PROCESS AND COMPOSITIONS FOR ENHANCING ENERGY EXPENDITURE

20240299482 ยท 2024-09-12

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention discloses a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising piceatannol, scirpusin B, scirpusin A, cyperusphenol A and cyperusphenol B, standardized to contain 6-10% w/w total stilbenes and a process of preparing the composition thereof. The invention also discloses the use of the above mentioned composition in enhancing energy expenditure in mammalian adipose cellular systems by the conversion of white adipose tissues to brown adipose tissues, inhibition of adipogenesis and for preventing weight gain in mammals.

    Claims

    1. A composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A, Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes.

    2. The composition as in claim 1, wherein the Cyperus rotundus extract is standardized to contain 0.1-5% total stilbenes and Passiflora edulis extract is standardized to contain 15-25% total stilbenes.

    3. The composition as in claim 1, wherein the Cyperus rotundus extract and Passiflora edulis extract are in the ratios ranging from 1:5 to 5:1.

    4. The composition as in claim 1, wherein the Cyperusphenol A include both the meso and dl isomers.

    5. The composition as in claim 1, wherein the composition comprising Cyperus rotundus extract and Passiflora edulis extract is obtained by the process comprising steps of: a) Powdering tubers of Cyperus rotundus into a fine mesh; b) Refluxing with 4 volumes of methanol and heating at 65-70? C. for 3-4 hours and filtering the solution to obtain a clear extract; c) Repeating the process of step b) twice and combining the three extracts; d) Concentrating the extract of step c) to obtain as extract containing 0.1-5% total stilbenes; e) Powdering seeds of Passiflora edulis into a fine mesh: f) Refluxing with 4 volumes of hexane and heating at 65-70? C. for 3-4 hours and filtering the solution; g) Repeating the process of step f) twice and combining the three hexane extracts; h) Concentrating the combined extract of step g) by distilling the solvent to obtain a clear Marc; i) Adding 4 volumes of ethanol to the Marc of step h) and heating at 70-75? C. and filtering; j) Repeating the process of step i) twice and combining the three ethanol extracts to obtain a clear ethanol extract of the Passiflora edulis seeds; k) Dissolving the ethanol extract of step j) in 6 volumes of water; l) Charging with 6 volumes of ethyl acetate and stirring for 5 minutes and allowing to settle for 1 hour; m) Collecting the ethyl acetate layer and washing with water; n) Repeating the process of steps 1) and m) two more times and combining all ethyl acetate layers; o) Concentrating the ethyl acetate layer by heating at 65-75? C. to obtain Passiflora edulis seed extract containing 15-25% total stilbenes; p) Mixing the Cyperus rotundus extract and Passiflora edulis seed extract in the ratios of 1:5, 2:4, 3:3, 4:2, 2:1 and 5:1 respectively to obtain a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes.

    6. The composition as in claim 1, wherein the composition is formulated with pharmaceutically/nutraceutically acceptable excipients, adjuvants, diluents or carriers and administered orally in the form of tablets, capsules, syrups, gummies, powders, suspensions, emulsions, chewables, candies and eatables.

    Description

    DESCRIPTION OF DRAWINGS

    [0024] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the office upon request and payment of the necessary fec.

    [0025] FIG. 1A is a graphical representation showing the increase in expression of genes related to brown fat conversion in mouse 3T3-L1 pre-adipocytes administered with composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes at 3.125 ?g/ml.

    [0026] FIG. 1B is a graphical representation showing the increase in expression of genes related to brown fat conversion in mouse 3T3-L1 pre-adipocytes administered with composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes at 6.25 ?g/ml.

    [0027] FIG. 2A is the oil-O-red staining of adipocytes indicating a dose dependent reduction in lipid accumulation in adipocytes by comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes.

    [0028] FIG. 2B is the graphical representation of the percentage inhibition of adipogenesis by composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes.

    [0029] FIG. 3 is a graphical representation showing the weight gain in animals administered with different concentrations of composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenesover a period of 120 days.

    [0030] FIG. 4 is a graphical representation showing the change in weight of animals administered with different concentrations of composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenesover a period of 120 days.

    DESCRIPTION OF PREFERRED EMBODIMENTS

    [0031] In a most preferred embodiment, the invention discloses a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A, Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes. In another related embodiment, the Cyperus rotundus extract is standardized to contain 0.1-5% total stilbenes and Passiflora edulis extract is standardized to contain 15-25% total stilbenes. In a related embodiment, the Cyperus rotundus extract and Passiflora edulis extract are in the ratios ranging from 1:5 to 5:1. In a related embodiment, Cyperusphenol A include both the meso and dl isomers since these co-occur in Cyperus rotundus as described by T Ito, H Endo, H Shinohara, M Oyama, Y Akao and M Iinuma, Fitoterapia 83, 1420-1429 (2012)

    [0032] In another preferred embodiment, the composition comprising Cyperus rotundus extract and Passiflora edulis extract is obtained by the process comprising steps of [0033] a) Powdering tubers of Cyperus rotundus into a fine mesh [0034] b) Refluxing with 4 volumes of methanol and heating at 65-70? C. for 3-4 hours and filtering the solution to obtain a clear extract; [0035] c) Repeating the process of step b) twice and combining the three extracts; [0036] d) Concentrating the extract of step c) to obtain as extract containing 0.1-5% total stilbenes. [0037] e) Powdering seeds of Passiflora edulis into a fine mesh [0038] f) Refluxing with 4 volumes of hexane and heating at 65-70? C. for 3-4 hours and filtering the solution; [0039] g) Repeating the process of step f) twice and combining the three hexane extracts; [0040] h) Concentrating the combined extract of step g) by distilling the solvent to obtain a clear Marc; [0041] i) Adding 4 volumes of ethanol to the Marc of step h) and heating at 70-75? C. and filtering; [0042] j) Repeating the process of step i) twice and combining the three ethanol extracts to obtain a clear ethanol extract of the Passiflora edulis seeds; [0043] k) Dissolving the ethanol extract of step j) in 6 volumes of water; [0044] l) Charging with 6 volumes of ethyl acetate and stirring for 5 minutes and allowing to settle for 1 hour; [0045] m) Collecting the ethyl acetate layer and washing with water; [0046] n) Repeating the process of steps 1) and m) two more times and combining all ethyl acetate layers; [0047] o) Concentrating the ethyl acetate layer by heating at 65-75? C. to obtain Passiflora edulis seed extract containing 15-25% total stilbenes. [0048] p) Mixing the Cyperus rotundus extract and Passiflora edulis seed extract in the ratios of 1:5, 2:4, 3:3, 4:2, 2:1 and 5:1 respectively to obtain a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes.

    [0049] In another related embodiment, the composition is formulated with pharmaceutically/nutraceutically acceptable excipients, adjuvants, diluents or carriers and administered orally in the form of tablets, capsules, syrups, gummies, powders, suspensions, emulsions, chewables, candies and eatables.

    [0050] In a preferred embodiment, the invention discloses a method of enhancing energy expenditure in mammalian adipose cellular systems, said method comprising: step of bringing into contact mammalian pre-adipocytes or adipocytes into contact with a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes to achieve effects of (a) increased expression of genes and proteins that function individually or in combination to specifically recruit brown adipocytes or beige or brite adipocytes, (b) induce brown or beige or brite like phenotype in white adipocyte depots, (c) induce enhanced expression of mitochondrial uncoupling protein-1 to result in increased mitochondrial thermogenesis in differentiated brown adipocytes and beige or brite adipocytes. In a related embodiment, the genes and proteins are at least one factor selected from the group consisting of comprising PRDM16, PGC-1? and BMP7. In a related embodiment, enhancing energy expenditure is essential in conditions selected from the group consisting of, but not limited to, obesity, metabolic disorders, diabetes, cold thermogenesis and sports endurance

    [0051] In another preferred embodiment, the invention discloses a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A CyperusphenolCyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes for use in enhancing energy expenditure in mammalian preadipocytes or adipocytes by administering in effective amounts targeted towards mammalian pre-adipocytes to bring about the effects of (a) increased expression of genes and proteins that function individually or in combination to specifically recruit brown adipocytes or beige or brite adipocytes, (b) induce brown or beige or brite like phenotype in white adipocyte depots, (c) induce enhanced expression of mitochondrial uncoupling protein-1 to result in increased mitochondrial thermogenesis in differentiated brown adipocytes and beige or brite adipocytes. In a related embodiment, the genes and proteins are at least one factor selected from the group consisting of comprising PRDM16, PGC-1? and BMP7. In a related embodiment, enhancing energy expenditure is essential in conditions selected from the group consisting of, but not limited to, obesity, metabolic disorders, diabetes, cold thermogenesis and sports endurance.

    [0052] In a preferred embodiment, the invention discloses a method of inhibition of adipogenesis in mammalian cellular systems, said method comprising step of bringing into contact mammalian adipocytes into contact with a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes to bring about inhibition in adipogenesis.

    [0053] In yet another preferred embodiment, the invention discloses a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes use in inhibiting adipogenesis in mammalian adipocytes.

    [0054] In another preferred embodiment, the invention discloses a method for therapeutic management of obesity in mammals, said the method comprising steps of administering an effective concentration of a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes to said mammals to bring about prevention in weight gain.

    [0055] In another preferred embodiment, the invention discloses a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes for preventing weight gain in mammals. In another related embodiment, the composition is formulated with pharmaceutically/nutraceutically acceptable excipients, adjuvants, diluents or carriers and administered orally in the form of tablets, capsules, syrups, gummies, powders, suspensions, emulsions, chewables, candies and eatables.

    [0056] The aforesaid most preferred embodiments incorporating the technical features and technical effects of instant invention, are explained through illustrative examples herein under.

    Example 1: Isolation and Formulation of Composition

    [0057] The composition comprising Cyperus rotundus extract and Passiflora edulis extract is obtained by the process comprising steps of [0058] a) Powdering tubers of Cyperus rotundus into a fine mesh [0059] b) Refluxing with 4 volumes of methanol and heating at 65-70? C. for 3-4 hours and filtering the solution to obtain a clear extract; [0060] c) Repeating the process of step b) twice and combining the three extracts; [0061] d) Concentrating the extract of step c) to obtain as extract containing 0.1-5% total stilbenes. [0062] e) Powdering seeds of Passiflora edulis into a fine mesh [0063] f) Refluxing with 4 volumes of hexane and heating at 65-70? C. for 3-4 hours and filtering the solution; [0064] g) Repeating the process of step f) twice and combining the three hexane extracts; [0065] h) Concentrating the combined extract of step g) by distilling the solvent to obtain a clear Marc; [0066] i) Adding 4 volumes of ethanol to the Marc of step h) and heating at 70-75? C. and filtering; [0067] j) Repeating the process of step i) twice and combining the three ethanol extracts to obtain a clear ethanol extract of the Passiflora edulis seeds; [0068] k) Dissolving the ethanol extract of step j) in 6 volumes of water; [0069] l) Charging with 6 volumes of ethyl acetate and stirring for 5 minutes and allowing to settle for 1 hour; [0070] m) Collecting the ethyl acetate layer and washing with water; [0071] n) Repeating the process of steps 1) and m) two more times and combining all ethyl acetate layers; [0072] o) Concentrating the ethyl acetate layer by heating at 65-75? C. to obtain Passiflora edulis seed extract containing 15-25% total stilbenes. [0073] p) Mixing the Cyperus rotundus extract and Passiflora edulis seed extract in the ratios of 1:5, 2:4, 3:3, 4:2, 2:1 and 5:1 respectively to obtain a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes.

    [0074] As an illustrative example, the Cyperus rotundus extract and Passiflora edulis seed extract are mixed in the ratios of 2:1 respectively to obtain a composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piccatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 7% w/w total stilbenes. The Cyperus rotundus extract and Passiflora edulis seed extract are also mixed in the above mentioned ratios along with pharmaceutically/nutraceutically acceptable excipients, adjuvants, diluents or carriers in a way that the final formulation is standardized to contain 6-10% w/w total stilbenes.

    Example 2: Adipogenesis Inhibition and Brown Fat Specific Gene Expression by Cyperus rotundus Extract and Passiflora edulis Extract in Cultured 3T3L1

    Cell Culture

    [0075] Mouse 3T3-L1 mouse embryo fibroblasts (American Type Culture Collection (ATCC, Rockville, MD, USA) were cultured in DMEM containing 25 mM glucose with 10% heat-inactivated fetal calf serum with antibiotics at 37? C. and 5% CO2. When the cells were 70-80% confluent, they were trypsinized, washed and seeded in 6 well plates at a density of 2?10.sup.6 cells per well. Cells were induced to differentiate 2 d after reaching confluence (day 0), by supplementing DMEM media containing 10% Fetal Bovine Serum (FBS) along with 1 ?g/mL insulin, 0.25 ?M dexamethasone, 0.5 mM 1-methyl-3-isobutyl-xanthine (IBMX) and different concentrations of Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes (Composition 1with tradename CIRPUSINS?) or Cyperus extract standardized to contain 3-5% w/w total stilbenes (Composition 2-CRE) at different concentrations. The composition comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes is trademarked as CIRCPUSINS?. From day 3 until day 7, cells were maintained in progression media supplemented with 1 ?g/mL insulin and different concentrations of the composition comprising CIRPUSINS?, compared to Composition 2-CRE. Untreated cells and undifferentiated cells grown in FCS media were taken as A positive and negative controls for the experiment. To study inhibition of adipogenesis, cells were plated in 48 well plate at a density of 10000 cells per well and differentiated as mentioned earlier. Quantification for amount of triglycerides accumulated in adipocytes was done by Oil red O staining Cell viability was measured using sulforhodamine-B (SRB) assay (Orellana & Kasinski, 2016, Assay in Cell Culture to Investigate Cell Proliferation. Bio Protoc. 2016 Nov. 5; 6(21):e1984. doi: 10.21769/BioProtoc.1984.).

    RNA Extraction and qRT-PCR

    [0076] RNA was extracted from 3T3-L1 cells using the trizol method and treated with DNAse to remove any traces of DNA (Au-Tan, Au-Pepin, & Au-Lavoie, 2018). First-strand cDNA was prepared from RNA samples using oligo dT primers and Superscript III reverse transcriptase (cDNA synthesis kit, Invitrogen?). Quantitative real-time PCR (qRT-PCR) was performed with SYBR Green I fluorescent dye using Light cycler 961 according to the manufacturer's instructions (Light Cycler? FastStart DNA Master SYBR Green I, Roche). The ?-actin gene was used as the housekeeping gene. The following primers were used:

    TABLE-US-00001 UCP1 (SEQID:1) F-AGGCTTCCAGTACCATTAGGT (SEQID:2) R-CTGAGTGAGGCAAAGCTGATTT PGC1? (SEQID:3) F-TATGGAGTGACATAGAGTGTGCT (SEQID:4) R-CCACTTCAATCCACCCAGAAAG PRDM16 (SEQID:5) F-CAGCACGGTGAAGCCATTC R-GCGTGCATCCGCTTGTG BMP7 (SEQID:7) F-CCAAAGAACCAAGAGGCCC R-GCTGCTGTTTTCTGCCACACT ?-Actin (SEQID:9) F-GAAGTCCCTCACCCTCCCAA (SEQID:10) R-GGCATGGACGCGACCA

    Gene Expression for Adipocyte Browning

    [0077] The mRNA levels of transcripts associated with energy metabolism (PGC-la), factors causing adipocyte browning (PRDM16), and secretary protein inducing BAT differentiation (BMP7), were assessed in the compositions treated cells compared to control. Fold change in expression was calculated in comparison to untreated differentiated cells, using the DDCT method

    Results

    Gene Expression

    [0078] The fold change in the expression of genes related to BAT, compared between CRE (Cyperus extract) and Cirpusins (Composition of Instant invention) are presented in FIG. 1A (at 3.125 ?g/ml) and 1B (at 6.25 ?g/ml). The results indicated that the fold change in the expression of genes in cells treated with CIRPUSINS was better compared to CRE (Cyperus rotundus extract standardized to contain 3-5% total stilbenes) (TABLE 1), indicating that the composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes, performs better in increased energy expenditure compared to Cyperus rotundus extract standardized to contain 3-5% total stilbenes. Thus, further studies of adipogenesis inhibition and preventing weigh gain in mammals were carried out for the composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes.

    TABLE-US-00002 TABLE 1 Fold Change in expression compared to differentiated and untreated cells Fold Change in expression compared to differentiated and untreated cells Sample Concentration PGC1 (?g/ml) PRDM16 ALPHA UCP 1 BMP 7 CRE 3.125 0.65 14.62 0.53 4.38 6.25 1.73 6.23 2.87 9.71 CIRPUSINS 3.125 1.11 16.17 1.03 5.94 6.25 4.94 5.21 9.35 11.51

    [0079] The composition comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes showed a dose dependant inhibition of adipogenesis (FIGS. 2A and 2B)

    Example 3: Anti-Obesity Studies

    Methods

    [0080]

    TABLE-US-00003 Test system: Animal Species Mice Strain C57 Sex Male Justification for selection of C57 Mice are recommended species species for conducting pharmacological study especially anti-obesity among the rodents and hence Anti-obesity study has been carried out in C57 Mice models. No. of animals/group 8 animals/Group. Body weight range at receipt 15-20 g Age at treatment 6-8 weeks

    [0081] Animals were housed under standard laboratory conditions, air-conditioned with adequate fresh air supply (12-15 Air changes per hour), room temperature 20.2-23.5? C. and relative humidity 58-64% with 12 hours fluorescent light and 12 hours dark cycle. The temperature and relative humidity was recorded once daily. Maximum of four animals were housed in a standard polypropylene cage with stainless steel mesh top grill having facilities for holding food and drinking water in water bottled fitted with stainless steel sipper tube. Clean sterilized paddy husk was provided as bedding material.

    [0082] The animals were fed with Normal diet (Group-I) and High fat diet (Group-II to V) throughout the acclimatization and experimental period. Water was provided along with High Fat Diet to the animals throughout the acclimatization and experimental period. Water from water filter cum purifier was provided in animal feeding bottle with stainless steel sipper tubes.

    Study Groups

    [0083]

    TABLE-US-00004 TABLE 2 Groups for anti-obesity studies Groups Treatment G1 - Control Mice were fed with Normal diet for 120 Days. G2 - HFD Mice were fed with high fat diet for 120 Days. G3 - HFD + Mice were fed with high fat diet for 16 weeks CIRPUSINS were administered with Cyprus extract (50 mg/kg (50 mg/kgbw) for 120 Days. body weight) G4 - HFD + Mice were fed with high fat diet for 16 weeks CIRPUSINS were administered with Cyprus extract (100 mg/kg (100 mg/kgbw) for 120 Days. body weight) GS - HFD + Mice were fed with high fat diet for 16 weeks CIRPUSINS and the mice were administered with Cyprus (200 mg/kg extract (200 mg/kgbw) for 120 Days. body weight)

    [0084] Body weight of the animals was recorded in all the days of experimental period. At the end of the experimental period, the animals were sacrificed by cervical dislocation. Blood was collected, Serum was separated by centrifugation and used for the analysis of biochemical parameters. The organs such as Liver and Fat Pads (Retroperitoneal, Peri-gonadal and Mesenteric) were dissected out and washed in phosphate buffered saline.

    [0085] The following parameters were studied: [0086] 1. Measurement of Body weight [0087] 2. Estimation of Blood Glucose (GOD/POD Method) [0088] 3. Estimation of Uric acid (URICASE/POD Method) [0089] 4. Estimation of AST (Enzyme Kinetic Method) [0090] 5. Estimation of ALT (Enzyme Kinetic Method) [0091] 6. Estimation of Cholesterol (CHOD/POD Method) [0092] 7. Estimation of Triglycerides (GPO/POD Method) [0093] 8. Estimation of HDL Cholesterol (HDL Cholesterol Direct Reagent Kit, Beacon) [0094] 9. Determination of LDL Cholesterol (LDL Cholesterol Direct Reagent Kit, Beacon)

    Results

    [0095] The composition showed a dose dependant decrease in the body weight of the mice (FIG. 3 and FIG. 4). The weight gain induced by high fat diet was significantly reduced by the composition. At the highest dose of 200 mg/kg bw, the reduction was 61.7%

    [0096] Significant reduction in retroperitoneal, perigonadal and mesenteric fat was also observed in the animals treated with the composition.

    TABLE-US-00005 TABLE 3 Visceral fat weights in mice treated with CIRPUSINS Retroperitoneal Perigonadal Mesenteric Fat (g Fat (g Fat (g wet tissue) wet tissue) wet tissue) G1 - Control 0.308 ? 0.01 0.413 ? 0.01 0.350 ? 0.02 G2 - HFD 0.848 ? 0.05 1.208 ? 0.09 0.837 ? 0.01 G3 - HFD + CIRPUSINS 0.817 ? 0.04 1.073 ? 0.03 0.784 ? 0.24 (50 mg/kg body weight) G4 - HFD + CIRPUSINS 0.606 ? 0.06 0.869 ? 0.03 0.595 ? 0.03 (100 mg/kg body weight) G5 - HFD + CIRPUSINS 0.417 ? 0.03 0.557 ? 0.01 0.388 ? 0.01 (200 mg/kg body weight)

    [0097] Among the biochemical parameters, the CIRPUSINS composition improved the lipid profile by decreasing the elevated levels of total cholesterol, LDL and triglycerides and increasing HDL cholesterol (Table 4)

    TABLE-US-00006 TABLE 4 Lipid profile HDL LDL TG Groups Cholesterol (mg/dl) (mg/dl) (mg/dl) G1 - Control 83.88 ? 2.75 64.38 ? 2.92 6.73 ? 0.37 105.63 ? 2.00 G2 - HFD 190.63 ? 2.62 24.38 ? 2.77 76.45 ? 2.69 234.38 ? 2.67 G3 - HFD + 182.13 ? 2.75 26.63 ? 1.69 69.69 ? 3.34 178.25 ? 2.49 CIRPUSINS (50 mg/kg body weight) G4 - HFD + 169.63 ? 2.97 35.25 ? 2.49 43.48 ? 2.02 159.63 ? 2.67 CIRPUSINS (100 mg/kg body weight) G5 - HFD + 94.75 ? 2.82 55.50 ? 2.56 20.08 ? 0.67 126.38 ? 2.62 CIRPUSINS (200 mg/kg body weight)

    [0098] The composition also improved the elevated levels of glucose, Uric acid, and the liver enzymes (table 5)

    TABLE-US-00007 TABLE 5 Biochemical parameters Glucose Uric Acid Groups (mg/dl) (mg/dl) AST(U/L) ALT(U/L) G1 - Control 89.50 ? 3.82 4.06 ? 0.16 30.50 ? 2.45 25.50 ? 1.51 G2 - HFD 153.13 ? 3.00 5.91 ? 0.24 53.38 ? 3.81 54.25 ? 1.67 G3 - HFD + 148.50 ? 2.45 5.49 ? 0.31 43.25 ? 2.87 48.75 ? 1.04 CIRPUSINS (50 mg/kg body weight) G4 - HFD + 123.00 ? 3.82 5.34 ? 0.27 38.38 ? 2.67 41.25 ? 1.04 CIRPUSINS (100 mg/kg body weight) G5 - HFD + 92.38 ? 3.11 4.63 ? 0.27 31.38 ? 1.06 34.75 ? 1.67 CIRPUSINS (200 mg/kg body weight)

    [0099] Overall, The results suggest that comprising Cyperus rotundus extract and Passiflora edulis extract comprising Piceatannol, Scirpusin B, Scirpusin A Cyperusphenol A and Cyperusphenol B, standardized to contain 6-10% w/w total stilbenes (CIRPUSINS?) is efficacious in controlling obesity in animals.

    Example 3: Formulations Containing CIRPUSINS?

    [0100] The composition is formulated along with pharmaceutically/nutraceutically acceptable excipients, adjuvants, diluents, stabilizing agents, dispersible gums, bioavailability enhancers or carriers and administered orally in the form of tablets, capsules, syrups, gummies, powders, suspensions, emulsions, chewables, candies or eatables.

    [0101] In a related aspect the bioavailability enhancer is selected from the group of piperine (BioPerine?), quercetin, garlic extract, ginger extract, and naringin. In another related aspect, the stabilizing agent is selected from the group consisting rosmarinic acid, butylated hydroxyanisole, butylated hydroxytoluene, sodium metabisulfite, propyl gallate, cysteine, ascorbic acid and tocopherols. In yet another related aspect, the dispersible gums are selected from the group consisting of Agar, Alginate, Carrageenan, Gum Arabic, Guar Gum, Locust Bean Gum, Konjac Gum, Xanthan Gum and Pectin.

    [0102] Tables 6-10 provide illustrative examples of nutraceutical formulations containing CIRPUSINS

    TABLE-US-00008 TABLE 6 Powder Formulation Active Ingredients CIRPUSINS? Excipients Microcrystalline cellulose, Dextrin

    TABLE-US-00009 TABLE 7 Tablet Active Ingredients CIRPUSINS? Excipients Microcrystalline cellulose, Colloidal silicon dioxide, Magnesium stearate, BioPerine?, Polyvinylpyrrolidone/starch/Hydroxy propyl methyl cellulose, Hydroxy propyl cellulose

    TABLE-US-00010 TABLE 8 Capsule Active Ingredients CIRPUSINS? Excipients Microcrystalline cellulose, BioPerine?

    TABLE-US-00011 TABLE 9 Powder Active Ingredients CIRPUSINS? Excipients BioPerine?, Microcrystalline cellulose, Dextrin

    TABLE-US-00012 TABLE 6 Gummy formulation Active Ingredients CIRPUSINS? Excipients BioPerine?, Gelatin (270 Bloom Mesh 10), Refined Sugar, Glucose Corn Syrup, Citric Acid, Lactic Acid, Water, Natural Mango Flavor M38630, Tartaric Acid, Refined Sugar

    TABLE-US-00013 TABLE 7 Candy formulation Active Ingredients AC3 complex (Curcumin BD3 Complex) Excipients BioPerine?, Sucrose, Liquid Glucose, Flavoring agent, Menthol, Acidulants (Citric acid/Tartaric Acid/Maleic Acid), Purified water

    [0103] The above formulations are merely illustrative examples, any formulation containing the above active ingredient intended for the said purpose will be considered equivalent.

    [0104] Other modifications and variations of the invention will be apparent to those skilled in the art from the foregoing disclosure and teachings. Thus, while only certain embodiments of the invention have been specifically described herein, it will be apparent that numerous modifications may be made thereto without departing from the spirit and scope of the invention and is to be interpreted only in conjunction with the appended claims.

    TABLE-US-00014 SEQUENCELISTING SEQIDNO1:FORWARDPRIMERFORUCP1 AGGCTTCCAGTACCATTAGGT SEQIDNO2:REVERSEPRIMERFORUCP1 CTGAGTGAGGCAAAGCTGATTT SEQIDNO3:FORWARDPRIMERFORPGC1ALPHA TATGGAGTGACATAGAGTGTGCT SEQIDNO4:REVERSEPRIMERFORPGC1ALPHA CCACTTCAATCCACCCAGAAAG SEQIDNO5:FORWARDPRIMERFORPRDM16 CAGCACGGTGAAGCCATTC SEQIDNO6:REVERSEPRIMERFORPRDM16 GCGTGCATCCGCTTGTG SEQIDNO7:FORWARDPRIMERFORBMP7 CCAAAGAACCAAGAGGCCC SEQIDNO8:REVERSEPRIMERFORBMP7 GCTGCTGTTTTCTGCCACACT SEQIDNO9:FORWARDPRIMERFORBETAACTIN GAAGTCCCTCACCCTCCCAA SEQIDNO10:REVERSEPRIMERFORBETAACTIN GGCATGGACGCGACCA