (s, 1H), 7.30 (dd, J=14.9, 9.0 Hz, 1H), 7.21-7.08 (m, 6H), 6.85 (d, J=7.7 Hz, 1H), 4.27 (br d, J=8.3 Hz, 1H), 3.70-3.65 (m, 1H), 3.43 (br d, J=14.3 Hz, 1H), 3.32-3.27 (m, 1H), 2.85 (d, J=11.5 Hz, 7H), 2.70 (d, J=9.8 Hz, 1H), 2.07 (q, J=11.8 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 160.92, 158.45, 144.49, 137.65, 136.42, 132.03, 130.84, 130.81, 129.46, 129.42, 129.39, 129.27, 129.19, 129.04, 128.04, 127.95, 127.92, 127.21, 127.08, 124.49, 124.46, 116.24, 116.02, 61.89, 46.12, 39.78, 39.48, 34.15, 30.40. Calculated C.sub.24H.sub.25FN for [M+H]*: 346.1971. Found: 346.1968. HPLC (s-prep): Solvent System: hexanes:.sup.iPrOH (94:6) 0.2% TEA (modifier), 0.1% TFA (modifier), flow rate=3.0 mL/min; t, =13.11 min, t.sub.2=29.15 min.
[0149] Cis-4-(3-fluoro-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3h: cis-amine 3h was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol), 3-fluorophenylboronic acid (42 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic cis-amine 3h as colorless oil with 97% isolated yield.
[0150] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.46 (d, J=7.7 Hz, 1H), 7.41-7.34 (m, 4H), 7.28-7.26 (m, 1H), 7.20-7.12 (m, 3H), 7.04-7.01 (m, 2H), 6.80 (d, J=7.8 Hz, 1H), 4.17 (dd, J=12.2, 5.1 Hz, 1H), 3.06 (dd, J=15.6, 2.6 Hz, 1H), 2.97 (dd, J=15.6, 11.4 Hz, 1H), 2.88-2.83 (m, 1H), 2.41-2.39 (m, 7H), 1.78 (q, J=12.1 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl3): ? 164.49, 162.04, 147.45, 143.62, 143.55, 140.37, 140.35, 139.22, 136.46, 130.31, 130.22, 129.58, 129.34, 129.25, 128.45, 127.65, 126.32, 126.08, 125.35, 122.95, 122.92, 114.29, 114.24, 114.07, 114.03, 60.71, 47.45, 41.63, 37.08, 33.20.
[0151] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 13.00 (s, 1H), 7.49 (d, J=7.7 Hz, 1H), 7.44-7.32 (m, J=8.0 Hz, 4H), 7.23 (s, 1H), 7.20-7.19 (m, 3H), 7.13-7.09 (m, 1H), 7.04 (td, J=8.2, 1.1 Hz, 1H), 6.84 (d, J=7.8 Hz, 1H), 4.28 (dd, J=11.8, 4.5 Hz, 1H), 3.69-3.65 (m, 1H), 3.44 (d, J=14.0 Hz, 1H), 3.34-3.29 (m, 1H), 2.85 (dd, J=4.9, 4.9 Hz, 6H), 2.74-2.72 (m, 1H), 2.08 (q, J=12.2 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 164.33, 161.88, 145.02, 143.10, 143.02, 140.52, 140.50, 137.60, 132.05, 130.34, 130.26, 129.46, 129.39, 129.32, 128.26, 127.43, 127.15, 127.04, 125.94, 122.87, 122.84, 114.32, 114.12, 114.11, 113.91, 61.80, 46.11, 39.58, 34.20, 30.23. Calculated C.sub.24H.sub.25FN for [M+H].sup.+: 346.1971. Found: 346.1967. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (90:5:5) 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=3.0 mL/min; t.sub.1=10.07 min, t.sub.2=16.80 min.
[0152] Cis-4-(4-fluoro-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3i: cis-amine 3i was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol), 4-fluorophenylboronic acid (42 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic cis-amine 3i as colorless oil with 98% isolated yield. .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.52 (dd, J=8.6, 5.4 Hz, 2H), 7.43-7.36 (m, 3H), 7.17-7.07 (m, 5H), 7.02 (t, J=7.4 Hz, 1H), 6.81 (d, J=7.8 Hz, 1H), 4.16 (dd, J=12.2, 5.1 Hz, 1H), 3.05 (dd, J=15.7, 3.0 Hz, 1H), 2.98-2.93 (m, 1H), 2.83 (tdd, J=11.4, 4.6, 2.2 Hz, 1H), 2.40-2.38 (m, 7H), 1.78 (q, J=12.1 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 163.78, 161.32, 147.35, 140.64, 139.29, 137.40, 136.46, 129.56, 129.35, 129.18, 128.89, 128.81, 127.87, 127.57, 126.28, 126.06, 125.26, 115.78, 115.56, 60.70, 47.45, 41.65, 37.08, 33.21.
[0153] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.77 (s, 1H), 7.51 (dd, J=7.6, 5.8 Hz, 2H), 7.45 (d, J=7.6 Hz, 1H), 7.39 (t, J=7.6 Hz, 1H), 7.34 (s, 1H), 7.18-7.08 (m, 6H), 6.83 (d, J=7.7 Hz, 1H), 4.27 (dd, J=11.3, 3.6 Hz, 1H), 3.69-3.65 (m, 1H), 3.42 (br d, J=13.9 Hz, 1H), 3.34-3.28 (m, 1H), 2.85 (dd, J=6.8, 4.8 Hz, 6H), 2.72 (br d, J=9.9 Hz, 1H), 2.08 (q, J=12.1 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 163.81, 161.35, 144.91, 140.94, 137.67, 136.98, 132.00, 129.47, 129.45, 129.44, 128.88, 128.80, 127.68, 127.41, 127.27, 127.14, 125.98, 115.83, 115.62, 61.91, 46.23, 39.68, 39.53, 34.31, 30.29. Calculated C.sub.24H.sub.25FN for [M+H]*: 346.1971. Found: 346.1967. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (90:5:5) 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=2.0 mL/min; t.sub.1=16.53 min, t.sub.2=23.22 min.
[0154] Cis-4-(4-chloro-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3j: cis-amine 3j was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol), 4-chlorophenylboronic acid (47 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic cis-amine 3j as colorless oil with 98% isolated yield.
[0155] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.49 (d, J=8.5 Hz, 2H), 7.45-7.37 (m, 5H), 7.18-7.12 (m, 3H), 7.03 (t, J=7.3 Hz, 1H), 6.80 (d, J=7.8 Hz, 1H), 4.17 (dd, J=12.1, 4.9 Hz, 1H), 3.06 (dd, J=15.5, 2.5 Hz, 1H), 3.00-2.94 (m, 1H), 2.90-2.86 (m, 1H), 2.41-2.38 (m, 7H), 1.79 (q, J=12.1 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 147.32, 140.43, 139.71, 139.16, 136.22, 133.49, 129.59, 129.36, 129.29, 128.99, 128.59, 128.20, 127.54, 126.38, 126.16, 125.30, 60.73, 47.39, 41.52, 36.93, 33.02.
[0156] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.88 (s, 1H), 7.49-7.46 (m, 3H), 7.42-7.38 (m, 3H), 7.35 (s, 1H), 7.19-7.15 (m, 3H), 7.12-7.10 (m, 1H), 6.84 (d, J=7.8 Hz, 1H), 4.28 (br d, J=8.2 Hz, 1H), 3.69-3.64 (m, 1H), 3.43 (br d, J=14.2 Hz, 1H), 3.34-3.29 (m, 1H), 2.86 (s, 6H), 2.73 (br d, J=10.4 Hz, 1H), 2.08 (q, J=11.7 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 145.01, 140.70, 139.30, 137.64, 133.64, 132.00, 129.56, 129.46, 129.01, 128.53, 128.02, 127.39, 127.30, 127.17, 125.96, 61.92, 46.24, 39.72, 39.52, 34.34, 30.28. Calculated C.sub.24H.sub.25CIN for [M+H]*: 362.1676. Found: 362.1673. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (85:10:5) 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=1.5 mL/min; t, =23.00 min, t.sub.2=30.59 min.
[0157] Cis-4-(4-(dimethylamino)-[1,1-biphenyl]-3-yl)-N,N-dimethyl-1,2,3,4-tetrahydro-naphthalen-2-amine, 3k: cis-amine 3k was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol), 4-(dimethylamino)phenylboronic acid (50 mg, 0.3 mmol) in presence of potassium phosphate (85 mg, 0.4 mmol), Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (12 mg, 0.03 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:2:0.1 hexanes:ethyl acetate:triethylamine) afforded racemic cis-amine 3k as colorless oil with 92% isolated yield.
[0158] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.48 (d, J=8.7 Hz, 2H), 7.44 (d, J=7.7 Hz, 1H), 7.37 (s, 1H), 7.34 (t, J=7.6 Hz, 1H), 7.13 (dt, J=14.7, 7.4 Hz, 2H), 7.06 (d, J=7.5 Hz, 1H), 7.01 (t, J=7.4 Hz, 1H), 6.83 (d, J=7.8 Hz, 1H), 6.79 (d, J=8.7 Hz, 2H), 4.14 (dd, J=12.3, 4.9 Hz, 1H), 3.07-3.03 (m, 1H), 2.98-2.94 (m, 7H), 2.88-2.85 (m, 1H), 2.42-2.38 (m, 7H), 1.79 (q, J=12.1 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 150.07, 146.95, 141.57, 139.50, 136.26, 129.46, 129.28, 128.99, 127.85, 126.96, 126.55, 126.17, 126.05, 124.52, 112.83, 60.70, 47.45, 41.51, 40.71, 36.83, 33.13.
[0159] HCl salt .sup.1H-NMR (500 MHz; CD30D): ? 7.85-7.80 (m, 2H), 7.75-7.70 (m, 2H), 7.59-7.55 (m, 2H), 7.47 (t, J=6.8 Hz, 1H), 7.30-7.24 (m, 2H), 7.17 (t, J=7.1 Hz, 1H), 7.07 (t, J=7.3 Hz, 1H), 6.77 (d, J=7.6 Hz, 1H), 4.41-4.40 (m, 1H), 3.87-3.86 (m, 1H), 3.21 (q, J=7.0 Hz, 2H), 2.98 (s, 6H), 2.60-2.59 (m, 1H), 2.17-2.15 (m, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): 164.94, 144.93, 140.15, 136.62, 132.41, 129.43, 129.34, 128.96, 128.45, 128.11, 127.50, 127.23, 127.02, 125.72, 120.63, 62.69, 48.27, 44.74, 43.91, 40.25, 32.12, 30.42. Calculated C2.sub.6H3.sub.1N.sub.2 for [M+H].sup.+: 371.2487. Found: 371.2486. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (85:10:5), 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=3.0 mL/min; t.sub.1=10.76 min, t2=21.76 min.
[0160] Racemic compounds 2c-d were synthesized. To an oven dried 25 mL round bottom flask with stir bar was added trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), Aryl MIDA boronate (0.3 mmol) and dioxane (2.4 mL). The resulting mixture was sparged with N.sub.2 for 30 min. To the flask was added palladium(II) acetate (2 mg, 0.01 mmol), SPhos (8 mg, 0.02 mmol) and aq K.sub.3PO.sub.4 (3.0 M, 0.5 mL, degassed by sparging with N.sub.2 for 30 min). The resulting reaction mixture was stirred for 20 h under nitrogen atmosphere at 60? C. (Scheme 7). The reaction was quenched with 1 N NaOH aq (3 mL) and ethyl acetate (4 mL). The organic layer was separated, and the aqueous layer was extracted with ethyl acetate (5 mL?4). The combined organic layer was washed with brine (10 mL) and dried over Na.sub.2SO.sub.4. After evaporation of solvent the crude reaction mixture was purified by silica gel column chromatography (4:1:0.1 hexanes: dichloromethane:triethylamine) to afford racemic 2c-d.
##STR00048##
[0161] The racemic mixtures of trans-analogs were separated by semi-preparative chiral HPLC Regiscell column using conditions and solvents specific to each analog to elute the trans-(2R,4S) and -(2S,4R) enantiomers at retention time t.sub.1 at t.sub.2, respectively, with absolute stereochemistry assigned according to retention time of the previously published trans-3CI-4-PAT analog (Sakhuja, et al., 2015). Both enantiomers were converted to HCl salts for use in pharmacological assays by adding 2M HCl solution in ether to the solution of free amine in ether.
[0162] Trans-4-(3-(thiophen-2-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 2c: trans-amine 2c was synthesized from trans-3Br-4-PAT 2a (66 mg, 0.2 mmol) and 2-thiopheneboronic acid MIDA ester (72 mg, 0.3 mmol) in presence of aq. potassium phosphate Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (8 mg, 0.02 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:1:0.1 hexanes:dichloromethane:triethylamine) afforded racemic trans-amine 2c as colorless oil with 60% isolated yield.
[0163] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.43 (d, J=7.6 Hz, 1H), 7.32 (s, 1H), 7.26-7.23 (m, 3H), 7.20-7.16 (m, 2H), 7.10 (t, J=6.9 Hz, 1H), 7.05 (dd, J=4.7, 3.9 Hz, 1H), 6.96 (d, J=7.6 Hz, 1H), 6.89 (d, J=7.7 Hz, 1H), 4.39 (t, J=5.2 Hz, 1H), 3.04 (dd, J=16.2, 4.7 Hz, 1H), 2.87 (dd, J=16.2, 9.4 Hz, 1H), 2.66 (tt, J=9.0, 4.5 Hz, 1H), 2.28 (s, 6H), 2.17-2.14 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 147.66, 144.67, 137.85, 136.49, 134.40, 130.10, 129.49, 128.83, 128.08, 128.06, 126.53, 126.44, 126.21, 124.84, 123.92, 123.20, 56.50, 44.15, 42.04, 34.98, 32.48. HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.71 (s, 1H), 7.47 (d, J=7.7 Hz, 1H), 7.29-7.21 (m, 7H), 7.07-7.03 (m, 2H), 6.77 (d, J=7.7 Hz, 1H), 4.57-4.55 (m, 1H), 3.53 (dd, J=15.5, 4.8 Hz, 1H), 3.40-3.36 (m, 1H), 3.25 (dd, J=15.3, 11.5 Hz, 1H), 2.71 (t, J=5.1 Hz, 6H), 2.48-2.45 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 145.33, 143.88, 135.30, 134.95, 132.78, 130.21, 129.54, 129.39, 128.22, 127.61, 127.52, 127.39, 125.78, 125.25, 124.69, 123.57, 58.77, 43.64, 41.08, 38.82, 31.51, 30.83. Calculated C.sub.22H.sub.24NS for [M+H].sup.+: 334.1630. Found: 334.1628. HPLC (s-prep): Solvent System: hexanes:.sup.iPrOH (98:2) 0.1% TEA (modifier), flow rate=2.0 mL/min; t, =10.55 min, t.sub.2=12.20 min.
[0164] Trans-4-(3-(furan-2-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 2d: trans-amine 2d was synthesized from trans-3Br-4-PAT 2a (66 mg, 0.2 mmol) and 2-furanboronic acid MIDA ester (67 mg, 0.3 mmol) in presence of aq. potassium phosphate Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (8 mg, 0.02 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:1:0.1 hexanes:dichloromethane:triethylamine) afforded racemic trans-amine 2d as colorless oil with 60% isolated yield.
[0165] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.49 (d, J=7.7 Hz, 1H), 7.44 (s, 1H), 7.39 (s, 1H), 7.27-7.24 (m, 2H), 7.21-7.17 (m, 2H), 7.11 (t, J=6.9 Hz, 1H), 6.96 (d, J=7.6 Hz, 1H), 6.86 (d, J=7.5 Hz, 1H), 6.59 (d, J=3.2 Hz, 1H), 6.45-6.44 (m, 1H), 4.41 (t, J=5.0 Hz, 1H), 3.09 (d, J=15.1 Hz, 1H), 2.91 (dd, J=15.9, 9.6 Hz, 1H), 2.72 (br s, 1H), 2.32 (s, 6H), 2.22-2.17 (m, 2H). .sup.13C-NMR (126 MHz, CDCl.sub.3): ? 154.17, 147.46, 142.07, 137.97, 136.52, 130.87, 130.07, 129.45, 128.62, 127.98, 126.45, 126.16, 124.18, 121.73, 111.70, 105.07, 56.49, 44.13, 42.12, 35.02, 32.64.
[0166] HCl-salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.71 (br s, 1H), 7.52 (d, J=7.7 Hz, 1H), 7.45 (s, 1H), 7.31-7.28 (m, 4H), 7.22-7.19 (m, 1H), 7.03 (d, J=7.7 Hz, 1H), 6.75 (d, J=7.7 Hz, 1H), 6.61 (d, J=3.2 Hz, 1H), 6.47-6.46 (m, 1H), 4.58-4.56 (br m, 1H), 3.56 (dd, J=15.6, 4.6 Hz, 1H), 3.43-3.36 (m, 1H), 3.25 (dd, J=15.2, 11.7 Hz, 1H), 2.71 (s, 6H), 2.47-2.44 (m, 2H). .sup.13C-NMR (126 MHz, CDCl.sub.3): ? 153.39, 145.08, 142.30, 135.32, 132.76, 131.29, 130.10, 129.45, 129.10, 127.45, 127.34, 127.28, 123.45, 122.44, 111.78, 105.60, 58.68, 43.62, 41.05, 38.67, 31.37, 30.78. Calculated C.sub.22H.sub.24NO for [M+H].sup.+: 318.1858. Found: 318.1858. HPLC (s-prep): Solvent System: hexanes:.sup.iPrOH (98:2) 0.1% TEA (modifier), flow rate=2.0 mL/min; t.sub.1=12.96 min, t2=15.57 min.
[0167] The cis analogues 3c and 3d (Scheme 8) were synthesized from cis-3Br-4-PAT 3a and corresponding Aryl MIDA boronates following the general procedure as described above for trans 2c and 2d. The racemic mixtures of cis-analogs were separated by semi-preparative chiral HPLC Regiscell column using conditions and solvents specific to each analog to elute the cis-(2S,4S) and -(2R,4R) enantiomers at retention time t.sub.1 at t.sub.2, respectively. The absolute stereochemistry was assigned by correlating retention time to the x-ray crystal structure of (2R,4R)-cis-3CI-4-PAT, 3b and (2S,4S)-cis-3F-4-PAT, 3b analogs. Both enantiomers were converted to HCl salts for use in pharmacological assays by adding 2M HCl solution in ether to the solution of free amine in ether.
##STR00049##
[0168] Cis-4-(3-(thiophen-2-yl) phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3c: cis-amine 3c was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol) and 2-thiopheneboronic acid MIDA ester (72 mg, 0.3 mmol) in presence of aq. potassium phosphate Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (8 mg, 0.02 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:1:0.1 hexanes:dichloromethane:triethylamine) afforded racemic cis-amine 3c as colorless oil with 60% isolated yield.
[0169] .sup.1H-NMR (500 MHz; CDCl3): ? 7.51 (d, J=7.8 Hz, 1H), 7.45 (s, 1H), 7.33 (t, J=7.7 Hz, 1H), 7.30-7.27 (m, 2H), 7.17-7.12 (m, 2H), 7.09-7.05 (m, 2H), 7.05-7.02 (m, 1H), 6.81 (d, J=7.8 Hz, 1H), 4.15 (dd, J=12.6, 5.4 Hz, 1H), 3.10-2.98 (m, 3H), 2.46-2.39 (m, 7H), 1.80 (q, J=11.8 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 147.39, 144.52, 139.17, 136.43, 134.76, 129.56, 129.36, 129.31, 128.08, 128.03, 126.55, 126.31, 126.10, 124.91, 124.29, 123.31, 60.72, 47.35, 41.68, 36.89, 33.27.
[0170] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 13.00 (br s, 1H), 7.54 (d, J=7.8 Hz, 1H), 7.42 (s, 1H), 7.35 (t, J=7.7 Hz, 1H), 7.30 (m, J=4.7 Hz, 2H), 7.19 (d, J=4.0 Hz, 2H), 7.12-7.05 (m, 3H), 6.84 (d, J=7.8 Hz, 1H), 4.24 (dd, J=12.1, 5.4 Hz, 1H), 3.68-3.64 (m, 1H), 3.48-3.44 (m, 1H), 3.34-3.28 (m, 1H), 2.87-2.84 (m, 6H), 2.72-2.69 (m, 1H), 2.06 (q, J=12.5 Hz, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 145.02, 143.97, 137.55, 135.08, 132.03, 129.63, 129.46, 128.16, 127.81, 127.31, 127.18, 126.36, 125.16, 124.97, 123.56, 61.92, 46.17, 39.68, 39.49, 34.08, 30.38. Calculated C.sub.22H.sub.24NS for [M+H].sup.+: 334.1630. Found: 334.1629. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (85:10:5) 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=3.0 mL/min; t.sub.1=8.58 min, t.sub.2=25.12 min.
[0171] Cis-4-(3-(furan-2-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, 3d: cis-amine 3d was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol) and 2-furanboronic acid MIDA ester (67 mg, 0.3 mmol) in presence of aq. potassium phosphate Palladium(II) acetate (2 mg, 0.01 mmol) and SPhos (8 mg, 0.02 mmol) following general procedure described above. Purification of crude reaction mixture by silica gel column chromatography (4:1:0.1 hexanes:dichloromethane:triethylamine) afforded racemic cis-amine 3d as colorless oil with 60% isolated yield.
[0172] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 7.57 (d, J=7.8 Hz, 1H), 7.54 (s, 1H), 7.46 (s, 1H), 7.35 (t, J=7.7 Hz, 1H), 7.15 (dt, J=15.4, 7.6 Hz, 2H), 7.08 (d, J=7.6 Hz, 1H), 7.03 (t, J=7.4 Hz, 1H), 6.81 (d, J=7.8 Hz, 1H), 6.65 (d, J=3.2 Hz, 1H), 6.48-6.45 (m, 1H), 4.15 (dd, J=12.1, 4.8 Hz, 1H), 3.07 (dd, J=15.5, 2.8 Hz, 1H), 2.98 (dd, J=15.8, 11.4 Hz, 1H), 2.88-2.83 (m, 1H), 2.40-2.37 (m, 7H), 1.79 (q, J=12.2 Hz, 1H). .sup.13C-NMR (126 MHz, CDCl.sub.3): ? 154.05, 142.10, 139.22, 136.37, 131.22, 129.52, 129.34, 129.09, 127.93, 126.26, 126.08, 124.26, 122.12, 111.74, 105.20, 60.69, 47.38, 41.62, 36.73, 33.21.
[0173] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 12.66 (s, 1H), 7.55 (d, J=7.7 Hz, 1H), 7.47 (s, 1H), 7.41 (s, 1H), 7.31 (t, J=7.7 Hz, 1H), 7.17-7.12 (m, 2H), 7.05-7.01 (m, 2H), 6.77 (d, J=7.8 Hz, 1H), 6.62 (d, J=3.0 Hz, 1H), 6.44-6.42 (m, 1H), 4.21 (d, J=8.1 Hz, 1H), 3.67-3.60 (br m, 1H), 3.39 (d, J=14.4 Hz, 1H), 3.30-3.25 (m, 1H), 2.81 (d, J=9.8 Hz, 6H), 2.65-2.63 (m, 1H), 2.07-2.01 (m, 1H). .sup.13C-NMR (126 MHz, CDCl.sub.3): ? 153.50, 144.75, 142.26, 132.01, 131.49, 129.42, 129.38, 129.37, 127.75, 127.12, 127.01, 124.02, 122.77, 112.57, 111.82, 105.55, 61.91, 46.20, 39.75, 39.50, 33.99, 30.39. C.sub.22H.sub.24NO for [M+H].sup.+: 318.1858. Found: 318.1859. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH (85:10:5) 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=3.0 mL/min; t.sub.1=9.27 min, t.sub.2=27.19 min.
[0174] Trans-4-(3-(pyridin-4-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine 2e (Knapp, et al., 2009): To an oven dried 25 mL round bottom flask with stir bar was added trans-3Br-4-PAT 2a (66 mg, 0.2 mmol), 4-pyridinylboronic acid (30 mg, 0.24 mmol) and dioxane (2.4 mL). The resulting mixture was sparged with N.sub.2 for 30 min. To the flask was added Tris(dibenzylideneacetone)dipalladium(0) (9 mg, 0.01 mmol), PCy.sub.3 (7 mg, 0.024 mmol) and aq K.sub.3PO.sub.4 (3.0 M, 0.5 mL, degassed by sparging with N.sub.2 for 30 min). The resulting reaction mixture was stirred for 12 h under nitrogen atmosphere at 95? C. (Scheme 9). The reaction was quenched with 1N NaOH aq (3 mL) and ethyl acetate (4 mL). The organic layer was separated, and the aqueous layer was extracted with ethyl acetate (5 mL?4). The combined organic layer was washed with brine (10 mL) and dried over Na.sub.2SO.sub.4.
##STR00050##
[0175] After evaporation of solvent the crude reaction mixture was purified by silica gel column chromatography (1:1:0.2 hexanes: ethyl acetate:triethylamine) to afford racemic 2e as colorless oil with 60% isolated yield.
[0176] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 8.63 (dd, J=4.6, 1.4 Hz, 2H), 7.47-7.43 (m, 3H), 7.37 (t, J=7.7 Hz, 1H), 7.32 (br s, 1H), 7.21-7.17 (m, 2H), 7.13-7.10 (m, 1H), 7.07 (d, J=7.7 Hz, 1H), 6.96 (d, J=7.6 Hz, 1H), 4.46 (t, J=5.2 Hz, 1H), 3.05 (dd, J=16.3, 4.8 Hz, 1H), 2.89 (dd, J=16.2, 9.3 Hz, 1H), 2.67 (tt, J=8.8, 4.4 Hz, 1H), 2.29 (s, 7H), 2.20-2.16 (m, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): ? 150.32, 148.55, 148.06, 138.21, 136.52, 130.04, 129.65, 129.61, 129.08, 127.42, 126.65, 126.27, 124.91, 121.81, 56.42, 44.24, 41.97, 35.23, 32.23.
[0177] HCl salt .sup.1H-NMR (500 MHz; CD.sub.3OD): ? 8.87 (d, J=6.7 Hz, 2H), 8.39 (d, J=6.7 Hz, 2H), 7.87 (d, J=7.8 Hz, 1H), 7.75 (s, 1H), 7.57 (t, J=7.8 Hz, 1H), 7.36 (d, J=7.7 Hz, 1H), 7.28 (dd, J=16.5, 7.9 Hz, 2H), 7.22 (t, J=7.4 Hz, 1H), 7.04 (d, J=7.6 Hz, 1H), 4.75 (t, J=4.1 Hz, 1H), 3.64-3.60 (m, 1H), 3.43 (dd, J=15.8, 4.8 Hz, 1H), 3.35 (s, 1H), 3.19 (dd, J=15.8, 10.9 Hz, 1H), 2.89 (d, J=11.2 Hz, 6H), 2.59-2.48 (m, 2H). .sup.13C-NMR (100 MHz, CDCl.sub.3): 148.83, 148.02, 147.86, 136.95, 134.92, 129.60, 129.51, 129.26, 128.02, 126.85, 126.93, 126.00, 124.28, 121.58, 57.62, 45.35, 39.75, 39.54, 32.87, 30.01. C.sub.23H.sub.25N.sub.2 for [M+H].sup.+: 329.2018. Found: 329.2018. HPLC (s-prep): Solvent System: hexanes:MeOH:.sup.iPrOH:EtOH (70:10:10:10) 0.1% TEA (modifier), flow rate=3.0 mL/min; t.sub.1=9.27 min, t.sub.2=14.68 min.
[0178] Cis-4-(3-(pyridin-4-yl)phenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine 3e: cis-amine 3e was synthesized from cis-3Br-4-PAT 3a (66 mg, 0.2 mmol) and 4-pyridinylboronic acid (30 mg, 0.24 mmol) in presence of aq. potassium phosphate Tris(dibenzylideneacetone)dipalladium(0) (9 mg, 0.01 mmol) and PCy.sub.3 (7 mg, 0,024 mmol) following procedure described above for trans-2e (Scheme 10). Purification of crude reaction mixture by silica gel column chromatography (1:1:0.2 hexanes: ethyl acetate:triethylamine) afforded racemic cis-amine 3e as colorless oil with 55% isolated yield.
[0179] .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 8.64-8.62 (m, 2H), 7.52 (d, J=8.1 Hz, 1H), 7.48 (dd, J=4.6, 1.4 Hz, 2H), 7.45-7.42 (m, 2H), 7.26-7.24 (m, 1H), 7.15 (dt, J=13.7, 7.0 Hz, 2H), 7.03 (t, J=7.4 Hz, 1H), 6.77 (d, J=7.8 Hz, 1H), 4.19 (dd, J=12.2, 4.8 Hz, 1H), 3.08 (d, J=14.6 Hz, 1H), 3.06-2.87 (m, 2H), 2.38-2.37 (m, 7H), 1.87-1.75 (m, 1H). .sup.13C-NMR (126 MHz, CDCl.sub.3): ? 150.33, 148.28, 147.07, 138.67, 138.54, 129.60, 129.30, 127.43, 126.64, 126.45, 125.48, 121.80, 60.98, 47.05, 41.06, 36.39, 32.29.
[0180] HCl salt .sup.1H-NMR (500 MHz; CDCl.sub.3): ? 8.64-8.62 (m, 2H), 7.52 (d, J=8.1 Hz, 1H), 7.48 (dd, J=4.6, 1.4 Hz, 2H), 7.45-7.42 (m, 2H), 7.26-7.24 (m, 1H), 7.15 (dt, J=13.7, 7.0 Hz, 2H), 7.03 (t, J=7.4 Hz, 1H), 6.77 (d, J=7.8 Hz, 1H), 4.19 (dd, J=12.2, 4.8 Hz, 1H), 3.08 (d, J=14.6 Hz, 1H), 3.06-2.87 (m, 2H), 2.38-2.37 (m, 7H), 1.87-1.75 (m, 1H). .sup.13C-NMR (100 MHz, CDCl.sub.3): 149.05, 148.88, 147.95, 140.69, 134.84, 129.88, 129.15, 127.55, 126.98, 126.32, 125.59, 121.92, 62.12, 45.98, 39.01, 39.26, 34.65, 30.15. C.sub.23H.sub.25N.sub.2 for [M+H]*: 329.2018. Found: 329.2018. HPLC (s-prep): Solvent System: hexanes:EtOH (85:15) 0.1% TEA (modifier), 0.1% TFA (modifier), flow rate=3.0 mL/min; t.sub.1=18.60 min, t.sub.2=23.79 min.
##STR00051##
[0181] Examples of synthesized and purified chemical structures are shown below:
##STR00052## ##STR00053## ##STR00054## ##STR00055## ##STR00056## ##STR00057## ##STR00058## ##STR00059## ##STR00060## ##STR00061## ##STR00062##
Example 2. Functional Assays
[0182] For cell culture and transfection, HEK293 (ATCC no. CRL-1573) and HEK293T cells (ATCC no. CRL-3216) were maintained in MEM and DMEM (Corning), respectively, supplemented with 10% regular FBS and 1% penicillin/streptomycin; CHO cells (ATCC no. CRL-61) were maintained in Kaighn's modification of Ham's F-12K (Gibco) using the same supplementation. All cells were grown adherently in 10 cm plates in a humidified incubator kept at 37? C. and 5% carbon dioxide. All human wild type aminergic GPCR clones, encoded in a pcDNA3.1(+) vector, were obtained from the cDNA Resource Center (cdna.orq). Transient transfections were used to express 5-HT.sub.2A, 5-HT.sub.2C, ?.sub.1A- or ?.sub.1B-adrenergic receptors, whereas 5-HT.sub.7(a)Rs were stably expressed in HEK293 cells. H.sub.1Rs were transiently expressed, and D.sub.2Rs were stably expressed in CHO cells. 5-HT.sub.2B and 5-HT.sub.1ARs in HEK293T cells were transiently expressed because HEK293 cells failed to provide sufficient expression. D.sub.3Rs stably expressed in HEK293 cells were generously provided by Dr. David Sibley's laboratory.
[0183] Transient transfections were performed on cells in the log growth phase (70-90% confluence). First, a transfection cocktail was prepared by adding 10 ?g of cDNA and 40 ?g of linear polyethylenimine (?40,000 g/mol; Polysciences Inc.) separately to two 2.5 mL aliquots of Opti-MEM (Gibco, Ref. 31985-070). Each solution was mixed by inversion before combining, mixed by inversion again, and incubated at 37? C. for 30 minutes. Cells were then washed with 1 mL 1?PBS, followed by the gentle addition of 5 mL of transfection cocktail and 5 mL of cell culture medium with 5% (final) dialyzed FBS. Transfections were performed for 48 hours. This represents an economic modification of the previous transfection methods using lipofectamine or Turbofect (Invitrogen, #11668027 and Thermo Scientific, #R0532, respectively), which gave similar levels of expression for the receptors studied here. Cell membranes were homogenized as previously described (Perry, et al., 2020).
[0184] The affinity of ligands was determined via radioligand binding techniques using human recombinant receptors expressed in mammalian clonal cells. Details on assay conditions, radioligand, nonspecific binding and receptor expression are shown in Table 5. Number of independent radioligand binding experiments is shown in Table 6. In Table 6, all independent experiments listed were performed using 3 technical replicates.
[0185] Ligand affinity was assessed using established methodology and 2-5 ?g of protein per well, determined by the Pierce bicinchoninic acid protein assay according to the manufacturers protocol (Thermo Scientific), (Perry, et al., 2020; Roth, 2013). Saturation binding experiments were performed on membranes expressing 5-HT.sub.2A, 5-HT.sub.2B, 5-HT.sub.2C, or H.sub.1Rs in triplicate across 8 concentrations. Competition binding assays were performed in at least triplicate with approximate K.sub.d concentrations of radioligand. Total and nonspecific binding were determined in octet. Each compound was assessed in at least two independent experiments across 10-14 concentrations in half-log units (1 ?M-100 ?M) where the center of the concentration range was the approximate pK.sub.i. Serial dilutions of unlabeled compound were made in assay buffer at 2.5? the final concentration using 10 mM DMSO stocks (final [DMSO]?1%). Assays were terminated using rapid filtration via Whatman GF/B Fired Filters (Brandel Inc., Gaithersburg, MD) soaked in 0.3% (w/v) PEI, using an automated Tomtec Harvester 96 (Hamden, CT).
[0186] Filters were washed with 50 mM Tri-HCl (pH=7.4, 4? C.) before being oven dried and placed into scintillation vials containing 1 mL SX18-4 ScintiVerse.sup.TM BD Cocktail (Fisher Chemical, Fair Lawn, NJ). Scintillation was detected using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (Perkin Elmer, Boston, MA).
TABLE-US-00008 TABLE 5 Radioligand binding assay conditions for membranes used in this study, including the binding parameters used to derive K.sub.i values and the results of saturation binding assays. B.sub.max K.sub.d (pmol/mg Nonspecific Incubation (nM ? protein ? Hill Slope Receptor n Radioligand Binding (10 ?M) time (min) Buffer SEM) SEM) (n.sub.H) 5-HT.sub.1A.sup.d [.sup.3H]5-CT 5-HT 90 a 2.5 5-HT.sub.2A 3 [.sup.3H]Ketanserin mianserin 90 a 0.57 ? 0.24 3.48 ? 0.42 1.1 ? 0.2 5-HT.sub.2B 2 [.sup.3H]Mesulergine mianserin 90 a 2.82 ? 0.35 2.03 ? 0.28 1.0 ? 0.1 5-HT.sub.2C 3 [.sup.3H]Mesulergine mianserin 90 a 1.00 ? 0.17 7.65 ? 0.84 1.3 ? 0.2 5-HT.sub.7.sup.d [.sup.3H]5-CT 5-HT 180 a 0.3 H.sub.1 3 [.sup.3H]Mepyramine triprolidine 90 a 2.59 ? 0.22 8.48 ? 0.20 0.90 ? 0.36 D.sub.2L 3 [.sup.3H]Spiperone chlorpromazine 180 b 0.28 ? 0.031 2.470 ? 110.sup. D.sub.3 3 [.sup.3H]Spiperone chlorpromazine 180 b 0.14 ? 0.016 500 ? 90 ?.sub.1A.sup.e [.sup.3H]Prazosin chlorpromazine 90 c 0.64 ?.sub.1B.sup.e [.sup.3H]Prazosin chlorpromazine 90 c 0.75 Original data are represented as the mean ? SEM from the indicated number of individual experiments performed in triplicate. Buffer: .sup.a50 mM Tris-HCl, 10 mM MgCl.sub.2, 0.1 mM EDTA, pH = 7.4, .sup.b50 mM HEPES, 50 mM NaCl, 5 mM MgCl.sub.2, 0.5 mM EDTA, 0.1% BSA, pH = 7.4, .sup.c20 mM Tris-HCl, 145 mM NaCl, pH = 7.4 .sup.dValues obtained from (Armstrong, Casey et al., 2020). .sup.eValues obtained from (Roth, 2013).
TABLE-US-00009 TABLE 6 Number of independent radioligand binding experiments performed for each ligand at 5-HT.sub.2A, 5-HT.sub.2B, 5-HT2c, and H.sub.1Rs listed in Table 1.
[0187] The pharmacological parameters (e.g., pEC.sub.50, pK.sub.b, pIC.sub.50, I.sub.max) of agonist and antagonist-mediated signal transduction through Ga.sub.q-coupled 5-HT.sub.2A, 5-HT.sub.2B, 5-HT.sub.2C, and H.sub.1Rs was quantified using the Cisbio (Bedford, MA) IP-One homogeneous time resolved fluorescence (HTRF) immunoassay. The protocol used was consistent with that recommended by the manufacturer for suspension cells in 384-well plate format, with minor modifications. Immediately following transfection, cells were washed twice with 10 mL of prewarmed 1?PBS, dissociated in 10 mL of 1?PBS, and centrifuged at 270 g for 5 minutes at room temperature. Cells (?2,000 cells/?L, >90% viability, determined by the Corning? Cell Counter) were resuspended in the manufacturer's stimulation buffer (pH=7.4, 37? C.) modified to include 0.1% bovine serum albumin stabilizer (PerkinElmer, part #: CR84-100) and added to a white 384-well OptiPlate (PerkinElmer). Next, stimulation buffer, or 2? compound diluted in stimulation buffer, was added to each well. For competitive antagonism (pK.sub.b) experiments, 2? antagonist was diluted in stimulation buffer containing 2? reference agonist (e.g., 2 ?M 5-HT for WT and point mutated 5-HT.sub.2ARs, 20 nM 5-HT for 5-HT.sub.2BRs, and 20 ?M histamine for H.sub.1Rs) such that agonist and antagonist were added to the cells simultaneously. Cells were then incubated in the dark for two hours at 37? C. to ensure equilibrium was obtained. Plates were covered with an aluminum foil seal to prevent evaporation.
[0188] Following incubation, the manufacturer's lysis solution (detection buffer) containing inositol monophosphate (IP1) covalently bound to a fluorescent acceptor dye (d2) was added to each well. This process generated a homogenous mixture of cellular and d2-labeled IP1, in a ratio dependent on the concentration- and activity-dependent efficacy of test ligands to modulate cellular IP1 levels. Next, detection buffer containing an anti-IP1 antibody covalently bound to a terbium-cryptate, which serves as a fluorescent acceptor, was added to each well. A one-hour incubation at room temperature was used to allow competitive interactions between cellular and d2-labeled IP1 to equilibrate with anti-IP1-cryptate. Time-resolved fluorescent resonance energy transfer (TR-FRET) was then quantified by a Synergy H1 plate reader equipped with a HTRF filter cube (BioTek). Light pulse at 320 or 340 nm was used to excite the fluorescent donor, and emission at 615 and 665 nm was detected. The relative levels of TR-FRET were used to obtain an emission ratio at 665/620 nm, which was then used to interpolate the concentration of IP1 in each well.
[0189] Site directed mutagenesis experiments were performed using 5-phosphorylated, PAGE-purified custom primers (Life Technologies, Carlsbad CA) and the Quikchange Site-Directed Mutagenesis kit (Agilent, Santa Clara CA) according to the manufacturer's protocol. Reactions were performed in thin-walled PCR tubes using a TOne Gradient 96 Thermal Cycler (Biometra). Primer sequences and optimized reaction conditions are provided in Table 7A, and the primer sequences are provided in Table 7B. Following Dpn1 digestion, 2 ?L of the PCR product mixture was transformed into 50 ?L XL1-Blue competent cells using a 45 second pulse of heat in a 42? C. water bath. The transformed bacteria were then incubated for 1 hour at 37? C. in 0.5 mL of LB broth before being plated on LB-agar plates and incubated overnight at 37? C. The next day, two colonies for each mutated receptor were grown overnight in LB broth at 37? C. The mutated cDNA was extracted the following day using the PureYield? Plasmid Maxiprep System (Promega Corp., Madison WI). Purified DNA was sequence validated by Psomagen Inc. (Cambridge, MA).
TABLE-US-00010 TABLE7A Experimentalconditionsusedtoperformsite-directedmutagenesis. Receptor 5-HT.sub.2A H.sub.1 Mutation G238S.sup.5.42 I210V.sup.4.60 S242A.sup.5.46 C322K.sup.6.34 V235M.sup.5.39 F213K.sup.4.63 D231F.sup.5.35 W158I.sup.4.56 Forward 5- 5- 5- 5- 5- 5- 5 5- CCTGATCTC GGTATATCCA CCTGATCGGC GAGCAAAAGG CGATGATA CCAATACCA GCTTACTCGCC CCTGGTTTC CTCTTTTGTG TGCCAGTACC TCTTTTGTGG CAAAGAAGGT ACTTTATG GTCAAAGGG TTTGATAACTTT TCTCTTTTC TCATTTTTC- AGTCTTTG-3 CATTTTTCATT GCTGGG-3 CTGATCGG CTACAGGAT GTCCTG-3 TGATTGTTA 3 (SEQIDNO:2) CCCTTAAC-3 (SEQIDNO:4) CTC-3 TCG-3 (SEQIDNO:7) TTCCC-3 (SEQIDNO:1) (SEQIDNO:3) (SEQIDNO:5) (SEQIDNO:6) (SEQIDNO:8) Reverse 5- 5- 5- 5- 5- 5 5- 5- CAAAAGAGG CCAAGACTGG GTTAAGGGAA CCCAGCACCT GAGCCGAT CCTGTAGCC GACAAAGTTAT GCCTAGAAT AGATCAGGA TACTGGCATG TGAAAAATGC TCTTTGCCTTT CAGCATAA CTTTGACTG CAAAGGCGAG GGGAATAA CAAAGTTATC- GATATACC-3 CACAAAAGAG TGCTC-3 AGTTATCA GTATTGGCA TAAGCAAC-3 CAATCAGAA 3 (SEQIDNO:10) CCGATCAGG-3 (SEQIDNO:12) TCG-3 TGG-3 (SEQIDNO:15) AAGAG-3 (SEQIDNO:9) (SEQIDNO:11) (SEQIDNO:13) (SEQIDNO:14) (SEQIDNO:16) Initial 95(60sec) Denaturation (?C.) Denaturation 95(60sec) (?C.) Annealing 55(60sec) 58(60sec) 72(60sec) 66(60sec) 72(60sec) 58(60sec) 64C 62 58(60sec) (?C.) (60sec) (60sec) Extension 72(7min) Final 72(10min) Extension (?C.) Hold 4(O/N) (?C.) Cycles(n) 25 ngDNA 10 DMSO 0 5% 0 (%v/v)
TABLE-US-00011 TABLE7B PrimerSequencesfromTable7A. Sequence name: Sequence: Desc.: SEQID CCTGATCTCCTCTTTTGTGTCATTTTTC Primer NO:1 sequence SEQID GGTATATCCATGCCAGTACCAGTCTTTG Primer NO:2 sequence SEQID CCTGATCGGCTCTTTTGTGGCATTTTTCATTCCCTTAAC Primer NO:3 sequence SEQID GAGCAAAAGGCAAAGAAGGTGCTGGG Primer NO:4 sequence SEQID CGATGATAACTTTATGCTGATCGGCTC Primer NO:5 sequence SEQID CCAATACCAGTCAAAGGGCTACAGGATTCG Primer NO:6 sequence SEQID GCTTACTCGCCTTTGATAACTTTGTCCTG Primer NO:7 sequence SEQID CCTGGTTTCTCTCTTTTCTGATTGTTATTCCC Primer NO:8 sequence SEQID CAAAAGAGGAGATCAGGACAAAGTTATC Primer NO:9 sequence SEQID CCAAGACTGGTACTGGCATGGATATACC Primer NO:10 sequence SEQID GTTAAGGGAATGAAAAATGCCACAAAAGAGCCGATCAGG Primer NO:11 sequence SEQID CCCAGCACCTTCTTTGCCTTTTGCTC Primer NO:12 sequence SEQID GAGCCGATCAGCATAAAGTTATCATCG Primer NO:13 sequence SEQID CCTGTAGCCCTTTGACTGGTATTGGCATGG Primer NO:14 sequence SEQID GACAAAGTTATCAAAGGCGAGTAAGCAAC Primer NO:15 sequence SEQID GCCTAGAATGGGAATAACAATCAGAAAAGAG Primer NO:16 sequence
[0190] GraphPad Prism (La Jolla, CA) version 9.1.1 was used to analyze all experimental data in this work. To analyze data from saturation binding studies, the radioligand counts per minute (cpm) were normalized to fmol/mg protein bound and then fit the data to a specific binding with hill slope model. For competitive radioligand displacement studies, a baseline correction was performed by subtracting the mean nonspecific binding value from the radioligand binding values with and without competitor to obtain specific binding values. Specific binding values were then normalized such that total binding in the absence of competitor represented 100% radioligand binding, and the radioactivity associated with each concentration of competitor was a percentage of total binding. The normalized data was then fit to the one-site Fit K.sub.i nonlinear regression model. Ligand selectivity is reported as the fold change between mean affinity (K.sub.i) values.
[0191] The functional activity of each compound was determined by incubating cells expressing recombinant receptors with or without a compound of interest in parallel with well containing only buffer and 8 known concentrations of IP1 to generate a standard curve for each experiment. The IP1 concentration in cell-containing wells was then interpolated using nonlinear regression and the log(inhibitor) vs. response (three parameters) model in Prism. To control for variation between assays, the resulting concentrations were transformed into molar units and change from basal was calculated using the following equation (Equation 1), where B is the basal concentration of IP, and Y is the concentration of IP generated by cells incubated with compound.
[0192] The antagonist equilibrium dissociation constant (K.sub.b), determined in parallel with the EC.sub.50 of reference agonists, was calculated using the following Equation 2 (Cheng, 2001):
where IC.sub.50 is the concentration of antagonist which inhibited 50% of the IP1 elicited by a constant concentration (A) of reference agonist (i.e., 1 ?M 5-HT, 10 nM 5-HT, or 10 ?M histamine for 5-HT.sub.2A, 5-HT.sub.2B, and H.sub.1Rs, respectively), EC.sub.50 is the concentration of the reference agonist which elicited a half maximal response, and K is the Hill slope of the reference agonist. The IC.sub.50 of antagonists was determined using the log([inhibitor]) vs. response (three parameter) model, where cells stimulated only by A represented the lowest X value (?12). The same model was used to calculate the IC.sub.50 of inverse agonists in the absence of A. In contrast, the EC.sub.50 was derived from a log([agonist]) vs. response-variable slope (four parameters) model to simultaneously obtain K. Each K.sub.b, IC.sub.50, and EC.sub.50 value was logarithmically transformed into the pK.sub.b, pIC.sub.50, and pEC.sub.50, respectively for ease of presentation and statistical analyses. Since standard deviations tend to be symmetrically distributed around log normal pharmacological parameters (e.g., pK.sub.b, pIC.sub.50, and pEC.sub.50), but not equilibrium constants (e.g., K.sub.b, IC.sub.50, and EC.sub.50), statistical comparisons of in vitro functional data were only performed using log normal values (Neubig, et al., 2003).
[0193] No blinding or randomization methods were used for in vitro studies since these measurements are insensitive to time of day or experimenter interpretation.
[0194] Data exclusion, sample size and statistical analyses were utilized. For purposes of efficient lead identification, each competitive radioligand displacement assay condition was performed using three or four technical replicates in at least two independent experiments. Some results from radioligand binding assays were not included in the reported data, for example, when excessive or incomplete radioligand displacement (>30%) occurred at the lowest or highest concentration of unlabeled ligand, respectively. Among these experiments were three of 130 pK values at the 5-HT.sub.2AR (pK=6.99 for [2S,4S]-3h, pK.sub.i=9.84 and 9.65 for [2S,4R]-2i), one of 125 pK.sub.i values at the 5-HT.sub.2BR (pK.sub.i=7.32 for (2S,4R)-2k), and two of 119 pK.sub.i values at the 5-HT.sub.2CR (pK.sub.i=9.08 for [2S,4R)-2c, and pK.sub.i=9.17 for [2S,4R]-2d). These results were attributed to experimenter error during assay optimization or chemical contamination.
[0195] The number of concentrations (7-9) used between receptors varied in functional assays. Three technical replicates were used in all functional assays except for antagonism (K.sub.b) assays, which utilized two technical replicates. Five independent experiments were performed to define the functional concentration-response relationships for ligands acting at point mutated 5-HT.sub.2ARs, WT 5-HT.sub.2BRs, WT 5-HT.sub.2CRs, and WT H.sub.1Rs. The number of independent experiments performed at WT 5-HT.sub.2ARs to determine the EC.sub.50 of 5-HT, and the K.sub.b of antagonists, however, varied (n=14-19) since these experiments were performed in parallel with each other and often in parallel with analogous experiments at point mutated 5-HT.sub.2ARs (see Table 2 for exact n). For all in vivo conditions (Example 3), n=6 treatments were administered, except mice treated with vehicle+(?)-DOI (n=7) due to an additional mouse being procured in case of error.
[0196] The data and statistical analyses in this study comply with the recommendations on experimental design and analysis in pharmacology (Curtis, et al., 2018). Where n ? 5, all pharmacological parameters are presented according to Hopkin's two-digit rule (Hopkins, et al., 2011). Parametric one-way ANOVA and unpaired t-tests were used to analyze the data in this work. The p<0.05 was considered as statistically significant, and only performed statistical analyses on groups with n>5 independent samples. The potential agonist activity of (2S,4R)-2k or (2R,4S)-2c at 5-HT.sub.2B or 5-HT.sub.2CRs, respectively, indicated by an exploratory screening effort (
[0197] To ensure data adhered to assumptions of ordinary one-way ANOVA and unpaired parametric t-tests, diagnostic statistics were performed using Brown-Forsythe and F-tests to measure variance distribution, and Shapiro-Wilk tests for normality. Data abided by these assumptions in the majority of cases with few deviations, and where deviations occurred, nonparametric tests (Mann-Whitney U or Kruskal-Wallis) were performed to assess the robustness of a result. No deviations were endemic to a particular compound, receptor variant, or experimental technique, and no comparison violated both assumptions.
[0198] All tritiated radioligands were purchased from PerkinElmer (Boston, MA) and are shown in Table 5. 5-hydroxytryptamine hydrochloride and doxepine hydrochloride were purchased from Alfa Aesar (Ward Hill, MA). (?)-2,5-Dimethoxy-4-iodoamphetamine hydrochloride, chlorpromazine hydrochloride, histamine dihydrochloride, and tripolidine hydrochloride were purchased from Sigma Aldrich (St. Louis, MO). Mianserin hydrochloride, and risperidone (free base), were purchased from Tocris Biosciences (Bristol BS11 OQL, UK). PIMA tartrate was purchased from Selleck Chemical LLC (Houston, TX).
[0199] For nomenclature of targets and ligands, key protein targets and ligands are hyperlinked to corresponding entries in (guidetopharmacology.org), the common portal for data from the IUPHAR/BPS Guide to Pharmacology (Harding, et al., 2018), and are permanently archived in the Concise Guide to Pharmacology 2017/18 (Alexander, et al., 2017).
Example 3. Comparative In Vivo Assessment of PIMA, (2S,4R)-2k and (2R,4R)-3h
[0200] Adult male C57BL/6J mice were procured from Jackson Laboratories (Bar Harbor, ME) at 8 weeks of age, and housed 4/cage inside sterile ventilated caging by Innovive (San Diego, CA) on irradiated corn cob. All cages were changed in an animal transfer station using forceps soaked in Clidox-S? solution (Genestil). Animals were maintained in an SPF facility on a 12-hr light:dark cycle with ad libitum access to pre-filled acidified water (Innovive) and irradiated rodent diet (Prolab Isopro). After at least one week at Northeastern University, mice were transported two floors above their vivarium to a testing facility kept at approximately 22? C. with a constant background noise level of 62 dB and fluorescent lighting. All animals were habituated to the novel environment for a minimum of one hour before handling. To eliminate bias during in vivo studies, mice were marked on the tail with a permanent marker and placed in an alphanumeric home cage. A random number generator was used to select the order of mice undergoing treatment, and treatments were blinded to the administrator and observers.
[0201] Compounds were prepared in vehicle (5% (v/v) DMSO in MilliQ water) and filtered through a 0.22 ?m syringe filter. All injections were performed s.c. on the neck at 0.1 mL/10 g body weight. PIMA and (2S,4R)-2k were administered at 0.3 or 3 mg kg.sup.?1, whereas (2R,4R)-3h was administered at elevated doses (3.0 or 5.6 mg kg.sup.?1) as pilot studies indicated analogs in the (2R,4R)-configuration were less active in vivo. For all testing procedures, mice were pretreated with compound, placed in their home cage for the time indicated below, and then in an open field arena (43 cm?43 cm, Med Associates, St. Albans, VT). Trials were video-taped using a ceiling-mounted video tracking system connected to Noldus Ethovision XT9 software (Noldus Information Technology, Leesburg, VA) allowing for locomotor activity tracking (distance traveled, cm). Animals were sacrificed by cervical dislocation after being anesthetized with isoflurane.
[0202] All behavioral procedures comply with the Guide for the Care and Use of Laboratory Animals (Council, 2011) and were approved by the Northeastern University Institutional Animal Care and Use Committee. The animal care and use program is fully accredited by AAALAC, International and holds an Assurance with OLAW. Moreover, these studies are in accordance with the ARRIVE 2.0 guidelines (Percie du Sert, et al., 2020) and recommendations made by the British Journal of Pharmacology.
[0203] DOI-elicited head twitch response assays were performed (
[0204] Locomotor activity assays were performed (
[0205] To compare the in vivo activity of PIMA, (2S,4R)-2k, and (2R,4R)-3h the DOI-elicited head twitch response assay in mice was used as a model of central 5-HT.sub.2AR engagement sensitive to antipsychotic-like activity (Canal & Morgan, 2012). Acute administration of each compound significantly attenuated the head twitch response at every dose tested (
[0206] Notably, only male mice were used in this study, and it is unclear if the behavioral findings generalize to female mice, although sex differences in the sensitivity of mice to DOI are nil (Canal & Morgan, 2012). Future studies investigating the efficacy and safety of novel 4-PATs in more comprehensive animal models of psychosis should consider sex as an experimental variable.
Example 4. Molecular Modeling and Site-Directed Mutagenesis
[0207] For computational chemistry and molecular modeling, physicochemical parameters (log P and log D) were determined computationally using StarDrop? (Optibrium) version 6.5 and the freebase form of 4-PAT-type compounds (Optibrium). All molecular modeling images were generated using the PyMOL Molecular Graphics System, Version 2.0 Schr?dinger, LLC (Schrodinger, 2015).
[0208] In molecular docking work, the 3D PAT analogs were built using Maestro (Schrodinger, LLC) and were optimized using an ab initio quantum chemistry method at the HF/6-31G* level, followed by single point energy calculations of molecular electrostatic potential for charge fitting using Gaussian 16 (Gaussian, Inc.) (Bayly, et al., 1993). The atomic charges derived from ab initio calculations were used for molecular docking simulations. The crystal structures for 5-HT.sub.2AR (PDB: 6A94) and H.sub.1R (PDB: 3RZE) were processed to add missing sidechains and loops with Discovery Studio software (BIOVIA). AutoDock 4.2 (Morris, et al., 1998) was used to dock molecules into the receptors with selected sidechain flexible residues in the binding pocket. A grid map was generated for the receptor using C, H, N, O, S, F, Cl, Br, I (i.e., carbon, hydrogen, nitrogen, oxygen, sulfur, fluorine, chlorine, bromine, and iodine) elements sampled on a uniform grid containing 80?80?80 points, 0.375 ? apart. The Lamarckian genetic algorithm was selected to identify ligand binding conformations. For each ligand, 100 docking simulations were performed. The final docked ligand conformations were selected based on binding energies and cluster analysis.
[0209] The molecular dynamics simulations were performed was follows: the protonation states of the titratable residues of 5-HT.sub.2A, 5-HT.sub.2B, 5-HT.sub.2C and H.sub.1 structures were calculated at pH=7.4 using the H++ server (biophysics.cs.vt.edu/). The PAT-bound receptor complexes obtained from molecular docking studies were inserted into a simulated lipid bilayer composed of POPC:POPE:cholesterol (2:2:1), (Grossfield, et al., 2008) and a water box using CHARMM-GUI Membrane Builder webserver (charmm-gui.org). Sodium chloride (150 mM) and extra neutralizing counter ions were added into the systems. The PMEMD.CUDA program of AMBER 16 was used to conduct MD simulations. The Amber ff14SB, lipid17, and TIP3P force field was used for the receptors, lipids, and water. The parameters of PAT analogs were generated using general AMBER force field by the Antechamber module of AmberTools 17. The partial charges for the compounds were calculated using a restrained electrostatic potential charge-fitting scheme by ab initio quantum chemistry at the HF/6-31G* level 15 (Gaussian 16) (Bayly, et al., 1993). System topology and coordinate files were generated by using the tleap module of Amber. The systems were energy minimized by 500 steps (with position restraint of 500 kcal/mol/A.sup.2) followed by 2000 steps (without position restraint) using the steepest descent algorithm. Subsequently, the systems were heated from 0-303 K using Langevin dynamics with a collision frequency of 1 ps.sup.?1. Receptor complexes were position-restrained using an initial constant force of 500 kcal/mol/?.sup.2 during the heating process, and weakened to 10 kcal/mol/?.sup.2, allowing lipid and water molecules free movement. Next, systems went through 5 ns equilibrium MD simulations. Finally, a total of 100-1000 ns MD simulations were conducted, and coordinates were saved every 100 ps for analysis. The MD simulations were conducted under NPT (constant temperature and pressure). Pressure was regulated using an isotropic position scaling algorithm with the pressure relaxation time fixed at 2.0 ps. Long range electrostatics was calculated by a particle mesh Ewald method (Darden, 1993) with a 10 ? cutoff.
[0210] The SAR results reported above and elsewhere (Canal, et al., 2014; Sakhuja, et al., 2015) indicated that selectivity to bind 5-HT.sub.2A and/or 5-HT.sub.2CRs is negligible for 4-PATs with small meta-substituents on ring C (e.g., 3a, 3b, 3b, Table 1). In contrast, larger aryl substituents at this position can yield moderate to high selectivity to bind 5-HT.sub.2ARs over 5-HT.sub.2BRs in the (2S,4R)-configuration, and over 5-HT.sub.2B, 5-HT.sub.2C and H.sub.1Rs in the (2R,4R)-configuration. Meanwhile, PIMA selectively bound 5-HT.sub.2ARs over 5-HT.sub.2B and H.sub.1Rs, with moderate selectivity over 5-HT.sub.2CRs. To understand how aryl substituted 4-PATs and PIMA bind to 5-HT.sub.2ARs, molecular modeling studies were performed using a model of the 5-HT.sub.2AR (
[0211] Overall, PIMA, (2S,4R)-2k, and (2R,4R)-3h stabilized an inactive-like conformation of the 5-HT.sub.2AR, typified by an ionic lock between R173.sup.3.50 and E318.sup.6.30 within the E/DRY domain (
[0212] The models also indicated that the isobutoxybenzyl moiety of PIMA and aryl ring D of (2S,4R)-2k and (2R,4R)-3h occupied a side cavity between TM4 and TM5, unimpeded by the small side chain of G238.sup.5.42, a residue unique to 5-HT.sub.2-type receptors among aminergic GPCRs. Furthermore, in all models, F234.sup.5.38 assumed a rotamer conformation oriented away from G238.sup.5.42, which has been suggested to extend the side cavity (Kimura, et al., 2019). Several amphipathic and hydrophobic side chains in this region of the binding pocket (I210.sup.4.60, V235.sup.5.39, G238.sup.5.42, and S242.sup.5.46) were close enough to the isobutoxybenzyl of PIMA and aryl ring D of (2S,4R)-2k and (2R,4R)-3h to facilitate interactions (Table 3), thus providing a potential structural basis for the observed selectivity of these ligands to bind 5-HT.sub.2ARs.
[0213] To validate the molecular modeling results, residues were point-mutated in and around the 5-HT.sub.2AR side-extended cavity (Kimura, et al., 2019) and quantified the antagonist affinity (pK.sub.b) of (2S,4R)-2k and (2R,4R)-3h, as well as (2S,4R)-2a (which lacks 5-HT.sub.2R subtype selectivity) at 5-HT.sub.2AR variants to understand how stereochemistry and aryl ring D impact ligand-receptor interactions. Notably, like PIMA, (2S,4R)-2k, and (2R,4R)-3h, key analog (2S,4R)-2a demonstrated inverse agonist activity at C322K.sup.6.34 5-HT.sub.2ARs (
[0214] A G238S.sup.5.42 5-HT.sub.2AR was generated to test the hypothesis that the large side chain of serine precludes ligand access to the side extended cavity, as suggested by the molecular modeling results (
[0215] The above experiments were extended by asking if the attenuated affinity of (2S,4R)-2a, (2S,4R)-2k, and (2R,4R)-3h at G238S.sup.5.42 5-HT.sub.2ARs translates to aminergic GPCRs natively presenting S.sup.5.42. Table 4 shows that (2S,4R)-2k and (2R,4R)-3h had >1,000-fold selectivity for 5-HT.sub.2ARs over 5-HT.sub.1A, 5-HT.sub.7, D.sub.2L, ?.sub.1A- and ?.sub.1B-adrenergic GPCRs. It was noted that (2S,4R)-2k had 270-fold selectivity over D.sub.3Rs, whereas (2R,4R)-3h had >1,000-fold selectivity. In contrast, (2S,4R)-2a exhibited moderate-to-high affinity for 5-HT.sub.7, D.sub.2L, D.sub.3, and ?.sub.1A-adrenergic receptors.
[0216] Interestingly, aryl substituted 4-PATs in the (2S,4R)-configuration had high affinity for H.sub.1Rs (Table 1), despite the presence of T194.sup.5.42, which possesses a bulkier side chain than serine. The molecular modeling results suggested that W158.sup.4.56, a residue unique to H.sub.1Rs, might form stereospecific aromatic interactions with 4-PATs to impart high affinity (
[0217] Alignment of 5-HT.sub.2A, 5-HT.sub.2B and 5-HT.sub.2CR crystal structures (
[0218] Further inspection of the 5-HT.sub.2-type receptor crystal structures revealed that one helical turn above F.sup.5.38 in 5-HT.sub.2A and 5-HT.sub.2CRs exists a non-conserved residue in 5-HT.sub.2BRs (D231.sup.5.35, D211.sup.5.35, and F214.sup.5.35, respectively). The root-mean-square deviation (RMSD) of the F.sup.5.38 side chain in WT 5-HT.sub.2A and 5-HT.sub.2BRs was tracked in silico and found that F.sup.5.38 exhibited large transient variations in RMSD in WT 5-HT.sub.2ARs. Interestingly, the RMSD of F.sup.5.38 in D231F.sup.5.35 5-HT.sub.2ARs recapitulated the restricted pattern observed in silico for WT 5-HT.sub.2BRs, indicating that D231.sup.5.35 may facilitate flexibility in the side chain of F.sup.5.38 (
[0219] It was therefore hypothesized that D231.sup.5.35 may modulate the side chain rotamer of F234.sup.5.38 in 5-HT.sub.2ARs to mediate subtype selective binding. To test this hypothesis, a D231F.sup.5.35 5-HT.sub.2AR was generated, however, D231F.sup.5.35 5-HT.sub.2ARs were insufficiently responsive to 5-HT for competitive antagonism studies (
[0220] Residues in TM4 and TM5 lining the side-extended cavity of 5-HT.sub.2ARs and in proximity to PIMA, (2S,4R)-2k, and (2R,4R)-3h (Table 3) were then investigated. Among these were the side chains of 1210.sup.4-6, V235.sup.5.39, and S242.sup.5.46. Importantly, the side chains of 1210.sup.4.60 and V235.sup.5.39 are conserved in 5-HT.sub.2CRs, while S242.sup.5.46 is unique to 5-HT.sub.2ARs. It was hypothesized that selectivity to bind 5-HT.sub.2A and 5-HT.sub.2CRs over 5-HT.sub.2BRs may involve interactions with the side chains of 1.sup.4.60, V.sup.5.39, or the 5-HT.sub.2AR-specific residue S242.sup.5.46. In fact, a significant increase in the affinity of PIMA and (2S,4R)-2k at V235M.sup.5.39 5-HT.sub.2ARs was observed, with no change in affinity for any antagonist at 1210V.sup.4.60 or S242A.sup.5.46 5-HT.sub.2ARs (Table 2,
Example 5. X-Ray Crystal Structures
[0221] X-ray crystal data for compound 3b was acquired. The computing details were as follows: data collection: APEX3 (Bruker, 2016); cell refinement: SAINT V8.40A (Bruker, 2016); data reduction: SAINT V8.40A (Bruker, 2016); program(s) used to solve structure: ShelXT (Sheldrick, 2015); program(s) used to refine structure: SHELXL (Sheldrick, 2015); molecular graphics: Olex2 (Dolomanov et al., 2009); software used to prepare material for publication: Olex2 (Dolomanov et al., 2009). The identification code was: mukherjee_neu2_Om.
TABLE-US-00012 TABLE 8 Crystal data for compound 3b. C.sub.18H.sub.21ClNCl D.sub.x = 1.272 Mg m.sup.?3 M.sub.r = 322.26 Cu Ka radiation, ? = 1.54178 ? Orthorhombic, P2.sub.12.sub.12.sub.1 Cell parameters from 9860 reflections a = 5.9420 (3) ? ? = 4.3-66.9? b = 11.1529 (5) ? ? = 3.40 mm-1 C = 25.3900 (12) ? T = 100 K V = 1682.61 (14) ?.sup.3 Bar, clear colourless Z = 4 0.18 ? 0.07 ? 0.04 mm F(000) = 680
TABLE-US-00013 TABLE 9 Data collection for compound 3b. Bruker X8 Proteum-R 2968 independent diffractometer reflections Radiation source: rotating anode 2884 reflections with I > 2?(I) Montel monochromator R.sub.int = 0.060 ? and ? scans ?.sub.max = 66.9?, ?.sub.min = 4.3? Absorption correction: multi-scan h = ?7.fwdarw.7 SADABS2016/2 (Bruker, 2016/2) was used for absorption correction. wR2(int) was 0.1166 before and 0.0912 after correction. The Ratio of minimum to maximum transmission is 0.8256. The ?/2 correction factor is not present. T.sub.min = 0.615, T.sub.max = 0.744 k = ?13.fwdarw.13 45402 measured reflections l = ?29.fwdarw.30
TABLE-US-00014 TABLE 10 Refinement for compound 3b. Refinement on F.sup.2 Hydrogen site location: mixed Least-squares matrix: full H atoms treated by a mixture of independent and constrained refinement R[F.sup.2 > 2?(F.sup.2)] = 0.031 w = 1/[?.sup.2(F.sub.o.sup.2) + (0.0349P).sup.2 + 1.1454P] where P = (F.sub.o.sup.2 + 2F.sub.c.sup.2)/3 wR(F.sup.2) = 0.078 (?/?).sub.max < 0.001 S = 1.02 ?.sub.max = 0.24 e ?.sup.?3 2968 reflections ?.sub.min = ?0.36 e ?.sup.?3 196 parameters Absolute structure: Refined as an inversion twin. 0 restraints Absolute structure parameter: 0.069 (19) Primary atom site location: dual
[0222] Special details were as follows: Geometry. All esds (except the esd in the dihedral angle between two I.s. planes) are estimated using the full covariance matrix. The cell esds are taken into account individually in the estimation of esds in distances, angles and torsion angles; correlations between esds in cell parameters are only used when they are defined by crystal symmetry. An approximate (isotropic) treatment of cell esds is used for estimating esds involving I.s. planes. Refinement. Refined as a 2-component inversion twin.
TABLE-US-00015 TABLE 11 Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (?.sup.2) for (2R,4R)-3b. x y z U.sub.iso*/U.sub.eq Cl2 0.88258 (11) 0.55367 (6) 0.24390 (3) 0.02293 (17) Cl1 0.58356 (17) 0.15348 (8) 0.46069 (4) 0.0499 (3) N1 0.5574 (4) 0.7492 (2) 0.27226 (9) 0.0171 (5) H1 0.660 (5) 0.693 (3) 0.2646 (12) 0.020* C12 0.3887 (5) 0.5955 (2) 0.33127 (10) 0.0176 (5) H12A 0.509165 0.540350 0.319457 0.021* H12B 0.255240 0.582857 0.308608 0.021* C5 0.1331 (5) 0.7709 (2) 0.38592 (10) 0.0198 (6) C3 0.4679 (5) 0.7240 (2) 0.32688 (11) 0.0186 (6) H3 0.597167 0.733302 0.351783 0.022* C9 ?0.0116 (5) 0.6228 (3) 0.44571 (11) 0.0214 (6) H9 ?0.006632 0.544144 0.460043 0.026* C10 0.1436 (5) 0.6548 (2) 0.40696 (10) 0.0177 (6) C11 0.3285 (4) 0.5698 (2) 0.38904 (10) 0.0180 (6) H11 0.465101 0.588122 0.410584 0.022* C13 0.2790 (5) 0.4371 (3) 0.39580 (10) 0.0197 (6) C8 ?0.1720 (5) 0.7020 (3) 0.46377 (11) 0.0244 (7) H8 ?0.275419 0.678034 0.490290 0.029* C6 ?0.0307 (5) 0.8499 (3) 0.40423 (11) 0.0213 (6) H6 ?0.038832 0.928285 0.389719 0.026* C7 ?0.1816 (5) 0.8169 (3) 0.44304 (11) 0.0244 (7) H7 ?0.290824 0.872409 0.455378 0.029* C1 0.3876 (5) 0.7457 (3) 0.22867 (11) 0.0225 (6) H1A 0.290992 0.675139 0.232978 0.034* H1B 0.465557 0.741106 0.194713 0.034* H1C 0.295337 0.818430 0.229816 0.034* C14 0.0908 (5) 0.3851 (3) 0.37229 (11) 0.0242 (6) H14 ?0.014184 0.433647 0.353817 0.029* C2 0.6871 (5) 0.8633 (3) 0.27007 (12) 0.0240 (6) H2A 0.584391 0.931203 0.274793 0.036* H2B 0.762154 0.869971 0.235823 0.036* H2C 0.800244 0.863869 0.298162 0.036* C18 0.4296 (5) 0.3655 (3) 0.42272 (11) 0.0244 (6) H18 0.558587 0.399882 0.438880 0.029* C15 0.0567 (6) 0.2616 (3) 0.37591 (13) 0.0331 (8) H15 ?0.071234 0.226364 0.359695 0.040* C17 0.3915 (6) 0.2427 (3) 0.42604 (12) 0.0313 (7) C4 0.2915 (6) 0.8136 (3) 0.34327 (13) 0.0325 (8) H4A 0.201480 0.835611 0.311909 0.039* H4B 0.368078 0.887146 0.355773 0.039* C16 0.2082 (6) 0.1901 (3) 0.40297 (14) 0.0359 (8) H16 0.185177 0.105960 0.405476 0.043*
TABLE-US-00016 TABLE 12 Atomic displacement parameters (?.sup.2) for (mukherjee_neu2_0m). U.sup.11 U.sup.22 U.sup.33 U.sup.12 U.sup.13 U.sup.23 Cl2 0.0159 (3) 0.0189 (3) 0.0340 (4) 0.0016 (3) ?0.0004 (3) ?0.0022 (3) Cl1 0.0519 (6) 0.0334 (4) 0.0644 (6) 0.0042 (4) ?0.0121 (5) 0.0231 (4) N1 0.0149 (11) 0.0157 (11) 0.0205 (12) ?0.0015 (9) 0.0009 (9) 0.0025 (9) C12 0.0180 (13) 0.0160 (12) 0.0189 (12) ?0.0010 (12) 0.0013 (11) 0.0015 (10) C5 0.0225 (14) 0.0202 (13) 0.0167 (13) ?0.0011 (12) 0.0009 (12) 0.0001 (10) C3 0.0206 (14) 0.0167 (14) 0.0186 (13) ?0.0023 (11) 0.0014 (11) 0.0024 (11) C9 0.0250 (14) 0.0232 (15) 0.0158 (13) ?0.0074 (12) ?0.0038 (11) 0.0006 (11) C10 0.0190 (13) 0.0185 (13) 0.0156 (12) ?0.0044 (11) ?0.0033 (11) ?0.0010 (10) C11 0.0167 (13) 0.0177 (14) 0.0195 (13) ?0.0022 (11) ?0.0026 (10) 0.0027 (11) C13 0.0235 (14) 0.0194 (14) 0.0163 (12) ?0.0042 (12) 0.0024 (11) 0.0046 (11) C8 0.0233 (16) 0.0328 (17) 0.0172 (13) ?0.0049 (12) 0.0023 (11) ?0.0023 (12) C6 0.0239 (14) 0.0193 (14) 0.0206 (14) 0.0010 (12) ?0.0027 (12) ?0.0019 (12) C7 0.0224 (15) 0.0307 (17) 0.0202 (14) 0.0030 (12) ?0.0001 (11) ?0.0083 (12) C1 0.0204 (14) 0.0253 (14) 0.0218 (14) ?0.0009 (14) ?0.0033 (12) 0.0025 (11) C14 0.0269 (16) 0.0227 (14) 0.0229 (14) ?0.0069 (14) ?0.0045 (13) 0.0045 (11) C2 0.0234 (14) 0.0228 (15) 0.0260 (15) ?0.0079 (12) 0.0017 (12) 0.0031 (12) C18 0.0259 (15) 0.0204 (14) 0.0269 (14) ?0.0022 (12) ?0.0021 (12) 0.0052 (11) C15 0.039 (2) 0.0259 (16) 0.0345 (17) ?0.0118 (15) ?0.0056 (15) 0.0007 (14) C17 0.0376 (17) 0.0256 (15) 0.0308 (16) ?0.0033 (16) 0.0005 (16) 0.0106 (13) C4 0.0421 (19) 0.0206 (16) 0.0348 (17) 0.0058 (14) 0.0188 (15) 0.0069 (13) C16 0.050 (2) 0.0199 (16) 0.0379 (18) ?0.0063 (15) ?0.0004 (16) 0.0062 (14)
TABLE-US-00017 TABLE 13 Geometric parameters (?, ?) for (mukherjee_neu2_0m). Cl1C17 1.751 (3) C9C8 1.378 (4) N1C3 1.512 (3) C10C11 1.521 (4) N1C1 1.498 (3) C11C13 1.518 (4) N1C2 1.489 (4) C13C14 1.395 (4) C12C3 1.513 (4) C13C18 1.381 (4) C12C11 1.537 (4) C8C7 1.387 (4) C5C10 1.401 (4) C6C7 1.382 (4) C5C6 1.393 (4) C14C15 1.394 (4) C5C4 1.512 (4) C18C17 1.391 (4) C3C4 1.507 (4) C15C16 1.385 (5) C9C10 1.395 (4) C17C16 1.369 (5) C1N1C3 115.9 (2) C13C11C10 115.7 (2) C2N1C3 112.0 (2) C14C13C11 120.8 (2) C2N1C1 110.1 (2) C18C13C11 119.6 (2) C3C12C11 108.6 (2) C18C13C14 119.4 (3) C10C5C4 122.4 (3) C9C8C7 119.6 (3) C6C5C10 119.2 (3) C7C6C5 121.5 (3) C6C5C4 118.3 (3) C6C7C8 119.3 (3) N1C3C12 110.7 (2) C15C14C13 119.9 (3) C4C3N1 112.0 (2) C13C18C17 119.6 (3) C4C3C12 113.1 (2) C16C15C14 120.5 (3) C8C9C10 121.8 (3) C18C17Cl1 118.9 (3) C5C10C11 119.6 (2) C16C17Cl1 119.4 (2) C9C10C5 118.4 (3) C16C17C18 121.7 (3) C9C10C11 121.9 (2) C3C4C5 114.9 (2) C10C11C12 109.7 (2) C17C16C15 118.8 (3) C13C11C12 109.6 (2) X-ray crystal data for compound 3b was acquired. The identification code used below is: mukherjee_neu1_0m.
TABLE-US-00018 TABLE 14 Crystal data for compound 3b. ClC.sub.18H.sub.21FN D.sub.x = 1.311 Mg m.sup.?3 M.sub.r = 305.81 Cu K? radiation, ? = 1.54178 ? Orthorhombic, P2.sub.12.sub.12.sub.1 Cell parameters from 9957 reflections a = 8.6282 (5) ? ? = 4.9-66.7? b = 10.8425 (6) ? ? = 2.21 mm.sup.?1 c = 16.5630 (8) ? T = 100 K V = 1549.49 (14) ?.sup.3 Block, colorless Z = 4 0.18 ? 0.17 ? 0.16 mm F(000) = 648
TABLE-US-00019 TABLE 15 Data collection for compound 3b. Bruker X8 Proteum-R diffractometer 2723 reflections with I > 2?(I) Radiation source: rotating anode R.sub.int = 0.043 Montel monochromator ?.sub.max = 66.7?, ?.sub.min = 4.9? ? and ? scans h = ?10.fwdarw.9 63173 measured reflections k = ?12.fwdarw.12 2725 independent reflections l = ?19.fwdarw.19
TABLE-US-00020 TABLE 16 Refinement for compound 3b. Refinement on F.sup.2 Secondary atom site location: difference Fourier map Least-squares matrix: full Hydrogen site location: mixed R[F.sup.2 > 2?(F.sup.2)] = 0.025 H atoms treated by a mixture of independent and constrained refinement wR(F.sup.2) = 0.062 w= 1/[?.sup.2(F.sub.o.sup.2) + (0.0176P).sup.2 + 0.690P] where P = (F.sub.o.sup.2 + 2F.sub.c.sup.2)/3 S = 1.16 (?/?).sub.max = 0.001 2725 reflections ?.sub.max = 0.17 e ?.sup.?3 206 parameters ?.sub.min = ?0.20 e ?.sup.?3 2 restraints Absolute structure: Refined as an inversion twin. Primary atom site location: Absolute structure parameter: 0.079 (17) dual
[0223] Special details were as follows: geometry. All esds (except the esd in the dihedral angle between two I.s. planes) are estimated using the full covariance matrix. The cell esds are taken into account individually in the estimation of esds in distances, angles and torsion angles; correlations between esds in cell parameters are only used when they are defined by crystal symmetry. An approximate (isotropic) treatment of cell esds is used for estimating esds involving I.s. planes. Refinement. Refined as a 2-component inversion twin.
TABLE-US-00021 TABLE 17 Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (?.sup.2) for (2S,4S)-3b. Occ. x y z U.sub.iso*/U.sub.eq (<1) Cl1 0.69912 (6) 0.82202 (5) 0.75000 (3) 0.02173 (14) F1A 0.6256 (2) 0.49037 (16) 0.31538 (10) 0.0277 (5) 0.823 (4) N003 0.3699 (2) 0.73623 (16) 0.76393 (10) 0.0160 (4) H003 0.470 (3) 0.754 (2) 0.7501 (17) 0.019* C13 0.3977 (2) 0.5182 (2) 0.49729 (12) 0.0146 (4) C12 0.3875 (2) 0.6236 (2) 0.63301 (12) 0.0159 (4) H12A 0.391418 0.539805 0.656723 0.019* H12B 0.494473 0.656288 0.630547 0.019* C17 0.5477 (3) 0.4594 (2) 0.38254 (13) 0.0215 (5) H17 0.599455 0.482388 0.334211 0.026* 0.177 (4) C6 ?0.1049 (3) 0.5955 (2) 0.61602 (13) 0.0178 (5) H6 ?0.164619 0.605955 0.663701 0.021* C11 0.3185 (2) 0.61731 (19) 0.54739 (12) 0.0142 (4) H11 0.339830 0.698303 0.520734 0.017* C14 0.3964 (3) 0.3950 (2) 0.52103 (13) 0.0176 (5) H14 0.343216 0.371583 0.568858 0.021* C18 0.4734 (3) 0.5504 (2) 0.42596 (13) 0.0174 (4) H18 0.473744 0.633460 0.407632 0.021* C10 0.1431 (2) 0.59977 (19) 0.54831 (13) 0.0146 (4) C8 ?0.0915 (3) 0.5515 (2) 0.47410 (13) 0.0193 (5) H8 ?0.141018 0.529928 0.424866 0.023* C5 0.0556 (2) 0.6136 (2) 0.61874 (12) 0.0142 (4) C7 ?0.1776 (3) 0.5625 (2) 0.54483 (14) 0.0198 (5) H7 ?0.286034 0.547475 0.544175 0.024* C4 0.1295 (3) 0.6481 (2) 0.69864 (13) 0.0178 (5) H4A 0.141059 0.573369 0.732423 0.021* H4B 0.061427 0.706704 0.727712 0.021* C9 0.0670 (3) 0.5721 (2) 0.47598 (13) 0.0175 (5) H9 0.124898 0.567368 0.427302 0.021* C16 0.5512 (3) 0.3376 (2) 0.40501 (13) 0.0226 (5) H16 0.605009 0.277501 0.374053 0.027* C3 0.2877 (3) 0.70688 (19) 0.68536 (12) 0.0144 (4) H3 0.271798 0.786112 0.655588 0.017* C15 0.4721 (3) 0.3063 (2) 0.47541 (13) 0.0235 (5) H15 0.469921 0.222628 0.492467 0.028* 0.823 (4) C2 0.3824 (3) 0.6312 (2) 0.82160 (13) 0.0212 (5) H2A 0.283091 0.619989 0.849382 0.032* H2B 0.463527 0.648859 0.861356 0.032* H2C 0.408661 0.555840 0.791995 0.032* C1 0.3031 (3) 0.8460 (2) 0.80562 (14) 0.0229 (5) H1A 0.311371 0.918207 0.770334 0.034* H1B 0.360182 0.861285 0.855777 0.034* H1C 0.193805 0.830461 0.818139 0.034* F1B 0.4922 (12) 0.2008 (6) 0.4961 (5) 0.035 (3) 0.177 (4)
TABLE-US-00022 TABLE 18 Atomic displacement parameters (?.sup.2) for (mukherjee_neu1_0m). U.sup.11 U.sup.22 U.sup.33 U.sup.12 U.sup.13 U.sup.23 Cl1 0.0214 (3) 0.0216 (2) 0.0222 (2) ?0.0002 (2) ?0.0012 (2) ?0.0008 (2) F1A 0.0280 (10) 0.0383 (10) 0.0168 (8) ?0.0075 (8) 0.0095 (7) ?0.0028 (7) N003 0.0192 (9) 0.0151 (8) 0.0137 (9) 0.0006 (7) ?0.0023 (8) ?0.0032 (7) C13 0.0106 (10) 0.0211 (11) 0.0122 (10) 0.0010 (8) ?0.0023 (8) ?0.0028 (8) C12 0.0149 (11) 0.0185 (11) 0.0142 (10) 0.0004 (9) ?0.0006 (9) ?0.0031 (8) C17 0.0146 (11) 0.0364 (14) 0.0136 (11) ?0.0046 (10) 0.0032 (9) ?0.0060 (10) C6 0.0172 (11) 0.0182 (11) 0.0180 (10) 0.0009 (9) 0.0023 (9) 0.0029 (9) C11 0.0142 (10) 0.0148 (9) 0.0135 (10) 0.0007 (9) 0.0009 (8) ?0.0018 (8) C14 0.0202 (11) 0.0203 (11) 0.0122 (10) 0.0024 (10) 0.0000 (9) 0.0003 (8) C18 0.0157 (10) 0.0220 (11) 0.0144 (10) ?0.0043 (9) ?0.0013 (8) ?0.0009 (9) C10 0.0150 (11) 0.0122 (9) 0.0168 (10) 0.0020 (8) ?0.0006 (8) 0.0010 (8) C8 0.0193 (12) 0.0201 (11) 0.0184 (11) 0.0015 (10) ?0.0060 (9) ?0.0003 (9) C5 0.0160 (11) 0.0129 (10) 0.0137 (10) 0.0012 (8) ?0.0003 (8) 0.0012 (8) C7 0.0137 (11) 0.0200 (10) 0.0258 (11) 0.0006 (9) ?0.0024 (9) 0.0029 (9) C4 0.0172 (11) 0.0223 (11) 0.0139 (10) ?0.0010 (9) 0.0010 (8) ?0.0022 (8) C9 0.0164 (11) 0.0213 (11) 0.0149 (11) 0.0034 (9) 0.0000 (8) ?0.0028 (9) C16 0.0185 (11) 0.0309 (13) 0.0184 (11) 0.0056 (10) ?0.0027 (8) ?0.0095 (10) C3 0.0166 (11) 0.0163 (10) 0.0104 (9) ?0.0009 (8) ?0.0019 (8) ?0.0010 (8) C15 0.0288 (12) 0.0228 (12) 0.0189 (11) 0.0089 (10) ?0.0058 (9) ?0.0029 (9) C2 0.0286 (13) 0.0200 (11) 0.0148 (10) 0.0002 (10) ?0.0043 (10) 0.0021 (9) C1 0.0275 (12) 0.0213 (11) 0.0199 (10) 0.0045 (10) ?0.0014 (10) ?0.0064 (9) F1B 0.066 (6) 0.014 (4) 0.024 (4) 0.013 (4) 0.003 (4) ?0.001 (3)
TABLE-US-00023 TABLE 19 Geometric parameters (?, ?) for (mukherjee_neu1_0m). F1AC17 1.343 (3) C6C7 1.383 (3) N003C3 1.516 (3) C11C10 1.525 (3) N003C2 1.490 (3) C14C15 1.387 (3) N003C1 1.492 (3) C10C5 1.397 (3) C13C11 1.520 (3) C10C9 1.399 (3) C13C14 1.393 (3) C8C7 1.393 (3) C13C18 1.394 (3) C8C9 1.385 (3) C12C11 1.539 (3) C5C4 1.516 (3) C12C3 1.519 (3) C4C3 1.523 (3) C17C18 1.379 (3) C16C15 1.393 (3) C17C16 1.373 (4) C15F1B 1.206 (7) C6C5 1.399 (3) C2N003C3 115.07 (16) C5C10C9 119.00 (19) C2N003C1 109.90 (17) C9C10C11 118.94 (18) C1N003C3 112.58 (17) C9C8C7 119.6 (2) C14C13C11 121.35 (19) C6C5C4 118.61 (19) C14C13C18 118.9 (2) C10C5C6 119.48 (19) C18C13C11 119.75 (19) C10C5C4 121.91 (19) C3C12C11 109.44 (17) C6C7C8 119.8 (2) F1AC17C18 119.1 (2) C5C4C3 110.74 (17) F1AC17C16 117.0 (2) C8C9C10 121.1 (2) C16C17C18 123.9 (2) C17C16C15 116.8 (2) C7C6C5 120.9 (2) N003C3C12 110.47 (17) C13C11C12 111.11 (17) N003C3C4 112.54 (16) C13C11C10 111.31 (17) C12C3C4 109.97 (17) C10C11C12 112.33 (17) C14C15C16 121.2 (2) C15C14C13 120.5 (2) F1BC15C14 124.8 (4) C17C18C13 118.7 (2) F1BC15C16 113.5 (5) C5C10C11 122.04 (19) Document origin: publCIF [Westrip, S. P. (2010). J. Apply. Cryst., 43, 920-925].
Example 6. Synthesis of Charged Substituent on Tetralin Core
[0224] Each of the compounds or formulas disclosed herein can be derivatized to a corresponding positively charged quaternary amine, for example, by the addition of a third alkyl group to the amine to render it impermeable to the blood-brain barrier and specific for peripheral 5-HT receptors. For example, any of the compounds or formulas described herein may be derivatized at an amino group at the 2 position of the tetralin core via Scheme 11 shown below, wherein R.sup.4 can represent ring C including substituents described above or shown in
##STR00076##
[0225] Examples compounds that can be synthesized, with E representing a charged group or charged amine, are shown below:
##STR00077## ##STR00078## ##STR00079## ##STR00080## ##STR00081## ##STR00082## ##STR00083## ##STR00084## [0226] or a pharmaceutically acceptable salt, hydrate, or solvate thereof.
Example 7. Compounds Bearing a Positively Charged Amino Group at the 2 Position of the Tetralin Core Do Not Readily Cross the Blood-Brain Barrier
[0227] In an example to demonstrate the compound or composition does not substantially accumulate in the human brain, adult, male, C57Bl/6J mice, approximately six months old, and treatment-na?ve for at least six weeks prior to testing, can be injected sc with any of the compounds described herein, bearing a positively charged amino group at the 2 position of the tetralin core (the test compound) at a dose of about 3.0 mg/kg and returned to their home cages. At 30, 60, or 90 min later, mice are euthanized by rapid cervical dislocation and decapitation. Trunk blood is collected in pre-chilled, heparin-coated tubes. Brains are quickly excised and frozen in liquid nitrogen. Plasma is collected from blood after centrifugation for 5 min at 13,000 g. Whole brain samples are wrapped in foil, and brain and plasma samples are labeled and stored at ?80? C. until liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) assays are performed. Frozen brain samples are weighed and homogenized in phosphate buffered saline (PBS), pH 7.4. After the first analysis, the extra brain homogenate is stored at ?80? C. until they are thawed for a second, more dilute, analysis. Plasma samples are used directly upon arrival. The proteins from each plasma sample and a portion of each brain homogenate are immediately precipitated with 1:1 methanol:acetonitrile (4? starting volume) and internal standard (e.g. (?)-MBP.sup.68) followed by centrifugation at 14,000 g for 5 minutes at 4? C. The resulting supernatants from each sample are dried under nitrogen. Each sample is reconstituted in methanol, vortexed, sonicated briefly, and centrifuged prior to LC-MS/MS analysis. Calibration curves are constructed from the ratios of the peak areas of test compound versus internal standard in extracted standards made in mouse plasma or homogenized mouse brain.
[0228] LC-MS/MS analysis can be performed using an Agilent 1100 series HPLC and a Thermo Finnigan Quantum Ultra triple quad mass spectrometer. Example mobile phases used are 0.1% formic acid in water (A) and 0.1% formic acid in methanol (B) in a 5 minute gradient. Samples of 10 ?L each are injected onto a Phenomenex Gemini C18 column (2?50 mm, 5?) with a C18 guard column. The test compound and its internal standard ((?)-MBP) were ionized in ESI+ and detected in SRM mode. Internal standards are used for quantification of the test compound level per g tissue or per ?L plasma.
[0229] The test compounds are not expected to accumulate in the brain and, rather, are expected to be more prevalent in the plasma.
[0230] Each of the compounds disclosed herein can be derivatized to a corresponding positively charged quaternary amine, for example, by the addition of a third alkyl group, to render it impermeable to the blood-brain barrier and specific for peripheral 5-HT receptors.
REFERENCES
[0231] Alexander S P, Christopoulos A, Davenport A P, Kelly E, Marrion N V, Peters J A, . . . Collaborators C (2017). THE CONCISE GUIDE TO PHARMACOLOGY 2017/18: G protein-coupled receptors. Br J Pharmacol 174 Suppl 1: S17-S129. [0232] Altman R A, & Buchwald S L (2007). Pd-catalyzed Suzuki-Miyaura reactions of aryl halides using bulky biarylmonophosphine ligands. Nat Protoc 2: 3115-3121. [0233] Ancoli-Israel S, Vanover K E, Weiner D M, Davis R E, & van Kammen D P (2011). Pimavanserin tartrate, a 5-HT(2A) receptor inverse agonist, increases slow wave sleep as measured by polysomnography in healthy adult volunteers. Sleep Med 12: 134-141. [0234] Andersson K E, & Gratzke C (2007). Pharmacology of alpha1-adrenoceptor antagonists in the lower urinary tract and central nervous system. Nat Clin Pract Urol 4: 368-378. [0235] Armstrong J L, Casey A B, Saraf T S, Mukherjee M, Booth R G, & Canal C E (2020). (S)-5-(2-Fluorophenyl)-N,N-dimethyl-1,2,3,4-tetrahydronaphthalen-2-amine, a Serotonin Receptor Modulator, Possesses Anticonvulsant, Prosocial, and Anxiolytic-like Properties in an Fmr1 Knockout Mouse Model of Fragile X Syndrome and Autism Spectrum Disorder. ACS Pharmacol Transl Sci 3: 509-523. [0236] Ayme-Dietrich E, Lawson R, Cote F, de Tapia C, Da Silva S, Ebel C, . . . Monassier L (2017). The role of 5-HT2B receptors in mitral valvulopathy: bone marrow mobilization of endothelial progenitors. Br J Pharmacol 174: 4123-4139. [0237] Ballard C, Kales H C, Lyketsos C, Aarsland D, Creese B, Mills R, Williams H, Sweet R A. Psychosis inAlzheimer's Disease. Curr Neurol Neurosci Rep. 2020; 20(12):57. doi: 10.1007/s11910-020-01074-y. PMID: 33048274. [0238] Ballard C, Banister C, Khan Z, Cummings J, Demos G, Coate B, Youakim J M, Owen R, Stankovic S. Evaluation of the safety, tolerability, and efficacy of pimavanserin versus placebo in patients with Alzheimer's disease psychosis: a phase 2, randomised, placebo-controlled, double-blind study. Lancet Neurol. 2018; 17(3):213-222. doi: 10.1016/S1474-4422(18).sub.30039-5.PMID: 29452684). [0239] Ballesteros J A, Weinstein, H. (1995). Integrated Methods for the Construction of Three-Dimensional Models and Computational Probing of Structure-Function Relations in G Protein-Coupled Receptors Methods in Neuroscience 25: 366-428. [0240] Bayly C I, Cieplak P, Cornell W D, & Kollman P A (1993). A Well-Behaved Electrostatic Potential Based Method Using Charge Restraints for Deriving Atomic Chargesthe Resp Model. J Phys Chem-Us 97: 10269-10280. [0241] Bellos I, Pergialiotis V, Papapanagiotou A, Loutradis D, Daskalakis G. Comparative efficacy and safety of oral antihypertensive agents in pregnant women with chronic hypertension: a network metaanalysis. Am J Obstet Gynecol. 2020 October; 223(4):525-537. doi: 10.1016/j.ajog.2020.03.016. PMID: 32199925. [0242] Berardelli A, Rothwell J C, Thompson P D, Hallett M. Pathophysiology of bradykinesia in Parkinson's disease.Brain. 2001; 124(Pt 11):2131-46. doi: 10.1093/brain/124.11.2131. PMID: 11673316. [0243] Bevilacqua L, Doly S, Kaprio J, Yuan Q, Tikkanen R, Paunio T, . . . Goldman D (2010). A population-specific HTR2B stop codon predisposes to severe impulsivity. Nature 468: 1061-1066. [0244] Booth R G, Fang L, Huang Y, Wilczynski A, & Sivendran S (2009). (1R, 3S)-(?)-trans-PAT: a novel full-efficacy serotonin 5-HT2C receptor agonist with 5-HT.sub.2A and 5-HT2B receptor inverse agonist/antagonist activity. Eur J Pharmacol 615: 1-9. [0245] Canal C E, & Morgan D (2012). Head-twitch response in rodents induced by the hallucinogen 2,5-dimethoxy-4-iodoamphetamine: a comprehensive history, a re-evaluation of mechanisms, and its utility as a model. Drug Test Anal 4: 556-576. [0246] Canal C E, Morgan D, Felsing D, Kondabolu K, Rowland N E, Robertson K L, . . . Booth R G (2014). A novel aminotetralin-type serotonin (5-HT) 2C receptor-specific agonist and 5-HT2A competitive antagonist/5-HT2B inverse agonist with preclinical efficacy for psychoses. J Pharmacol Exp Ther 349: 310-318. [0247] Caraci F, Santagati M, Caruso G, Cannavb D, Leggio G M, Salomone S, Drago F. New antipsychotic drugs for the treatment of agitation and psychosis in Alzheimer's disease: focus on brexpiprazole and pimavanserin. F1000Res. 2020; 9:F1000. doi: 10.12688/f1000research.22662.1. PMID:32695312. [0248] Casey A B, Mukherjee M, McGlynn R P, Cui M, Kohut S J, Booth R G. A new class of 5-HT2A/5-HT2C receptor inverse agonists: Synthesis, molecular modeling, in vitro and in vivo pharmacology of novel 2-aminotetralins. Br J Pharmacol. 2022 June; 179(11):2610-2630. doi: 10.1111/bph.15756. Epub 2022 Mar. 7. PMID: 34837227. [0249] Chagraoui A, Thibaut F, Skiba M, Thuillez C, & Bourin M (2016). 5-HT2C receptors in psychiatric disorders: A review. Prog Neuropsychopharmacol Biol Psychiatry 66: 120-135. [0250] Cheng H C (2001). The power issue: determination of KB or Ki from IC50. A closer look at the Cheng-Prusoff equation, the Schild plot and related power equations. J Pharmacol Toxicol Methods 46: 61-71. [0251] Chopko T C, & Lindsley C W (2018). Classics in Chemical Neuroscience: Risperidone. ACS Chem Neurosci 9: 1520-1529. [0252] Cordova-Sintjago T C, Fang L, Bruysters M, Leurs R, & Booth R G (2012). Molecular determinants of ligand binding at the human histamine H1 receptor: Site-directed mutagenesis results analyzed with ligand docking and molecular dynamics studies at H1 homology and crystal structure models. J Chem Pharm Res 4: 2937-2951. [0253] Council N R (2011) Guide for the care and use of laboratory animals. National Academy Press. Washington, D.C. Available from http://ebookcentral.proquest.com/lib/northeastern-ebooks/detail.action?doclD=3378734. [0254] Cummings J, Isaacson S, Mills R, Williams H, Chi-Burris K, Corbett A, . . . Ballard C (2014). Pimavanserin for patients with Parkinson's disease psychosis: a randomised, placebo-controlled phase 3 trial. Lancet 383: 533-540. [0255] Curtis M J, Alexander S, Cirino G, Docherty J R, George C H, Giembycz M A, . . . Ahluwalia A (2018). Experimental design and analysis and their reporting II: updated and simplified guidance for authors and peer reviewers. Br J Pharmacol 175: 987-993. [0256] Darden T. YD, Pedersen L. (1993). Particle Mesh Ewald-an N.Log(n) Method for Ewald Sums in Large Systems. J Chem Phys 98: 10089-10092. [0257] Demireva E Y, Suri D, Morelli E, Mahadevia D, Chuhma N, Teixeira C M, . . . Ansorge M S (2018). 5-HT2C receptor blockade reverses SSRI-associated basal ganglia dysfunction and potentiates therapeutic efficacy. Mol Psychiatry. [0258] Egan C T, Herrick-Davis K, & Teitler M (1998). Creation of a constitutively activated state of the 5-hydroxytryptamine2A receptor by site-directed mutagenesis: inverse agonist activity of antipsychotic drugs. J Pharmacol Exp Ther 286: 85-90. [0259] El Haj M, Altintas E, Chapelet G, Kapogiannis D, Gallouj K. High depression and anxiety in people with Alzheimer's disease living in retirement homes during the covid-19 crisis. Psychiatry Res. 2020; 291:113294. doi: 10.1016/j.psychres.2020.113294. PMID: 32763552. [0260] Fava M, Dirks B, Freeman M P, Papakostas G I, Shelton R C, Thase M E, . . . Stankovic S (2019). A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study of Adjunctive Pimavanserin in Patients With Major Depressive Disorder and an Inadequate Response to Therapy (CLARITY). J Clin Psychiatry 80. [0261] Fluyau D, Mitra P, Jain A, Kailasam V K, Pierre C G. Selective serotonin reuptake inhibitors in the treatment of depression, anxiety, and post-traumatic stress disorder in substance use disorders: a Bayesian meta-analysis. Eur J Clin Pharmacol. 2022; 78(6):931-942. doi: 10.1007/s00228-022-03303-4. PMID: 35246699. [0262] Gillard M, Van Der Perren C, Moguilevsky N, Massingham R, & Chatelain P (2002). Binding characteristics of cetirizine and levocetirizine to human H(1) histamine receptors: contribution of Lys(191) and Thr(194). Mol Pharmacol 61: 391-399. [0263] Grossfield A, Pitman M C, Feller S E, Soubias 0, & Gawrisch K (2008). Internal hydration increases during activation of the G-protein-coupled receptor rhodopsin. J Mol Biol 381: 478-486. [0264] Gutierrez M G, Mansfield K S, & Malmstadt N (2016). The Functional Activity of the Human Serotonin 5-HT1A Receptor Is Controlled by Lipid Bilayer Composition. Biophys J 110: 2486-2495. [0265] Hacksell U, Burstein E S, McFarland K, Mills R G, & Williams H (2014). On the discovery and development of pimavanserin: a novel drug candidate for Parkinson's psychosis. Neurochem Res 39: 2008-2017. [0266] Harding S D, Sharman J L, Faccenda E, Southan C, Pawson A J, Ireland S, . . . Nc I (2018). The IUPHAR/BPS Guide to PHARMACOLOGY in 2018: updates and expansion to encompass the new guide to IMMUNOPHARMACOLOGY. Nucleic Acids Res 46: D1091-D1106. [0267] Hauser A S, Attwood M M, Rask-Andersen M, Schioth H B, & Gloriam D E (2017). Trends in GPCR drug discovery: new agents, targets and indications. Nat Rev Drug Discov 16: 829-842. [0268] Hedner T, Persson B. Effects of a new serotonin antagonist, ketanserin, in experimental and clinical hypertension. Am J Hypertens. 1988; 1(3 Pt 3):317S-323S. doi: 10.1093/ajh/1.3.317s. PMID: 3046635. [0269] Hopkins W G, Batterham A M, Pyne D B, & Impellizzeri F M (2011). Misplaced decimal places. Scand J Med Sci Sports 21: 867-868. [0270] Janssen W, Schymura Y, Novoyatleva T, Kojonazarov B, Boehm M, Wietelmann A, Luitel H, Murmann K, Krompiec D R, Tretyn A, Pullamsetti S S, Weissmann N, Seeger W, Ghofrani H A, Schermuly R T. Biomed Res Int. 2015; 2015:438403. doi: 10.1155/2015/438403. Epub 2015 Feb. 1. PMID: 25667920. [0271] Kim K, Che T, Panova O, DiBerto J F, Lyu J, Krumm B E, . . . Roth B L (2020). Structure of a Hallucinogen-Activated Gq-Coupled 5-HT.sub.2A Serotonin Receptor. Cell 182: 1574-1588 e1519. [0272] Kimura K T, Asada H, Inoue A, Kadji F M N, Im D, Mori C, . . . Shimamura T (2019). Structures of the 5-HT.sub.2A receptor in complex with the antipsychotics risperidone and zotepine. Nat Struct Mol Biol 26: 121-128. [0273] Knapp D M, Gillis E P, & Burke M D (2009). A general solution for unstable boronic acids: slow-release cross-coupling from air-stable MIDA boronates. J Am Chem Soc 131: 6961-6963. [0274] Kristiansen K, Kroeze W K, Willins D L, Gelber El, Savage J E, Glennon R A, & Roth B L (2000). A highly conserved aspartic acid (Asp-155) anchors the terminal amine moiety of tryptamines and is involved in membrane targeting of the 5-HT(2A) serotonin receptor but does not participate in activation via a salt-bridge disruption mechanism. J Pharmacol Exp Ther 293: 735-746. [0275] Kudo N, Perseghini M, & Fu G C (2006). A versatile method for Suzuki cross-coupling reactions of nitrogen heterocycles. Angew Chem Int Ed Engl 45: 1282-1284. [0276] Lee J S, Kildegaard H F, Lewis N E, & Lee G M (2019). Mitigating Clonal Variation in Recombinant Mammalian Cell Lines. Trends Biotechnol 37: 931-942. [0277] Lefkowitz R J, Pierce K L, & Luttrell L M (2002). Dancing with different partners: protein kinase a phosphorylation of seven membrane-spanning receptors regulates their G protein-coupling specificity. Mol Pharmacol 62: 971-974. [0278] Meltzer H Y (1999). The role of serotonin in antipsychotic drug action. Neuropsychopharmacology 21: 106S-115S. [0279] Meltzer H Y, Mills R, Revell S, Williams H, Johnson A, Bahr D, & Friedman J H (2010). Pimavanserin, a serotonin(2A) receptor inverse agonist, for the treatment of parkinson's disease psychosis. Neuropsychopharmacology 35: 881-892. [0280] Moguilevsky N, Varsalona F, Guillaume J P, Noyer M, Gillard M, Daliers J, . . . Bollen A (1995). Pharmacological and functional characterisation of the wild-type and site-directed mutants of the human H1 histamine receptor stably expressed in CHO cells. J Recept Signal Transduct Res 15: 91-102. [0281] Moniri N H, Covington-Strachan D, & Booth R G (2004). Ligand-directed functional heterogeneity of histamine H1 receptors: novel dual-function ligands selectively activate and block H1-mediated phospholipase C and adenylyl cyclase signaling. J Pharmacol Exp Ther 311: 274-281. [0282] Morris G M, Goodsell D S, Halliday R S, Huey R, Hart W E, Belew R K, & Olson A J (1998). Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function. J Comput Chem 19: 1639-1662. [0283] Nagatomo T, Rashid M, Abul Muntasir H, Komiyama T. Functions of 5-HT.sub.2A receptor and its antagonists in the cardiovascular system. Pharmacol Ther. 2004; 104(1):59-81. doi: 10.1016/j.pharmthera.2004.08.005. PMID: 15500909. [0284] Neubig R R, Spedding M, Kenakin T, Christopoulos A, International Union of Pharmacology Committee on Receptor N, & Drug C (2003). International Union of Pharmacology Committee on Receptor Nomenclature and Drug Classification. XXXVIII. Update on terms and symbols in quantitative pharmacology. Pharmacol Rev 55: 597-606. [0285] Nicholson A N, Pascoe P A, Turner C, Ganellin C R, Greengrass P M, Casy A F, & Mercer A D (1991). Sedation and histamine H1-receptor antagonism: studies in man with the enantiomers of chlorpheniramine and dimethindene. Br J Pharmacol 104: 270-276. Optibrium StarDrop v. 6.5 (optibrium.com). [0286] Padhariya K, Bhandare R, Canney D, Velingkar V. Cardiovascular Concern of 5-HT2B Receptor and Recent Vistas in the Development of Its Antagonists. Cardiovasc Hematol Disord Drug Targets. 2017; 17(2):86-104. doi: 10.2174/1871529X17666170703115111. PMID: 28676029. [0287] Pandy-Szekeres G, Munk C, Tsonkov T M, Mordalski S, Harpsoe K, Hauser A S, . . . Gloriam D E (2018). GPCRdb in 2018: adding GPCR structure models and ligands. Nucleic Acids Res 46: D440-D446. [0288] Peng Y, McCorvy J D, Harpsoe K, Lansu K, Yuan S, Popov P, . . . Liu Z J (2018). 5-HT2C Receptor Structures Reveal the Structural Basis of GPCR Polypharmacology. Cell 172: 719-730 e714. [0289] Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey M T, Baker M, . . . Wurbel H (2020). The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol 18: e3000410. [0290] Perry C K, Casey A B, Felsing D E, Vemula R, Zaka M, Herrington N B, . . . Booth R G (2020). Synthesis of novel 5-substituted-2-aminotetralin analogs: 5-HT1A and 5-HT7 G protein-coupled receptor affinity, 3D-QSAR and molecular modeling. Bioorg Med Chem 28: 115262. [0291] Peters J U, Hert J, Bissantz C, Hillebrecht A, Gerebtzoff G, Bendels S, . . . Kansy M (2012). Can we discover pharmacological promiscuity early in the drug discovery process?Drug Discov Today 17: 325-335. [0292] Pitychoutis P M, Belmer A, Moutkine I, Adrien J, & Maroteaux L (2015). Mice Lacking the Serotonin Htr2B Receptor Gene Present an Antipsychotic-Sensitive Schizophrenic-Like Phenotype. Neuropsychopharmacology 40: 2764-2773. [0293] Rasmussen S G, Choi H J, Fung J J, Pardon E, Casarosa P, Chae P S, . . . Kobilka B K (2011). Structure of a nanobody-stabilized active state of the beta(2) adrenoceptor. Nature 469: 175-180. [0294] Roth B L (2013). Assay Protocol Book Version II. University of North Carolina at Chapel Hill, Chapel Hill, NC. [0295] Rothman R B, Baumann M H, Savage J E, Rauser L, McBride A, Hufeisen S J, & Roth B L (2000). Evidence for possible involvement of 5-HT(2B) receptors in the cardiac valvulopathy associated with fenfluramine and other serotonergic medications. Circulation 102: 2836-2841. [0296] Sakhuja R, Kondabolu K, Cordova-Sintjago T, Travers S, Vincek A S, Kim M S, . . . Booth R G (2015). Novel 4-substituted-N,N-dimethyltetrahydronaphthalen-2-amines: synthesis, affinity, and in silico docking studies at serotonin 5-HT2-type and histamine H1 G protein-coupled receptors. Bioorg Med Chem 23: 1588-1600. [0297] Schrodinger, LLC (2015). The PyMOL Molecular Graphics System, Version 1.8. [0298] Seiler M P, & Markstein R (1984). Further characterization of structural requirements for agonists at the striatal dopamine D2 receptor and a comparison with those at the striatal dopamine D1 receptor. Studies with a series of monohydroxyaminotetralins on acetylcholine release from rat striatum. Mol Pharmacol 26: 452-457. [0299] Shapiro D A, Kristiansen K, Weiner D M, Kroeze W K, & Roth B L (2002). Evidence for a model of agonist-induced activation of 5-hydroxytryptamine 2A serotonin receptors that involves the disruption of a strong ionic interaction between helices 3 and 6. J Biol Chem 277: 11441-11449. [0300] Shimamura T, Shiroishi M, Weyand S, Tsujimoto H, Winter G, Katritch V, . . . Iwata S (2011). Structure of the human histamine H1 receptor complex with doxepin. Nature 475: 65-70. [0301] Simonoff E, Pickles A, Charman T, Chandler S, Loucas T, Baird G. Psychiatric disorders in children with autism spectrum disorders: prevalence, comorbidity, and associated factors in a population-derived sample J Am Acad Child Adolesc Psychiatry. 2008; 47(8):921-9. doi: 10.1097/CHI.0b013e318179964f. PMID: 18645422. [0302] Stahl S M (2008). Selective histamine H1 antagonism: novel hypnotic and pharmacologic actions challenge classical notions of antihistamines. CNS Spectr 13: 1027-1038. [0303] Stahl S M (2016). Mechanism of action of pimavanserin in Parkinson's disease psychosis: targeting serotonin 5HT.sub.2A and 5HT2C receptors. CNS Spectr 21: 271-275. [0304] Symons J L, Cho K J, Chang J T, Du G, Waxham M N, Hancock J F, . . . Levental K R (2021). Lipidomic atlas of mammalian cell membranes reveals hierarchical variation induced by culture conditions, subcellular membranes, and cell lineages. Soft Matter 17: 288-297. [0305] Tariot P N, Cummings J L, Soto-Martin M E, Ballard C, Erten-Lyons D, Sultzer D L, Devanand D P, Weintraub D, McEvoy B, Youakim J M, Stankovic S, Foff E P. Trial of Pimavanserin in Dementia-Related Psychosis. N Engl J Med. 2021; 385(4):309-319. doi: 10.1056/NEJMoa2034634.PMID: 34289275. [0306] Tran K T, Pallesen J S, Solbak S M O, Narayanan D, Baig A, Zang J, . . . Bach A (2019). A Comparative Assessment Study of Known Small-Molecule Keap1-Nrf2 Protein-Protein Interaction Inhibitors: Chemical Synthesis, Binding Properties, and Cellular Activity. J Med Chem 62: 8028-8052. [0307] Unett D J, Gatlin J, Anthony T L, Buzard D J, Chang S, Chen C, . . . Gaidarov I (2013). Kinetics of 5-HT2B receptor signaling: profound agonist-dependent effects on signaling onset and duration. J Pharmacol Exp Ther 347: 645-659. [0308] Valk P J, & Simons M (2009). Effects of loratadine/montelukast on vigilance and alertness task performance in a simulated cabin environment. Adv Ther 26: 89-98. [0309] Vanover K E, Weiner D M, Makhay M, Veinbergs I, Gardell L R, Lameh J, . . . Davis R E (2006). Pharmacological and behavioral profile of N-(4-fluorophenylmethyl)-N-(1-methylpiperidin-4-yl)-N-(4-(2-methylpropyloxy)phen ylmethyl) carbamide (2R,3R)-dihydroxybutanedioate (2:1) (ACP-103), a novel 5-hydroxytryptamine(2A) receptor inverse agonist. J Pharmacol Exp Ther 317: 910-918. [0310] Vass M, Podlewska S, de Esch I J P, Bojarski A J, Leurs R, Kooistra A J, & de Graaf C (2019). Aminergic GPCR-Ligand Interactions: A Chemical and Structural Map of Receptor Mutation Data. J Med Chem 62: 3784-3839. [0311] Vincek A S, & Booth R G (2009). New Approach to 4-Phenyl-beta-aminotetralin from 4-(3-Halophenyl)tetralen-2-ol Phenylacetate. Tetrahedron Lett 50: 5107-5109. [0312] Visiers I, Ballesteros J A, & Weinstein H (2002). Three-dimensional representations of G protein-coupled receptor structures and mechanisms. Methods Enzymol 343: 329-371. [0313] Weiner D M, Burstein E S, Nash N, Croston G E, Currier E A, Vanover K E, . . . Brann M R (2001). 5-hydroxytryptamine2A receptor inverse agonists as antipsychotics. J Pharmacol Exp Ther 299: 268-276. [0314] Wen M C, Chan L L, Tan L C, Tan E K. Depression, anxiety, and apathy in Parkinson's disease: insights from neuroimaging studies. Eur J Neurol. 2016; 23(6):1001-19. doi: 10.1111/ene.13002. PMID: 27141858. [0315] Zhang Y, Baycin-Hizal D, Kumar A, Priola J, Bahri M, Heffner K M, . . . Betenbaugh M J (2017). High-Throughput Lipidomic and Transcriptomic Analysis To Compare SP2/0, CHO, and HEK-293 Mammalian Cell Lines. Anal Chem 89: 1477-1485.