SESAME PLANTS RESISTANT TO ACETOLACTATE SYNTHASE-INHIBITING HERBICIDES, COMPOSITIONS AND METHODS FOR PRODUCING SAME

20240298601 ยท 2024-09-12

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to sesame plants resistant to herbicides that inhibit the plant enzyme acetolactate synthase (ALS), and further to compositions and methods for producing the same.

    Claims

    1. A sesame (Sesamum indicum L.) plant or a part thereof comprising at least one cell comprising a mutant acetolactate synthase encoding polynucleotide (mALS), wherein the mALS encodes a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one acetolactate synthase (ALS)-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein, and wherein the plant is resistant to at least one ALS-inhibiting herbicide.

    2. The sesame plant of claim 1, wherein the mutant ALS (mALS) protein comprises an amino acid other than alanine at position 188 of a protein having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1.

    3. The sesame plant of claim 2, wherein the alanine is substituted by valine (Ala.sub.188Val).

    4. The sesame plant of claim 3, wherein the mALS protein comprises the amino acid sequence set forth in SEQ ID NO:3.

    5. The sesame plant of claim 1, wherein the mALS protein is encoded by a polynucleotide comprising a substituted codon coding for an amino acid other than alanine at positions 562-564, the polynucleotide comprising a nucleic acid sequence having at least 90% identity to the nucleic acid sequence set forth in SEQ ID NO:2.

    6. The sesame plant of claim 5, wherein the substituted codon codes for the amino acid valine.

    7. The sesame plant of claim 6, wherein the polynucleotide comprises the nucleotide thymine (T) at position 563 of a nucleic acid sequence having at least 90% identity to the nucleic acid sequence set forth in SEQ ID NO:2.

    8. The sesame plant of claim 7, wherein the polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:4.

    9. The sesame plant of claim 1, wherein said plant is characterized by indehiscent capsules and wherein the indehiscent capsules are visibly closed when fully ripen.

    10. The sesame plant of claim 1, wherein said plant produces higher seed yield when grown under weed free conditions obtained by applying ALS-inhibiting herbicide compared to when grown under weed free conditions obtained by alternative weed control methods, wherein the herbicide is applied post-emergence.

    11-14. (canceled)

    15. The sesame plant of claim 1, wherein the mALS encoding polynucleotide is an exogenous polynucleotide.

    16-18. (canceled)

    19. The sesame plant of claim 1, wherein the ALS-inhibiting herbicide is of a type selected from the group consisting of herbicidal effective Imidazolinones (IMI), Sulfonylureas (SU), Pyrimidinylthiobenzoates (PTB), Triazolopyrimidines (TP), and Sulfonylaminocarbonyltriazolinone (SCT).

    20-24. (canceled)

    25. A seed of the sesame plant of claim 1, wherein a sesame plant grown from the seed comprises at least one cell comprising a mutant acetolactate synthase encoding gene (mALS), wherein the mALS encodes a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein, and wherein the plant is resistant to at least one ALS-inhibiting herbicide.

    26. An isolated cell or a tissue culture of the sesame plant or part thereof according to claim 1, wherein a sesame plant regenerated from the cell or tissue culture comprises at least one cell comprising a mutant acetolactate synthase encoding gene (mALS), wherein the mALS encodes a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein, and wherein the plant is resistant to at least one ALS-inhibiting herbicide.

    27. A method for producing a sesame plant having tolerance and/or resistance to at least one ALS-inhibiting herbicide, the method comprising introducing at least one mutation in at least one allele of the plant endogenous ALS encoding gene, wherein the at least one mutation results in an encoded ALS protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to an ALS protein encoded by a non-mutated gene, thereby producing sesame plant having tolerance and/or resistance to at least one ALS-inhibiting herbicide.

    28-29. (canceled)

    30. An isolated polynucleotide encoding acetolactate synthase (ALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS protein.

    31. The isolated polynucleotide of claim 30, wherein the encoded ALS protein comprises an amino acid other that alanine at position 188 of a protein having at least 90% identity to the amino acid sequence set forth in SEQ ID NO: 1.

    32-41. (canceled)

    42. A method for producing a sesame plant having tolerance and/or resistance to at least one ALS-inhibiting herbicide, the method comprising introducing into at least one cell of a sesame plant susceptible to ALS-inhibiting herbicide at least one polynucleotide according to claim 30, thereby producing a sesame plant having tolerance and/or resistance to at least one ALS-inhibiting herbicide.

    43. (canceled)

    44. A method for identifying a sesame plant having an enhanced tolerance and/or resistance to at least one type of ALS-inhibiting herbicide, the method comprising detecting, in a genetic material obtained from the plant, the presence of a nucleic acid marker amplified by a pair of primer comprising the nucleic acid sequence set forth in SEQ ID NO:5 and SEQ ID NO:6.

    45. (canceled)

    46. A method for controlling weeds in the vicinity of at least one sesame plant resistant to at least one ALS-inhibiting herbicide according to claim 1, the method comprises applying at least one ALS-inhibiting herbicide to the weeds and said at least one sesame plant in an amount sufficient to inhibit the weed growth.

    47-50. (canceled)

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0070] FIGS. 1A-1D demonstrate the identification and validation of point-mutation in the SiALS gene. FIG. 1A: Genomic sequence of a segment in the SiALS gene. The point mutation and amino acid substation are marked. FIG. 1B: High-resolution melt (HRM) marker for separation between wild-type (S-416), mutant (SiRM), and hybrid (F.sub.1) plants (H). The pick for each genotype (wild-type-right line; mutant-left line and hybrid-middle line) is measured in relative fluorescence units (RFU). FIG. 1C: Representative photo of wild-type (up) and SiRM (down) lines under application of increasing dosage of Imazamox: untreated control (0), 3 (?X), 6 (?X), 12 (?X), 24 (X), 48 (2X), 96 (4X), 96 (8X) and 384 (16X) g a.i. ha.sup.?1. The recommended dose (X=24 g a.i. ha.sup.?1) is underlined. FIG. 1D: Shoot dry weight calculated relative to the untreated control. The line curves represent the genotype mean (n=5). Shaded areas indicate the standard error. The resistance index (RI) represents the ratio of the ED.sub.50 between WT and SiRM.

    [0071] FIGS. 2A-2F demonstrate genetic and physiological characterization of hybrid (F.sub.1) plants in response to Imazamox application (48 g a.i. ha.sup.?1). FIG. 2A-D: Visual characterization of the plants 3, 4, 7, and 11 days after treatment (DAT). FIG. 2E: Longitudinal hourly dynamics of photosynthesis assimilation (A) of WT, F.sub.1, and SiRM plants in response to Imazamox application. FIG. 2F: Longitudinal dynamics of canopy coverage (green pixels) throughout the experiment. The solid line curves represent the genotype mean (n=4). Shaded areas indicate the standard error.

    [0072] FIGS. 3A-3F demonstrate genetic and physiological characterization of hybrid (F.sub.1) plants in response to Imazamox application (48 g a.i. ha.sup.?1). FIG. 3A: A representative photo of wild type (WT, S-416), hybrid (F.sub.1), and mutant (SiRM) plants under untreated control (UTC) and application of Imazamox (IMA, 48 g a.i. ha.sup.?1) (IMA) at the end of the experiment (21 days after application). FIG. 3B-3D: Nodes length (B), length to the first flower (C), and shoot dry weight (D) of WT. F.sub.1, and SiRM plants under UTC and in response to Imazamox application. Data was obtained 21 days after application.

    [0073] FIGS. 4A-4D demonstrate a response to Imazapic and Imazethapyr of wildtype and SiRM plants. FIG. 4A: A representative photo of wild type (S-416, up) and SiRM (down) plants and FIG. 4B: Dose-response to an application of increasing dosage of Imazapic. Untreated control (0), 6 (?X), 12 (?X), 24 (?X), 48 (X), 96 (2X), 192 (4X), 384 (8X) and 768 (16X) g a.i. ha.sup.?1. The recommended dose (X=48 g a.i. ha.sup.?1) is underlined. The line curves (dashed: SiRM; solid-WT) represent the genotype mean (n=5). Shaded areas indicate the standard error. FIG. 4C: A representative photo of wild type (S-416, up) and SiRM (down) plants and FIG. 4D: Dose-response to an application of increasing dosage of Imazethapyr. Untreated control (0), 1.25 (?X), 2.5 (?X), 5 (?X), 10 (X), 20 (2X), 40 (4X), 80 (8X) and 160 (16X) g a.i. ha.sup.?1. The recommended dose (X=10 g a.i. ha.sup.?1) is underlined. The line curves (dashed: SiRM; solid-WT) represent the genotype mean (n=5). Shaded areas indicate the standard error.

    [0074] FIGS. 5A-5E show the response to Imazamox under field conditions. FIG. 5A: Ariel photo of the plots under field conditions (left, non-treated control A. palmeri) and application of Imazamox (right, 40 g a.i. h.sup.?1). FIG. 5B: A photo of wild type (S-416, WT) and mutant (SiRM) 84 days after application of Imazamox (40 g a.i. h.sup.?1). FIG. 5C: Quantification of the number of weeds per plot. FIG. 5D: Seed yield at the end of the experiment. FIG. 5E: Arial image observation of WT (S-416; left row) and SiRM (right) plants grown in the field under control (up) and application of Imazapic (48 g a.i. ha.sup.?1).

    [0075] FIGS. 6A-6C show the effect of pre-emergence application of Imazapic on the SiRM plants. FIG. 6A: Dose-response of pre-emergence Imazapic application on SiRM line in clay soil. FIG. 6B: Effect of Imazapic application (144 g a.i. h.sup.?1) at pre-emergence on wild type (S-416) and mutant (SiRM) plants development and shoot canopy coverage.

    [0076] FIG. 6C: Root volume of SiRM plants in response to an increasing rate of Imazapic. FIGS. 7A-7E show SiRM response to ALS inhibiting herbicides. FIG. 7A-7E: representative photo of wild type (S-416, up) and SiRM (down) plants and dose-response to an application of increasing dosage of: (A) Trifloxysulfuron (X=12 g a.i. ha.sup.?1), (B) Foramsulfuron (X=450 g a.i. ha.sup.?1), (C) Propoxycarbazone (X=48 g a.i. ha.sup.?1), (D) Florasulam (X=4 g a.i. ha.sup.?1), and (E) Pyrithiobac sodium (X=68 g a.i. ha.sup.?1). The recommended dose is underlined. Shoot dry weight calculated relative to the untreated control (UTC). The line curves (dashed line-SiRM; solid line-WT) represent the genotype mean (n=5). Shaded areas indicate the standard error.

    [0077] FIGS. 8A-8D show the theoretical protein configuration of a wild type (WT; FIG. 8A-8B) and mutated (SiRM; FIG. 8C-8D) ALS protein.

    [0078] FIGS. 9A-9G show the effect of pre-emergence application of Imazapic on weed control under field conditions. FIG. 9A: Arial photo of the field 25 days after sowing. FIG. 9B: Zoom in on representative plots in the field. FIG. 9C: Total weed dry weight as recorded at the end of the experiment. FIG. 9D: Flowering time, FIG. 9E: Height to the first capsule, FIG. 9F: Number of branches per plant, and FIG. 9G: Seed yield. Box plots represent the mean Box-plots represent the mean (n=6), and the statistical analysis was done by Dunnett' test comparing the treatments to weed-free control.

    DETAILED DESCRIPTION OF THE INVENTION

    [0079] Weeds infestation is a major agronomical factor preventing the implantation of sesame-crop in intensive agro-systems. Thus, developing novel weed-control practices is highly required. The present invention is the first to disclose sesame lines with high tolerance and/or resistance to ALS-inhibiting herbicides. The resistance was obtained by mutation induction and selection of plants resistant to the herbicides. The obtained resistant plant carried a single mutation in the 188 Alanine codon (in relation to the sesame ALS amino acid reference sequence shown in SEQ ID NO:1), which resulted in a change in the ALS protein configuration at the binding site of the herbicide toward decreased affinity of the herbicide to the enzyme. The sesame plants of the invention carrying the mutated ALS were tolerant to broadleaf ALS-inhibiting herbicides applied pre- and post-emergence. The present invention thus significantly contributes to the adoption of integrated weed management in sesame to meet the rising global demand for sesame seeds.

    Definitions

    [0080] The terms plant and sesame plant are used herein interchangeably in the terms broadest sense. The terms also refer to a plurality of plant cells that are largely differentiated into a structure that is present at any stage of a plant's development. Such structures include, but are not limited to, a root, stem, shoot, leaf, flower, petal, and fruit. According to certain exemplary embodiments, the sesame plants of the present invention are hardy cultivars grown for commercial production of sesame seeds. According to certain exemplary embodiments, the sesame plants of the present invention are indehiscent, i.e., characterized by capsules (fruit) that are visibly closed when fully ripen (matured).

    [0081] As used herein, the term plant part typically refers to a part of the sesame plant. Examples of plant parts include, but are not limited to, pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruit (capsules), stems, shoots, and seeds. The term plant part also encompasses single cells and cell tissues such as plant cells that are intact in the plant parts, cell clumps and tissue cultures from which sesame plants can be regenerated.

    [0082] The terms Acetolactate synthase, ALS ALS protein and ALS enzyme are used herein interchangeably and refer to the enzyme (also known as acetohydroxyacid synthase [AHAS]) involved in the conversion of pyruvate to acetolactate:


    2CH.sub.3COCO.sub.2.sup.?.fwdarw..sup.?O.sub.2CC(OH)(CH.sub.3)COCH.sub.3+CO.sub.2

    [0083] The reaction uses thiamine pyrophosphate in order to link the two pyruvate molecules. The resulting product of this reaction, acetolactate, eventually becomes valine, leucine, and isoleucine. According to certain embodiments, with reference to wild-type SiALS, the term refers to sesame SiALS having the amino acid sequence set forth in SEQ ID NO:1 or an enzyme having at least 90% sequence identity to SEQ ID NO: 1 comprising alanine at position 188.

    [0084] It is to be explicitly understood that the wild-type sesame SiALS gene or the encoded protein may, may, or may not, comprise mutations, other than the mutation that causes the Ala188 substitution. As used herein, sequence identity or identity in the context of two polypeptide or nucleic acid sequences includes reference to the residues in the two sequences which are the same when aligned. When the percentage of sequence identity is used in reference to proteins it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are considered to have sequence similarity or similarity. Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Henikoff S and Henikoff JG. (Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. U.S.A. 89(22), 10915-9, 1992).

    [0085] Identity (e.g., percent homology) can be determined using any homology comparison software, including, for example, the BlastN, BlastX or Blastp software of the National Center of Biotechnology Information (NCBI) such as by using default parameters.

    [0086] According to certain currently exemplary embodiments of the invention, the identity is a global identity, i.e., an identity over the entire amino acid or nucleic acid sequences of the invention and not over portions thereof.

    [0087] The term gene refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of RNA or a polypeptide. A polypeptide can be encoded by a full-length coding sequence or by any part thereof. The term parts thereof when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, a nucleic acid sequence comprising at least a part of a gene may comprise fragments of the gene or the entire gene.

    [0088] The term gene also encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5 and 3 ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5 of the coding region and which are present on the mRNA are referred to as 5 non-translated sequences. The sequences which are located 3 or downstream of the coding region and which are present on the mRNA are referred to as 3 non-translated sequences.

    [0089] The terms polynucleotide, polynucleotide sequence, nucleic acid sequence, and isolated polynucleotide are used interchangeably herein. These terms encompass nucleotide sequences and the like. A polynucleotide may be a polymer of RNA or DNA or hybrid thereof, that is single- or double-stranded, linear or branched, and that optionally contains synthetic, non-natural or altered nucleotide bases. The terms also encompass RNA/DNA hybrids.

    [0090] As used herein, the term reduced affinity with regard to the interaction of ALS enzyme and herbicide refers to a reduction of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, %, at least 95%, at least 96% at least 97%, at least 98%, at least 99%, or more in the mALS enzyme-herbicide interaction compared to a corresponding wild type ALS-herbicide interaction. The reduced mALS-herbicide affinity results in reduced or no inhibition of the mALS activity by the herbicide. According to certain embodiments, the mALS enzyme shows activity in the presence of an ALS-inhibiting herbicide which is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, %, at least 95%, at least 96% at least 97%, at least 98%, at least 99%, or identical to its activity in the absence of the herbicide. According to certain additional or alternative embodiments, the mALS enzyme shows activity in the presence of an ALS-inhibiting herbicide which is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, %, at least 95%, at least 96% at least 97%, at least 98%, at least 99%, or identical to the activity of a corresponding wild type ALS enzyme in the absence of the herbicide.

    [0091] As used herein, the terms tolerant, tolerance, resistant or resistance of a plant with regard to herbicide(s) treatment refers to a plant that survives treatment with the herbicide. The survived tolerant/resistant plant may show no or reduced symptoms caused by the herbicide. In certain embodiments, a plant tolerant and/or resistant to herbicide shows reduced symptoms when challenged with the herbicide compared to a plant susceptible to said herbicide. For example, a plant tolerant and/or resistant to an herbicide, after the herbicide is applied, can exhibit one or more symptoms associated with the herbicide effect (including, e.g., leaf wilt, leaf or vascular yellowing), spike bleaching etc., and yet not exhibit a reduction in yield in comparison to the yield of a corresponding plant to which the herbicide was not applied and grown under the same conditions.

    [0092] The application of ethyl methanesulfonate (EMS) mutagenesis chemical was proved to be an efficient approach for producing genetic diversity in many crops, such as tomato [Solanum lycopersicum (Dor E et al., 2016. Weed Science, 64:348-360)], rapeseed [Brassica napus L. (Channaoui et al., 2019. Oilseeds fats Crop Lipids, 26, 35)], sesame (Kouighat et Journal of Crop Improvement. al., 2020. doi.org/10.1080/15427528.2020.1861155) and many more. In the course of the work of the present invention, a large EMS-mutagenized population (?80,000 M1 plants) was developed according to the small genome size of sesame (?370 Mbps) and the G:C content. In Arabidopsis, Jander et al. (2003. Plant Physiology, 131:139-146) found that fewer than 50,000 M1 EMS-mutagenized lines are needed to find a mutation in any given G:C base pair in the genome. Likewise, in soybean, Sebastian et al. (1989. Crop Science, 29:1403-1408) found resistance to ALS herbicide using a population of 70,000 M1 plants. Field-based screening of response to Imidazolinone herbicide (IMI), resulted in the identification of a single mutant plant (SiRM).

    [0093] The genetic analysis exposed a point mutation in the SiALS gene which confers a change in amino acid Ala188.

    [0094] The SiRM plants exhibited strong resistance to Imazamox, under both controlled (up to 192 g a.i. ha.sup.?1) and field (48 g a.i. ha.sup.?1) conditions (FIGS. 1 and 5). Similarly, high resistance was found for other widely used members of the Imidazolinone class, Imazapic and Imazethapyr (FIGS. 4 and 6).

    [0095] Thus, according to certain aspects, the present invention provides a sesame (Sesamum indicum L.) plant or a part thereof comprising at least one cell comprising a mutant acetolactate synthase encoding gene (mALS), wherein the mALS encodes a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein, and wherein the plant is resistant to at least one ALS-inhibiting herbicide.

    [0096] According to certain embodiments, the wild-type SiALS protein comprises an amino acid sequence having at least 91%, least 92%, least 93%, least 94%, least 95%, least 96%, least 97%, least 98%, least 99%, or more identity to the amino acid sequence set forth in SEQ ID NO:1 wherein the amino acid sequence comprises alanine at position 188. Each possibility represents a separate embodiment of the present invention.

    [0097] According to certain exemplary embodiments, the wild-type SiALS protein comprises the amino acid sequence set forth in SEQ ID NO:1.

    [0098] According to certain embodiments, the mALS protein comprises an amino acid other than alanine at position 188 of a protein having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the amino acid sequence set forth in SEQ ID NO:1. Each possibility represents a separate embodiment of the present invention.

    [0099] According to certain currently exemplary embodiments, the alanine is substituted by valine (Ala188Val). According to these embodiments, the mALS protein comprises the amino acid valine at position 188 of an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2. Each possibility represents a separate embodiment of the present invention.

    [0100] According to certain currently exemplary embodiments, the mALS protein comprises the amino acid sequence set forth in SEQ ID NO:3.

    [0101] According to certain embodiments, the wild-type SiALS gene comprises a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2, wherein the sequence comprises an alanine coding sequence at positions 562-564. Each possibility represents a separate embodiment of the present invention.

    [0102] According to certain exemplary embodiments, the wild-type SiALS gene comprises the nucleic acid sequence set forth in SEQ ID NO:2.

    [0103] According to certain embodiments, the alanine-coding sequence comprises the nucleic acids 562-564 of SEQ ID NO:2.

    [0104] According to certain embodiments, the mALS polynucleotide comprises a substituted codon coding for an amino acid other than alanine at positions 562-564 of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2. Each possibility represents a separate embodiment of the present invention.

    [0105] According to certain embodiments, the substituted codon codes for the amino acid valine. According to these embodiments, the mALS polynucleotide comprises the nucleotide thymine (T) in position 563 of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2. Each possibility represents a separate embodiment of the present invention.

    [0106] According to certain currently exemplary embodiments, the mALS polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:4.

    [0107] Relying the weed control on a single class herbicide is not a recommended agricultural practice, as it can lead to rapid selection pressure and expose resistant weeds (Kumar et al., 2018, International Journal of Chemical Studies, 6:2844-2850). Therefore, to test if the newly identified mutation can promote resistance to the other four classes of ALS inhibitors, representative herbicides of each class were screened. In general, SiRM plants were more resistant to each of the herbicides (i.e., RI>2) tested, as compared to WT plants. Under the application of SU. TP, and SCT representative herbicides, SiRM plants exhibited tolerance at the field dosage while WT plants were susceptible to all classes (FIG. 7; Table 3). The present invention thus allows flexibility in the use of ALS-inhibiting classes of herbicides to control a wider variety of weeds and reduce the risk, to some extent, of the development of resistant weeds.

    [0108] According to certain embodiments, the ALS-inhibiting herbicide is selected from the group consisting of herbicidal effective Imidazolinones (IMI), Sulfonylureas (SU), Pyrimidinylthiobenzoates (PTB), Triazolopyrimidines (TP), and Sulfonylaminocarbonyltriazolinone (SCT).

    [0109] As used herein, the term imidazolinone means an herbicidal composition comprising one or more chemical compounds of the imidazolinone class, including, but not limited to, 2-(2-imidazolin-2-yl)pyridines, 2-(2-imidazolin-2-yl)quinolines and 2-(2-imidazolin-2-yl) benzoates or derivatives thereof, including their optical isomers, diastereomers and/or tautomers exhibiting herbicidal activity. According to certain embodiments, the Imidazolinone herbicide is selected from the group consisting of 5-(methoxymethyl)-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazamox); 5-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazapic); 5-ethyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazethapyr); 2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)pyridine-3-carboxylic acid (Imazapyr); 4-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)benzoic acid (Imazamethabenz); methyl 4-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)benzoate (Imazamethabenz methyl); 2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)quinoline-3-carboxylic acid (Imazaquin) and 1-(2-chloroimidazo[1,2-a]pyridin-3-yl)sulfonyl-3-(4,6-dimethoxypyrimidin-2-yl)urea (Imazosulfuron). Each possibility represents a separate embodiment of the present invention.

    [0110] As used herein, the term sulfonylurea refers to an herbicidal composition comprising one or more chemical compounds of the sulfonylurea class, which generally comprise a sulfonylurea bridge, SO2NHCONH, linking two aromatic or heteroaromatic rings. According to certain embodiments, the Sulfonylurea herbicide is selected from the group consisting of 2-[(4,6-dimethoxypyrimidin-2-yl)carbamoylsulfamoyl]-4-formamido-N,N-dimethylbenzamide (foramsulfuron) and 1-(4,6-dimethoxypyrimidin-2-yl)-3-[3-(2,2,2-trifluoroethoxy)pyridin-2-yl]sulfonylurea (trifloxysulfuron). Each possibility represents a separate embodiment of the present invention.

    [0111] According to certain embodiments, the Pyrimidinylthiobenzoate herbicide is selected from the group consisting of N-(2,6-difluorophenyl)-8-fluoro-5-methoxy-[1,2,4]triazolo[1,5-c]pyrimidine-2-sulfonamide (Florasulam) and sodium;2-chloro-6-(4,6-dimethoxypyrimidin-2-yl)sulfanylbenzoate (Pyrithiobac sodium). Each possibility represents a separate embodiment of the present invention.

    [0112] According to certain embodiments, the Sulfonylaminocarbonyltriazolinone is methyl 2-[(4-methyl-5-oxo-3-propoxy-1,2,4-triazole-1-carbonyl)sulfamoyl]benzoate (Propoxycarbazone).

    [0113] The genetic inheritance of known resistance to ALS inhibitors was suggested to be controlled by a complete or partial dominant allele (Yu and Powles, 2014. Pest Management Science, 70:1340-1350), and differ between species and dosage of application (Ghanizadeh et al., 2019, ibid). To evaluate the mode of inheritance in sesame the hybrid response to Imazamox (48 g a.i. ha.sup.?1) and of the parental lines (WT and SiRM) was characterized. An intermediate response for the F.sub.1 plants during the first 4 days after application, and full photosynthetic recovery afterward was observed. These results indicate an additive effect in which each copy of the resistant allele promotes a higher level of resistance. Imaizumi et al. (2008. Weed Research, 48:187-196) suggested, based on the allelic test of F.sub.2 population for SU-resistant x susceptible Monochoria vaginalis plants, that at a low dose (i.e., 25 g a.i. ha.sup.?1 bensulfuron-methyl) there is a dominant response of the resistance allele and at high dose (i.e., 225 g a.i. ha.sup.?1) the susceptible allele is dominant. Together, these findings indicate that the number of copies of the mutant ALS enzyme on one hand, and the number of herbicide molecules on the other, play a key role in the level of resistance, and may change between species and environmental conditions.

    [0114] The present invention now shows that under field conditions, SiRM plants treated, post-emergence, with the ALS-inhibiting herbicide Imazamox, exhibited a two-fold greater yield compared to the corresponding weed-free UTC (FIG. 5D). Without wishing to be bound by any specific theory or mechanism of action this phenomenon may be a consequence of the phloemic mobility of ALS-herbicides, primarily, to the apical meristems (Russell et al., 2002. Pestic Outlook, 13:166-173).

    [0115] Thus, according to certain embodiments, the plant resistant to at least one ALS-inhibiting herbicide produces a higher seed yield after being exposed to treatment with the ALS-inhibiting herbicide compared to the yield obtained when the plant is grown under conditions of mechanical/manual weed control, wherein said ALS-inhibiting herbicide is applied post-emergence.

    [0116] During the first two days after application of Imazamox, the mutant plants exhibit a slight yellowing of the apex, which may lead to the breaking of the apical meristem dominance and alters the source-sink relationship. Likewise, it has been shown that sesame cutting of apical bud can increase the formation of lateral branches and increase seed yield (Vasanthan et al., 2019. International Journal of Chemical Studies, 7:4180-4183). Unexpectedly, following the above mention recovery, the hybrid plants exhibited a compact and bushy phenotype (i.e., shorter nodes) (FIG. 3), which further supports the partial break of the apical meristem dominance. Reduced height up to the first flower (=capsule) was observed in the field trial using the pre-emergence ALS-inhibiting herbicide Imazapic (FIG. 9). From an agronomical perspective, such modification in plant architecture can promote earlier development of branches on the first internodes, reducing the risk of lodging, maximizing the yield potential and supporting a mechanical harvest of the mutant plants of the invention. Thus, this phenomenon offers a dual effect to the farmers, not only efficient weed control (FIG. 7) but also improved yield.

    [0117] According to certain embodiments, the sesame plant of the invention, characterized as being resistant to at least one ALS-inhibiting herbicide is further characterized by indehiscent capsules.

    [0118] According to certain embodiments, the sesame plant of the invention comprises at least one cell comprising a mutant acetolactate synthase (mALS) gene, encoding a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein being tolerant and/or resistant to at least one ALS-inhibiting herbicide, further characterized by indehiscent capsules, has the genetic background of Sesamum indicum S-91 plant, seeds of which have been deposited with NCIMB Ltd. as the International Depositary Authority under Accession No. 43877.

    [0119] The ALS-inhibiting herbicide-resistant plants of the present invention can be produced by any method as is known or will be known to a person skilled in the art.

    [0120] According to certain embodiments, the mutant polynucleotide encoding the mutant acetolactate synthase is a mutant of the sesame plant endogenous ALS-encoding gene (mSiALS).

    [0121] Any mutation(s) can be inserted into the polynucleotide encoding ALS including deletions, insertions, site-specific mutations including nucleotide substitution and the like, as long as the mutation(s) results in reduced affinity of the encoded protein to an ALS-inhibiting herbicide.

    [0122] According to certain exemplary embodiments, mutating the endogenous ALS encoding gene of the sesame plant is performed by cite-directed mutagenesis. According to certain embodiments, cite-directed mutagenesis is performed by a gene-editing method.

    [0123] Genome editing is a reverse genetics method that uses artificially engineered nucleases to cut and create specific double-stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homology directed repair (HDR) and non-homologous end-joining (NFfEJ). NFfEJ directly joins the DNA ends in a double-stranded break, while HDR utilizes a homologous sequence as a template for regenerating the missing DNA sequence at the breakpoint. To introduce specific nucleotide modifications to the genomic DNA, a DNA repair template containing the desired sequence must be present during HDR. Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and the probability is very high that the recognized base-pair combination will be found in many locations across the genome resulting in multiple cuts not limited to a desired location. To overcome this challenge and create site-specific single- or double-stranded breaks, several distinct classes of nucleases have been discovered and bioengineered to date. These include the meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system.

    [0124] According to certain embodiments, the plants of the present invention are produced by inserting a mutation within the sesame endogenous ALS gene using the CRISPR/Cas system, a CRISPR/Cas homologous and CRISPR/Cas modified systems.

    [0125] The CRISPR/Cas system for genome editing contains two distinct components: a gRNA (guide RNA) and an endonuclease e.g., Cas9.

    [0126] The gRNA is typically a 20-nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA/Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break. Comparable with other genome-editing nucleases, Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), the double-stranded brakes produced by CRISPR/Cas can undergo homologous recombination or nonhomologous end-joining (NHEJ). The Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both of these domains are active, the Cas9 causes double-strand breaks in the genomic DNA.

    [0127] Since most genome-editing techniques can leave behind minimal traces of DNA alterations evident in a small number of nucleotides as compared to transgenic plants, crops created through gene editing could avoid the stringent regulation procedures commonly associated with genetically modified (GM) crop development.

    [0128] According to further aspects, the present invention provides an isolated polynucleotide encoding acetolactate synthase (ALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS protein.

    [0129] According to certain embodiments, the encoded ALS protein comprises an amino acid other that alanine at position 188 of a protein having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the amino acid sequence set forth in SEQ ID NO:1. According to certain exemplary embodiments, the encoded protein comprises the amino acid valine at position 188.

    [0130] According to certain currently exemplary embodiments, the encoded protein comprises the amino acid sequence set forth in SEQ ID NO:3.

    [0131] According to certain embodiments, the isolated polynucleotide comprises a substituted codon coding for an amino acid other than alanine at positions 562-564 of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2.

    [0132] According to certain exemplary embodiments, the isolated polynucleotide comprises a valine-encoding codon at positions 562-564. According to certain currently exemplary embodiments, the isolated polynucleotide comprises the nucleotide thymine (T) in position 563 of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2.

    [0133] According to further currently exemplary embodiments, the isolated polynucleotide comprises the nucleotide thymine (T) in position 563 of SEQ ID NO:2 to form SEQ ID NO:4.

    [0134] According to certain embodiments, the isolated polynucleotide is comprised within a DNA construct further comprising at least one regulatory element. According to certain embodiments, the regulatory element is selected from the group consisting of a promoter, an enhancer, a termination sequence and any combination thereof. According to certain embodiments, the isolated polynucleotide or the DNA construct comprising same is comprised within a plant-cell compatible expression vector.

    [0135] According to certain further aspects, the sesame plants of the invention being tolerant and/or resistant to at least one ALS-inhibiting herbicide are transgenic plants comprising at least one cell comprising at least one exogenous polynucleotide encoding a mutated ALS protein as described hereinabove.

    [0136] Any method as is known and will be known in the art for introducing an isolated polynucleotide into sesame plant or a part thereof can be used according to the teachings of the present invention.

    [0137] According to certain embodiments, introducing the isolated polynucleotide into at least one cell of a sesame plant susceptible to ALS-inhibiting herbicide is performed by methods of gene editing as described hereinabove.

    [0138] According to certain embodiments, introducing the isolated polynucleotide into at least one cell of a sesame plant susceptible to ALS-inhibiting herbicide comprises transforming the at least one cell with said isolated polynucleotide.

    [0139] As used herein the term transformation or transforming describes a process by which a foreign nucleic acid sequence, such as a vector, enters and changes a recipient cell into a transformed, genetically modified or transgenic cell. Transformation may be stable, wherein the nucleic acid sequence is integrated into the plant genome and as such represents a stable and inherited trait, or transient, wherein the nucleic acid sequence is expressed by the cell transformed but is not integrated into the genome, and as such represents a transient trait. According to typical embodiments, the nucleic acid sequences of the present invention are stably transformed into a plant cell.

    [0140] Transforming plants with isolated nucleic acid sequence generally involves the construction of an expression vector that will function in plant cells. According to the teachings of the present invention, such a vector comprises the isolated polynucleotide encoding the nutated ALS protein having reduced affinity to at least one ALS-inhibiting herbicide. Typically, the vector comprises the polynucleotide under control of, or operatively linked to, a regulatory element. According to certain embodiments, the regulatory element is selected from the group consisting of a promoter, enhancer, a translation termination sequence, and any combinations thereof. The vector(s) may be in the form of a plasmid, and can be used, alone or in combination with other plasmids, in a method for producing transgenic ALS-inhibiting herbicide-tolerant and/or resistant sesame plants.

    [0141] Agrobacterium-mediated gene transfer: The Agrobacterium-mediated system includes the use of plasmid vectors that contain defined DNA segments which integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf-disc procedure, which can be performed with any tissue explant that provides a good source for initiation of whole-plant differentiation (Horsch et al., 1988. Plant Molecular Biology Manual A5, 1-9, Kluwer Academic Publishers, Dordrecht). A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. Agrobacterium mediated transformation protocols for tomato plants are known to a person skilled in the art.

    [0142] Direct nucleic acid transfer: There are various methods of direct nucleic acid transfer into plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field, opening up mini-pores to allow DNA to enter. In microinjection, the nucleic acid is mechanically injected directly into the cells using micropipettes. In microparticle bombardment, the nucleic acid is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues. Another method for introducing nucleic acids to plants is via the sonication of target cells. Alternatively, liposome or spheroplast fusion has been used to introduce expression vectors into plants.

    [0143] Expression vectors can include at least one marker (reporter) gene, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the markers gene). Many commonly used selectable marker genes for plant transformation are known in the art, and include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or an herbicide, or genes that encode an altered target which is insensitive to the inhibitor. Several positive selection methods are known in the art, such as mannose selection.

    [0144] Alternatively, the transgenic as well as the non-transgenic sesame plants of the present invention can be identified using a marker specific for the mutant ALS protein.

    [0145] According to yet additional certain aspects, the present invention provides a method for identifying a sesame plant having an enhanced tolerance and/or resistance to at least one type of ALS-inhibiting herbicide, the method comprising detecting, in a genetic material obtained from the plant, the presence of a nucleic acid marker amplified by a pair of primer comprising the nucleic acid sequence set forth in SEQ ID NO:5 (CAGGTTCCCCGTCGTATG) and SEQ ID NO:6 (TCCTTGACAACCCGAGGA).

    [0146] According to certain embodiments, the amplified marker comprises the nucleic acid sequence set for the in SEQ ID NO:7. SEQ ID NO:7 comprises the nucleobase thymine (T) at position14.

    [0147] According to yet further certain aspects, the present invention provides a method for controlling weeds in the vicinity of at least one sesame plant resistant to at least one ALS-inhibiting herbicide according to the teachings of the invention, the method comprises applying at least one ALS-inhibiting herbicide to the weeds and the plant in an amount sufficient to inhibit the weed growth.

    [0148] According to certain embodiments, the method comprises controlling weeds in a field planted with a plurality of plants resistant to at least one ALS-inhibiting herbicide according to the teachings of the invention. According to these embodiments, the method comprises applying at least one ALS-inhibiting herbicide to the field.

    [0149] According to certain embodiments, the amount of the ALS-inhibiting herbicide does not significantly inhibit the growth of the sesame plant resistant to the herbicide.

    [0150] According to certain embodiments, the amount of the ALS-inhibiting herbicide inhibits the growth of a corresponding sesame plant susceptible to the herbicide.

    [0151] According to certain embodiment, the amount of the ALS-inhibiting herbicide results in an enhanced seed yield of the sesame plant resistant to the herbicide compared to the yield of a corresponding sesame plant resistant to the herbicide grown in a weed-free environment obtained by an alternative weed control method, wherein the herbicide is applied post-emergence.

    [0152] The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.

    EXAMPLES

    Materials and Methods

    Development of Mutant Population

    [0153] The wild-type (WT) sesame line S-416 was selected for the current study. This mechanical harvest adapted line was previously developed by the inventors of the present invention and co-workers for the Mediterranean climate (Sabag et al., 2021. BMC Plant Biology, 21:549). Plants were selfed over six generations to get homozygote uniform seeds. About 80,000 WT seeds were washed and soaked in water for 6 hours. Seeds were divided into five containers with ddH.sub.2O and the mutagen Ethyl methanesulfonate (EMS, Merck KGaA, USA) at a concentration of 0.2, 0.4, 0.6, 0.8, or 1% (v/v). After 16 hours, seeds were washed under running water for 4 hours to remove the remains of the mutagen. M.sub.1 seeds were sown in planting trays and transplanted in the field, a month later. At maturation, M.sub.2 seeds were harvested as bulk and systematically mixed to randomly distribute the progeny of any given M1 plant.

    Screening for Resistant Plants in the Field

    [0154] The bulk of M.sub.2 seeds were sown in the field (Moshav Revaha; 31?3841.30N, 34? 4551.72E) with clay soil, at a rate of 6,000,000 seeds ha.sup.?1 (?4.2 million seeds). At the two real leaves stage, plants were sprayed with Imazamox (Pulsar, BSAF, 48 g active ingredient (a.i.) ha.sup.?1) using a commercial sprayer (Degania Industries Ltd., Israel). To prevent possible plant escape, a second dose after three weeks was applied. A weekly observation was conducted to identify plants that were not affected by the herbicide. The identified candidate plant was harvested for further examination in the laboratory. The Sesamum indicum resistant mutant (hereafter SiRM) plant was selfed up to Ms generation.

    SiALS Gene Sequencing

    [0155] Leaf samples (?2 mg) were taken from two-weeks old plants of SiRM M3 plants and the susceptible WT (S-416). Plants were sprayed with Imazamox (48 g a.i. ha.sup.?1) for resistance validation (after DNA sampling). Genomic DNA was extracted using the CTAB protocol, with modification for sesame as described before (Teboul et al., 2020. Genes, 11, 1221). To test possible mutation(s) in the SiALS gene, a targeted sequencing was applied using four primer pairs covering the whole gene sequence (Table 1) according to the sequenced sesame genome (Zhongzhi No. 13; Wang et al., 2014. Genome Biology, 15:1-13). The gene was amplified, and PCR products were sequenced (HUJI genome center, Israel). Sequence alignment was performed using the Clustal Omega tool (Madeira et al., 2019. Nucleic Acids Research, 47:636-641).

    TABLE-US-00001 TABLE1 Listofprimersusedforsequencingofthe sesameSiALSgenesegments. Primer Sequence(5-3) SEQIDNO. ALS1F CCCACTCAGCTGCCTCAT SEQIDNO:8 ALS1R GCGAGGCCAGAGACCAAA SEQIDNO:9 ALS2F AGGGAGGTGTCTTCGCTG SEQIDNO:10 ALS2R CCTCCAGCTTACCCGTCA SEQIDNO:11 ALS3F GCTGGGTATGCATGGGAC SEQIDNO:12 ALS3R TTGTCACACGAGCTGCAG SEQIDNO:13 ALS4F CAGCACTTGGGTATGGTTGT SEQIDNO:14 ALS4R TTCGAGTGGGATGTGCC SEQIDNO:15

    Determination of the Mutant Allelic Configuration

    [0156] A high-resolution melting (HRM) protocol was developed to determine the allelic configuration of SiALS mutation, based on dsDNA melting temperatures. One ?l of forward (CAGGTTCCCCGTCGTATG, SEQ ID NO:5) and reverse (TCCTTGACAACCCGAGGA, SEQ ID NO:6) primers designed to amplify DNA segments that contain the SNP, were mixed with 2 ?l of genomic DNA (20 ng/?l), 4 ?l of HRM mix (HOT FIREPol EvaGreen HRM Mix, Solis BioDyne, Tartu, Estonia) and 13 ?l of ddH.sub.2O. Each mix was transferred to a separate well within a plate (96-well Piko PCR Plate, Thermo Fisher Scientific, Massachusetts, USA), and placed in a Real-Time PCR System (PikoReal 96, Thermo Fisher Scientific, Massachusetts, USA). Reaction settings (i.e., cycles, temperature, and duration) were determined according to the supplied protocol.

    Herbicides Dose-Response Assays

    [0157] Seeds of WT and SiRM were sown in a 9?9?10 cm pot with clay soil (57% clay, 23% silt, 20% sand) from Newe Yaar Research Station. At the stage of two true leaves, plants were exposed to increasing rates (0, ?X, ?X, ?X, X, 2X, 4X, 8X) of representative herbicides from all ALS sub-groups (Table 2). Herbicides were sprayed on the plants using a Generation 4 Research Track Sprayer (DeVries Manufacturing, Inc., USA) at a 200 L ha.sup.?1 spray volume. Plant heights were measured sixteen days after treatments (DAT), and the aboveground material was harvested and oven-dried (at 80? C. for 48 h) to obtain the shoot dry weight (DW).

    TABLE-US-00002 TABLE 2 List of herbicides used. Trade Rate range Herbicide name Chemical family Manufacturer (g a.i. h.sup.?1 Imazamox Pulsar Imidazolinone BASF 3-384 Corporation Imazapic Cadre Imidazolinone BASF 6-768 Corporation Imazethapyr Pursuit Imidazolinone BASF 1.25-160 Corporation Trifloxysulfuron Envoke Sulfonylurea Syngenta 1.5-96 Formsulfuron Equip Sulfonylurea Bayer 11.25-180 CropScience Pyrithiobac- Staple Pyrimidinyl- Dupont 8.5-1088 sodium thiobenzoate Propoxycarbazone Olimpus Sulfonylamino- Bayer 6-384 carbonyltriazolinone CropScience Florasulam Darbuka Sulfonyd- Agan-Adama 0.5-64 triazolopyrimidine

    Physiological Characterization of F.SUB.1 .Hybrid Plants

    [0158] A cross between SiRM (?) and the WT (?) was made to produce F.sub.1 seeds. Uniform F.sub.1 seeds were sown in a 9?9?10 cm pot with clay soil alongside the two parental lines (WT and SiRM). The pots were placed in a growth chamber under long-day conditions (16/8 light/dark and 32/25? C.). At the stage of two true leaves, half of the plants were sprayed with Imazamox (48 g a.i. h.sup.?1). Plants were characterized daily for canopy coverage (Canopeo software, Oklahoma State University, USA; Patrignani and Ochsner, 2015. Agronomy Journal, 107:2312-2320) and gas exchange (IRGA 6800; Li-Cor, Lincoln, Nebraska, USA), over the next 11 days. At the end of the experiment, 21 DAT, the aboveground material was harvested, oven-dried (80? C., 48 h), and weighed to obtain shoot DW.

    Field Experiments

    Imazamox Post-Emergence Experiment

    [0159] The experiment was conducted in the Experimental Farm of the Hebrew University of Jerusalem in Rehovot, Israel (34?47 N, 31?54 E; 54 m above sea level). The soil at this location is brown-red, degrading, sandy soil (Rhodoxeralf), composed of 76% sand, 8% silt, and 16% clay. A pair-samples experimental design was applied with the two genotypes (WT and SiRM) and two treatments: untreated control (UTC) and Imazamox application (40 g a.i. h.sup.?1). Each plot consisted of a 5-meter row, with a sowing density of 7-plants m.sup.?1 (n=6). At the end of the season, the survival rate was analyzed (number of plants per plot) and the plants in the plot were harvested. Samples were threshed using a laboratory thresher (Wintersteiger AG LD 350, Austria) and after sifting, the seeds were weighed to obtain seed yield.

    [0160] To test the efficiency of Imazamox for weed control, Amaranthus palmeri was used as a model. Seeds of A. palmeri were sown (20-seeds m-1) as competitor weeds alongside the two sesame lines described above. As a negative control, plots that were not treated were used. At the end of the experiment, the number of A. palmeri plants per plot was counted.

    Imazapic Pre-Emergence Experiment

    [0161] Seeds of WT and SiRM, and two weed species, A. palmeri and Euphorbia heterophylla were sowed in pots (9?9?10 cm) with clay soil (Newe Yaar Research Station), 5 seed per pot, except A. palmeri with 20 seeds. Five pots from each plant species were sprayed with Imazapic (144 g a.i. h.sup.?1). Herbicide application was followed by irrigation equivalent to 200-millimeter ha.sup.?1. The pots were placed in a growth chamber under long-day conditions (16/8 light/dark and 32/25? C.) and the canopy coverage (Canopeo) was measured at 14 DAT.

    [0162] An additional field experiment was conducted during the summer of 2021 at the Experimental Farm of the Hebrew University of Jerusalem, Rehovot, Israel. A split-plot random block design with six replicates was applied. Treatments included: weed-free plots (i.e., manual weeding), untreated control (i.e., herbicide-free treatment) and application of Imazapic (48 g a.i. ha.sup.?1) pre-germination. The plot size was 3.6 m?0.8 m (10 cm between plants) with two rows per plot. To evaluate the efficacy of weed control, two weeds were sown on the sesame sowing lines (Amaranthus Palmeri, 500 seeds per plot, and Abutilon Theophrastus, 70 seeds per plot). Phenological characterization was conducted during the growing season for the flowering date, the number of brunches per plant and the height to the first capsule. At the end of the growing season, the number of weeds per plot was counted and weeds were harvested for dry weight measurements. Sesame plants were harvested 1 m from the middle of the plot, samples were threshed using a laboratory thresher (Wintersteiger AG LD 350, Austria), and after sifting, the seeds were weighed to obtain seed yield.

    Characterization of Roots Development Under Increasing Dosages of Imazapic

    [0163] Three seeds of SiRM were sown in plastic columns (30 cm long) filled with sandy soil (composed of 76% sand, 8% silt, and 16% clay) (n=5) and sprayed with increasing doses of Imazapic (24, 48, 96, and 192 g a.i. ha.sup.?1). Herbicide application was followed by irrigation equivalent to 200-millimeter ha.sup.?1 and placed in a growth chamber under long-day conditions (16/8 light/dark and 32/25? C.). Fourteen DAT, the roots were washed and scanned using a flatbed scanner (Epson 12000XL, Seiko EPSON, Japan), and root architecture was analyzed using the WinRHIZO Pro software (Regent Instruments Ltd., Ontario, Canada).

    Statistical Analyses

    [0164] The JMP? (ver. 15) statistical package (SAS Institute Inc., Cary, NC. USA) was used for all statistical analyses. Descriptive statistics are graphically presented in box-plot: median value (horizontal short line), quartile range (25 and 75%), and data range (vertical long line). Dose-response curves were constructed by plotting the shoot DW data 16 DAT, from the different accessions as a percentage of untreated control (UTC). A nonlinear curve model (Exponential two parameters) was adjusted to analyze the effects of the tested herbicides in the different experiments.

    [00001] Y = a ? Exp ( b ? d ) ;

    [0165] where Y is the shoot DW, a=scale, b=growth rate, and d represents the herbicide dosage. The resistance/susceptible ratio of the ED.sub.50 was calculated to determine the resistance index (RI) of the resistant plants compared to that of the susceptible plants.

    Example 1: Induced Mutation in SiALS Gene Provides High Resistance to Imazamox

    [0166] To identify a possible mutation(s) in the ALS encoding gene, over 4,000,000 M2 plants were screened in the field. Visual characterization of the plants after two consecutive applications of Imazamox (48 g a.i. ha.sup.?1) resulted in a single candidate plant without any visual symptoms (i.e., no visible growth reduction and meristem damage). Seeds from this candidate plant were harvested, and the M3 plants were sprayed with a similar dose of Imazamox. Seven days after spraying, the WT plants (S-416) showed reduced growth and meristem damages, while the mutant plants (SiRM) did not display any visual symptoms. It is worth noting that SiRM plants exhibited higher vigor under Imazamox treatment as compared with its untreated control (FIG. 1D). To test the possibility of target-site mutation in the SiALS gene, the gene segments were sequenced and a single point mutation in position 563 was identified. This mutation conferred substitution from Cytosine to Thymine (C.fwdarw.T) and amino acid substitution in position 188 in the ALS enzyme from alanine to valine (FIG. 1A). To enable fast screening of this mutation, a high-resolution melt (HRM) marker was developed. This new marker resulted in a clear separation between WT. SiRM, and the F.sub.1 hybrid (FIG. 1B). To evaluate the level of resistance, a dose-response assay was conducted, from sub-lethal (3 g a.i. ha.sup.?1) to 16 times field dosage (i.e., 364 g a.i. ha.sup.?1). WT plants exhibited visual symptoms and reduced shoot DW already at a low dose of 6 g a.i. ha.sup.?1 and reached ED.sup.50 (i.e., reductions of 50% shoot DW) at 18 g a.i. ha.sup.?1. In contrast, SiRM plants did not show any visual symptoms up to 8X of the recommended dose (192 g a.i. ha.sup.?1). Consequently, the calculated ED.sub.50 of the mutant line was at a high rate of 823 g a.i. ha.sup.?1 (which is above the tested rates) (FIG. 1C-D). Notably, under low doses of 3, 6, and up to half of the recommended field dose 12 g a.i. h.sup.?1, SiRM plants exhibited a 50% increment in shoot DW as compared with corresponding untreated control plants.

    Example 2: Intermediate Response of Hybrid Plants Exhibited Modification in Plant Architecture and Gas Exchange

    [0167] To test the genetic inheritance of the mutant ALS gene the time-response to ALS-inhibitors of hybrid (F.sub.1) plants and their parental lines (WT and SiRM) was analyzed. In general, while the SiRM (homozygote) plants did not differ from the UTC plants and maintained a normal growth pattern, both WT and hybrid plants exhibited a significant reduction in growth during the first 4 DAT. The hybrid plants were able to recover and, already after 7 DAT, they looked like the SiRM plants. Fourteen DAT, the hybrid plants shifted their growth pattern from stem elongation to the production of more lateral branch meristems, as expressed in shorter plant height. At the end of the experiment, WT plants were fully eradicated, whereas SiRM plants showed no effect of Imazamox treatment (FIGS. 2F and 3A). The hybrid plants displayed intermediate response as expressed in a reduction of ?40% in plant height, and ?35% in shoot DW (FIG. 3D). Morphological characterization of the hybrid plants showed that the erect morphology was associated with more nodes to the first flower (11.4 vs. 5.6 nodes for treated and UTC, respectively) but shorter nodes (2.4 vs. 8.0 cm), which consequently resulted in lower first flower bud (27.6 vs. 44.6 cm) (FIG. 3B-C).

    [0168] While all three lines exhibited a similar trend of reduction in assimilation and transpiration during the first 48 hours after application, the severity of response was significantly stronger for the WT plants, with hybrid plants exhibiting intermediate response. After 48 h, WT had less than a 20% assimilation rate, and the SiRM plant recover completely and did not differ from the UTC plants. The hybrid plants showed slower recovery, though after six days they fully recovered (FIG. 2E).

    Example 3: Field-Based Validation Confirmed High Resistance and Enhanced Yield

    [0169] To evaluate the level of field resistance and its effectiveness in sesame weed control, a field experiment was done with the two lines (WT and SiRM) under Amaranthus palmeri infestation and Imazamox (40 g a.i. h.sup.?1) application (FIG. 5A). Overall, the Imazamox treatment was very efficient in controlling A. palmeri (?0 A. palmeri plants per meter plot) compared with the field conditions (non-treated control) (?12 A. palmeri plants m.sup.?1) (FIG. 5C). Application of Imazamox resulted in a significant reduction in WT sesame stand (75%, P<0.0001) due to severe plant death (FIG. 5B). In contrast, there was no significant effect on the SiRM plots stand. At the end of the experiment, the plots were treated with Imazamox, and the weed-free plots (control) were harvested. While the WT plants exhibited significant yield reduction (0.93 vs. 3.6 g per plant for the Imazamox and weed-free control, respectively, P=0.0015), the SiRM plants exhibited the opposite trend. The mutant plants had a double yield per plant under Imazamox treatment compared to plants grown in weed-free plots, where the weeds were eradicated manually (6.05 vs. 2.88 g per plant, respectively, P=0.011). Notably, the differences in plot stand could have affected the obtained results. Therefore, to eliminate this factor, the yield per plot was also analyzed; a similar pattern was obtained at the plot level (FIG. 5D). The WT plots under Imazamox treatment showed significant yield reduction compared to weed-free (control) plots (1.6 vs. 19 g, respectively, P=0.0002). Surprisingly, the mutant plots had a significantly higher yield under Imazamox treatment compared with control (31.5 and 16.7 g, respectively, P=0.02) (FIG. 5D).

    Example 4: The Mutation Confers High Resistance to Imidazolinone Herbicide

    [0170] To test if the point mutation in the SiALS gene also promotes resistance to other herbicides in the same class of Imidazolinone, Imazapic and Imazethapyr were used. These herbicides were chosen based on their widespread use in field crops. Dose-response assay showed a similar trend, with clear differences between lines. Under Imazapic application, the WT exhibited a significant reduction in growth already at 6 g a.i. h.sup.?1 (18%, P=0.0055), which become more pronounced visually as Imazapic dosages increased. SiRM plants were not affected up to 2X of the recommended dose (96 g a.i. h.sup.?1) and exhibited severe damage symptoms only at a high rate of 16X (768 g a.i. h.sup.?1; FIG. 4A-B). The same trend was observed after the application of Imazethapyr. All dosages applied on WT plants caused a significant reduction in shoot DW, and the field recommended dosage (20 g a.i. h.sup.?1) was deadly for the plants. On the other hand, SiRM plants were not affected up to 4X of the recommended dose (80 g a.i. h.sup.?1), and even at the highest dosage of 160 g a.i. h.sup.?1 plants were viable and fully recovered (FIG. 4C-D). Field observation of WT vs. SiRM followed Imazapic recommended dose (48 g a.i. h.sup.?1) application resulted in clear differences. While all WT plants (and weeds) were dead already 10 DAT, the SiRM plants were only slightly affected and showed a five-day delay in shoot development and flowering time.

    Example 5: SiRM Exhibited Mild Resistance to Different ALS Classes

    [0171] To test if the point-mutation in the SiALS gene affects sesame plant response to other herbicides of the ALS class, a dose-response assays for the additional classes was performed. Overall, for all herbicides applied, SiRM plants showed better performance compared with WT plants, as reflected in their higher ED.sub.50, and a higher growth rate at the field dose level (Table 3). Application of two sulfonylurea (SU) herbicides, foramsulfuron, and trifloxysulfuron exposed mild resistance of the SiRM plants as compared with WT plants. Under the recommended dose, WT plants exhibited significant reduction compared with SiRM in shoot DW (63% vs. 18% and 25% vs. 8% for trifloxysulfuron and foramsulfuron, respectively) and shoot length (74% vs. 7% and 64% vs. 58%) (FIG. 7A-B). The application of increasing doses of propoxycarbazone resulted in a severe response of the WT plants already at a low dose of ?X, whereas the SiRM plants were able to maintain growth (and develop flowering buds) up to the recommended dose (FIG. 7C). Application of florasulam (triazolopyrimidines class) showed a similar response of both lines under low doses, with a mild advantage of the SiRM line under higher doses, as also reflected in RI=2 (Table 3; FIG. 7D). Application of pyrithiobac sodium was lethal for both lines, with the mutant able to survive up to the recommended dose (however, with a severe reduction of shoot length of 66%) (Table 3; FIG. 7E).

    TABLE-US-00003 TABLE 3 Effect of different ALS inhibitors application at field rates on wild type (S-416) and SiRM plants Shoot length Shoot DW field rate field rate (% ED.sub.50 (% control) control) Herbicide WT SiRM WT SiRM WT SiRM RI Imazamox 18 823 0.28 1.02 0.33 1.01 45 Imazapic 236 563 0.74 0.75 0.35 0.94 2.4 Imazethapyr 3.7 161 0.17 0.78 0.27 0.87 48 Foramsulfuron 41 165 0.37 0.82 0.26 0.93 3.95 Florasulam 31 62 0.81 0.71 0.60 0.83 2 Pyrithiobac sodium 9.8 202 0.26 0.65 0.17 0.34 20.5 Propoxycarbazone 12 96 0.42 0.50 0.30 0.80 8 Trifloxysulfuron 33 69 0.75 1.05 0.36 0.42 2

    [0172] Table 3: Shoot dry weight (DW) and shoot length as a percentage of that of the untreated control (UTC) and ED.sub.50 values (herbicide rate reducing plant growth by 50%) are presented. Values are means (n=5).

    Example 6: The SiRM Plants Exhibited High Resistance to Pre-Emergence Imazapic Application

    [0173] To evaluate the response of SiRM plants to the pre-emergence application of Imazapic, a responsiveness assay at increasing doses (48, 96, and 144 g a.i. h.sup.?1) was performed. In general, under all tested doses, the SiRM plants exhibited normal growth and development (100% survival rate; FIG. 6A). To test the potential of using Imazapic pre-emergence, the WT and SiRM plants and two weed species A. palmeri and Euphorbia heterophylla, were compared under the highest dose (144 g a.i. h.sup.?1) using visual and image-based phenomics approaches (FIG. 6B). While WT plants were fully controlled and did not develop beyond the growth of the cotyledons, the SiRM plants developed normally without any visual differences compared to the untreated control. These differences were also expressed belowground when the WT plants did not develop roots (82 vs. 5 mm under controlled and Imazapic treatment, respectively), while SiRM maintains a similar root length (72 vs. 85 mm, respectively, P=0.106) (FIG. 6B). The canopy coverage of the WT plants 14 days after sowing showed a significant reduction (2.23 vs. 0.27% of coverage, P=0.0008), while SiRM plants maintained similar values (FIG. 6C).

    [0174] ALS herbicides are known to have a strong effect on the root developments due to their phloemic transport to the meristems (sink organs), as was also found here (FIG. 6B). The higher root length found in the treated SiRM seedlings leads us to investigate the possibility of roots hormesis response. However, the pre-emergence Imazapic application at increasing doses didn't show any significant differences in root volume (FIG. 6C).

    Example 7: Effect of the Mutation of ALS Configuration

    [0175] FIG. 8 shows that substitution from Alanine to Valine changes the protein conformation at the binding site of the herbicide and decreases the affinity of the herbicide to the ALS enzyme.

    Example 8: 2021 Field Trial-Effect of Imazapic on Weed Control and Sesame Performance

    [0176] Under the control treatment (herbicide-free) the A. palmeri was the dominant weed (98 plants per plot), and no other weeds or sesame plants were able to develop as displayed visually (FIG. 9A-C). The pre-application of Imazapic resulted in weed-free plots. The A. Palmeri didn't emerge (full-control), and the Abutilon plants that emerged didn't develop beyond the cotyledons. As is clearly shown in FIG. 9 D-E, pre-application of Imazapic had no deleterious effects on the resistant plants of the invention, showing similar growth to the growth obtained in the weed-free control. Pre-application of Imazapic also resulted in reduced height to the first capsule, which indicates a decrease in apical meristem dominance (FIG. 9E-G).

    [0177] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.