MiRNA molecule, equivalent, antagomir, or source thereof for treating and/or diagnosing a condition and/or a disease associated with neuronal deficiency or for neuronal (re)generation

11497762 · 2022-11-15

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to the diagnostic and therapeutic uses of a miRNA molecule, an equivalent or a source thereof in a neuronal deficiency or a disease and condition associated with neuronal deficiency.

Claims

1. A method for treating, reverting, preventing, curing, and/or delaying epilepsy comprising administering to a subject in need thereof a therapeutically effective amount of an antagomir of a miRNA-135, or a source of such an antagomir or a pharmaceutical composition comprising an antagomir of a miRNA-135, or a source of such an antagomir, wherein said miRNA-135 is a miRNA-135 molecule or a miRNA-135 isomiR, and is an oligonucleotide with a seed sequence comprising at least 6 of the 7 nucleotides of the seed sequence represented by SEQ ID NOs: 14-17, 19-42, 52-55, or is a source thereof.

2. The method according to claim 1, wherein said miRNA-135 is a miRNA-135a molecule, a miRNA-135b molecule, an isomiR of miRNA-135a, or an isomiR of miRNA-135b.

3. The method according to claim 1, wherein a source of a miRNA is a precursor of a miRNA and is an oligonucleotide of at least 50 nucleotides in length.

4. The method according to claim 1, wherein said miRNA-135 shares at least 70% sequence identity with any one of SEQ ID NOs: 147-214, and/or wherein said antagomir shares at least 70% sequence identity with any one of SEQ ID NOs: 242-245, 247-314, and/or wherein said miRNA or antagomir is from 15-30 nucleotides in length, and/or wherein said source of a miRNA is a precursor of said miRNA and shares at least 70% sequence identity with any one of SEQ ID NOs: 1-3 or 10-12.

5. The method according to claim 1, wherein the amount of antagomir administered is effective to restore expression of myocyte-specific enhancer factor 2A (Mef2a).

6. The method according to claim 1, wherein the amount of antagomir administered is effective to reduce seizure count and/or seizure duration.

7. The method according to claim 1, wherein the amount of antagomir administered is effective to prevent, delay, or revert abnormal neuronal spine formation.

8. The method according to claim 1, wherein the subject is a human with mesial temporal lobe epilepsy with hippocampal sclerosis.

9. A method for reducing spontaneous seizures in a subject with epilepsy comprising administering to the subject a therapeutically effective amount of an antagomir of a miRNA-135, or a source of such an antagomir or a pharmaceutical composition comprising an antagomir of a miRNA-135, or a source of such an antagomir, wherein said miRNA-135 is a miRNA-135 molecule or a miRNA-135 isomiR, and is an oligonucleotide with a seed sequence comprising at least 6 of the 7 nucleotides of the seed sequence represented by SEQ ID NOs: 14-17, 19-42, 52-55, or is a source thereof.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1: Image-based high content screen identifies miRNAs involved in neurite growth.

(2) (A) Schematic representation of the Cellomics ArrayScan screen. SH-SY5Y cells were seeded and differentiated using retinoic acid. Viral library was added and after 3 days cells were fixed and immunostained. Images covering the entire surface of the well were taken using a Thermo Arrayscan automated microscope and analyzed using a Neuronal Profiling algorithm to assess the effect of miRNAs on general neuron-like features, such as the number of neurites, neurite length, and number of branch-points. The effect of a miRNA on each parameter was scored binarily (0 or 1). A positive score (1) was given when the effect on the parameter deviated more than 2 times the standard deviation of the median value for all miRNAs. Scores for each of the triplicate plates were combined, with the score for a certain parameter taken into account (effect is ‘true’) when the miRNA scored positive in a minimum of 2 out of 3 plates. This resulted in a final (cumulative) ‘hitscore’ which was used to rank the lentiviral clones for an effect on neuronal morphology. (B) Representative images of untreated SH-SY5Y cells (left panel) and SH-SY5Y cells treated with retinoic acid (middle panel). The right panel shows the result of tracings generated by the Neuronal Profiling algorithm. Scale bar: 100 μm. (C) Graph showing the cumulative score of all the parameters of the Neuronal Profiling algorithm for the top list of annotated miRNAs that have a positive effect on neuronal features of virus-transduced SH-SY5Y cells. (D) Graphs showing average total hitscore (left), hitscore based on parameters describing neurite length (middle), and hitscore based on parameters describing neurite branching (right) of SH-SY5Y cells electroporated with the indicated miRIDIAN miRNA mimics. Data are expressed as means±SEM. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001, One-way ANOVA with Tukeys multiple comparison test. Scale bar: 200 μm.

(3) FIG. 2: Expression of miR-135a and miR-135b during neuronal development.

(4) (A, C) Graphs show results of quantitative PCR experiments on RNA from isolated mouse cortex (A) or from hippocampus (C) from 5 different embryonic and post-natal stages. Tissue from three different mice from different litters was used for analysis. Samples were run in duplicate. Fold changes are relative to 5S housekeeping rRNA expression. Data are expressed as means±SEM. (B) Locked-nucleic acid (LNA) in situ hybridization shows miR-135a and miR-135b expression in the E14, P10 and adult cortex. miR-135a and miR-135b are expressed in the cortical plate (cp) and upper layers of the adult cortex. Sections treated with scrambled LNA-in situ probes were devoid of specific staining. Scale bars: 200 μm. (D) Locked-nucleic acid (LNA) in situ hybridization shows miR-135a and miR-135b expression in the E16, P0, P10 and adult hippocampus. In the hippocampus, the dentate gyrus (DG) and CA3 region specifically show strong miR-135a and miR-135b staining. Sections treated with scrambled LNA-in situ probes were devoid of specific staining. Scale bars: 200 μm.

(5) FIG. 3: miR-135a and miR-135b increase neurite outgrowth and branching.

(6) (A) Graphs show results of quantitative PCR on primary hippocampal neurons at different days in vitro (DIV). RNA was collected from 3-4 coverslips of two different cultures. Samples were run in duplicate. Fold changes are relative to 5S housekeeping rRNA expression. Data are expressed as means±SEM. (B) Representative silhouettes of primary neurons at day in vitro (DIV) 4 following transfection with control-1, miR-135a, miR-135b and miR-135a/miR-135b mimics. Longest neurites are shaded in grey. (C) Graph shows results of tracing of the longest neurite of DIV4 hippocampal neurons in experiments as in A. At least 173 neurons were traced from 3 individual experiments. Data are expressed as means±SEM. ** p<0.01, **** p<0.0001, T-test. (D) Quantification of tracing of the longest neurite of DIV4 hippocampal neurons after transfection with scrambled or miR-135a and miR-135b H1-mCherry-sponge vectors. Sponges are labelled “sp” and are antagomiRs of their indicated miRNA. At least 100 neurons were traced from ≥3 individual experiments. Data are expressed as means±SEM. ** p<0.01, T-test. (E) Representative silhouettes of primary neurons at DIV 4 following transfection with control sponge—or miR-135ab sponge vector. Longest neurites are shaded in grey. (F) Sholl analysis from 31 control-1 (dark grey), 15 miR-135a (light grey), 16 miR-135b (black) or 23 miR-135a and miR-135b (light grey with black outline) over-expressing neurons reveals increased branching in proximal neurites and in the distal axon. Data are expressed as means±SEM. **** p<0.0001, multiple T-tests. In the silhouette, proximal neurites originate from the main cellular corpus, and distal branches originate from the long neurite; both are shaded in grey. (G) Cumulative intersections of neurites from neurons transfected with control-1 or miR-135a and miR-135b mimics with the sholl-circles (as in D). Data are expressed as means±SEM. ** p<0.01, T-test.

(7) FIG. 4: miR-135s are required for cortical neuron migration.

(8) (A) Representative images of cortices that were ex vivo electroporated with control-1, miR-135a, or miR-135b mimics. Neuron migration was quantified by placing a rectangle containing 8 square bins perpendicular on the cortex. Cells in each bin were counted and expressed as percentage of the total number of cells in the rectangle. The bins perfectly align with the layers of the cortex: ventricular zone (vz), subventricular zone (svz), intermediate zone (iz), cortical plate (cp), and marginal zone (mz). Cell-counts of two to three rectangles per section were used for comparison. At least two to three sections from 3 animals from different litters were used. Data are expressed as means±SEM. Red** bin7 control-1 vs. miR-135a: MWU=24, p=0.0042; blue* bin 4 control-1 vs. miR-135b: MWU=32, p=0.0195; blue** bin 7 control-1 vs. miR-135b: MWU=25, p=0.0051, Mann-Whitney U tests. Scale bar: 100 μm.

(9) (B) Representative images and quantification of neuron migration and leading process length in in utero electroporated E16.5 cortices of mice embryos treated with either control-1 or miR-135a and miR-135b mimics. GFP signal in white. Neuron migration was quantified as described in (F). Data are expressed as means±SEM. Bin 3: MWU=198, p<0.0001; bin6 MWU=282, p<0.0053; bin 7: MWU=161, p<0.0001; bin 8: MWU=164, p<0.0001. ** p<0.01, **** p<0.0001, Mann-Whitney U tests, **** p<0.0001 T-test. Scale bar: 100 μm.

(10) (C) Representative images and quantification of neuron migration and leading process length in in utero electroporated E16.5 cortices of mice embryos treated with either scrambled or miR-135a and miR-135b H1-mCherry-sponge vectors. mCherry signal in white. Neuron migration was quantified as described in (A). Data are expressed as means±SEM. Bin 2: MWU=70, p=0.018; bin 5: MWU=69, p=0.016; bin 6: MWU=75, p=0.030; bin 8: MWU=69, p=0.016, Mann-Whitney U tests, * p<0.05. **** p<0.0001 T-test. Scale bar: 100 μm.

(11) (D) Representative images and quantification of neuron migration in in utero electroporated P4 cortices of mice pups electroporated with either control-1 or miR-135a and miR-135b mimics at E14.5. GFP signal in white. Neuron migration was quantified as described in (A). Data are expressed as means±SEM. Bin3: MWU=475, p=0.0114; bin 4: MWU=392.5, p=0.0016; bin 5: MWU=148, p<0.0001; bin 6: MWU=319.5, p=0.0004; bin 7: MWU=194.5, p<0.0001, Mann-Whitney U tests.* p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Scale bar: 200 μm.

(12) (E) Representative images and quantification of neuron migration in in utero electroporated P10 cortices of mice pups electroporated with either control-1 or miR-135a and miR-135b mimics at E14.5. GFP signal in white. Neuron migration was quantified as described in (A). Data are expressed as means±SEM. Bin 6: MWU 783.5, p=0.032, Mann-Whitney U test. * p<0.05. Scale bar: 200 μm.

(13) FIG. 5: Kruppel-like factor 4 (KLF4) is a functional target for miR-135a and miR-135b during axonal development and neuron migration. (A) Schematic representation of predicted miR-135a and miR-135b binding sites in the 3′-UTR of KLF4 mRNA. Site 394 is predicted to mediate strongest binding (marked by arrow). (B) The 3′-UTR of KLF4 was cloned into a psi-CHECK2 vector and used for a Renilla-luciferase assay with control-1 or miR-135a and miR-135b mimics. Subsequently, a psi-CHECK vector with the KLF4 3′-UTR in which 3 nucleotides within site 394 were mutated was used to confirm specificity of miRNA-135-KLF4 binding. Luciferase activity was normalized to the 3′-UTR only condition of either wild-type or mutated 3′-UTR (UTRm). The experiment was repeated 3 times. Data are expressed as means±SEM. ** p<0.01, * p<0.05, T-test. (C) Immunohistochemistry of KLF4 in sections of mouse cortex and hippocampus at E16.5 and adulthood. KLF4 is highly expressed in the cortical plate (cp), in axons running through the intermediate zone (iz) and in hippocampal granule cells in the dentate gyrus (DG) and in pyramidal cells of the CA3. Scale bars: 200 μm. (D) Western blot analysis of KLF4 protein levels after transfection of control-1 or miR-135a and miR-135b mimics in Neuro2A cells. Data are expressed as means±SEM. ** p<0.01, T-test. (E) Representative silhouettes of primary hippocampal neurons at 4 days in vitro (DIV 4) after transfection with control-1 mimics, control-1 mimics combined with a KLF4 cDNA insensitive for miRNA binding (CMV-KLF4-GFP), miR-135a and miR-135b mimics, and miR-135a and miR-135b mimics combined with CMV-KLF4-GFP. (F) Graph shows results of tracing of the longest neurite of DIV4 hippocampal neurons in experiments as in E. At least 182 neurons were traced from 3 individual experiments. Data are expressed as means±SEM. * p<0.05, *** p<0.001, **** p<0.0001, T-test. (G) Representative images and quantification of neuron migration and leading process length in in utero electroporated E16.5 cortices of mice embryos treated with either miR-135a and miR-135b mimics, or miR-135a and miR-135b mimics combined with a pCAG-KLF4 vector which is insensitive to miR-135 regulation. Neuron migration was quantified as described in FIG. 4. Data are expressed as means±SEM. Bin1: MWU=422, p=0.0171, bin2: MWU=332, p=0.0005, bin3: MWU=293, p<0.0001, bin4: MWU=395, p=0.0068, bin5: MWU=357, p=0.0016, bin6: MWU=261, p<0.0001, bin7: MWU=219, p<0.0001 and bin8: MWU=211.5, p<0.0001. Mann-Whitney U tests. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Control-1 condition is as described in FIG. 4B. Scale bar: 100 μm.

(14) FIG. 6: Exogenous miR-135s enhance axon regeneration after optic nerve injury.

(15) (A) Experimental setup of the optic nerve crush studies. (B, C) Graph shows results of quantitative PCR on eye tissue following injection of mimics. miR-135a and miR-135b levels are increased after two injections of miRNA-mimics, while KLF4 levels are decreased (C). Fold changes are relative to 5S housekeeping rRNA expression. Data are expressed as means±SEM. * p<0.05, ** p<0.01, T-test on delta Ct values. (D) Representative images of optic nerves stained for Cholera-toxin B conjugated to Alexa-555 14 days after optic nerve crush. Following injection of miR-135 mimics axons grow into and beyond the injury site (dotted lines indicate proximal and distal boundaries site of injury). Boxes indicate higher magnification images shown at the right. Scale bar: 100 μm. (E) Graph shows quantification of the number of regenerating axons relative to the distal end of the crush site at 14 days post-injury for the conditions represented in (D). n=9 mice per condition. * p<0.05; **** p<0.0001, ANOVA followed by Sidak's test. Data are presented as means±SEM. (F) Graph shows results of quantitative PCR on eye tissue following co-transfection of miR-135 mimics and GFP or KLF4 vector. No differences in miR-135a and miR-135b expression between the GFP or KLF4 transfected groups. Fold changes are relative to 5S housekeeping rRNA expression. Data are expressed as means±SEM. (G) AAV2-GFP virus was injected intravitreally. One week post-injection strong GFP signals are detected in RGCs but not in other cell types in the retina. Scale bar 100 μm. (H) Graph shows quantification of the number of regenerating axons relative to the distal end of the crush site at 14 days post-injury for experiments performed using intravitreal injection of AAV2 (at 7 days pot-lesion) expressing control miRNA or miR-135a and miR-135b (in addition to GFP). n=6 mice per condition. **** p<0.0001, ANOVA followed by Sidak's test. Data are presented as means±SEM. (I) Graph shows quantification of the number of regenerating axons relative to the distal end of the crush site at 14 days post-injury for experiments performed using intravitreal injection of control or miR-135a and miR-135b sponge vectors. n=6 mice per condition. ** p<0.01, ANOVA followed by Sidak's test. Data are presented as means±SEM.

(16) FIG. 7: Human data of miR-135a A) Expression levels of miR-135a in human TLE patients determined by quantitative PCR. C— controls, mTLE-HS, mTLE+HS. n=6 patients/group. Students tTest. Normalized to U6 and 5srRNA. Students Ttest, *p<0.05, **p<0.01.

(17) B) Representative images of in situ localization of miR-135a among different groups. Scale bar, 200

(18) FIG. 8: Celltype specific localization of miR-135a. Co-localization with neuronal marker, NeuN. Specific localization of miR-135a was observed in neuronal soma co-stained with NeuN in the CA regions among different groups. Scale bar, 25 μm.

(19) FIG. 9: miR-135a expression upregulated in Intraamygdala animal model. (A) Expression levels of miR-135a are found to be significantly upregulated at 2 weeks after status epilepticus. Normalized to 5srRNA, n=4 PBS injected, 3 KA injected mice. Students tTest. *p<0.05, **p<0.01. (B) ISH, representative images showing the upregulation of miR-135a at 2 weeks compared to 24 hr. Scale bar, 300 μm

(20) FIG. 10: In vivo data; antagomir administration and mice phenotype after kainate induction. A) miR-135a expression 24 h after antagomir administration, three doses were tested (0.5, 1.0, 1.5 nmol). 1 nmol of concentration was used further as it had maximum knockdown without any offtarget effects. miR-124 expression was unchanged at this concentration, n=3 mice/group. Normalized to RNU6B, One way ANOVA. *p<0.05. B) Schematic of the antagomir experiment plan. C) Graph showing number of spontaneous seizures recorded for 2 weeks after antagomir injections using EEG telemetry. There was no significant difference between treated and control animals in seizure frequency during the 7-day washout period (p=0.743). Following treatment, there was almost complete separation of the distributions of seizure frequencies in treated and control animals, with a Wilcoxon Mann-Whitney statistic of 0.90, 95% CI 0.65 to 0.97, indicating a 90% probability of a control animal having a higher seizure frequency than a treated animal (P<0.001). N=5 controls and 5 KA mice injected with Ant-135a. Epileptic seizures were significantly reduced in antagomir injected mice compared to controls.

(21) FIG. 11: Increased miR-135a expression in human TLE. A) Expression levels of miR-135a in human TLE patients determined by quantitative PCR. Controls (n=8), mTLE+HS (n=7). Normalized to 5srRNA. Data is expressed as mean±SEM, **p<0.01. Mann Whitney U test. B) LNA in situ hybridization showing localization of miR-135a in control and mTLE+HS groups. Scale bar, 200 μm. C) Cell type specific localization of miR-135a. Co-localization with neuronal marker, NeuN. Specific localization of miR-135a was observed in neuronal soma in the CA regions. Arrows indicate co-labelled cells. No co-localization with astrocytic marker GFAP was observed. Scale bar, 25 μm.

(22) FIG. 12: Increased miR-135a in mouse model of TLE. A) Increased miR-135a levels in the hippocampus of IAK mice 2 wk after SE. N=4 PBS and 3 KA mice. Normalized to 5srRNA. Data is expressed as mean±SEM. *p<0.05. t test. B) Representative images of the ISH showing strong miR-135a expression in hippocampus and amygdala regions at 2 wks after SE induction compared to 24 h and PBS injections. Scramble stained images were devoid of signal. Scale bar, 300 μm. C) FISH, co-labelling miR-135a with astrocytic marker GFAP with no specific co-localization observed. Dentate gyrus ML-molecular layer, GCL—granule cell layer, hilus, cornu ammonis regions CA2, CA3 and CA4. Scale bar, 100 μm. D) Increased levels of miR-135a-2 in mTLE+HS condition but no change of miR-135a-1. n=8 controls and 7 mTLE+HS samples. Data is expressed as mean±SEM, *p<0.05. t test. E) Both miR-135a-1 and miR-135a-2 levels are increased in KA mice compared to PBS injected controls. N=4 PBS and 3 KA mice. Data is expressed as mean±SEM, ***p<0.001, *p<0.05. t test.

(23) FIG. 13: Ant-135a reduces seizure count in the mouse intra-amygdala kainite model of epilepsy. A) LNA ISH for miR-135a inhibitor probe in ant-135a injected mice. Strong signal for miR-135a.inh observed in ipsilateral (injected) hippocampus in images 1, 2 and the control was devoid of any signal. Scale bar, 200 μm. Ant-135a was taken up mainly by neuronal cells in hippocampal CA1, CA4 and DG regions. Scale bar, 50 μm. B) Male C57BL6 adult mice (˜25 g) were implanted with DSI telemetry devices connected to cortical electrodes (both brain hemispheres) for EEG recordings. After appropriated surgical recovery mice were connected to the EEG, and underwent intra-amygdala kainic acid-induced status epilepticus (SE) on Day Zero (D0). Telemetry devices were turned off and reactivated on Day 7 (D07) to record a 7-days “Epileptic Baseline”. On Day 14 (D14) mice were intracerebroventricularly (i.c.v) injected with Ant-135a or its scramble control, and continuously monitored for 6 days (D14 to D20; “after miR treatment period”).

(24) C) Epileptic baseline—There was no significant difference between treated and control animals in seizure frequency during the 7-day of epileptic baseline—prior the miR treatment (p=0.743). After miR treatment—Following treatment (on D14), there was an almost strong decrease in the number of seizures in treated and control animals starting from D15. D) Application of ant-135a at day 7 (dotted line) resulted in a significant decrease in seizure count with respect to time. N=5 for control and ant-135a. ***—mixed design repeated measures general linear model; day*treatment interaction; F statistic—5.834 (F.sub.(20,60)=1.75 for α=0.05); p<0.001. E) Average seizure duration: Epileptic baseline—There was no significant difference between treated and control animals in seizure duration during the 7-day of epileptic baseline—prior the miR treatment (p=0.4721). After miR treatment—Following treatment (on D14), Ant-135a-treated mice presented significantly shorter seizures than the control group, with a Student's t test analysis (P=0.0006). n=5 per group. F) Time spent in ictal activity: Epileptic baseline—There was no significant difference between treated and control animals in total time spent in seizures during the 7-day of epileptic baseline—prior the miR treatment (p=0.7546). After miR treatment—Following treatment (on D14), Ant-135a-treated mice significantly less time in seizures than the control group mice, with a Student's t test analysis (P=0.0021).

(25) n=5/group. G) Representative EEG traces of spontaneous seizures 3 days after treatment with Ant-135a (bottom) or control (top). H) Total time spent in seizures—total time in seizures per day (seconds) per mouse.

(26) FIG. 14: Target identification for miR-135a using biotinylated probes. A) Schematic of miRNA duplex design. The mature strand (SEQ ID NO: 5) is labelled with a biotin molecule at the 3′ hydroxyl group via a C6 linker. B) Schematic showing the immunoprecipitation (IP) procedure. Neuro2A cells were transfected with biotin tagged probes, IP was performed using Streptavidin beads. Total RNA was extracted and deep RNA sequenced. N=3 biological replicates/group C) Representative WB showing Ago2 band in miR-135a and Scr IP samples. Beta-actin as loading control only present in the input samples. D) Heat maps of inputs and IPs showing differential gene expression. E) Principal component analysis (PCA) plots of inputs and IPs showing the clustering of samples basing on their differential gene expression F) PCA plots of inputs and IPs showing the clustering of samples basing on their differential gene expression.

(27) FIG. 15: GeneOntology terms (A. Biological processes, B. Cellular compartments, C. Molecular function) for IPs showing the various processes that could be potentially regulated by miR-135a. The dotted line indicates p=0.05. D) Venn diagram showing the overlap of predicted seed sequence location (targeting site for miR-135a) in various segments of a transcript. E) Venn diagram showing the common (50.4%) and unique targets of miR-135a and miR135b. miR-135a and miR-135b contain same mature sequence with only one mis-match outside the seed region, so they essentially can target similar targets.

(28) FIG. 16: Validation of Bio-IP targets. A) Few of the selected targets were tested by qPCR and found significantly enriched in the IP samples compared to inputs. Bargraphs and representative blot images showing GR (B-B1), PlxnA4 (C-C1) and Mef2a (D-D1) protein levels normalized to β-actin after miR-135a overexpression in N2A cells. All of the validated targets were significantly downregulated after miR-135a overexpression compared to scramble condition. Data is expressed as means, mean±SEM, *p<0.05. t test.

(29) FIG. 17: Mef2a in TLE. A) Schematic of 3′ UTR of Mef2a with miR-135a target site which is highly conserved. B) Target site of miR-135a were ligated into psiCheck2 vector multiple cloning site and tested for binding with Renilla-lucifearse assay. Luciferase assay in HeLa cells transfected with the constructs carrying miR-135a WT and mutant binding sites isolated from the 3′ UTR of Mef2a, co-transfected with and without miR-135a mimic. N=3 independent transfections were performed with 4 wells/condition each time. Data is expressed as means mean±SEM, **p<0.01. t test. C) Representative image showing secondary apical dendrites quantified for spine density. Dissociated neurons were transfected with miR-135a (with or without Mef2) or control vectors on div13 and fixed and analyzed on div17. D) Schematic showing the different types of spines quantified. E) Histogram showing the quantification, reduced spine density after miR-135a overexpression was observed and this effect was rescued by co-transfecting with Mef2. n=12-22 neurons were analyzed from three independent transfections. Data is expressed as means, mean±SEM. ****p<0.0001, One way ANOVA multiple group comparison. F) Graph showing the percentage of different spine types. Increase in immature type of spines observed after miR-135a overexpression which was rescued after Mef2 co-expression. G) Representative WB image of Mef2a in control and IAK mice at 2 weeks after SE found to be strongly reduced. H) Quantification of total protein levels normalized to β-actin. N=5 controls, 4 KA mice hippocampi. Data is expressed as means, mean±SEM. *p<0.05. Mann-whitney test. I) Representative image of the Mef2a staining in IAK mice. Scale bar, 200 μm. J) Representative WB image of Mef2a in hippocampi of control and mTLE+HS patients. K) Quantification of total protein levels normalized to β-actin. N=6 controls, 4 mTLE+HS. Data is expressed as means mean±SEM. *p<0.05. Mann-whitney test. L) Representative image of the Mef2a staining in Controls and mTLE+HS dentate gyrus (DG) and CA regions. Scale 50 μm. M) Mef2a immunostaining in control and ant-135a injected mice. Scale bar, 100 μm.

EXAMPLES

Example 1. Generation of the Lentiviral Library Encoding miRNAs

(30) Human miRNAs were selected from both the public miRNA repository (www.mirbase.org) and the proprietary small RNA deep sequencing database SIROCCO (see WO 2007/081204). The miRNA sequences were amplified from their genomic location with amplicons containing the full-length pre-miRNA hairpin and a flanking sequence on both sides of 50-150 basepairs. The primers for the amplicons were designed using a custom implementation of the Primer3 software (www.geneious.com). If the primer design program could not find appropriate primers in the designated sequences, the requirements for the flanking sequences were adjusted to 0-200 basepairs. The designed primers were complemented with a 5′ GCGC overhang and a restriction site for directional cloning. As default the primer upstream of the miRNA was complemented with a BamHI restriction site (GGATCC) and the primer downstream of the miRNA was complemented with an EcoRI restriction site (GAATTC). Primers of amplicons with internal BamHI or EcoRI restriction sites (i.e. occurring in the genomic sequence) were complemented with either a BglII site (AGATCT) or a XbaI site (TCTAGA) respectively. The miRNAs were amplified using the abovementioned primers from human genomic DNA of a single individual in the following PCR reaction:

(31) TABLE-US-00001 constituent concentration volume supplier/cat # buffer 10X 1 μl Stratagene/600159 dNTPs 10 mM each 0.2 μl GE Healthcare/27-18(58) 0-04 fwd primer 10 μM 0.2 μl Integrated DNA Technologies rev primer 10 μM 0.2μ Integrated DNA Technologie gDNA 100 ng/μl 0.1 μl private source Pfu DNA pol 2.5 U/μl 0.1 μl Stratagene/600159 H.sub.2O 8.2 μl temp (° C. ) time cycles 95 2 min — 95 15 s 40  59* 15 s 40 72 90 s 40 72 15 min  4 ∞ *−0.1° C./cycle

(32) All miRNA loci were amplified in separate 10 μl PCR reactions. The products were purified using the Qiagen PCR Clean-Up buffer set and Whatman Unifilter GF/C filter plates (cat #7700-1101). DNA was eluted with 17 μl H.sub.2O per well. The separate eluates were used in the following restriction reaction:

(33) TABLE-US-00002 Constituent concentration volume supplier/cat # buffer E 10X 2 μl Promega/R005A EcoRI* 12 U/μl 0.1 μl Promega/R6017 BamHI* 10 U/μl 0.1 μl Promega/R6025 eluate N/A 16 μl N/A H.sub.2O N/A 1.8 μl N/A *Amplicons with internal restriction sites for EcoRI or BamHI were cut with Xbal or BgIII respectively instead. The EcoRI + BgIII reaction was done with Promega buffer D. The BamHI + Xbal reaction was done with Promega buffer E.

(34) TABLE-US-00003 constituent conc. volume supplier/cat # buffer 10X 2 μl Promega/C1263 T4 DNA ligase 1-3 U/μl 0.2 μl Promega/M1804 restricted pCDH* 1 ng/μl 7.8 μl System Biosciences/CD510B-1 eluate N/A 10 μl N/A Ligation overnight at 4° C. *For directional cloning, pCDH was cut with both EcoRI and BamHI. An alternate construct called pCDH- was made with reversed EcoRI and BamHI restriction sites so that the amplicons with 5′ BamHI and 3′ EcoRI were cloned in the proper direction. The amplicons with an internal EcoRI site were cut with Xbal and ligated into a pCDH vector that was restricted with Xbal and BamHI.

(35) The resulting ligates were transformed separately into bacteria (Promega Single Step (KRX) competent cells, cat #L3002). 50 μl competent cells was diluted with 950 μl transformation buffer II (10 mM MOPS, 75 mM CaCl.sub.2, 10 mM RbCl, 15% glycerol, filter-sterilized). Per 20 μl ligate, 20 μl diluted competent cells was added. The mix was incubated for 15 minutes on ice, heat-shocked at 37° C. for 30 seconds, and put back on ice. After 2 minutes the transformed bacteria were reconstituted in 150 μl Luria broth (LB). The bacteria were allowed to recover for 20 minutes at 37° C. after which they were plated out separately on ampicillin-containing (50 μg/mL) LB-agar plates and grown overnight at 37° C.

(36) Single colonies of each plate are picked and subcultured overnight in 400 μl ampicillin-containing (50 μg/mL) LB. 1 μl of subculture is lysed in 100 μl water for sequencing purposes. Bacterial lysate is used in the following PCR reaction:

(37) TABLE-US-00004 constituent conc. Volume supplier/cat # buffer 5X 1 μl private source dNTPs 10 mM each 0.1 μl GE Healthcare/27-18(5-8)0-04 pCDH-fwd 10 uM 0.1 μl Integrated DANN Technologies pCDH-rev 10 uM 0.1 μl Integrated DANN Technologies lysate 1:100 1 μl N/A Taq DNA pol unknown 0.02 μl private source H.sub.2O N/A 2.68 μl N/A temp (° C. ) time cycles 95 2 min — 95 15 s 40  59* 15 s 40 72 90 s 40 72 15 min  4 ∞ *−0.1° C./cycle

(38) TABLE-US-00005 pCDH-fwd (SEQ ID No: 344) CACGCTGTTTTGACCTCCATAGA pCDH-rev (SEQ ID No: 345) CACTGACGGGCACCGGAG

(39) The PCR products were diluted 25×. 1 μl of diluted PCR product was used in the following Sanger Sequencing reaction:

(40) TABLE-US-00006 Constituent concentration volume supplier/cat # buffer N/A 1.9 μl private source BigDye v3.1 N/A 0.1 μl ABI/4336921 pCDH-seq 10 uM 0.1 μl Integrated DNA Technologies PCR product 1:25 1 μl N/A H.sub.2O N/A 1.9 μl N/A temp (° C. ) time cycles 94 10 sec — 50  5 s 40 60  2 min 40 10 ∞

(41) TABLE-US-00007 pCDH-seq (SEQ ID NO: 346) GACCTCCATAGAAGATTCTAGAGCTAGC

(42) 30 μl precipitation mix (80% ethanol, 50 mM sodium acetate pH 5.5) was added to each of the sequencing reaction products. The mixes were vortexed for 10 seconds and spun down at 5000 rcf (relative centrifugal force) for 45 minutes at 4° C. Supernatant was aspirated and DNA pellets were washed with 30 μl ice cold 80% ethanol and spun at 5000 rcf for 5 minutes at 4° C. Supernatant was aspirated and the DNA pellet was dried on a heat block for 10 minutes. The dry DNA pellet was dissolved in 10 μl H.sub.2O. The resulting DNA solution was sequenced on an ABI 3730XL DNA Analyzer. Sequences were compared to the expected genomic sequences. Correct clones were added to the library. For incorrect clones an additional 4 bacterial colonies were picked, and analyzed for insert sequence.

(43) Library constructs were subcultured overnight in 50 mL ampicillin-containing (100 ug/mL) LB and isolated with the Qiagen QIAfilter Plasmid Midi Kit (cat #12245) supplemented with the Qiagen EndoFree Plasmid Buffer Set (cat #19048) according to the instructions of the manufacturer. DNA was dissolved in the supplied TE buffer and brought to a final concentration of 500 ng/μl.

(44) We ordered constructs that we were not able to clone ourselves as minigenes from Integrated DNA Technologies. In these cases, the full-length hairpin plus 20 basepairs flanking each site were cloned into our vector as a service by IDT.

(45) Packaging and virus production was performed by System Biosciences as described in the user manual of CD-500131-CD523-A1.

Example 2: An Image-Based miRNA Screen Identifies miRNA-135s as Regulators of CNS Axon Growth and Regeneration by Targeting Krüppel-Like Factor 4

(46) Materials and Methods

(47) Animals

(48) All animal use and care was carried out in accordance with institutional guidelines and approved by the local ethical animal experimentation committee (DEC). C57Bl/6J mice (RRID:IMSR_JAX:000664, male and female) were obtained from Charles River. When timed-pregnant females were used, the morning on which a vaginal plug was detected was considered embryonic day 0.5 (E0.5). For pups the day of birth was considered postnatal day 0 (P0).

(49) Lentiviral Human Whole miRnome Library High Content Screen and Hit Confirmation

(50) SH-SY5Y cells, obtained from DSMZ (Acc 209, RRID:CVCL_0019), were grown in DMEM-F12 (Gibco)+10% FCS+L-Glutamine+penicillin/streptomycin and used between passage 12 and 21. Cells were seeded in 96-wells plates using an automated cell-seeder Multidrop Combi Reagent Dispenser (Thermo Scientific) at 6000 cells/well. One day after seeding, cells were treated with 60 μM retinoic acid and transduced with a lentiviral human genome-wide miRNA library at on average 7.34′10.sup.5 IFU/well (InteRNA Technologies). Each library plate was evaluated in triplicate. The lentiviral library contains 640 annotated human miRNA genes (miRBase 12) and 400 candidate miRNAs from deep-sequencing efforts and is based on the pCDH-CMV-MCS-EF1-Puro vector (No CD510B-1, System Biosciences) (Poell et al., 2011). Systems Bioscience performed the lentiviral packaging and the library had an average IFU/ml of 1.2210.sup.9. The library was stored in 14 96-wells plates. At 4 days in vitro (DIV), cells were fixed by addition of 1:1 8% paraformaldehyde in PBS and blocked in 0.4% Triton-X100, 5% Goat Serum, 1% BSA, 1% glycin, and 0.1% lysin in PBS. Cells were immunostained for βIII-tubulin (1:3000, mouse monoclonal T8660, Sigma, RRID:AB_477590) with an Alexa 488-conjugated secondary antibody (Invitrogen) and counterstained with DAPI. Cells were automatically washed thoroughly by two washing cycles with an AquaMax 2000 (Molecular Devices). Automated microscopy was carried out using a Thermo ArrayScan VTI HCS Reader (Thermo Scientific) and morphological features were extracted with the Cellomics Neuronal Profiling V3 Bioapplication algorithm. Raw data (.mdb files) were converted into Excel format using a custom script (courtesy of Ronald van Kesteren, Vrije Universiteit Amsterdam). All wells with a valid nucleus count below 100 were removed. Non-neuronal attributes and attributes dependent on cell number were trimmed from the dataset. For all other attributes the plate median was calculated. Each attribute of each well was scored binary (0 or 1), with a positive score (1) when deviating more than 2 times from the standard deviation of the control median. The median of all miRNAs was used as control, assuming that most miRNAs would not affect cell morphology. Triplicates of each plate were combined and a well attribute was taken as ‘true’ when a minimum of 2 out of 3 plates scored positive. This resulted in a final (cumulative) ‘hitscore’ which was used to rank the lentiviral clones with effects on neuronal morphology.

(51) For hit confirmation, SH-SY5Y cells were harvested by trypsinization, washed with PBS and resuspended at 8*10.sup.6 cells/ml in INB buffer (135 mM KCl, 0.2 mM CaCl.sub.2, 2 mM MgCl.sub.2, 10 mM HEPES, 5 mM EGTA, pH 7.3). Then, cells were mixed with 20 pmol miRIDIAN mimic (always the human (hsa) isoform, Dharmacon, ThemnoScientific) and electroporated with 3 120V pulses of 900 μs and 2 s pulse interval in a 1 mm gap size cuvet in an ECM 830 square wave generator with PEP cuvette module (all BTX Harvard Apparatus). In this way, over 98% of the cells are electroporated. Each electroporation was divided and equally distributed over 4 wells of a 24-wells plate, leaving the outer left and right wells without cells to take into account possible edge-well effects. One day post-electroporation, cells were treated with 60 μM retinoic acid to induce the development of neuron-like features. Four days after electroporation, cells were fixed and immunostained as described above. Analysis of morphological cell features was performed using the Cellomics software outlined above.

(52) Locked Nucleic Acid (LNA) In Situ Hybridization

(53) E16.5 C57BL/6J mouse embryos were collected and decapitated. Brains were fixed in 4% PFA in PBS and cryoprotected in 30% sucrose in PBS. Twenty μm thick coronal brain cryosections were made. LNA in situ hybridization was performed as previously described (Kan et al., 2012). Briefly, sections were air-dried and post-fixed for 10 min in 4% PFA, acetylated (10 min RT), treated with proteinase K (5 μg/ml for 5 min at RT) and prehybridized (1 h at RT, 30 min at 55° C.) before incubation with 15 nM of LNA-containing, double DIG-labeled miR-135a, miR-135b or control in situ probes (Exiqon) (2 h, at 55° C.). After hybridization, slides were washed in 0.2×SSC for 1 h at 55° C. Slides were blocked 1 h with 10% FCS in PBS and incubated with anti-digoxigenin-AP Fab fragments (1:2500, Roche Diagnostics) in blocking buffer ON at 4° C. After PBS washes, slides were incubated with nitroblue and 5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Roche Diagnostics) substrates for 2-20 h at RT. Staining was terminated by washing of the slides in PBS. Slides were mounted in 90% glycerol in PBS. Sections stained with scrambled LNA-DIG probe were devoid of specific staining.

(54) Quantitative PCR

(55) E14.5 and E16.5 C57BL/6 embryos, P0 and P10 pups, and adult mice were decapitated and brains were removed. Hippocampi and cortices were dissected and frozen immediately on dry-ice. Total RNA was isolated from at least 3 animals from 3 different litters using the miRNeasy kit (Qiagen) according to manufacturer's protocol. In addition, total RNA was isolated from primary hippocampal neurons from 3-4 coverslips out of 2 different cultures at DIV 2, 7, 14, and 21. Furthermore, total RNA was isolated from retina 14 days after optic nerve crush experiments and intravitreal injection of miRNA mimics (see paragraph describing optic nerve injury experiments). RNA quantity was determined using Nanodrop (Thermo Scientific) and equal amounts of each sample were used for first strand cDNA synthesis using universal cDNA synthesis kit (Exiqon). Quantitive PCR reactions were run on Quantstudio 6 flex Real-Time PCR system (Applied Biosystems) using microRNA LNA™ PCR primer sets and SYBR Green master mix (Exiqon). All samples were run in duplicates. Ct values were determined using Quant studio real time per software v1.1. The expression levels of different miRNAs were estimated by normalization to 5S rRNA, and the statistical significance was analyzed with single factor ANOVA. p<0.05 was evaluated as significant.

(56) Culturing and Transfection of Mouse Hippocampal and Cortical Neurons

(57) Hippocampal and cortical cultures were generated as described previously (Van Battum et al., 2014). In brief, P0-P1 C57BL/6 mouse pups were decapitated and brains were rapidly removed in ice-cold dissection medium. Hippocampi or cortices were isolated, trypsinized and dissociated into single cells. They were cultured in neurobasal medium supplemented with B-27, L-glutamine, penicillin/streptomycin, and β-mercaptoethanol, on acid-washed, poly-D-lysin (PDL, 20 μg/ml) and laminin (40 μg/ml)-coated glass coverslips at 37° C.+5% CO.sub.2 in 12-well plates. On DIV 1 neurons were co-transfected with 0.5 μg CAG-GFP vector and 50 pmol miRIDIAN mimics for miR-135a, miR-135b, or control-1 mimic (also known as Negative control-A, all obtained from Dharmacon) per well, or 0.5 μg miRNA H1-mCherry-sponge vectors per well for miR-135a or miR-135b (Tebu-bio) using Lipofectamine 2000 (Invitrogen). For rescue experiments, a pCMV-KLF4-EGFP vector (Origene) was used. On DIV4, neurons were fixed with 4% PFA and 4% sucrose in PBS. For immunocytochemistry, neurons were incubated with rabbit anti-GFP (1:1000, A-11122, Invitrogen, RRID:AB_221569) or rabbit-anti-RFP (1:1000, Rockland, RRID:AB_11182807) and mouse anti-8111 tubulin (1:3000, T8660, Sigma, RRID:AB_477590) dissolved in 3% normal horse serum, 0.1% BSA and 0.1% triton-X100 in PBS. Images were taken using an Axioskop 2 EPI fluorescent microscope (Zeiss). Longest neurites were traced semi-manually using the NeuronJ plugin (RRID:SCR_002074) of ImageJ and sholl analysis was performed using ImageJ software (RRID:SCR_003070). More than 100 transfected neurons from at least 3 independent experiments were traced. Non-paired parametric T-tests were performed in Prism6 (Graphpad software, RRID:SCR_002798) to statistically analyze the data.

(58) miRNA Target Finding and Validation

(59) The MiRecords database was used to search for shared mRNA targets of miR-135a and miR-135b, predicted by at least 6 target prediction programs (Xiao et al., 2009).

(60) Predicted targets shared by miR-135a and miR-135b were post-selected on basis of potential involvement in neuronal development. For target validation, the entire 3′-UTR from KLF4 was retrieved from cDNA and cloned into the psiCHECK2 vector (Promega). PCR-mediated mutagenesis of the KLF4 3′-UTR was performed to alter the binding site located at 394 nt of the KLF4 3′-UTR (FIG. 5A, arrow). HEK293 cells (RRID:CVCL_0045) were transfected using Lipofectamine with 250 ng vector and 20 pmol miRIDIAN miRNA mimic (Dharmacon). Cells were lysed 24 h post-transfection and examined with Dual-Luciferase reporter assay (E1960, Promega) on a spectrophotometer. T-tests were performed to compare luciferase activity in Prism6 (Graphpad Software, RRID:SCR_002798).

(61) For protein analysis, miRIDIAN miRNA mimics (Dharmacon) were transfected into Neuro2A cells (ATCC, RRID:CVCL_0470) using Lipofectamine 2000. After 24 h, cells were lysed in lysis buffer (20 mM Tris pH 8.0, 150 mM KCL, 1% Triton-X-100, protease inhibitor (Roche) in MQ). Samples were separated on 8% SDS-page gels and blotted onto nitrocellulose membrane. Non-specific binding was blocked with 5% milk in TBS-tween for 1 h at RT. After incubation with rabbit-anti-KLF4 (1:500, Santa-Cruz, RRID:AB_669567) and mouse-anti-β-actin (1:5000, Sigma, RRID:AB_476743) in 1% milk in TBS-tween, blots were stained with peroxidase-conjugated secondary antibodies (Abcam). Signals were detected using Pierce ECL Western Detection Reagent (Thermo Scientific), and images were made using FluorChem M Imaging system (Protein Simple). ImageJ was used to determine protein levels in the individual bands, and KLF4 expression was normalized to β-actin levels in the same sample. T-tests were performed to compare the relative KLF4 expression between conditions (Graphpad Prism6 software, RRID:SCR_002798).

(62) Immunohistochemistry

(63) E16.5 C57BL/6J mouse embryos or adult mice were collected and decapitated. Brains were fixed in 4% PFA in PBS and cryoprotected in 30% sucrose in PBS. Twenty μm thick coronal brain cryosections were made. Sections were incubated with rabbit anti-KLF4 (Santa-Cruz, 1:500 (no longer available) or LabNed LN2023880 1:100, RRID:AB_2687557) diluted in 3% BSA and 0.1% Triton-X-100 in PBS, stained with Alexa Fluor-conjugated secondary antibody and counterstained with DAPI. Images were made using an AxioScope EPI-fluorescent microscope (Zeiss) and a confocal scanning microscope (Olympus).

(64) Ex Vivo Electroporation

(65) Ex vivo electroporation was performed as described previously (Yau et al., 2014). In brief, pregnant C57Bl/6 mice were sacrificed by cervical dislocation and E14.5 embryos were rapidly removed and decapitated. 30 μM miRIDIAN mimics (Dharmacon) for miR-135a, miR-135b or control-1 combined with 0.4 μg/μl pCAG-GFP vector were dissolved in 0.1% Fast Green in MQ, and 1.7 μl of this mixture was injected in the lateral ventricles using glass micro-pipettes (Harvard Apparatus) and a microinjector. Heads were subjected to three 100 ms pulses of 30 V with 100 ms pulse interval, using gold plated gene paddle electrodes and an 830 square wave generator (BTX Harvard Apparatus). Brains were then isolated, collected in cHBSS, embedded in 3% LMP-Agarose (Fisher Scientific) in cHBSS and sectioned coronally into 250 μm thick slices using a vibratome (Leica). Sections were collected on poly-D-lysin-laminin-coated culture membrane inserts (Falcon), placed on top of slice culture medium (70% v/v Basal Eagle Medium, 26% v/v cHBSS, 20 mM D-glucose, 1 mM L-glutamine, penicillin/streptomycin) and cultured for 4 days to assess the degree of migration. Cultures were fixed with 4% PFA, blocked in 3% BSA and 0.1% triton in PBS, and stained with rabbit anti-GFP (1:1000, A-11122, Invitrogen, RRID:AB_221569) and mouse anti-MAP2 SMI 52 (1:1000, Abcam, RRID:AB_776173) antibodies. Z-stack images were taken using confocal laser-scanning microscopy (Olympus). Migration of GFP-positive cells was analyzed as follows: using Adobe Photoshop, consistent rectangles divided in 8 equal bins were placed on top of the image, so that bin 1 includes the ventricular zone (vz) and bin 8 covers the marginal zone (mz, as shown schematically in FIG. 4A). Cells in each bin were counted and divided by the total amount of cells in the rectangle. The average of at least two rectangles of each image was used for comparison. For each condition, 12 cortical slices from at least 3 different experiments were used. Non-parametric Mann-Withney U tests were performed in Prism6 (Graphpad software, RRID:SCR_002798) to compare migration between control and miRNA overexpression.

(66) In Utero Electroporation

(67) In utero electroporation was performed as described previously (van Erp et al., 2015). Pregnant C57131/6 mice at E14.5 were deeply anaesthetized with Isoflurane (induction: 3-4%, surgery: 1.5-2%), injected with 0.05 mg/kg buprenorfinhydrochloride in saline, and hereafter the abdominal cavity was opened under sterile surgical conditions. Uterine horns were exposed and 1.7 μl DNA mixture containing 0.4 μg/μl pCAG-GFP, and 15 μM miR-135a and 15 μM miR-135b mimic, or 30 pmol control-1 mimic, or 0.6 μg/μl scrambled sponge vector, or 0.3 μg/μl miR-135a sponge vector and 0.3 μg/μl miR-135b sponge vector (H1-mCherry vectors, Tebu-bio) dissolved in MQ with 0.05% Fast Green (Sigma) was injected in the lateral ventricles of the embryo's using glass micro-pipettes (Harvard Apparatus) and a PLI-100 Pico-injector (Harvard Apparatus). For rescue experiments, 0.2 μg/μl pCAG-GFP was combined with 0.2 μg/μl pCAG-KLF4, and 15 μM miR-135a and 15 μM miR-135b mimic. Brains were electroporated using an ECM 830 Electro-Square-Porator (Harvard Apparatus) set to five unipolar pulses at 30 V (50 ms pulse length interval and 950 ms pulse length). The motor cortex was targeted by holding the head with a platinum tweezer-electrode (negative pole) while a third a gold-plated Genepaddle (positive pole, Fisher Scientific) was placed on top of the head. Embryos were placed back into the abdomen, and abdominal muscles and skin were sutured separately. Release from isoflurane awakened the mother mice. Embryos were collected at E16.5 and pups at P4 or P10. Heads were fixed in 4% PFA in PBS and submerged in 30% sucrose. 20 μm thick coronal cryosections were made and immunohistochemistry and cortical migration analysis were performed as described for ex vivo electroporated slices. To measure neurite outgrowth in vivo, leading process length was traced using ImageJ. In the case of endogenous miR-135 down-regulation, where brains were electroporated with H1-mCherry sponge vectors (Tebu-bio), neuron migration and leading process length were analyzed upon staining with rabbit-anti-RFP (1:1000, Rockland, RRID:AB_11182807). Control and miRNA test conditions were always equally distributed among the embryos in the uterus. Analysis was always performed on the slice in which the corpus callosum was first complete and in 1 or 2 consecutive slices. At least 5 embryos from at least 2 separate experiments were used for comparison.

(68) Optic Nerve Injury and In Vivo Gene Transfection

(69) 3-week-old C57BL/6J mice were obtained from SLC company (Hamamatsu, Japan). Optic nerve injury was performed as previously described in detail (van Erp et al., 2015). The left optic nerve was crushed with fine forceps for 10 sec approximately 1 mm posterior to the optic disc. 50 pmol/μl miR-135a and 50 pmol/μl miR-135b or 100 pmol/μl control-1 mimic were injected intravitreally (with lipofectamine) immediately following injury and on day 7 post-axotomy. In vivo gene transfection was performed as described previously (van Erp et al., 2015). Briefly, pCAG-GFP or pCAG-KLF4 was mixed with miRNA mimics and Lipofectamine 2000. 2 μl of the complexes were injected intravitreally immediately following injury and on day 7 post-axotomy. Nine mice were used for each group. Similarly, 4 ug of sponge vectors specifically targeting miR-135a and miR-135b or control sponge (Tebu-bio) were injected intravitreally (with lipofectamine). Six mice per group were used. AAV2 virus (AAV-miR-GFP-Blank Control virus, Cat. No: Am00102, GFP mmu-miR-135a-5p AAV miRNA Virus, Cat. No: Amm1006802, GFP mmu-miR-135b-5p AAV miRNA Virus, Cat. No: Amm1007002, abm) was injected at 7 days before optic nerve crush injury. To visualize RGC axons, 1 μl of cholera toxin β subunits conjugated to Alexa Fluor 555 (2 μg/μL, Invitrogen) was injected into the vitreous with a glass needle 12 days after the injury. On day 14 post-axotomy, animals were perfused with 4% PFA. The eye cups with the nerve segment attached were post-fixed, and immersed in 30% sucrose overnight at 4° C. Tissues were embedded in Tissue Tek and serial cross-sections (16 μm) were prepared using cryostat and collected on MAS-coated glass slides (Matsunami, Osaka, Japan). Axonal regeneration was quantified by counting the number of CTB-labeled fibers extending 0.2, 0.5, and 1.0 mm from the distal end of the lesion site in 5 sections. The cross-sectional width of the optic nerve was measured at the point at which the counts were taken and was used to calculate the number of axons per millimeter of nerve width. The number of axons per millimeter was then averaged over the 5 sections. Σad, the total number of axons extending distance d in a nerve having a radius of r, was estimated by summing all the sections having a thickness t (16 μm): Σad=πr.sup.2×[average axons/mm]/t. Statistical analyses were performed using one-way ANOVAs. p<0.05 was considered significant.

(70) Experimental Design and Statistical Analysis

(71) In this study, female and male C57Bl/6J mice were used regardless of their sex. For statistical analyses, Prism 6 software (Graphpad) was used. Generally unpaired T-tests were used to compare the means of two groups, with the exception of neuron migration analyses (non-parametric Mann-Whitney U tests) and q-PCR analyses (single factor ANOVA). For all statistical tests, significance was set at p<0.05. Exact p values, t-values and degrees of freedom are provided in the results, and Ns are provided in the figure legends.

(72) At the start of this study an automated morphological cellomics screen of retinoic acid-treated SH-SY5Y cells that were transduced with a lentiviral library containing 1140 unique human miRNAs (Poell et al, 2011) was performed to identify miRNAs that (positively) influence neuronal features (FIG. 1A). The screen was conducted in triplo, and morphological parameters were scored with a neuroprofiling algorithm. To confirm the effect of the most robust miRNAs, the cellomics analysis was repeated on SH-SY5Y cells that were electroprated with miRNA mimics for a selection of hits. This experiment was performed three times in quadruplo (i.e., three times four coverslips, FIG. 1D), and statistically analyzed using Student T-tests.

(73) Expression of miR-135a and miR-135b in the mouse brain at different ages was tested by LNA in situ hybridization and q-PCR experiments (in tissue of at least 3 different mice per age (FIG. 2)). Expression of miR-135a and miR-135b was also determined in cultured primary hippocampal neurons (FIG. 3A). Q-PCR experiments were statistically analyzed using single factor ANOVAs.

(74) Next, the effect of miR-135a and miR-135b overexpression and down-regulation was examined in primary neuron cultures. Lipofectamine-based transfections were replicated at least 3 times in triplo (i.e., 3 times 3 coverslips). miRNA mimics were co-transfected with GFP vector and in case of sponge-vectors internal RFP was exploited to trace neurite length using the NeuronJ plugin of ImageJ (FIG. 3B-F). Student T-tests were performed to compare the means of each group with the control condition.

(75) To assess the endogenous effects of miR-135a and miR-135b during neuronal development, ex vivo electroporation of miRNA mimics combined with a GFP vector and subsequent organotypic slice cultures of mouse embryonic cortex were performed (E14, FIG. 4A). Embryos of one mother were divided among the three conditions to compare littermates, and the experiment was repeated three times. Similar cortical slices of at least 6 embryos from 3 different mothers were used for comparison. Next, in utero electroporation experiments were performed in E14 mice embryos to over-express and down-regulate miR-135a and miR-135b in vivo. For embryonic analysis, the three conditions were divided over the embryos that were present in the uterus to always compare littermates. In utero electroporation dedicated to the isolation of postnatal tissue was performed one condition per mother. For analysis of migration and neurite outgrowth of electroporated cortical neurons three consecutive cryosections showing the corpus callosum were used and taken from at least 9 pups derived from at least 3 different mothers. For both ex vivo and in utero electroporation analyses we performed Mann-Whitney U-tests to compare the distribution of the migrating cells. These were manually counted in 2-3 rasters containing 8 cortical ‘bins’ per slice placed exactly perpendicular to the direction of migration, with the bottom of bin 1 touching the border of the ventricle (for embryonic brains) or the axons of the anterior commissure (for postnatal brains) and the top of bin 8 reaching the cortical surface (FIG. 4A).

(76) Next, possible mRNA targets of miR-135a and miR-135b were identified using the bio-informatic tool miRecords (Xiao et al 2009). KLF4 was selected based on its reported effects on neurite outgrowth and neuronal migration. The strongest predicted binding site of miR-135a and miR-135b in the KLF4 3′-UTR was selected and used for a luciferase assay performed three times in HEK293 cells to confirm direct target binding (FIG. 5A, B). Immunohistochemistry was then used to assess whether KLF4 and miR-135a and b are expressed in similar brain areas (FIG. 5C). Next, we tested whether endogenous KLF4 expression in N2A cells was down-regulated upon miR-135a and miR-135b administration. To determine an endogenous role for miR-135-KLF4 signaling, rescue experiments were performed in primary hippocampal neuron cultures and in utero electroporation using KLF4 cDNA (insensitive to miRNA regulation) using the same experimental procedures and repetitions as described before.

(77) Since KLF4 is one of the most important signals counteracting axon regeneration, we investigated whether miR-135a and miR-135b could be used to decrease KLF4 expression in poorly regenerating neurons in a specific and cell-autonomous fashion. We first injected miRNA mimics intravitreally (on day 0 and day 7) to learn whether this was sufficient to deliver miRNAs to the optic nerve and down-regulate KLF4 expression. Q-PCR was performed on 3 optic nerves per condition, 14 days after the first injection of mimics. Then, mimics were combined with GFP vector and/or KLF4 cDNA to determine axon regeneration 14 days after optic nerve injury. This was repeated in 9 mice per condition. Q-PCR experiments revealed no differences in transfection efficiency between conditions. AAV2 virus containing miR-135a, miR-135b, or control miRNA was injected to transduce RGCs only in 6 mice 7 days before the optic nerve crush and to assess the cell-autonomous nature of the effect observed with mimic injections. Finally, we determined whether miR-135a and miR-135b had an endogenous role in optic nerve regeneration measured 14 days after the optic nerve crush by injecting sponge vectors at day 0 and day 7 in 6 mice. Axon regeneration was statistically tested by ANOVAs followed by Sidak post-hoc tests.

(78) Results

(79) miRNome-Wide Screen for miRNAs that Regulate Neurite Growth

(80) To identify miRNAs that can promote neurite growth, an image-based miRNA screen was performed in neuronal SH-SY5Y cells, a cell line regularly used for cellular screening. Neuronal differentiation of SH-SY5Y cells was induced by retinoic acid treatment followed by transduction of a lentiviral library containing 1140 unique human miRNAs (Poell et al., 2011)(FIG. 1A, B). Using a Cellomics ArrayScan platform, thousands of cells in each condition were analyzed for parameters related to neuronal morphology. This multiparametric analysis resulted in a cumulative hitscore that was based on parameters such as neurite length and branching. To identify hits, scores for each individual miRNA were compared to the median score of all miRNAs. This approach assumes that the majority of miRNAs do not affect neuronal morphology. This approach identified 13 annotated miRNAs with pronounced effects on specific morphological properties of differentiated SH-SY5Y cells (e.g. neurite length). Of these miRNAs, miR-135b had the largest effect (FIG. 1C). miRNA-135a was later shown to perform similarly—in this screen it in the corner of the plate and suffered from edge-well artefacts.

(81) To confirm the effect of miR-135b, retinoic acid-treated SH-SY5Y cells were electroporated with miR-135b mimics to simulate over-expression. miR-135a, a close homolog of miR-135b (Table 7) was also included since it shares many mRNA targets with miR-135b and because we suspected that miR-135a was not identified in the initial screen because of technical problems (edge-well effects in the culture plates). miR-124, a well-known brain-enriched miRNA that was identified in the screen, was also included (FIG. 1D), as well as two control miRNA mimics (both originating from C. elegans and proven to not target specific mammalian mRNAs (Dharmacon, own observations)). In line with the results of the screen, miR-135b mimics affected the general morphology of SH-SY5Y cells (6.58±1.11 vs. 1.24±0.50, t(188)=4.64, p<0.0001 (control-1), or vs. 1.67±0.52, t(188)=4.19, p<0.0001 (control-2), one-way ANOVA, Sidak post-hoc test; FIG. 1D, left panel). Furthermore, miR-135b enhanced neurite outgrowth (3.53±0.69, t(189)=4.46, p<0.0001 vs. 0.55±0.28 (control-1), or vs. 0.90±0.35 t(189)=3.87, p=0.0006 (control-2), one-way ANOVAs, Sidak post-hoc tests; FIG. 1D, middle panel). Total hitscore and hitscore related to neurite length appeared to be affected by miR-135a, but these effects did not reach statistical significance. Neurite branching was significantly increased by miR-135a (2.00±0.71, t(189)=3.62, p=0.0015 vs. control-1 and t(189)=3.54; p=0.0020 vs. control-2) and miR-135b (1.53±0.36, t(189)=3.11, p=0.0085 vs. control-1 and t(189)=3.03, p=0.011 vs. control-2, one-way ANOVAs, Sidak post-hoc tests) mimics compared to control mimics (0.14±0.12 (control-1), or 0.15±0.11 (control-2); FIG. 1D, right panel). Together, these data confirm that miR-135b and miR-135a increase neurite growth and complexity.

(82) Expression of miR-135a and miR-135b in the Developing Mouse and Hippocampus

(83) miR-135a and miR-135b sequences are preserved across species and detected in mouse brain tissue (Lagos-Quintana et al., 2002; Sempere et al., 2004; Ziats and Rennert, 2014; Caronia-Brown et al., 2016), but the precise spatiotemporal pattern of expression and functional role of these miRNAs in neurons remained poorly understood. We analyzed the expression of miR-135a and miR-135b by quantitative PCR (qPCR) in the developing (at E14, E16, P0 and P10 during which neurite growth and branching occur) and in adult mouse cortex and hippocampus. qPCR analysis detected miR-135a and miR-135b in embryonic and postnatal cortex and hippocampus. Expression of both miRNAs declined as cortical development progressed, and increased in adult. In contrast, while hippocampal miR-135a expression decreased towards P10 and increased in adult, miR-135b levels remained unchanged (FIG. 2A, C). Locked nucleic acid (LNA)-based in situ hybridization supported these results by revealing miR-135a and miR-135b expression in the cortex (at E14, P10 and adult, FIG. 2B) and hippocampus (at E14, P0, P10 and adult, FIG. 2D). Specific signals were observed in the dentate gyrus (DG) and CA3 pyramidal cell layers of the hippocampus and in the cortical plate of the developing cortex. Furthermore, both miRNAs were expressed abundantly in the adult mouse brain (FIG. 2B, D). Thus, miR-135a and miR-135b display specific spatiotemporal patterns of expression in the developing mouse brain.

(84) miR-135s Control Axon Growth and Branching

(85) Both miR-135a and miR-135b displayed prominent hippocampal expression and therefore, to investigate their functional role in neurons, hippocampal neurons were dissociated, transfected with miRNA mimics, and analyzed for axon growth at 4 days in vitro (DIV). First, qPCR was used to confirm endogenous expression of miR-135a and miR-135b in primary hippocampal cultures (FIG. 3A). At DIV4, the longest neurite, confirmed to be the axon, was significantly longer in neurons transfected with miR-135a (354.9±24.41 μm) or miR-135b (392.8±15.24 μm) mimics as compared to control (271.7±7.18 μm, t(776)=4.443 (Control-1 vs. miR-135a), t(900)=8.181 (Control-1 vs. miR-135b), both p<0.0001, unpaired T-tests; FIGS. 3B and C). Co-transfection of both miR-135a and miR-135b further increased axon length (428.7±14.97 μm, vs. Control-1 t(1022)=10.36, p<0.0001; vs. miR-135a t(590)=2.628, p=0.0088, unpaired T-tests). To assess the endogenous roles of miR-135a and miR-135b specific miRNA sponges designed to sequester miR-135a and miR-135b were co-transfected into hippocampal neurons. Decreased availability of the miRNAs resulted in a significant decrease in axon length (270.1±13.63 μm) compared to scrambled control sponge transfection (340.1±18.09 μm, t(211)=3.053, p=0.0026, unpaired T-test; FIG. 3D). Since the initial screen in SH-SY5Y cells showed effects on both neurite growth and branching, Sholl analysis was performed on primary hippocampal neurons transfected with miR-135a, miR-135b and the combination of the two mimics. Over-expression of both miRNAs alone and combined resulted in a marked increase in neurite branching in more distal regions (FIG. 3E). Interestingly, combined over-expression of miR-135a and miR-135b or of miR-135b alone also resulted in increased branching in the area close to the cell body. These data suggest an increase in the number of (branches of-) primary neurites and increased branching of the axon (control-1 vs. miR-135a: t(12800) ranges from 3.728 to 8.52, control-1 vs. miR-135b: t(13144) ranges from 3.735 to 6.426; control-1 vs. miR-135ab: t(12164) ranges from 3.84 to 7.496; p<0.001 for all; unpaired T-tests). The number of cumulative intersections of neurites with the Sholl circles was also higher in miR-135ab treated neurons (53.9±4.91) as compared to control (38.69±2.67, t(37)=2.414, p=0.021, unpaired T-test; FIG. 3F). Together, these experiments show that miR-135s (miRNA-135a and miR-135b) regulate axon growth and branching.

(86) Cortical Neuron Migration Requires miR-135a and miR-135b

(87) miR-135a and miR-135b are expressed in hippocampal and cortical neurons as they migrate in the developing nervous system and extend neurites (FIG. 2) and manipulation of these miRNAs affects neuronal morphology in cultured hippocampal but also cortical neurons (FIG. 3; data not shown). To next assess the role of miR-135a and miR-135b in neurons in the complex environment of the embryonic brain, we performed ex vivo and in utero electroporation (van Erp et al., 2015). Ex vivo electroporation of mouse cortex with miR-135a and miR-135b mimics was performed at E14.5, brains were sliced and cultured, and analyzed at DIV4. Electroporation of miR-135a or miR-135b mimics induced a marked increase in the migration of cortical neurons from the ventricular zone (VZ) to the cortical plate (CP), exemplified by a larger number of electroporated GFP-positive neurons in the CP and fewer cells in the intermediate zone (IZ), as compared to control mimic conditions (FIG. 4A, see figure legend for statistical results). To confirm these effects in vivo, we delivered miRNA mimics or sponges to the E14.5 cortex by in utero electroporation and analyzed migrating neurons at E16.5. Mimics for miR-135a and miR-135b were combined to elicit significant phenotypes in a short time period. In line with the ex vivo electroporation data, delivery of miR-135ab mimics to the cortex enhanced neuronal migration towards the pial surface and induced a concomitant depletion in deeper layers such as the SVZ (FIG. 4B, see figure legend for statistical results). Electroporation of miR-135a and miR-135b sponges had a small, but opposite effect, i.e. delayed migration of cortical neurons, confirming an endogenous requirement for miR-135a and miR-135b in cortical neuron migration (FIG. 4C, see figure legend for statistical results). As a measure for in vivo neurite outgrowth, we quantified the length of the leading process of migrating neurons following in utero electroporation. While miR-135a and miR-135b mimics induced an increase in leading process length (30.65±1.09 vs. 23.91±1.01, t(364)=4.497, p<0.0001, unpaired T-test; FIG. 4B), leading processes were shorter after application of miR-135 sponges (25.23±0.80 vs. 33.78±1.28, t(325)=5.712, p<0.0001, unpaired T-test; FIG. 4C). To assess the long-term effect of miR-135 over-expression in vivo, we isolated the brains from embryos in utero electroporated at E14.5 at P4 (FIG. 4D) and P10 (FIG. 4E). Interestingly, at P4 electroporation of miR-135a and miR-135b significantly enhanced neuron migration resulting in a larger number of neurons in upper cortical areas (FIG. 4D, see figure legend for statistical results). At P10, a small but significant difference in the distribution of cells in the upper cortical layers remained between embryos electroporated with control or miR135 mimics (FIG. 4E, see figure legend for statistical results). Overall, these data suggest that, in line with their effects in cultured neurons, miR-135a and miR-135b control neurite length and neuron migration in vivo.

(88) miRNA-135s Control Axon Growth and Neuronal Migration Through KLF4

(89) How do miR-135s (both miR-135a and miR-135b) control neuronal morphology and migration? Based on high sequence similarity and comparable biological effects in neurons, we hypothesized that miRNA-135s (miRNA-135a and miRNA-135b) may share many of their mRNA targets. To identify those targets, we performed target prediction analysis using miRecords (Xiao et al., 2009). By combining data from at least 6 databases in miRecords, 57 overlapping targets were found for miR-135a and miR-135b. Several of these targets had confirmed roles in neurite growth and neuronal morphology. However, for many of these targets (e.g. PTK2, TAF4) knockdown had been reported to reduce neurite growth or neuron migration (data not shown). KLF4 was particularly interesting as knockdown of KLF4 in neurons, similar to overexpression of miR-135s, enhances axon growth, leading process length and neuronal migration (Moore et al., 2009; Qin and Zhang, 2012). Furthermore, recent work in vascular smooth muscle and hepatocellular carcinoma cells links miRNA-135a to KLF4 (Lin et al., 2016; Yao et al., 2016). Finally, KLF4 contains predicted binding sites for several miRNAs in the top list of our initial screen (miR-124, miR-449, miR-488, miR-499; FIG. 1C). The 3′-UTR of KLF4 harbours two predicted miR-135 binding sites (FIG. 5A) and to confirm that KLF4 is a bona fide target for miR-135s we first performed dual-luciferase reporter assays by co-transfecting psiCHECK2-KLF4 3′-UTR and miR-135a and miR-135b mimics into HEK293 cells. miR-135a and miR-135b mimics significantly decreased luciferase activity both when transfected alone or when combined (FIG. 5B). To confirm direct and specific binding, the miRNA-135 binding site that was predicted to have the strongest association (according to www.microRNA.org) was mutated (site 394; FIG. 5A). This mutation completely abolished miR-135-mediated effects on luciferase activity, suggesting that site 394 is the main miR-135 binding site in KLF4 (KLF4 WT miR-135a vs. KLF4 mutated miR-135a, t(4)=4.715, p=0.0092; KLF WT miR-135b vs. KLF4 mutated miR-135b, t(4)=2.933, p=0.0427; KLF4 WT miR-135ab vs. KLF4 mutated miR-135ab, t(4)=4.735, p=0.0091, Unpaired T-test) (FIG. 5B). Next, we performed immunohistochemistry for KLF4 to assess whether miR-135s and KLF4 are expressed in the same brain regions. Indeed, in line with our in situ hybridization data for miR-135a and miR-135b, prominent KLF4 expression was detected in neurons in the CP of the E16.5 and adult cortex and in the developing and adult hippocampus (FIG. 5C). To further validate the relation between miR-135 and KLF4, endogenous KLF4 protein levels were analyzed in transfected Neuro2A cells by Western blot. Reduced KLF4 expression was observed after transfection with miR-135a and miR-135b mimics as compared to control mimic transfection (miR-135ab vs. Control-1: 0.378±0.032 vs. 0.643±0.01, t(10)=3.170, p=0.010, Unpaired T-test; FIG. 5D). Together, these data indicate that KLF4 is a target for miR-135a and miR-135b.

(90) Next, we assessed whether the effects of miR-135s (miR-135a and miR-135b) on axon growth and neuronal migration require KLF4. In primary hippocampal neurons, co-transfection of KLF4 cDNA lacking the 3′-UTR (KLF4A3′-UTR), and therefore miR-135 binding sites, markedly reduced the increase in axon growth by transfection of miR-135 mimics (FIG. 5E, Control-1 vs. Control-1+KLF4: 271.1±7.178 vs. 239.9+9.701, t(785)=2.250, p=0.025; Control-1 vs. miR-135ab+KLF4: 271.1±7.178 vs. 331.7±10.92, t(980)=4.787, p<0.0001; miR-135ab+KLF4 vs. miR-135ab: 331.7±10.92 vs. 428.7±14.97, t(794)=5.139, p<0.0001, Unpaired T-test). FIG. 5F). Similarly, the positive effect of miR-135a and miR-135b over-expression on cortical neuron migration and leading process length was normalized by co-electroporation of KLF4A3′-UTR (see figure legend for statistical results of neuronal migration, for leading process length: miR-135ab: 32.34±1.084, miR-135ab+KLF4: 20.42±0.79, t(240)=8.851, p<0.0001. Unpaired T-test. FIG. 5G). Together, these experiments indicate that miRNA-135s enhance axon growth and neuronal migration by repressing KLF4 protein expression.

(91) Exogenous miR-135 Application Promotes Optic Nerve Regeneration Through KLF4

(92) Lowering neuronal KLF4 expression not only promotes axon growth in developing neurons but is also one of the few experimental treatments that facilitates regenerative axon growth following CNS injury. Knockout mice lacking KLF4 showed significantly enhanced retinal ganglion cell (RGC) axon regeneration following optic nerve injury (Moore et al., 2009; Qin et al., 2013) This effect of KLF4 requires downstream signalling via the Janus kinase (JAK)-signal transducer and activator of transcription 3 (STAT3) pathway (Qin et al., 2013), but upstream regulatory mechanisms of this pathway remain unknown. Because of these results and our data showing that miR-135 mimics can promote axon growth by reducing KLF4 expression, we next asked whether application of miR-135 mimics can facilitate regenerative axon growth in the CNS. To test this hypothesis, we used the optic nerve crush model. siRNAs and miRNA mimics can be efficiently targeted to adult RGCs and optic nerve regeneration can be reliably quantified (Dickendesher et al., 2012; van Erp et al., 2015). Further, both KLF4 and miR-135s are expressed in adult mouse RGCs and reducing KLF4 expression enhances optic nerve regeneration (Moore et al., 2009; Qin et al., 2013). First, we confirmed that intravitreal injection of miR-135 mimics leads to an elevation of miR-135a and miR-135b levels (FIG. 6A, B). Although endogenous expression of miR-135s was detected, intravitreal injection of mimics markedly increased miR-135a and miR-135b expression, as compared to injections with scrambled controls (Ctrl1 vs. miR-135a: t(4)=2.462, p=0.0348; Ctrl1 vs. miR-135b: t(4)=4.309, p=0.0063, Unpaired T-test). In line with our data identifying KLF4 as a miR-135 target (FIG. 5), injection of miR-135 mimics in the eye led to a decrease in KLF4 expression (Ctrl1 vs. miR-135ab: t(3)=2.901, p=0.0312, Unpaired T-test. FIG. 6C). Next we assessed the effect of miR-135 injection on optic nerve regeneration. Following administration of scrambled control mimics, most CTB-labeled RGC axons stopped abruptly at the crush site and only few fibers crossed the lesion into the distal nerve (FIG. 6D, E). In contrast, miR-135 mimics induced significant regeneration (0.2 mm, Control-1+GFP vs. miR-135ab+GFP: 46.89±6.816 vs. 208.4±35.11, t(96)=7.374, p<0.0001. one-way ANOVA with Sidak post-hoc test) beyond the lesion site and more pronounced sprouting in the distal segment of the nerve (FIG. 6D, E). To examine whether this effect was caused by the ability of miR-135s to reduce KLF4 expression, we combined intravitreal injection of miR-135 mimics with co-transfection of vectors expressing GFP (pCAG-GFP) or a KLF4 cDNA which is not targeted by miR-135s (pCAG-KLF4) (van Erp et al., 2015). Overexpression of KLF4 did not affect RGC axon regeneration, but partly normalized the regeneration promoting effect of miR-135 mimic injection following ONI (0.2 mm, Control-1+GFP vs. miR-135ab+KLF4: 46.89±6.816 vs. 115.4±24.63, t(96)=3.128, p=0.028, one-way ANOVA with Sidak post-hoc test) (FIG. 6D, E). Importantly, this effect of KLF4 was not due to its ability to regulate miR-135 expression as miR-135a and miR-135b levels in the retina were similar following miR-135ab+GFP and miR-135ab+KLF4 administration (FIG. 6F).

(93) Intravitreal injection may target miRNA mimics to different cell types in the mouse retina. To ensure that miR-135a and miR-135b can have a positive, cell autonomous effect in RGCs on axon regeneration, overexpression of both miRNAs was induced by intravitreal injection of AAV2, a viral serotype known to specifically target RGCs (FIG. 6A, G) (Weitz et al., 2013). Indeed, targeting miR-135s to RGCs induced RGC axon regeneration at a level comparable to that observed following mimic injection (0.2 mm, AAV2-Control vs. AAV2-miR-135ab: 53.76±10.62 vs. 243.6±23.59, t(30)=10.98, p<0.0001. one-way ANOVA with Sidak post-hoc test) (FIG. 6H). Finally, to assess a potential endogenous role of miR-135a and miR-135b in regenerating RGC axons specific miRNA sponges designed to sequester miR-135a and miR-135b were injected intravitreally. Decreased availability of the miRNAs resulted in a small but significant decrease in the number of regenerating axons close to the injury site compared to scrambled control sponge transfection (0.2 mm, Control sponge vs. miR-135a/b sponge: 49.6±4.566 vs. 28.46±7.593, t(18)=3.589, p=0.0063. one-way ANOVA with Sidak post-hoc test) (FIG. 6I). Together, these results indicate that overexpression of miR-135 promotes CNS axon regeneration in part by reducing KLF4 expression, while decreasing functional miR-135 levels further reduces the regenerative potential of adult RGCs.

(94) During embryonic development, axons extend over long distances to establish functional connections. In contrast, axon regeneration in the adult mammalian central nervous system (CNS) is limited, in part by a reduced intrinsic capacity for axon growth. Therefore, insight into the intrinsic control of axon growth may provide new avenues for enhancing CNS regeneration. Here, we performed one of the first miRNome-wide functional miRNA screens to identify microRNAs (miRNAs) with robust effects on axon growth. High-content screening identified the miRNA-135s (miR-135a and miR-135b) as potent stimulators of axon growth and cortical neuron migration in vitro and in vivo in male and female mice. Intriguingly, both these developmental effects of miR-135s relied, in part, on silencing of KLF4, an intrinsic inhibitor of axon growth and regeneration. These results prompted us to test the effect of miR-135s on axon regeneration following injury. Our study shows that intravitreal application of miR-135s facilitates retinal ganglion cell (RGC) axon regeneration following optic nerve injury (ONI) in adult mice in part by repressing KLF4. In contrast, depletion of miR-135s further reduced RGC axon regeneration. Together, these data identify a novel neuronal role for miR-135s and the miR-135-KLF-4 pathway, and highlight the potential of miRNAs as tools for enhancing CNS axon regeneration.

Example 3: The Role of miR-135a in Temporal Lobe Epilepsy

(95) Epilepsy is a chronic neurological disorder that effects 65 million people worldwide, is a major socioeconomic burden (Moshe et al., 2015). It is characterized by recurrent unprovoked seizures, caused due to abnormal and synchronous neuronal discharges with in the brain (Chang and Lowenstein, 2003). In some cases, epilepsy is caused by single gene mutations mainly of genes encoding ion channels, but the reason for most epilepsies is unknown. Temporal lobe Epilepsy (TLE) is a subclass of epilepsy, accounts for about one third of all patients with epilepsy (Engel, 2001). It consists of several subgroups of which Mesial Temporal Lobe Epilepsy with Hippocampal Sclerosis (MTLE-HS) is the most severe one. MTLE-HS presents with a typical set of diagnostics, clinical and pathological characteristics (neuron loss, gliosis and axonal sprouting) and is known to be most resistant to pharmacological treatment (Wieser and Epilepsy, 2004). For many patients, surgical removal of the hippocampus is the only alternative to achieve seizure control (Semah et al., 1998). The pathological mechanisms underlying TLE are largely unknown. Anticonvulsant and anti-epileptic drugs are used to treat these patients. But, unfortunately these only reduce the occurrence of seizures but do not treat the underlying pathophysiology. Hence there is an urgent need to develop novel treatment strategies for this disabling condition. A need for developing disease-modifying drugs is increasingly recognized by research community and in clinical practice (Loscher et al., 2013).

(96) The pathological mechanisms underlying MTLE are still largely unknown. Animal models of epilepsy and human tissue studies suggest that epileptogenesis involves a cascade of molecular, cellular and neuronal network alterations (Rakhade and Jensen, 2009). Approaches starting from the transcriptome have revealed that patterns of gene expression are significantly altered in human MTLE (van Gassen et al., 2008) and during epileptogenesis in animal models for TLE (Gorter et al., 2006; Pitkanen and Lukasiuk, 2009; Rakhade and Jensen, 2009). This dysregulation effects entire gene regulatory networks that normally control gene expression that regulate pathways involving inflammation, gliosis, synaptic structure and neuronal function. Insight into whether or how these mechanisms are altered may not only provide important new insights into the pathogenesis of TLE, but could also yield novel targets for therapy.

(97) During the past several years, microRNAs (miRNAs) have emerged as important post-transcriptional regulators of gene expression, providing a completely new level of control of large groups of genes. miRNAs are small, non-coding RNAs (18-25 nucleotides long) that are generated by a series of cleavage events from longer RNA precursors transcribed from the genome. miRNAs recognize partially complementary target sequences in cognate mRNAs and inhibit protein expression by either destabilizing their mRNA targets or by inhibiting protein translation (Kosik, 2006). A single miRNA can have many different targets, it can regulate several genes in multiple pathways or single genes in multiple pathways (Ebert and Sharp, 2012). Deletion of miR-128, a brain expressed miRNA led to upregulation of more than thousand transcripts, from which 154 were direct targets of miR-128 and 25 were from extracellular signal kinase regulated kinase ½ (ERK1/2) network (Tan et al., 2013). This property of multi-targeting is of advantage as it can target genes and disrupt multiple pathways but at the same time disadvantageous due to the potential of unwanted side effects of miRNA-based therapy (Henshall et al., 2016). Overall miRNAs can control different aspects of cellular physiology and are considered as novel targets for therapy (Czech, 2006).

(98) Deregulation of miRNAs has been linked to several pathological mechanisms observed in TLE (Gorter et al., 2014; Jimenez-Mateos et al., 2012; Jimenez-Mateos and Henshall, 2013; Kan et al., 2012). Studies in mice show that miR-134 inhibition after status epilepticus suppressed the development of spontaneous seizures (Jimenez-Mateos et al., 2012) and complete loss of miR-128 leads to fatal epilepsy (Tan et al., 2013). Similarly, miR-324-5p was found to inhibit Kv4.2 expression in epilepsy (a major mediator of hyperpolarizing A-type currents in brain, which is a crucial regulator of neuronal excitability), and antagonizing miR-324 is seizure suppressive and neuroprotective (Gross et al., 2016). Not just these few, but the function of more miRNAs has been investigated using miRNA inhibitors (called antagomirs: miRNA-targeting antisense oligonucleotides) and mimics (agomirs) in various animal models of epilepsy (reviewed in (Henshall et al., 2016)). Of those miRNAs (12 out of 14) that are functionally validated have been found to have beneficial effects on electroencephalogram (EEG), seizures or histopathology level. Hence miRNAs could be a flexible and broad class of targets for treatment of seizures (Henshall et al., 2016).

(99) Materials and Methods

(100) RNA Isolation and Quantitative PCR

(101) Two patient groups (six each) mTLE-HS (without hippocampal sclerosis), mTLE+HS (with hippocampal sclerosis) and six post-mortem controls were used. Patient tissue representing all hippocampal regions was selected following nissl stainning. Approximately 20 mg of tissue was collected by slicing 25 μm thick sections on a cryostat and stored at −80° C. Total RNA was isolated using miRNeasy kit (Qiagen), according to manufacturer's instructions. RNA quantity was determined using Nanodrop (Thermo Scientific), first strand cDNA synthesis was performed using a universal cDNA synthesis kit (Exiqon). Quantitive PCR reactions were run on Quantstudio 6 flex Real-Time PCR system (Applied Biosystems) using microRNA LNA™ PCR primer sets and SYBR Green master mix (Exiqon). All samples were run in duplicates. Ct values were determined using Quant studio real time per software v1.1. The expression levels of different miRNAs were estimated by normalizing to 5s rRNA, and the statistical significance was analyzed with single factor ANOVA and p<0.05 was considered as significant.

(102) Non-Radioactive In Situ Hybridisation

(103) Non-radioactive in situ hybridization was performed as described previously (Obernosterer et al., 2007). Three patients from each patient group (Control, mTLE-HS and mTLE+HS) with two to three sections per patient were used for performing the in situ. Briefly, 16 μm thick sections from fresh frozen human hippocampal tissue were collected on glass slides and stored at −80° C. until use. On day of in situ sections were fixed (4% PFA for 10 min at room temperature (RT)), acetylated (10 min at RT) and treated with proteinase K (5 μg/ml for 5 m at RT). Pre-hybridisation was performed for 1 h at RT. Hybridisation was performed with 10 nM of double-DIG (3′ and 5′)—labeled locked nucleic acid (LNA) probe for human-miR-135a-5p (Exiqon) or LNA-DIG Scramble probe overnight at 50° C. Slides were washed at 55° C. in 0.2×SSC for 1 h, followed by blocking with 10% fetal calf serum (FCS) in B1 buffer (0.1 M Tris pH 7.5/0.15 M NaCl) for 1 h at RT. Sections were incubated with anti-digoxigenin-AP Fab fragments (1:2,500, Roche Diagnostics) in 10% FCS in B1 buffer overnight at 4° C. Slides were treated with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitrobluetetrazolium (NBT) substrates (NBT/BCIP stock solution, Roche Diagnostics) in B3 (0.1 M Tris pH 9.5/0.1 M NaCl/50 mM MgCl2) for 5-20 h at RT. Staining was stopped by washing in PBS and slides were mounted using vectashield (VectorLabs). No staining was observed in sections hybridized with scramble probe. Images were acquired with brightfiled microscope and processed on ImageJ.

(104) FISH

(105) Similar protocol was used for FISH except hybridization was done at 55° C. and washes at 60° C., to reduce background staining. After blocking slides were co-incubated with anti-Digoxigenin-POD (1;500, Roche Diagnostics) and NeuN (1;400, Millipore) or GFAP (1;1000, Dako Cytomation) antibody overnight at 4° C. Signal was amplified using ISA™ Cyanine 3 System (1;50 in amplification diluent, PerkinElmer) for 10 min at RT. After washes with PBS, slides were incubated with secondary antibody (Alexafluor 488, Invitrogen) specific against the primary antibody for 1.5 h at RT. Nuclei were stained with DAPI (10 min at RT) and slides were mounted using ProLong Gold (Life Technologies). Images were acquired using Confocal laser scanning microscope (LSM880, Zeiss).

(106) Intra Amygdala Kainate Mice

(107) Status epilepticus (SE) induction, EEG recording and analysis was done as in previous studies (Jimenez-Mateos et al., 2012; Mouri et al., 2008). Briefly, mice were implanted with telemetric EEG transmitters (Data Systems International). Two days after surgery, SE was induced for 40 min by administration of kainic acid (0.3 ug in 0.2 ul in PBS). Control animals received the same volume of PBS. Forty minutes after microinjection, mice received an intravenous injection of lorazepam (6 mg/kg) to stop SE. Mice were EEG monitored for 1 hr after injection to make sure that all the seizure activity is reduced. From day 7 after SE induction, baseline EEG was recorded.

(108) Intra Cerebro Ventricular (i.c.v) Injections

(109) For antagomirs, i.c.v injections were performed streotractically. On day 14 after SE mice received an infusion of 1.0 nmol/2 ul of Antagomir-135a LNA modified and 3′-cholesterol-modified oligonucleotides (Exiqon) in PBS. Controls received same volume of PBS. During this period mice were continuously EEG and video monitored for another 2 weeks. EEG data analysis was performed using LabChart 8 software (ADInstruments Ltd). The antagomir used in this experiment is available from Exiqon A/S, Denmark (Product Number 199900 Batch Number 182482—Exiqon is a Qivagen company) and consisted of an oligonucleotide featuring phosphorothioate backbone linkages instead of phosphodiester backbone linkages, and having a sequence represented by CACATAGGAATAAAAAGCCAT (SEQ ID NO: 261). The antagomir was 3′-modified with a tetraethyleneglycol-linked cholesterol.

(110) Results

(111) Increased Expression of miR-135a in Human and Mouse Model of TLE

(112) Increased expression of miR-135a was observed in human TLE using a microRNA array (Kan et al., 2012). Upon validating the expression of miR-135a by quantitative PCR in human TLE tissue comparing expression in two patient groups (mTLE+HS, mTLE−HS) to controls, a significant reduction in miR-135a levels was observed in mTLE-HS condition whereas the expression of miR-135a was increased in mTLE+HS condition (FIG. 7A). By in situ hybridisation (ISH) the localization of miR-135a was checked and found a stronger signal in mTLE+HS condition (FIG. 7B). To confirm the cell type specific localization fluorescent ISH was performed and found miR-135a co-localized mainly with the neuronal marker NeuN (FIG. 8).

(113) Next, we checked if seizure induction (status epilepticus) in an experimental model of TLE by intraamygdala microinjection of glutamate receptor agonist kainic acid (Mouri et al., 2008), will mimic the increased levels of miR-135a found in human patient tissue. By qPCR, a significant increase in miR-135a levels were observed at 2 weeks after SE induction specifically in the CA3 and DG regions of the hippocampus (FIG. 9A). Similarly, a stronger signal for miR-135a was detected in the soma of pyramidal neurons in the hippocampus, and also in neuronal cells of cortex, thalamic and amygdala regions by ISH at 2 weeks after SE, and no change in expression at 24 h (FIG. 9B).

(114) Reduction of Spontaneous Seizures Upon Silencing miR-135a

(115) To further understand the in vivo effect of miR-135a increased expression in TLE and check if it contributes to the recurrence of spontaneous seizures, we targeted it by antagomirs. Antagomirs targeting miR-135a were administered to reduce the increased levels of miR-135a after 2 weeks after SE. SE induced mice were injected with anti-miRs for miR-135a or PBS (intra-cerebro-ventricularly) at 2 weeks after SE and continuously EEG monitored for two weeks after injection (FIG. 10B). There was no significant difference between treated and control animals in seizure frequency from day 7-day 14 (p=0.743) after SE, baseline recording. Following treatment with miR-135a on day 14, there was an almost complete separation of the distributions of seizure frequencies in treated and control animals, with a Wilcoxon Mann-Whitney statistic of 0.90, 95% CI 0.65 to 0.97, indicating a 90% probability of a control animal having a higher seizure frequency than a treated animal (P<0.001). Silencing of miR-135a expression protected mice from spontaneous epileptic seizures compared to PBS injected. The number of spontaneous epileptic seizures were significantly reduced, total time spent during seizures was reduced but no difference was observed in the severity of seizures (FIG. 100). These data suggest that miR-135a increased expression at 2 weeks after SE contributes to increased seizure activity, and this can be rescued by in vivo depletion of miR-135a. Further histological analysis is to be performed in the antimiR injected brains to assess if pathological hallmarks of TLE (neuron loss, gliosis, rearrangement of mossy fibers) are rescued. No off-target effects of the anti-miR were observed, ant-135a was specifically targeting miR-135a as the levels of miR-124 were unaltered at 1 nmol (FIG. 10A).

(116) Summary

(117) In this study, we found increased miR-135a levels in intra-amygdala kainate mice (2 weeks after SE), and silencing miR-135a expression using antagomirs protected mice from spontaneous epileptic seizures. This is the first time that silencing miR-135a in already established epilepsy after epileptogensis, can significantly reduce recurrence of spontaneous seizures. To identify new targets that are mediating miR-135a function in TLE we performed immunoprecipitation using biotin-tagged miRNA mimics and found several interesting targets (data not shown), for example MEF2 as a potential target. MEF2 proteins are a family of transcription factors which mediate activity-dependent synaptic development. MEF proteins are activated by neurotrophin stimulation and calcium influx resulting from increased neurotransmitter release at synapses (Flavell et al., 2008). MEF2 negatively regulates excitatory synapses (Flavell et al., 2006), and loss of MEF2 in mTLE could lead to abnormal spine formation and contribute to aberrant firing pattern and cell death observed in epilepsy.

(118) TABLE-US-00008 TABLE 1 Precursor sequences of miRNAs identified in screening or referred to List of miRNA precursor sequences (5′ to 3′ direction). All sequences were obtained from miRBase (release 21: June 2014; www.mirbase.org) and checked for consistency with SIROCCO. In case of discrepancy, SIROCCO data was used. SEQ ID No Precursor of: Precursor sequence 1 hsa-mir-135a-1 AGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUG AUUCUACUGCUCACUCAUAUAGGGAUUGGAGCCGUGGC GCACGGCGGGGACA 2 hsa-mir-135a-2 AGAUAAAUUCACUCUAGUGCUUUAUGGCUUUUUAUUCCU AUGUGAUAGUAAUAAAGUCUCAUGUAGGGAUGGAAGCC AUGAAAUACAUUGUGAAAAAUCAUCAAC 3 hsa-mir-135b CCCCUCCACUCUGCUGUGGCCUAUGGCUUUUCAUUCCU AUGUGAUUGCUGUCCCAAACUCAUGUAGGGCUAAAAGC CAUGGGCUACAGUGAGGGGCGAGCUCC 4 hsa-mir-196a-1 GAACUGCUGAGUGAAUUAGGUAGUUUCAUGUUGUUGGG CCUGGGUUUCUGAACACAACAACAUUAAACCACCCGAUU CAC

(119) TABLE-US-00009 TABLE 2 Mature and mimic sequences of canonical miRNAs identified in screening or referred to List of mature miRNA sequences (5′ to 3′ direction). All sequences were obtained from miRBase (release 21: June 2014; www.mirbase.org) and checked for consistency with SIROCCO. In case of discrepancy, SIROCCO data was used. miRNA precursor Mature miRNA SEQ ID No SEQ mature miRNA hsa-mir-135a-1 hsa-miR-135a-5p 5 UAUGGCUUUUUAUUCCUAUGUGA hsa-mir-135a-2 hsa-mir-135a-1 hsa-miR-135a-3p 6 UAUAGGGAUUGGAGCCGUGGCG hsa-mir-135b hsa-miR-135b-5p 7 UAUGGCUUUUCAUUCCUAUGUGA hsa-mir-135b hsa-miR-135b-3p 8 AUGUAGGGCUAAAAGCCAUGGG hsa-mir-196a-1 hsa-miR-196a-5p 9 UAGGUAGUUUCAUGUUGUUGGG

(120) TABLE-US-00010 TABLE 3 DNA sequences of miRNAs identified in screening SEQ ID No miRNA Cloned sequence in lentiviral vector 10 hsa-miR-135a-1 TCCACACCCTCAGGGAGGAGGGGAGGGTTGGGGTGGAAGAAGT GCCTGCAAGAGCAGCCCCAGGCCTCGCTGTTCTCTATGGCTTTT TATTCCTATGTGATTCTACTGCTCACTCATATAGGGATTGGAGCC GTGGCGCACGGCGGGGACAGCCAGCGGAGGGTTCTGACACTG AGCAAGGGGGCTCAAAAGGAGGCAGGACAGTGGCACCTCCCTC 11 hsa-miR-135a-2 GCTTTGAAATGGTTGTGAAGTCATGTGAAGAAAATAAGTTTTGCA TCCGACCAAGATAAATTCACTCTAGTGCTTTATGGCTTTTTATTCC TATGTGATAGTAATAAAGTCTCATGTAGGGATGGAAGCCATGAAA TACATTGTGAAAAATCATCAACTAAGAAGGGGCCATCAGTATAGA GAACGTTAGCCTGTGGAGCTGTG 12 hsa-miR-135b CTCGCTTCCCTATGAGATTCCTGCCGCTGGACCCCTCCACTCTG CTGTGGCCTATGGCTTTTCATTCCTATGTGATTGCTGTCCCAAAC TCATGTAGGGCTAAAAGCCATGGGCTACAGTGAGGGGCGAGCT CCTTCTCCTGCGCAGCTGCACCTCCCATGGGACCAGGTTCGGA GCCAGCCACCAAGGGGCACCAGAAGGAGGCTTTG 13 hsa-miR-196a-1 CCCCCAGTGAGCTCTTGACCTAGAGCTTGAATTGGAACTGCTGA GTGAATTAGGTAGTTTCATGTTGTTGGGCCTGGGTTTCTGAACAC AACAACATTAAACCACCCGATTCACGGCAGTTACTGCTCCTCGC TTAGCTGGAGGAGTTGGGG

(121) TABLE-US-00011 TABLE 4 Seed sequences of canonical miRNAs List of miRNA seed sequences (5 to 3′ direction). Seed sequence is defined as nucleotide 2-8 (5′ to 3′ direction) of the mature miRNA sequence processed from miRNA precursor hairpins. All sequence designations were obtained from miRBase (release 21: June 2014; www.mirbase.org). The seed sequences of the mature miRNAs listed in Table 2 are enclosed in this Table. miRNA precursor Mature miRNA SEQ ID No Seed sequence mature miRNA hsa-mir-135a-1 hsa-miR-135a-5p 14 AUGGCUU hsa-mir-135a-2 hsa-mir-135a-1 hsa-miR-135a-3p 15 AUAGGGA hsa-mir-135b hsa-miR-135b-5p 16 AUGGCUU hsa-mir-135b hsa-miR-135b-3p 17 UGUAGGG hsa-mir-196a-1 hsa-miR-196a-5p 18 AGGUAGU

(122) TABLE-US-00012 TABLE 5 IsomiRs and seed sequences of miRNAs identified in screening (see Table 1) or referred to in the application. These isomiR sequences have been derived from small RNA high-throughput deep sequencing analyses, and were obtained after combining the data of 87 human tissue samples. Mature miRNA Seed (SEQ ID NO) IsomiR sequence (SEQ ID NO) hsa-miR-135a-5p AUGGCUU (19) UAUGGCUUUUUAUUCCUAUGUGAUAG (57) UGGCUUU (20) UAUGGCUUUUUAUUCCUAUGUGAUUC (58) GGCUUUU (21) UAUGGCUUUUUAUUCCUAUGUGAUA (59) GCUUUUU (22) UAUGGCUUUUUAUUCCUAUGUGAU (60) CUUUUUA (23) UAUGGCUUUUUAUUCCUAUGUG (61) UUUUUAU (24) UAUGGCUUUUUAUUCCUAUGU (62) UUUUAUU (25) UAUGGCUUUUUAUUCCUAUG (63) UUUAUUC (26) UAUGGCUUUUUAUUCCUAU (64) UUAUUCC (27) UAUGGCUUUUUAUUCCUA (65) UAUGGCUUUUUAUUC (66) UAUGGCUUUUUAUUCC (67) AUGGCUUUUUAUUCCUAUGUGAU (68) AUGGCUUUUUAUUCCUAUGUGA (69) AUGGCUUUUUAUUCCUAUGUG (70) AUGGCUUUUUAUUCCUAUGU (71) UGGCUUUUUAUUCCUAUGUGAU (72) UGGCUUUUUAUUCCUAUGUGA (73) UGGCUUUUUAUUCCUAUGUG (74) GGCUUUUUAUUCCUAUGUGA (75) GCUUUUUAUUCCUAUGUGA (76) GCUUUUUAUUCCUAUGUG (77) GCUUUUUAUUCCUAUGU (78) CUUUUUAUUCCUAUGUGA (79) CUUUUUAUUCCUAUGUG (80) CUUUUUAUUCCUAUG (81) CUUUUUAUUCCUAUGU (82) UUUUUAUUCCUAUGUGA (83) UUUUUAUUCCUAUGU (84) UUUUUAUUCCUAUGUG (85) UUUUAUUCCUAUGUGA (86) UUUUAUUCCUAUGUG (87) UUUAUUCCUAUGUGA (88) hsa-miR-135a-3p AUAGGGA (28) UAUAGGGAUUGGAGCCGUGGC (89) UAUAGGG (29) UAUAGGGAUUGGAGCCGUGG (90) AUAUAGG (30) AUAUAGGGAUUGGAGCCGUGGC (91) UAGGGAU (31) AUAUAGGGAUUGGAGCCGUGG (92) AUAUAGGGAUUGGAGCCGUG (93) CAUAUAGGGAUUGGAGCCGUGGCG (94) AUAGGGAUUGGAGCCGUGGC (95) hsa-miR-135b-5p AUGGCUU (32) UAUGGCUUUUCAUUCCUAUG (96) UGGCUUU (33) UAUGGCUUUUCAUUCCUAU (97) GGCUUUU (34) UAUGGCUUUUCAUUCCUA (98) CUUUUCA (35) AUGGCUUUUCAUUCCUAUGUGAU (99) UUUUCAU (36) AUGGCUUUUCAUUCCUAUGUGA (100) UUUCAUU (37) AUGGCUUUUCAUUCCUAUGUG (101) UUCAUUC (38) AUGGCUUUUCAUUCCUAUGU (102) UAUGGCU (39) UGGCUUUUCAUUCCUAUGUGA (103) GCUUUUCAUUCCUAUGUGA (104) CUUUUCAUUCCUAUGUGA (105) CUUUUCAUUCCUAUGU (106) CUUUUCAUUCCUAUGUG (107) CUUUUCAUUCCUAUG (108) UUUUCAUUCCUAUGUGA (109) UUUUCAUUCCUAUGU (110) UUUUCAUUCCUAUGUG (111) UUUCAUUCCUAUGUGA (112) UUUCAUUCCUAUGUG (113) CUAUGGCUUUUCAUUCCUAUGU (114) hsa-miR-135b-3p UGUAGGG (40) AUGUAGGGCUAAAAGCCAUGGGC (115) GUAGGGC (41) AUGUAGGGCUAAAAGCCAUGG (116) GGCUAAA (42) AUGUAGGGCUAAAAG (117) UGUAGGGCUAAAAGCCAUGGGCU (118) UGUAGGGCUAAAAGCCAUGGGC (119) GGGCUAAAAGCCAUGGG (120) hsa-miR-196a-5p AGGUAGU (43) UAGGUAGUUUCAUGUUGUUGGGCC (121) GGUAGUU (44) UAGGUAGUUUCAUGUUGUUGGGC (122) GUAGUUU (45) UAGGUAGUUUCAUGUUGUUGG (123) UAGUUUC (46) UAGGUAGUUUCAUGUUGUUG (124) AGUUUCA (47) UAGGUAGUUUCAUGUUGUU (125) GUUUCAU (48) UAGGUAGUUUCAUGUUGU (126) UUCAUGU (49) UAGGUAGUUUCAUGUUG (127) UUAGGUA (50) UAGGUAGUUUCAUGUU (128) UAGGUAG (51) UAGGUAGUUUCAUGU (129) AGGUAGUUUCAUGUUGUUGGGCC (130) AGGUAGUUUCAUGUUGUUGGGC (131) AGGUAGUUUCAUGUUGUUGGG (132) AGGUAGUUUCAUGUUGUUGG (133) GGUAGUUUCAUGUUGUUGGG (134) GGUAGUUUCAUGUUGUUGG (135) GUAGUUUCAUGUUGUUGGG (136) GUAGUUUCAUGUUGUUGG (137) UAGUUUCAUGUUGUUGGG (138) UAGUUUCAUGUUGUUGG (139) AGUUUCAUGUUGUUGGG (140) AGUUUCAUGUUGUUGG (141) UUUCAUGUUGUUGGGC (142) UUUCAUGUUGUUGGG (143) AUUAGGUAGUUUCAUGUUGUUG (144) UUAGGUAGUUUCAUGUUGUUGGG (145) UUAGGUAGUUUCAUGUUGUUGG (146)

(123) TABLE-US-00013 TABLE 6 Sequences of antagomirs (Anti-miRNAs, 5′ to 3′ direction) based on mature miRNA sequences and on miRNA isomiR sequences (5′ to 3′ direction) obtained from miRBase (release 21: June 2014; www.mirbase.org) or from SIROCCO. In case of discrepancy, SIROCCO data was used. Numbers in between parentheses that follow a sequence refer to the corresponding SEQ ID NO. Mature miRNA Seed (SEQ ID NO) SEQ anti-miRNA (5′-3′) (SEQ ID NO) hsa-miR-135a-5p AUGGCUU (52) TCACATAGGAATAAAAAGCCATA (242) hsa-miR-135a-3p AUAGGGA (53) CGCCACGGCTCCAATCCCTATA (243) hsa-miR-135b-5p AUGGCUU (54) TCACATAGGAATGAAAAGCCATA (244) hsa-miR-135b-3p UGUAGGG (55) CCCATGGCTTTTAGCCCTACAT (245) hsa-miR-196a-5p AGGUAGU (56) CCCAACAACATGAAACTACCTA (246) Mature miRNA miRNA/isomiR sequence (SEQ ID NO) SEQ anti-miRNA (5′-3′) (SEQ ID NO) hsa- UAUGGCUUUUUAUUCCUAUGUGA (147) TCACATAGGAATAAAAAGCCATA miR- UAUGGCUUUUUAUUCCUAUGUGAUAG (247) 135a-5p (148) CTATCACATAGGAATAAAAAGCCATA UAUGGCUUUUUAUUCCUAUGUGAUUC (248) (149) GAATCACATAGGAATAAAAAGCCATA UAUGGCUUUUUAUUCCUAUGUGAUA (249) (150) TATCACATAGGAATAAAAAGCCATA UAUGGCUUUUUAUUCCUAUGUGAU (151) (250) UAUGGCUUUUUAUUCCUAUGUG (152) ATCACATAGGAATAAAAAGCCATA UAUGGCUUUUUAUUCCUAUGU (153) (251) UAUGGCUUUUUAUUCCUAUG (154) CACATAGGAATAAAAAGCCATA (252) UAUGGCUUUUUAUUCCUAU (155) ACATAGGAATAAAAAGCCATA (253) UAUGGCUUUUUAUUCCUA (156) CATAGGAATAAAAAGCCATA (254) UAUGGCUUUUUAUUCCU (157) ATAGGAATAAAAAGCCATA (255) UAUGGCUUUUUAUUC (158) TAGGAATAAAAAGCCATA (256) AUGGCUUUUUAUUCCUAUGUGAU (159) AGGAATAAAAAGCCATA (257) AUGGCUUUUUAUUCCUAUGUGA (160) GAATAAAAAGCCATA (258) AUGGCUUUUUAUUCCUAUGUG (161) ATCACATAGGAATAAAAAGCCAT AUGGCUUUUUAUUCCUAUGU (162) (259) UGGCUUUUUAUUCCUAUGUGAU (163) TCACATAGGAATAAAAAGCCAT (260) UGGCUUUUUAUUCCUAUGUGA (164) CACATAGGAATAAAAAGCCAT (261) UGGCUUUUUAUUCCUAUGUG (165) ACATAGGAATAAAAAGCCAT (262) GGCUUUUUAUUCCUAUGUGA (166) ATCACATAGGAATAAAAAGCCA (263) GCUUUUUAUUCCUAUGUGA (167) TCACATAGGAATAAAAAGCCA (264) GCUUUUUAUUCCUAUGUG (168) CACATAGGAATAAAAAGCCA (265) GCUUUUUAUUCCUAUGU (169) TCACATAGGAATAAAAAGCC (266) CUUUUUAUUCCUAUGUGA (170) TCACATAGGAATAAAAAGC (267) CUUUUUAUUCCUAUGUG (171) CACATAGGAATAAAAAGC (268) CUUUUUAUUCCUAUG (172) ACATAGGAATAAAAAGC (269) CUUUUUAUUCCUAUGU (173) TCACATAGGAATAAAAAG (270) UUUUUAUUCCUAUGUGA (174) CACATAGGAATAAAAAG (271) UUUUUAUUCCUAUGU (175) CATAGGAATAAAAAG (272) UUUUUAUUCCUAUGUG (176) ACATAGGAATAAAAAG (273) UUUUAUUCCUAUGUGA (177) TCACATAGGAATAAAAA (274) UUUUAUUCCUAUGUG (178) ACATAGGAATAAAAA (275) UUUAUUCCUAUGUGA (179) CACATAGGAATAAAAA (276) TCACATAGGAATAAAA (277) CACATAGGAATAAAA (278) TCACATAGGAATAAA (279) hsa- UAUAGGGAUUGGAGCCGUGGCG (180) CGCCACGGCTCCAATCCCTATA miR- UAUAGGGAUUGGAGCCGUGGC (181) (280) 135a-3p UAUAGGGAUUGGAGCCGUGG (182) GCCACGGCTCCAATCCCTATA (281) AUAUAGGGAUUGGAGCCGUGGC (183) CCACGGCTCCAATCCCTATA (282) AUAUAGGGAUUGGAGCCGUGG (184) GCCACGGCTCCAATCCCTATAT AUAUAGGGAUUGGAGCCGUG (185) (283) CAUAUAGGGAUUGGAGCCGUGGCG CCACGGCTCCAATCCCTATAT (284) (186) CACGGCTCCAATCCCTATAT (285) AUAGGGAUUGGAGCCGUGGC (187) CGCCACGGCTCCAATCCCTATATG (286) GCCACGGCTCCAATCCCTAT (287) hsa- UAUGGCUUUUCAUUCCUAUGUGA (188) TCACATAGGAATGAAAAGCCATA miR- UAUGGCUUUUCAUUCCUAUG (189) (288) 135b-5p UAUGGCUUUUCAUUCCUAU (190) CATAGGAATGAAAAGCCATA (289) UAUGGCUUUUCAUUCCUA (191) ATAGGAATGAAAAGCCATA (290) AUGGCUUUUCAUUCCUAUGUGAU (192) TAGGAATGAAAAGCCATA (291) AUGGCUUUUCAUUCCUAUGUGA (193) ATCACATAGGAATGAAAAGCCAT AUGGCUUUUCAUUCCUAUGUG (194) (292) AUGGCUUUUCAUUCCUAUGU (195) TCACATAGGAATGAAAAGCCAT (293) UGGCUUUUCAUUCCUAUGUGA (196) CACATAGGAATGAAAAGCCAT (294) GCUUUUCAUUCCUAUGUGA (197) ACATAGGAATGAAAAGCCAT (295) CUUUUCAUUCCUAUGUGA (198) TCACATAGGAATGAAAAGCCA (296) CUUUUCAUUCCUAUGU (199) TCACATAGGAATGAAAAGC (297) CUUUUCAUUCCUAUGUG (200) TCACATAGGAATGAAAAG (298) CUUUUCAUUCCUAUG (201) ACATAGGAATGAAAAG (299) UUUUCAUUCCUAUGUGA (202) CACATAGGAATGAAAAG (300) UUUUCAUUCCUAUGU (203) CATAGGAATGAAAAG (301) UUUUCAUUCCUAUGUG (204) TCACATAGGAATGAAAA (302) UUUCAUUCCUAUGUGA (205) ACATAGGAATGAAAA (303) UUUCAUUCCUAUGUG (206) CACATAGGAATGAAAA (304) CUAUGGCUUUUCAUUCCUAUGU (207) TCACATAGGAATGAAA (305) CACATAGGAATGAAA (306) ACATAGGAATGAAAAGCCATAG (307) hsa- AUGUAGGGCUAAAAGCCAUGGG (208) CCCATGGCTTTTAGCCCTACAT (308) miR- AUGUAGGGCUAAAAGCCAUGGGC (209) GCCCATGGCTTTTAGCCCTACAT 135b-3p AUGUAGGGCUAAAAGCCAUGG (210) (309) AUGUAGGGCUAAAAG (211) CCATGGCTTTTAGCCCTACAT (310) UGUAGGGCUAAAAGCCAUGGGCU (212) CTTTTAGCCCTACAT (311) UGUAGGGCUAAAAGCCAUGGGC (213) AGCCCATGGCTTTTAGCCCTACA GGGCUAAAAGCCAUGGG (214) (312) GCCCATGGCTTTTAGCCCTACA (313) CCCATGGCTTTTAGCCC (314) hsa- UAGGUAGUUUCAUGUUGUUGGG (215) CCCAACAACATGAAACTACCTA (315) miR- GGUAGUUUCAUGUUGUUGGGCC (216) GGCCCAACAACATGAAACTACC 196a-5p UAGGUAGUUUCAUGUUGUUGGGC (217) (316) UAGGUAGUUUCAUGUUGUUGG (218) GCCCAACAACATGAAACTACCTA UAGGUAGUUUCAUGUUGUUG (219) (317) UAGGUAGUUUCAUGUUGUU (220) CCAACAACATGAAACTACCTA (318) UAGGUAGUUUCAUGUUGU (221) CAACAACATGAAACTACCTA (319) UAGGUAGUUUCAUGUUG (222) AACAACATGAAACTACCTA (320) UAGGUAGUUUCAUGUU (223) ACAACATGAAACTACCTA (321) UAGGUAGUUUCAUGU (224) CAACATGAAACTACCTA (322) AGGUAGUUUCAUGUUGUUGGGCC (225) AACATGAAACTACCTA (323) AGGUAGUUUCAUGUUGUUGGGC (226) ACATGAAACTACCTA (324) AGGUAGUUUCAUGUUGUUGGG (227) GGCCCAACAACATGAAACTACCT AGGUAGUUUCAUGUUGUUGG (228) (325) GGUAGUUUCAUGUUGUUGGG (229) GCCCAACAACATGAAACTACCT (326) GGUAGUUUCAUGUUGUUGG (230) CCCAACAACATGAAACTACCT (327) GUAGUUUCAUGUUGUUGGG (231) CCAACAACATGAAACTACCT (328) GUAGUUUCAUGUUGUUGG (232) CCCAACAACATGAAACTACC (329) UAGUUUCAUGUUGUUGGG (233) CCAACAACATGAAACTACC (330) UAGUUUCAUGUUGUUGG (234) CCCAACAACATGAAACTAC (331) AGUUUCAUGUUGUUGGG (235) CCAACAACATGAAACTAC (332) AGUUUCAUGUUGUUGG (236) CCCAACAACATGAAACTA (333) UUUCAUGUUGUUGGGC (237) CCAACAACATGAAACTA (334) UUUCAUGUUGUUGGG (238) CCCAACAACATGAAACT (335) AUUAGGUAGUUUCAUGUUGUUG (239) CCAACAACATGAAACT (336) UUAGGUAGUUUCAUGUUGUUGGG (240) GCCCAACAACATGAAA (337) UUAGGUAGUUUCAUGUUGUUGG (241) CCCAACAACATGAAA (338) CAACAACATGAAACTACCTAAT (339) CCCAACAACATGAAACTACCTAA (340) CCAACAACATGAAACTACCTAA (341)

(124) TABLE-US-00014 TABLE 7 Sequence and genomic location of miRNA-135s being miRNA-135a and miRNA-135b. The mature sequence of miRNA-135a and miRNA-135b differs by only one nucleotide (underlined) which is outside the seed region (in bold). Numbers in between parentheses that follow a sequence refer to the corresponding SEQ ID NO. miRNA-135b UAUGGCUUUUCAUUCCUAUGUGA (342) chr1:205448302-205448398 miRNA-135a UAUGGCUUUUUAUUCCUAUGUGA (343) mir-135a-1 chr3:52294219-52294308 mir-135a-2 chr12:97563812-97563911

Example 4: miRNA-135a Reduces MEF2a Expression

(125) Methods:

(126) Animals: C57bl6J mice (male and female) were obtained from Charles Rivers Laboratories.

(127) Target Validation: Western Blot and Luciferase Assay

(128) HEK293 (RRID:CVCL_0045) and N2A (RRID:CVCL_0470) cells were cultured according to the guidelines provided by ATCC. Luciferase assay was performed in HEK293 cells and target validations by western blot were performed in N2A cells.

(129) For luciferase assays, miRNA recognition elements (MRE) for miR-135a present on the 3′ UTR of Mef2a were identified in RNAseq data and also predicted by Targetscan. Oliogonucleotides with these sites were cloned into the psi-Check2 vector (Promega). Oligonucleotides with WT (MEF2A-135a-fw: TCG AGA GCA GAA CCT TGG AAA AAA AAA GCC ATG GC (SEQ ID NO: 351), Rv-GGC CGC CAT GGC TTT TTT TTT CCA AGG TTC TGC TC (SEQ ID NO: 352)) and MUT (MEF2A-135aM-fw: TCG AGA GCA GAA CCT TGG AAA AAA AAA GGC TTG GC (SEQ ID NO: 353); Rv-GGC CGC CAA GCC TTT TTT TTT CCA AGG TTC TGC TC (SEQ ID NO: 354)) miR-135a binding sites on Mef2a 3′ UTR were phosphorylated, annealed and ligated into Notl and Xhol sites of the multiple cloning site. Cells (8×10.sup.4) were transfected using Lipofectamine 2000 (Invitrogen) with 250 ng of reporter construct together with 25 pmol of miRIDIAN miRNA mimic or Scramble control (NC-1, Dharmacon). Cells were harvested after 24 h and luciferase assay was performed using the dual-luciferase assay system (E1960, Promega) on a Luminometer. Normalizing against Renilla luciferase activity was used to determine relative luciferase activity.

(130) For protein analysis, western blotting was performed. N2A cells were transfected with miRIDIAN mimics for miR-135a or a scrambled control using Lipofectamine 2000. After 48 h cells were harvested and lysed in RIPA buffer (50 mM Tris pH.7.5, 150 mM Nacl, 0.5% NP-40, 0.5% NaDoc, 1% Triton, Protease inhibitor (Roche) in MilliQ (MQ)). Equal amounts of protein samples were separated on SDS-PAGE gels (8%) and transferred onto nitrocellulose blotting membranes (GE Healthcare Lifesciences), following blots were blocked for 1 hr at RT in 5% milk powder in 1×TBS-Tween. Blots were incubated overnight at 4° C. with rabbit-anti-NR3C1 (GR) (1;1000, Santa-cruz Biotechnology, RRID:AB_2155786), rabbit-anti-PlxnA4 (1;250, Abcam, RRID:AB_944890), mouse-anti-β actin (1;2000, Sigma-Aldrich, RRID:AB_476743). Blots were stained with peroxidase-conjugated secondary antibodies for 1 hr at RT and signal was detected by incubating blots with Pierce ECL substrate (Thermo Fischer Scientific). Images were acquired using a FluorChem M imaging system (Protein Simple). Using ImageJ, individual band intensities for each sample were measured and normalized to corresponding β-actin levels. Relative expression between conditions of each protein was estimated by t test (GraphPad Prism version 6 software, RRID:SCR_002798). Except for Mef2a, blots were blocked in Supermix blocking solution (Tris 50 mM, Nacl 154 mM, 0.25% Gelatin, 0.5% Triton-x-100 in MQ, pH-7.4) for 10 min at RT and inclubated overnight at 4° C. with rabbit-anti-Mef2a (1;50,000, Abcam, RRID:AB_10862656) and mouse-anti-β actin (1;2000, Sigma-Aldrich, RRID:AB_476743). Blots were washed in 1×TBS-Tween and incubated with secondary antibodies coupled with IR dyes (anti-rabbit-IRdye 800 1;5000 and anti-mouse-IRdye700 1;2000 in 1×TBS-Tween) for 1 hr at RT. Finally, blots were washed in 1×TBS-Tween and scanned on Odyssey Clx imaging system (LI-COR biosciences, Westburg) using Li-COR Image studio v3.1 software (RRID:SCR_015795) and band intensities were measured and relative expression between conditions was estimated by t test (GraphPad Prism version 6 software, RRID:SCR_002798).

(131) Culturing and Transfection of Primary Mouse Hippocampal Neurons

(132) Dissociated hippocampal neurons were cultured. Briefly, C57bl6J (P0-1) mouse pups were decapitated and brains were quickly isolated in ice cold dissection medium (Leibovitz's L-15 supplemented with 7 mM HEPES (Thermo scientific)). Hippocampus was isolated, trypsinized in 0.25% trypsin in L15-HEPES medium for 20 min at 37° C., followed by trituration using fire polished Pasteur pipettes in growth medium (Neurobasal medium supplemented with B27, Penicillin/streptomycin L-glutamine and β-mercaptoethanol). Dissociated cells were plated onto glass coverslips coated with PDL (20 μgml.sup.−1) and Laminin (40 μgml.sup.−1) in growth medium and incubated at 37° C. with 5% CO.sub.2. Half of the growth medium was refreshed twice a week. On day in vitro (DIV)14 neurons were transfected with 0.5 μg of pre-miR-135a1 (cloned into pJEBB vector with CMV promoter, contains GFP reporter) or pJEBB vector only. For rescue experiments, pJEBB-pre-miR-135a1 and the constitutively active mutant Mef2-vp16 (Fiore et al., 2009) were co-transfected. Transfected neurons were fixed on DIV16 with 4% PFA and 4% sucrose in PBS for 20 min. Immunocytochemistry was performed by blocking neurons in blocking buffer (4% NGS, 0.1% BSA, 0.1% Triton-X-100 in 1×PBS (pH-7.4)) for 1 hr at RT followed by incubation with primary antibody chicken-anti-GFP (1;1000, Abcam, RRID:AB_300798) diluted in blocking buffer. The next day washes in 1×PBS were performed followed by incubation with appropriate secondary antibodies in blocking buffer for 1 hr at RT. Sections were mounted using ProLong Gold (Thermo Fischer Scientific). High resolution images were acquired using an oil immersion 63× objective of a confocal laser scanning microscope (LSM880, Zeiss). 6-7 Z stack images of each apical dendrites close to the soma were captured. Using ImageJ software (RRID:SCR_003070) with cell counter plugin, different types of spines categorized as immature to mature: filopodium, thin, stubby, mushroom and cupshaped on secondary dendrite were identified and counted. Spine density was determined by dividing the number of spines on a branch with the length of the branch.

(133) RNA Isolation and Quantitative PCR

(134) Samples from seven patients with mTLE+HS (with hippocampal sclerosis) and eight post-mortem control samples were used (for patient details see Table 8). Patient tissue representing all hippocampal regions was selected using Nissl staining. Approximately 20 mg of tissue was collected by slicing 25 μm thick sections on a cryostat. For intraamygdala kainate (IAK) mice, hippocampus was dissected, frozen and stored at −80° C. Total RNA was isolated using the miRNeasy kit (Qiagen), according to the manufacturer's instructions. RNA quantity was determined using Nanodrop (Thermo Scientific). For miRNA quantitative PCR (qPCR), first strand cDNA synthesis was performed using a universal cDNA synthesis kit (Exiqon) according to the manufacturer's recommendation. QPCR reactions were run in a Quantstudio 6 flex Real-Time PCR system (Applied Biosystems) using microRNA LNA™ PCR primer sets (miR-135a, miR-124) and SYBR Green master mix (Exiqon). For pre-miRNA qPCR, primer sequences (pre-miR-135a1 and a2) were designed using Primer3 software. Primers sequences for each target are provided in Table 11. 100 ng of RNA was reverse transcribed using Superscript III first strand synthesis kit (Thermo fischer scientific). Similarly, for validation of bio-IP targets equal amount of input and IP RNA was reverse transcribed as above. Primers sequences for each target are provided in Table 11. QPCR reactions were run on Quantstudio 6 flex Real-Time PCR system (Applied Biosystems) using Fast start universal SYBR Green master mix (Roche). All samples were run in duplicates. Ct values were determined using Quant studio real time PCR software v1.1. For miRNA, expression levels were estimated by normalizing to 5s rRNA. Pre-miRs were normalized to GAPDH (human) and beta-actin (mouse). For Bio-ip fold enrichment of target gene in the IP sample was estimated after normalizing to input deltaCt. DeltaCt and fold changes were calculated and the statistical significance was analyzed by Mann Whitney U test and Students t test. P<0.05 was considered as significant.

(135) Non-Radioactive In Situ Hybridisation

(136) Non-radioactive in situ hybridization was performed as described previously (Kan et al., 2012). Three patients from each group (control and mTLE+HS) were used for in situ hybridization. Similarly, for IAK mice sections three mice per group were used. Briefly, 16 μm thick sections from fresh frozen hippocampal tissue were collected on glass slides and stored at −80° C. until use. Sections were fixed (4% PFA for 10 min at RT), acetylated (10 min at RT) and treated with proteinase K (5 μg/ml for 5 min at RT). Pre-hybridisation was performed for 1 h at RT. Hybridisation was performed with 10 nM of double-DIG (3′ and 5′)-labeled locked nucleic acid (LNA) probe for human-miR-135a-5p (Exiqon) or LNA-DIG Scramble probe overnight at 50° C. Slides were washed at 55° C. in 0.2×SSC for 1 h, followed by blocking with 10% fetal calf serum (FCS) in B1 buffer (0.1 M Tris pH 7.5/0.15 M NaCl) for 1 h at RT. Sections were incubated with anti-digoxigenin-AP Fab fragments (1;2,500, Roche Diagnostics) in 10% FCS in B1 buffer overnight at 4° C. Slides were treated with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitrobluetetrazolium (NBT) substrates (NBT/BCIP stock solution, Roche Diagnostics) in B3 (0.1 M Tris pH 9.5/0.1 M NaCl/50 mM MgCl.sub.2) for 5-20 h at RT. Staining was stopped by washes in PBS and slides were mounted using vectashield (VectorLabs). No staining was observed in sections hybridized with scramble probe. Images were acquired with brightfield microscope and processed using ImageJ.

(137) A similar protocol was used for FISH except that hybridization was performed at 55° C. and washes at 60° C. After blocking, slides were co-incubated with anti-Digoxigenin-POD (1;500, Roche Diagnostics) and mouse-anti-NeuN (1;400, Millipore, RRID:AB_2298772) or rabbit-anti-GFAP (1;1000, Dako Cytomation, RRID:AB_10013482) antibodies overnight at 4° C. Signal was amplified using the ISA™ Cyanine 3 System (1;50 in amplification diluent, PerkinElmer) for 10 min at RT. After washes with PBS, slides were incubated with secondary antibodies (Alexafluor 488, Invitrogen) against the primary antibody for 1.5 h at RT. Nuclei were stained with DAPI (10 min at RT) and slides were mounted using ProLong Gold (Life Technologies). Images were acquired using a confocal laser scanning microscope (LSM880, Zeiss).

(138) RNA Immunoprecipitation with Biotinylated miRIDIAN Mimics

(139) N2A cells were cultured in Dulbecco's modified Eagle's medium (DMEM) low glucose supplemented with L-glutamine, pencillin/streptomycin (100 U/ml and 100 mg/ml, respectively) and 10% FCS (Invitrogen) at 37° C. with 5% CO.sub.2. For each condition (miR-135a, scrambled and no transfection) three 10 cm dishes with 2×10.sup.6 cells/dish were plated and transfected with 37.5 nM of 3′ biotinylated miRNA mimics (miR-135a and Scramble: Dharmacon) using HighPerfect Transfection reagent (Qiagen). RNA immunoprecipitation was performed as described previously (Wani and Cloonan, 2014) with some modifications. Briefly, 24 h after transfection cells were collected and lysed in lysis buffer (10 mM Tris-Cl pH 7.5, 10 mM KCl, 1.5 mM Mgcl2, 5 mM DTT, 0.5% NP-40, 60 U/ml SUPERase-in RNase inhibitor (Invitrogen), protease inhibitor tablet (Roche) in MQ) and the cleared cell lysates were incubated with Dynabeads M-280 Streptavidin beads (Invitrogen) for 30 min at RT. Beads were washed three times in wash buffer (lysis buffer containing 1 M NaCl) and stored in Qiazol at −80° C. Total RNA was extracted using miRNeasy kit (Qiagen). One part of the beads was incubated with 4× Nu-PAGE sample buffer (with 10% β-mercaptoethanol in MQ) for 10 min at 70° C. to extract bound proteins. Proteins were then separated on 8% SDS-PAGE gel and the subsequent proteins transferred blot was incubated with rabbit-anti-Ago2 antibody (1;1000, Cell-signalling, RRID:AB_2096291) and mouse-anti-β actin (1;2000, Sigma-Aldrich, RRID:AB_476743) in blocking solution (5% Milk in 1×TBS-T) overnight at 4° C., finally signal was detected as above.

(140) Library Preparation and Total RNA Sequencing

(141) For input samples, libraries for total RNA sequencing were prepared using the TruSeq Stranded Total RNA (w/ RiboZero Gold) sample prep kit (Illumina). The starting material (100 ng) of total RNA was depleted of rRNAs using Ribo-Zero Gold (removes both cytoplasmic and mitochondrial rRNA) magnetic bead-based capture-probe system (Illumina). The remaining RNA, including mRNAs, lincRNAs and other RNA species, was subsequently purified (RNAcleanXP) and enzymatically fragmentated. For IP samples, libraries were prepared using the TruSeq stranded mRNA sample prep kit (Illumina) according to the manufacturer's instructions with some modifications: the starting material (37.5-50.0 ng) of total RNA was not mRNA-enriched nor fragmented prior to library synthesis. First strand synthesis and second strand synthesis were performed and double stranded cDNA was purified (Agencourt AMPure XP, Beckman Coulter). The cDNA was end repaired, 3′ adenylated and Illumina sequencing adaptors were ligated onto the fragments ends, and the library was purified (Agencourt AMPure XP). The polyA+ RNA stranded libraries were pre-amplified with PCR and purified (Agencourt AMPure XP). Library size distribution was validated and quality inspected using the 2100 Bioanalyzer (high sensitivity DNA chip, Agilent). High quality libraries were quantified using the Qubit Fluorometer (Life Technologies). Single-end sequencing was performed using the NextSeq500 instrument according to the manufacturer's instructions (Illumina).

(142) Read Mapping and Differential Expression Analysis

(143) Following trimming of low-quality bases and adapter sequences with FASTQ-MCF (version 0.0.13), processed reads were mapped to the GRCm38.p6 reference mouse genome (Ensembl) with TopHat2 (version 2.0.13) (Kim et al., 2013). ‘fr-secondstrand’ option was chosen for the alignments of the total RNA sequencing data. Mapped counts were summarised for each gene using the python script htseq-count (Anders et al., 2015).

(144) For differential expression analysis, count data for genes and transcripts were analysed for differential expression in R using the Bioconductor package EdgeR version 3.12.1 (Robinson et al., 2010) with the trimmed mean of M-values (TMM) normalisation method (Robinson and Oshlack, 2010). Gene expression levels were corrected for batch effects by including the series of sequencing rounds. Adjusted P values for multiple testing were calculated using the Benjamini-Hochberg false discovery rate (FDR) and only genes with an FDR<0.05 were considered significantly differentially expressed. Data visualisation was performed in R using the ggplot2 library. Gene expression heatmaps with hierarchical clustering of expression profiles were created in R with the Bioconductor pheatmap package. Enrichment analysis was performed using the R package goseq (Young et al., 2010) to correct for bias due to transcript length.

(145) In Silico Prediction of miRNAs Binding Sites

(146) miRanda software version 3.3a was used to predict microRNA signatures. The following parameters were used in this study: match with a minimum threshold score of 150; target mRNA duplex with minimum folding free energy threshold −7 kcal/mol; gap opening penalty −8; gap extension penalty −2; scaling parameter 4 for complementary nucleotide match score.

(147) Immunohistochemistry and Western Blotting for Mef2a

(148) Mef2a immunostainings were performed on resected human hippocampal sections and 2 wk IAK mouse tissue. 16 μm sections were blocked in 10% NGS, 0.4% Triton in 1×PBS (pH 7.4) for 1 hr at RT followed by incubation in anti-Mef2a antibody (1;150, Abcam) and anti-NeuN antibody (1;400, Millipore) in blocking solution overnight at 4° C. Sections were washed and incubated with corresponding Alexa-fluor conjugated (Thermofischer scientific) secondary antibodies for 1.5 hr at RT, followed by washes in 1×PBS and stained for nuclei with DAPI (4′,6-diamidino-2-phenylindole) and mounted using ProLong gold (Thermofischer scientific). High resolution images were acquired using confocal microscope (LSM880, Zeiss) and processed using ImageJ.

(149) For analyzing Mef2a protein levels in human TLE and IAK mice hippocampal tissue. Protein lysates were prepared in RIPA buffer and equal amounts of proteins were separated on SDS-PAGE gels (8% gel for mice samples amd 10% gel for human samples), and transferred onto nitrocellulose membranes, blocked and incubated overnight at 4° C. with rabbit-anti-Mef2a (for human—1;20,000, for mice—1;50,000, Abcam, RRID:AB_10862656) and mouse-anti-β actin (1;2000, Sigma-Aldrich, RRID:AB_476743). Blots were stained, developed and quantified as described above.

(150) Intraamygdala Kainate Mice

(151) Status epilepticus (SE) induction, EEG recording and analysis was done as previously described (Jimenez-Mateos et al., 2012) (Mouri et al., 2008). Briefly, mice were implanted with telemetric EEG transmitters (Data Systems International). Two days after surgery, SE was induced for 40 min by administration of kainic acid (0.3 μg in 0.2 μl in PBS). Control animals received the same volume of scrambled mimics or PBS. Forty minutes after microinjection, mice received an intravenous injection of lorazepam (6 mg/kg) to stop SE. Mice were EEG monitored for 1 hr after injection to make sure that all the seizure activity was reduced.

(152) Intracerebroventricular Injections

(153) For antagomirs, intracerebroventricular (i.c.v) injections were performed as described (Jimenez-Mateos et al., 2012) (Reschke et al., 2017). From day 7 after SE induction, baseline EEG was recorded. At day 14 (D14) mice received an infusion of 1.0 nmol/2 μl of antagomir-135a LNA modified and 3′-cholesterol-modified oligonucleotides (Exiqon) in PBS. Controls received same volume of PBS. During this period mice were continuously EEG and video monitored for another 2 weeks. EEG data analysis was performed using LabChart 8 software (ADInstruments Ltd).

(154) Statistical Analysis

(155) Statistical analysis was performed using GraphPad Prism and a p value<0.05 was considered as significant. Seizure frequencies before (baseline) and after Ant-135a were analyzed using paired t test, the number of seizures per day using F statistics mixed design repeated measures general linear model. Seizure duration and total time spent in seizures were analyzed using t test. Differences between two groups were tested using either two tailed student t test or Mann whitney test. For comparing more than two groups one way ANOVA was used.

(156) TABLE-US-00015 TABLE 8 Control and mTLE patient group details. Details of mediation used for TLE patients. LTG lamotrigine, PHT phenytoin, CBZ carbamazepine, LEV levetiracetam, OXC oxcarbazepine, CLO clobazam, DZP diazepam, LZP lorazepam, SER Seroquel, PGB pregabaline, RES restoril. Age of Years of # Sample Age Sex PMD onset epilepsy AED's 1 Control 58 M 7 hr NA NA NA 2 Control 73 F 6.5 hr NA NA NA 3 Control 71 M 9 hr NA NA NA 4 Control 62 M 7 hr NA NA NA 5 Control 64 F 4.5 hr NA NA NA 6 Control 74 M 8 hr NA NA NA 7 Control 94 F 4 hr NA NA NA 8 Control 70 M 20.5 hr NA NA NA 9 Control 82 M 4 hr NA NA NA 10 Control 94 M 5 hr NA NA NA 11 Control 78 F 7 hr NA NA NA 12 Control 93 M 7.5 hr NA NA NA 13 Control 72 F 7 hr NA NA NA 14 Control 75 F 9 hr NA NA NA 1 TLE + HS 41 M NA 1 40 CBZ 2 TLE + HS 36 F NA 14 22 OXC, LZP 3 TLE + HS 42 M NA 0.45 41 LEV, LTG 4 TLE + HS 52 F NA 20 32 CBZ, CLO, DZP 5 TLE + HS 50 M NA 2.5 47 LTG, CBZ, CLO 6 TLE + HS 41 M NA 10 31 PHT, CLO, CBZ, LTG 7 TLE + HS 49 F NA 12 37 OXC, CLO, SER 8 TLE + HS 58 F NA 36 22 LEV, LTG 9 TLE + HS 23 F NA 14 9 LTG 10 TLE + HS 60 F NA 15 45 LTG, CBZ, LEV 11 TLE + HS 41 M NA 16 25 PGB, RES, CBZ
Results
Increased Expression of miR-135a in Human and Experimental TLE

(157) To begin to characterize a potential role for miR-135a in the pathophysiology of TLE, miR-135a expression was assessed in human TLE hippocampus (mTLE+HS) and controls. miR-135a expression levels were increased in mTLE hippocampus as compared to control (FIG. 11A). To verify the spatial distribution of miR-135a in human hippocampal tissue we performed in situ hybridization (ISH). In line with the qPCR data stronger signals for miR-135a were observed in mTLE+HS hippocampus as compared to control. Signals were mainly confined to neurons in the CA and DG regions (FIG. 11B). To confirm this cell type-specific localization, fluorescent ISH (FISH) was performed in combination with immunohistochemistry for NeuN (neurons) or GFAP (astrocytes). MiR-135a specifically co-localized with NeuN but not GFAP (FIG. 11C).

(158) Next, we checked whether seizure induction (status epilepticus, SE) in an experimental model of TLE by intra-amygdala microinjection of glutamate receptor agonist kainic acid (Mouri et al., 2008) would also lead to increased levels of miR-135a. Indeed, we observed a strong increase in miR-135a expression at day 14 (D14) after SE by qPCR and/or ISH (FIG. 12A, 12B). ISH revealed a strong signal for miR-135a in the soma of pyramidal neurons in the hippocampus, and also in neurons in the cortex, thalamus and amygdala at D14 (FIG. 12B). Similar to our observations in the human mTLE hippocampus, miR-135a was mainly localized in neurons and not in astrocytes (FIG. 12C). The mature form of miR-135a, miR-135a-5p, is spliced from two different pre-transcripts in both human and mice that arise from different loci on the chromosomes (Table 9). To examine whether a specific locus was responsible for the increase in miR-135a expression in TLE, pre-miR levels were studied in human and mouse. Pre-miR-135A2 was significantly increased in human TLE (FIG. 12D), whereas in mice both pre-miR-135a1 and pre-miR-135a2 were significantly increased (FIG. 12E). In all, we found increased expression of miR-135a in TLE and the increased miRNA is localized mainly to neuronal cells.

(159) TABLE-US-00016 TABLE 9 Genomic location and sequence of miR-135a in human and mice. Mature miR-135a-5p is spliced from two pre-sequences in mice and human. Species Pre-miR Chromosome Location Human miR-135A-1  3 52,294,219-52,295,308 miR-135A-2 12 97,563,812-97,563,911 Mouse miR-135a-1  9 106,154,124-106,154,213 miR-135a-2 10 92,072,086-92,072,185 Sequence miR-135a-5p: UAUGGCUUUUUAUUCCUAUGUGA (SEQ ID NO: 5)
Silencing of miR-135a Rescues Mice from Spontaneous Recurrent Seizures

(160) Our data show that miR-135a levels are high at the time recurrent spontaneous seizures are detected. To link increased miR-135a expression to spontaneous seizures, this miRNA was targeted by antagomirs (in this case locked nucleic acid (LNA) 3′ cholesterol-conjugated oligonucleotides (Exiqon)). Several studies have shown that antagomirs can effectively reduce spontaneous seizures when administered either before status epilepticus (Jimenez-Mateos et al., 2012) (Gross et al., 2016) or immediately after SE (Reschke et al., 2017). However, it remained unknown whether administering of antagomirs in the spontaneous recurrent seizure phase can impact on seizure propagation. Antagomirs were administered (intracerebroventricularly, i.c.v) in different concentrations to test for their specific effect on miR-135a. Twenty four hours after injection, miR-135a levels were significantly reduced at 1.0 nmol of antagomir, whereas expression of another, unrelated miRNA, miR-124, was not affected. Injection of 1.5 nmol had a small but non-significant effect on miR124 expression (data not shown). On basis of these data we decided to use injections of 1.0 nmol in subsequent experiments. However, first ISH was used to detect endogenous miR-135a and ant-miR-135a following antagomir or control injection. This analysis showed that ant-miR-135a is taken up primarily by hippocampal neuronal cells in the CA and DG regions (FIG. 13A).

(161) To assess the effect of blocking miR-135 on the occurrence of spontaneous seizures, SE-induced mice were injected with antagomirs for miR-135a or control at D14 and continuously monitored by EEG for 6 days after injection (FIG. 13B). One-week prior injections (D7-D14 after SE) baseline EEG recordings were performed and no significant difference in seizure frequency between treated and control animals was observed (FIG. 13C-13D). We verified in an independent experiment that injecting PBS or a modified Scramble (same as antagomir) yielded similar seizure pattern after SE (data not shown). Following injection of anti-miR-135a at D14, a significant decrease in the number of seizures per day was detected (FIG. 13C). A significantly different and strong reduction in seizure count was observed in ant-miR-135a as compared to control mice (FIG. 13D (n=5 control and ant-miR-135a injected; mixed design repeated measures general linear model; F statistic—5.834 (F.sub.(20,60)=1.75 for α=0.05); P<0.001). The average seizure duration was not different between the groups, before ant-135a injection (p=0.4721), whereas it was significantly lower (P=0.0006, Student's t test) after injection (FIG. 13E). Similarly, the total amount of time spent during seizures reduced in the first 6 days following ant-miR-135a injection (P=0.0021, Student's t test) (FIG. 13F). On average, ant-135a injected mice spent less time (<300 sec) in seizures per day, as compared to control injected mice (>300 sec) (FIG. 13H). Together, these data show that blocking elevated expression of miR-135a during the period of recurrent spontaneous seizures has an acute and seizure suppressive effect.

(162) Identification of miR-135a Targets

(163) miR-135a can affect axon growth and regeneration by controlling KLF4 expression. However, the acute nature of the effects of ant-miR-135a injection on seizure activity in vivo hints at interference with cellular processes that regulate neuronal activity such as intracellular signaling, synaptic transmission or synaptic morphology. miRNAs function by binding specific sequences known as miRNA recognition elements (MRE) in the 3′ untranslated regions (UTR) of target transcripts. Upon binding, miRNAs repress translation or induce target RNA degradation. Prediction tools are available that predict targets based on few empirical rules derived experimentally (Brennecke et al., 2005) (Lewis et al., 2005), but many of these computational prediction tools perform poorly in experimental validation due to high false positive rates (Krek et al., 2005). To identify targets that are physically interacting with miR-135a, we performed miRNA immunoprecipitation in neuronal mouse Neuro2A cells using biotin-tagged mimics. miR-135a and scrambled mimics were tagged with a biotin molecule at their 3′ end (FIG. 14A, 14B) as 3′ molecule tagging was reported to not interfere with seed recognition and miRNA binding (Wani and Cloonan, 2014). Although applying previously reported protocols for bio-miR IP (Wani and Cloonan, 2014), we confirmed the IP procedure by immunoblotting for Ago2 (the main component of RISC complex) following IP of miR-135 and scrambled mimics. Ago2 was detected in both input and IP samples, whereas the cytoskeletal protein β-actin was detected only in input samples (FIG. 14C). The presence of Ago2 confirms that the bio-miRNA mimic has been immunoprecipitated with the RISC complex, and presumably bound RNA targets. The sequence of the scr control is based on Caenorhabditis elegans microRNAs with minimal sequence identity with human, mice and rat. The presence of Ago2 in the scr IP sample can most likely be explained by the fact that Argonaute proteins are very conserved among species (Hack and Meister, 2008).

(164) Following IP, total RNA sequencing was performed. For input samples, on average 58.5 million and for IP samples 48.7 million high quality reads were obtained. For input samples, most of these reads could be aligned with the mouse reference genome, but for IP samples 39.7% of reads could be aligned with the reference genome. As no polyA+ enrichment or ribosomal RNA depletion was performed, a large part of the aligned sequences derived from ribosomal RNA. For each sample, gene-level read counts and KPKM-values (K-mers Per Kilobase of exon per Million reads) were generated with Sailfish (Patro et al., 2014). Analysis of input samples revealed only few significantly changed transcripts including validated miR-135a targets such as Complexins (Cplx1 and Cplx2) (Hu et al., 2014). In IP samples, levels of 587 transcripts were significantly altered (using a cutoff of FDR<0.05 and P<0.01) (FIG. 14D). These observations were supported by principal component analyses (PCA) which showed clear segregation of gene expression profiles for IP samples (Scr vs miR-135a IP), but no clear segregation for inputs (FIG. 14E, F). Furthermore, IP samples contained many previously reported miR-135a targets such as Metastasis suppressor protein (Mtss)1 (Zhou et al., 2012), Cyclin-dependent kinase (Cdk)4 (Dang et al., 2014), proteoglycan Versican (Vcan) (Zhao et al., 2017), Zinc finger protein (Zfp) 217 (Xiang et al., 2017). Gene ontology (GO) analysis demonstrated that differentially expressed transcripts found in IP samples are involved in neuron-related functions as semaphorin-plexin signaling, semaphorin receptor activity, ion transport, and cAMP response element binding (FIG. 15A-C). As a first step to identify targets of miR-135a relevant for the observed effect of ant-miR-135a treatment in vivo, we selected transcripts from the IP samples with predicted miR-135a MREs, using miRanda software. MREs were found to be present not only in the 3′UTR (258), but also in the 5′ UTR (33) and the coding sequence (CDS) (279) of the 578 transcripts. 177 putative targets had no predicted target site (FIG. 15D). miR-135a and miR-135b are highly similar and have an identical seed region, so in principle these miRNAs should target a similar set of mRNAs. Comparison of targets in IP samples of miR-135a and miR-135b (not shown) revealed 50% overlap while 25.8% of targets were unique for miR-135a) and 23.8% for miR-135b (FIG. 15E).

(165) Using the approach outlined above, we identified several new targets of miR-135a with reported roles in the regulation of neuronal development and function (Table 10). For further validation, 7 targets were selected on basis of their function in neurons and/or implication in epilepsy (Tuberous sclerosis complex (TSC)1, Calcium channel (Cacnacic)). All targets tested were enriched in IP as compared to input samples (FIG. 16A). The effect of overexpression of miR-135a mimics in N2A cells on the expression of a few of the selected targets was tested and showed a significant downregulation of NR3C1 (GR), PlxnA4 and Mef2a protein expression (FIG. 16B-D). This experiment confirms that targets identified by IP can be regulated by miR-135a.

(166) TABLE-US-00017 TABLE 10 Gene list of selected targets for validation of Bio-IP. Gene Function involved Log FC P-value FDR Nr3c1 (GR) Glucocorticoid receptor 3.378650362 8.86E−16 2.17E−13 Tsc1 Tuberous sclerosis complex 1.502705494 0.000161564 0.002630348 Nrp1 AG, MFS 1.367505695 7.45E−06 0.000172036 Tgfbr1 Tgf beta signaling 1.35700473 1.27E−06 3.73E−05 Mtss1 Spine density 1.327584297 0.002385165 0.020182166 PlxnA4 AG, MFS 1.207035618 0.000125568 0.00190651  Cacna1c Calcium channel 1.1901732 0.000761925 0.008197154 Ncam 1 Neurite outgrowth 1.052455671 5.18E−05 0.000926565 Slit2 AG, MFS 1.044428042 0.000332578 0.004183416 Mef2a Spine density 0.983455004 0.002032665 0.01769962  Creb1 Transcription factor 0.909096844 0.00363345  0.028097983 AG—axon guidance, MFS—mossy fiber sprouting.
The miR-135 Target Mef2a is Regulated in TLE

(167) MEF2 proteins (MEF2A-D) form a family of transcription factors that are spatially and temporally expressed in the brain (Lyons et al., 1995), with most prominent expression for MEF2A, 2C and 2D. MEF2s mediate activity-dependent synaptic development, and are activated by neurotrophin stimulation and calcium influx resulting from increased neurotransmitter release at synapses (Flavell et al., 2008). Mutations in MEF2C were described in patients with severe mental retardation and epilepsy (Bienvenu et al., 2013) (Nowakowska et al., 2010). In addition, Mef2a is deregulated in temporal cortex of human and experimental TLE (Huang et al., 2016). Based on the ant-miR-135a experiments (FIG. 13) and its specific enrichment by miR-135a IP, we focused subsequent experiments on Mef2a. Mef2a 3′UTR contains one specific conserved binding site for miR-135a (seed sequence from 1024-1030 nt) (FIG. 17A). This site is targeted by miR-135a as shown by luciferase assay. Co-expression of miR-135a mimics with the miR-135a binding site in a luciferase reporter vector led to reduced luciferase activity. Mutation of the site abolished the effect of miR-135a (FIG. 17B).

(168) To verify if miR-135a also regulates spine number, miR-135a was overexpressed in mouse primary hippocampal neurons. Spine density was measured at a distance of 100 um from the 1.sup.st secondary dendritic branch on the apical dendrite (FIG. 17C) and 5 different spine types (cupshaped, mushroom, stubby, thin and filopodium) were counted (FIG. 17D). Overexpression of miR-135a led to a significant reduction in the number of spines (0.34±0.13 spines/um) compared to the control (0.55±0.06 spines/um). Overexpression of miR-135a in vitro resembled pathological neuronal cell observed in vivo in TLE, and so increased miR-135a in epileptic brain could be directly or indirectly contributing to the neuronal spine loss observed, though the exact mechanisms are not clear. This effect was rescued to control levels when Mef2 vector lacking the 3′ UTR was co-expressed with miR-135a (0.49±0.08 spines/um) (FIG. 17E). Interestingly, miR-135a overexpression led to a specific reduction in the number of mature spines: cupshaped (3.32%), mushroom (18.05%), stubby (20.81%), but led to increase in immature type of spines thin (31.00%) and filopodium (26.82%) compared to control (cupshaped: 6.60%, mushroom: 34.51%, stubby: 26.53%, thin: 23.16%, filopodium: 9.2%). The reduction in mature spines and increase in immature spine type due to miR-135a overexpression was normalized to control levels when miR-135a was co-expressed with Mef2 (cupshaped: 5.49%, mushroom: 32.77%, stubby: 25.00%, thin: 21.12%, filopodium: 15.63%) (FIG. 17F). Thus, increased expression of miR-135a leads to a MEF2-dependent increase in spine number and type.

(169) To examine whether miR-135a could interact in TLE we tested Mef2a expression in mouse and human TLE hippocampus. In line with our model, Mef2a protein expression was significantly reduced in the hippocampus of D14 IAK mice (FIG. 17G-H) and a weaker immunosignals were observed (FIG. 17I). Similarly, in patients with mTLE, MEF2A expression was strongly reduced in mTLE+HS hippocampal samples compared to controls (FIG. 17J-K), and weaker immunostaining was observed in mTLE+HS condition compared to controls in the dentate gyrus and CA region (FIG. 17L). Finally, blocking miR-135a in vivo using antagomirs resulted in increased Mef2a expression, as detected by immunohistochemistry (FIG. 17M). Together, these results show that the increased expression of miR-135a in hippocampal neurons in mTLE leads to decreased MEF2A levels. Loss of MEF2 in mTLE leads to abnormal spine formation and thereby contributes to aberrant firing patterns and cell death observed in epilepsy.

(170) TABLE-US-00018 TABLE 11 pre-miRNA qPCR primer sequences (pre-miR-135a1 and a2) were designed with Primer3 software. Similarly, for validation of bio-IP targets primer sequences per target are shown below. Pre-mir primers Gene Species Sequence SEQ ID NO Pre-miR-135a1 Human Forward TCGCTGTTCTCTATGGCTTTT 355 Reverse CGGCTCCAATCCCTATATGA 356 Pre-miR-135a2 Human Forward TGCTTTATGGCTTTTTATTCCT 357 Reverse TGGCTTCCATCCCTACATGA 358 Pre-miR-135a1 Mice Forward GCCTCACTGTTCTCTATGGCTTT 359 Reverse CCACGGCTCCAATCCCTATATGA 360 Pre-miR-135a2 Mice Forward TGCTTTATGGCTTTTTATTC 361 Reverse CATCCCTACATGAGACTTTATT 362 GAPDH Human Forward TGGAAGGACTCATGACCACA 363 Reverse GGGATGATGTTCTGGAGAGC 364 Beta-actin Mice Forward AGCCATGTACGTAGCCATCC 365 Reverse CTCTCAGCTGTGGTGGTGAA 366 Bio-IP targets mouse primers Gene Sequence SEQ ID NO GR Forward GGGGAAGCGTGATGGACTTG 367 Reverse CAGCAGCCACTGAGGGTGAA 368 KLF6 Forward GAGTTCCTCCGTCATTTCCA 369 Reverse GTCGCCATTACCCTTGTCAC 370 Mef2a Forward AGCAGCACCATCTAGGACAA 371 Reverse CTGCTGTTGGAAGCCTGATG 372 Mtss1 Forward ACAGCACCCAGACCACCACC 373 Reverse TGCCTCCTGGTCGCCACTTA 374 PlxnA4 Forward TCTCAGTACAACGTGCTG 375 Reverse TAGCACTGGATCTGATTGC 376 Slit2 Forward CAGTCATTCATGGCTCCCTC 377 Reverse TTCCCTCGGCAGTCTACAAT 378 Tsc1 Forward CAGGAGTTACAGACAAAGCTGG 379 Reverse AGCTTCTGAGAGACCTGGCT 380

REFERENCE LIST

(171) Adams R. H. and Alitalo K. Nat Rev Mol Cell Biol 8(6):464-478, 2007. Aksoy-Aksel A, Zampa F, Schratt G (2014) Philos Trans R Soc Lond B Biol Sci 369:20130515-20130515—rstb.royalsocietypublishing.org/cgi/doi/10.1098/rstb.2013.0515 Anand S., Majeti B. K., Acevedo L. M., et al., Nat Med 16(8):909-914, 2010. Apara A, Goldberg J L (2014) Neural Regen Res 9:1418-1421 Available at: www.nrronline.org/text.asp?2014/9/15/1418/139454 Aravin, A. & Tuschl, T. FEBS Lett 579:5830-40, 2005. Asahara T., Masuda H., Takahashi T., Kalka C., Pastore C., Silver M., Kearne M., Magner M. and Isner J. M. Circ Res 85(3):221-228, 1999. Baldwin K T, Giger R J (2015) Front Mol Neurosci 8:23 Available at: www.ncbi.nlm.nih.gov/pubmed/26113809 van Battum E Y, Gunput R-AF, Lemstra S, et al., (2014) Nat Commun 5:4317 Available at: www.ncbi.nlm.nih.gov/pubmed/25007825 Baudet M-L, Bellon A, Holt C E (2013) Semin Cell Dev Biol 24:146-155 Available at: www.ncbi.nlm.nih.gov/pubmed/23219835 Beijnum, J. R., Rousch, M., Castermans, K., van der Linden, E & Griffioen, A W. Nature Protocols 3(6):1085-1091, 2008. Berezikov, E., Cuppen, E., and Plasterk, R. H. Nat Genet 38 Suppl, S2-7, 2006. Berezikov, E., Liu, N., Flynt, A. S., Hodges, E., Rooks, M., Hannon, G. J., and Lai, E. C. Nat Genet 42:6-9; author reply 9-10, 2010. Berezikov, E. et al. Genome Res 21:203-215, 2011. Blackmore M G, Moore D L, et al., (2010) Mol Cell Neurosci 44:43-54 Available at: linkinghub.elsevier.com/retrieve/pii/S1044743110000254 Bodles-Brakhop A M, Heller R and Draghia-Akli R. Current Clinical Developments. Molecular Therapy vol. 17 no. 4:585-592, apr. 2009 Bonnet, E., Wuyts, J., Rouze, P. and Van De, P. e. Y. Bioinformatics 20:2911-2917, 2004. Carmeliet P. Nature 438(7070):932-936, 2005. Carmeliet P. Nat Med 6(4):389-395, 2000. Carmeliet P. and Jain R. K. Nature 407(6801):249-257, 2000. Caronia-Brown G, Anderegg A, Awatramani R (2016) Neural Dev 11:9 Available at: neuraldevelopment.biomedcentral.com/articles/10.1186/s13064-016-0065-y Chang, B. S., and Lowenstein, D. H. (2003). Epilepsy. N. Engl. J. Med. 349, 1257-1266. Chang T. C. and Mendell J. T. Annu Rev Genomics Hum Genet 8:215-239, 2007. Chen C. Z., Li L., Lodish H. F. and Bartel D. P. Science 303(5654):83-86, 2004. Creighton, C J., et al., Briefings in Bioinformatics. VOL 10. NO 5:490-497, 2009. Czech, M. P. (2006). N. Engl. J. Med. 354, 1194-1195. Daud, A. I. et al., Journal of clinical oncology 26(36):5896-903, 2008. Dickendesher T L, Baldwin K T, et al., (2012) Nat Neurosci 15:703-712 Available at: www.pubmedcentral.nih.gov/articlerenderfcgi?artid=3337880&tool=pmcentrez&rendertype=abstract Ebert, M. S., and Sharp, P. A. (2012). Cell 149, 515-524. Enciu, A et al., BMC Neurology, 2011, 11:75, DOI: 10.1186/1471-2377-11-75 Engel, J., Jr. (2001). Epilepsia 42 Suppl 6, 3. van Erp S, van den Heuvel D M A, et al., (2015) Dev Cell 35:537-552 Available at: www.ncbi.nlm.nih.gov/pubmed/26651291 Fang J, Shaw P X, Wang Y, Goldberg J L (2016) eNeuro 3 Available at: www.ncbi.nlm.nih.gov/pubmed/27022622 Fish J. E., Santoro M. M., Morton S. U., Yu S., Yeh R. F., Wythe J. D., Ivey K. N., Bruneau B. G., Stainier D. Y. and Srivastava D. Dev Cell 15(2):272-284, 2008. Flavell, S. W., Cowan, C. W., Kim, T. K., Greer, P. L., Lin, Y., Paradis, S., Griffith, E. C., Hu, L. S., Chen, C., and Greenberg, M. E. (2006). Science 311, 1008-1012. Flavell, S. W., Kim, T. K., et al., (2008). Neuron 60, 1022-1038. Folkman J. N Engl J Med. 285, 21:1182-1186, 1971. Folkman J. Nat Med 1(1):27-31, 1995. Folkman J. Nat Rev Drug Discov 6(4):273-286, 2007. Folkman J. Semin Oncol 29(6 Suppl 16):15-18, 2002. Gamier B. et al., bioconj. chem., 2009, 11:2114-22 van Gassen, K. L., de Wit, M., Koerkamp, M. J., Rensen, M. G., van Rijen, P. C., Holstege, F. C., Lindhout, D., and de Graan, P. N. (2008). Epilepsia 49, 1055-1065. Gaudet A D, Mandrekar-Colucci S, Hall J C E, et al., (2016) J Neurosci 36:8516-8532 Available at: www.ncbi.nlm.nih.gov/pubmed/27511021 Gorter, J. A., Iyer, A., White, I., et al., (2014). Neurobiol Dis 62, 508-520. Gorter, J. A., van Vliet, E. A., et al., (2006). J Neurosci 26, 11083-11110. Griffioen A. W. and Molema G. Pharmacol Rev 52(2):237-268, 2000. Gross, C., Yao, X., Engel, T., et al., (2016). Cell Rep 17, 37-45. Hanahan D. and Folkman J. Cell 86(3):353-364, 1996. Hancock M L, Preitner N, Quan J, Flanagan J G (2014) J Neurosci 34:66-78 Available at: www.jneurosci.org/cgi/doi/10.1523/JNEUROSCI.3371-13.2014 Harris T. A., Yamakuchi M., et al., Proc Natl Acad Sci USA 105(5):1516-1521, 2008. He Z, Jin Y (2016) Neuron 90:437-451 Available at: www.ncbi.nlm.nih.gov/pubmed/27151637 Helisch A. and Schaper W. Microcirculation 10(1):83-97, 2003. Henshall, D. C., Hamer, H. M., et al., (2016). Lancet Neurol. 15, 1368-1376. Heusschen R. et al., iochim Biophys Acta. 1805, 1:87-96, 2010 Hofacker, I. L. Nucleic Acids Res 31:3429-31, 2003. Kuehbacher A., Urbich C., Zeiher A. M. and Dimmeler S. Circ Res 101(1):59-68, 2007. Hu Y-W, Jiang J-J, Yan-Gao, Wang R-Y, Tu G-J (2016) Neurosci Lett 622:61-66 Available at: www.ncbi.nlm.nih.gov/pubmed/27102143 Hu Z, Yu D, Gu Q, Yang Y, Tu K, Zhu J, Li Z (2014) Nat Commun 5:3263 Available at: www.nature.com/doifinder/10.1038/ncomms4263 Issler O, Haramati S, Paul E D, et al., (2014) Neuron 83:344-360 Available at: linkinghub.elsevier.com/retrieve/pii/S0896627314004863 Jiang J-J, Liu C-M, Zhang B-Y, Wang X-W, et al., (2015) Cell Death Dis 6:e1865 Available at: www.ncbi.nlm.nih.gov/pubmed/26313916 Jimenez-Mateos, E. M., Engel, T., et al., (2012). Nat Med 18, 1087-1094. Jimenez-Mateos, E. M., and Henshall, D. C. (2013). Neuroscience 238, 218-229. Kan A A, van Erp S, Derijck AAHA, de Wit M, et al., (2012) Cell Mol Life Sci 69:3127-3145 Available at: www.ncbi.nlm.nih.gov/pubmed/22535415 Khatri R, Subramanian S (2013) Front Oncol 3:268 Available at: journal.frontiersin.org/article/10.3389/fonc.2013.00268/abstract Kosik, K. S. (2006). Nat. Rev. Neurosci. 7, 911-920. Kraev et al, PLoS ONE, 10 Aug. 2011, Vol 6, Issue 8, DOI: 10.1371/journal.pone.0023433 Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T (2001) Science (80-) 294:853-858 Available at: www.ncbi.nlm.nih.gov/pubmed/11679670 Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T (2002) Curr Biol 12:735-739 Available at: www.ncbi.nlm.nih.gov/pubmed/12007417 Li P, Teng Z-Q, Liu C-M (2016) Neural Plast 2016:1-11 Available at: www.ncbi.nlm.nih.gov/pubmed/27818801 Lin C-W, Chang Y-L, Chang Y-C, et al., (2013) Nat Commun 4:1877 Available at: www.nature.com/doifinder/10.1038/ncomms2876 Lin L, et al., (2016) Curr Vasc Pharmacol 14:211-218 www.ncbi.nlm.nih.gov/pubmed/26202084. Linsen, SEV., de Wit, E., de Bruijn, E.& Cuppen, E. BMC Genomics 11:249, 2010. Loscher, W., Klitgaard, H., et al., (2013). Nat. Rev. Drug Discov. 12, 757-776. Martirosyan N L, Carotenuto A, Patel A A, et al., (2016) Front Surg 3:56 Available at: www.ncbi.nlm.nih.gov/pubmed/27878119 Miki K., Miki A., et al., Ophthalmology 116(9):1748-1754, September 2009. Moore D L, Blackmore M G, et al., (2009) Science 326:298-301 Available at: www.sciencernag.org/cgi/doi/10.1126/science.1175737 Moritoki Y, Hayashi Y, Mizuno K, et al., (2014) J Urol 191:1174-1180 Available at: linkinghub.elsevier.com/retrieve/pii/S002253471305876X Moshe, S. L., Perucca, E., Ryvlin, P., and Tomson, T. (2015). Lancet 385, 884-898. Mouri, G., et al., (2008). Brain Res 1213, 140-151. Nagel R, le Sage C, et al., (2008) Cancer Res 68:5795-5802 Available at: cancerres.aacrjournals.org/cgi/doi/10.1158/0008-5472.CAN-08-0951 Obad, S., dos Santos, C. O. et al. Nature Genetics 43,371-378, 2011. Obernosterer, G., Martinez, J., and Alenius, M. (2007). Nat. Protoc. 2, 1508-1514. Phay M, Kim H H, Yoo S (2015) Sciatic Nerve Di Giovanni S, ed. PLoS One 10:e0137461 Available at: www.ncbi.nlm.nih.gov/pubmed/26331719 Pitkanen, A., and Lukasiuk, K. (2009). Epilepsy Behay. 14 Suppl 1, 16-25. Podolska et al., PLoS One. 2011 Jan. 6;6(1):e14494, doi: 10.1371/journal.pone.0014494 Poell J B, van Haastert R J, Cerisoli F, et al., (2011) BMC Genomics 12:546 Available at: bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-12-546 Poliseno L., Tuccoli A., Mariani L., Evangelista M., Citti L., Woods K., Mercatanti A., Hammond S. and Rainaldi G. Blood 108(9):3068-3071, 2006. Poy M. N., Eliasson L., Krutzfeldt J., Kuwajima S., Ma X., Macdonald P. E., Pfeffer S., Tuschl T., Rajewsky N., Rorsman P. and Stoffel M. Nature 432(7014):226-230, 2004. Qin S, Liu M, Niu W, Zhang C-L (2011) Proc Natl Acad Sci 108:21117-21121 Available at: www.ncbi.nlm.nih.gov/pubmed/22160720 Qin S, Zhang C-L (2012) Mol Cell Biol 32:4297-4305 Available at: mcb.asm.org/cgi/doi/10.1128/MCB.00838-12 Qin S, Zou Y, Zhang C-L (2013) Nat Commun 4:2633 Available at: www.ncbi.nlm.nih.gov/pubmed/24129709 Rakhade, S. N., and Jensen, F. E. (2009). Nat. Rev. Neurol. 5, 380-391. Ren J-W, Li Z-J, Tu C (2015) Int J Clin Exp Pathol 8:6356-6366 Available at: www.ncbi.nlm.nih.gov/pubmed/26261511 Ribatti D., Vacca A. and Presta M. Gen Pharmacol 35(5):227-231, 2000. van Rooij E., et al., Science 316(5824):575-579, 2007. Rossi M, Kilpinen H, Muona M, et al., (2014) Eur J Hum Genet 22:840-843 Available at: www.nature.com/doifinder/10.1038/ejhg.2013.246 le Sage C. et al. EMBO J 26(15):3699-3708, 2007. Semah, F., Picot, M. C., et al., (1998). Neurology 51, 1256-1262. Sempere L F, Freemantle S, et al., (2004) Genome Biol 5:R13 Available at: genomebiology.biomedcentral.com/articles/10.1186/gb-2004-5-3-r13 Shen et al. Gene therapy 13:225-234, 2006. Shi H, Ji Y, Zhang D, Liu Y, Fang P (2015) Biochem Biophys Res Commun 465:125-130 Available at: linkinghub.elsevier.com/retrieve/pii/S0006291X15303466 Song Y, Ori-McKenney K M, Zheng Y, Han C, Jan L Y, Jan Y N (2012) Genes Dev 26:1612-1625 Available at: www.ncbi.nlm.nih.gov/pubmed/22759636 Steffen P., Voss B., Rehmsmeier M., Reeder J., Giegerich R. Bioinformatics, 22:500-503, 2006 Steketee M B, Oboudiyat C, Daneman R, et al., (2014) Investig Opthalmology Vis Sci 55:4369 Available at: iovs.arvojournals.org/article.aspx?doi=10.1167/iovs.14-13882 Suarez Y., Fernandez-Hernando C., et al., Circ Res 100(8):1164-1173, 2007. Tan, C. L., Plotkin, J. L., Veno, M. T., et al. (2013). Science 342, 1254-1258. Vader P, van der Meel R, Symons M H, et al., Angiogenesis. 2011 December; 14(4):457-66, 2011. Valeri N et al. (2014) Cancer Cell 25:469-483 Available at: linkinghub.elsevier.com/retrieve/pii/S1535610814001159 Wang S. et al., Dev Cell 15(2):261-271, 2008. Weitz A C, Behrend M R, et al., (2013) J Neurophysiol 109:1979-1988 Available at: www.ncbi.nlm.nih.gov/pubmed/23343890 Wieser, H. G., and Epilepsy, I. C. o. N. o. (2004). Epilepsia 45, 695-714. de Wit, E., Linsen, S. E., Cuppen, E., and Berezikov, E. Genome Res 19:2064-2074, 2009. Wu C W, Ng S C, Dong Y, Tian L, Ng S S M, et al., (2014) IClin Cancer Res 20:2994-3002 Available at: www.ncbi.nlm.nih.gov/pubmed/24691020 Wu D, Raafat A, Pak E, Clemens S, Murashov A K (2012) Exp Neurol 233:555-565 Available at: linkinghub.elsevier.com/retrieve/pii/S0014488611004456 Xiao F, Zuo Z, Cai G, Kang S, Gao X, Li T (2009) Nucleic Acids Res 37:D105-10 Available at: academic.oup.com/nadarticle-lookup/doi/10.1093/nar/gkn851 Yang X, Wang X, Nie F, Liu T, Yu X, Wang H, Li Q, Peng R, Mao Z, Zhou Q, Li G (2015) Int J Mol Med Available at: www.spandidos-publications.com/10.3892/ijrnrn.2015.2259 Yao S, et al., (2016) Oncotarget 7:42566-42578 Available at: www.oncotarget.com/abstract/9934 Yau K W, van Beuningen S F B, Cunha-Ferreira I, et al., (2014) Neuron 82:1058-1073 Available at: linkinghub.elsevier.com/retrieve/pii/S089662731400333X Yoon H S and Yang V W (2004). J. Biol. Chem. 279 (6): 5035-41. doi:10.1074/jbc.M307631200 Zhang Y K, Sun B, Sui G (2016) Genet Mol Res 15 www.ncbi.nlm.nih.gov/pubmed/27525941 Ziats M N, Rennert O M (2014) Mol Psychiatry 19 www.nature.com/doifinder/10.1038/mp.2013.93 Zou Y, et al., (2013) Science (80-) 340:372-376 www.ncbi.nlm.nih.gov/pubmed/23599497 Aliashkevich, A. F. et al., Acta Neuropathol. 106, 99-106. https://doi.org/10.1007/s00401-003-0707-0 Anders, S., et al., 2015. Bioinformatics 31, 166-169. https://doi.org/10.1093/bioinforrnatics/btu638 Bienvenu, T. et al., 2013. Neurogenetics 14, 71-75. https://doi.org/10.1007/s10048-012-0344-7 Brennecke, J. et al., 2005. PLoS Biol. 3, 0404-0418. https://doi.org/10.1371/journal.pbio.0030085 Dang, Z., et al., 2014. Int. J. Biol. Sci. 10, 733-745. https://doi.org/10.7150/ijbs.8097 Fiore, R., et al., 2009. EMBO J. 28, 697-710. https://doi.org/10.1038/emboj.2009.10 Flavell, S. W., et al., 2006. Science 311, 1008-1012. https://doi.org/10.1126/science.1122511 Gibbs, S., Chattopadhyaya, B., Desgent, S., et al., 2011. Neurobiol. Dis. 43, 312-321. https://doi.org/10.1016/j.nbd.2011.02.013 Guo, D., Arnspiger, S., Rensing, N. R., Wong, M., 2012. Neurobiol. Dis. 45, 348-355. https://doi.org/10.1016/j.nbd.2011.08.020 Höck, J., Meister, G., 2008. The Argonaute protein family. Genome Biol. 9. https://doi.org/10.1186/gb-2008-9-2-210 Huang, Y., Wu, X., Guo, J., Yuan, J., 2016. Int. J. Neurosci. 126, 786-796. https://doi.org/10.3109/00207454.2015.1062003 Isokawa, M., 1998. Neurosci. Lett. 258, 73-76. https://doi.org/10.1016/S0304-3940(98)00848-9 Jimenez-Mateos, E. M., et al., 2012. Nat. Med. 18, 1087-1094. https://doi.org/10.1038/nm.2834 Kim, D., et al., 2013. Genome Biol. https://doi.org/10.1186/gb-2013-14-4-r36 Krek, A., et al., 2005. Nat. Genet. 37, 495-500. https://doi.org/10.1038/ng1536 Lewis, B. P., et al., 2005. Cell 120, 15-20. https://doi.org/10.1016/j.cell.2004.12.035 Lyons, G. E., et al., 1995. J. Neurosci. 15, 5727-38. Multani, P., et al., 1994. Epilepsia. https://doi.org/10.1111/j.1528-1157.1994.tb02503.x Nowakowska, B. A., et al., 2010. Am. J. Med. Genet. Part B Neuropsychiatr. Genet. 153, 1042-1051. https://doi.org/10.1002/ajmg.b.31071 Patro, R., Mount, S. M., Kingsford, C., 2014. Nat. Biotechnol. https://doi.org/10.1038/nbt.2862 Reschke, C. R., Silva, L. F. A., et al., 2017. Mol. Ther.—Nucleic Acids 6, 45-56. https://doi.org/10.1016/j.omtn.2016.11.002 Robinson, M., McCarthy, D., Smyth, G., 2010. https://doi.org/10.1093/bioinformatics/btp616 Robinson, M. D., Oshlack, A., 2010. Genome Biol. https://doi.org/10.1186/gb-2010-11-3-r25 Wani, S., Cloonan, N., 2014. bioRxiv 0-11. https://doi.org/10.1101/005439 Xiang, H., et al., 2017. Int. J. Mol. Sci. 18, 1-17. https://doi.org/10.3390/ijrns18071367 Young, M. D., et al., 2010 Genome Biol. https://doi.org/10.1186/gb-2010-11-2-r14 Zhao, X., et al., 2017 Cancer Biomarkers. https://doi.org/10.3233/CBM-170566 Zhou, W., et al. 2012. Acta Biochim Biophys Sin https://doi.org/10.1093/abbs/gms071.Original