EFFECTOR PROTEINS AND USES THEREOF
20240301379 ยท 2024-09-12
Assignee
Inventors
- Lucas Benjamin HARRINGTON (San Francisco, CA, US)
- David PAEZ-ESPINO (Concord, CA, US)
- Benjamin Julius RAUCH (San Francisco, CA, US)
- Stepan TYMOSHENKO (Sacramento, CA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
International classification
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
Provided herein are compositions, systems, and methods comprising effector proteins and uses thereof. These effector proteins may be characterized as CRISPR-associated (Cas) proteins. Various compositions, systems, and methods of the present disclosure may leverage the activities of these effector proteins for the modification, detection, and engineering of nucleic acids.
Claims
1. A composition comprising an effector protein and a guide nucleic acid, wherein the effector protein comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOS: 1-10,484 or 15,022-24,165.
2. A composition comprising an effector protein and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOS: 1-10,484 or 15,022-24,165.
3. A composition comprising an effector protein and a guide nucleic acid, wherein the effector protein comprises about 100, about 120, about 140, about 160, about 180, about 200, about 220, about 240, about 260, about 280, about 300, about 320, about 340, about 360, about 380, about 400, about 420, about 440, about 460, about 480, about 500, about 520, about 540, about 560, about 580, about 600, about 620, about 640, about 660, about 680, about 700, about 720, about 740, about 760, about 780, about 800, about 820, about 840, about 860, about 880, about 900, about 920, about 940, about 960, about 980, about 1000, about 1020, about 1040, about 1060, about 1080, about 1100, about 1120, about 1140, about 1160, about 1180, about 1200, about 1220, about 1240, about 1260, about 1280, about 1300, about 1320, about 1340, about 1360, about 1380, about 1400, about 1420, about 1440, about 1460, about 1480, about 1490, about 1500, about 1520, about 1540, about 1560, about 1580, about 1600, about 1620, about 1640, about 1660, about 1680, about 1700, about 1720, about 1740, about 1760, about 1780, about 1800, about 1820, about 1840, about 1860, about 1880, about 1900, or about 1920 contiguous amino acids of a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165.
4. A composition comprising an effector protein and a guide nucleic acid, wherein the effector protein comprises the amino acid sequence located at positions 1-100, 150-250, 101-200, 250-350, 201-300, 350-450, 301-400, 350-450, 401-500, 450-550, 501-600, 550-650, 601-700, 650-750, 701-800, 750-850, 801-900, 850-950, 901-1000, 950-1050, 1001-1100, 1050-1150, 1101-1200, 1150-1250, 1201-1300, 1250-1350, 1301-1400, 1350-1450, 1401-1500, 1450-1550, 1501-1600, 1550-1650, 1601-1700, 1650-1750, 1701-1800, 1850-1950, 1801-1900, or 1850-1950 of a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165.
5. A composition comprising an effector protein and a guide nucleic acid, wherein the effector protein comprises an amino acid sequence that is at least 90%, at least 95%, or 100% identical to a portion of a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165, and wherein the length of the portion is at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, or at least about 600 linked amino acids in length.
6. The composition of claim 5, wherein the portion of the sequence is about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90% of a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165.
7. A composition comprising an effector protein, and a guide nucleic acid, wherein a) the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column A1 of TABLE 1; and b) at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is: i) at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1, or ii) at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
8. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein a) the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column A2 of TABLE 1; and b) at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is: i) at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1, or ii) at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
9. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein a) the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column A3 of TABLE 1; and b) at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is: i) at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1, or ii) at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
10. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 50% identical or at least 50% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
11. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 60% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 60% identical or at least 60% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
12. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 70% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 70% identical or at least 70% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
13. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 80% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 80% identical or at least 80% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
14. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 90% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 90% identical or at least 90% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
15. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 95% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 95% identical or at least 95% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
16. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
17. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 50% identical or at least 50% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
18. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 60% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 60% identical or at least 60% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
19. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 70% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 70% identical or at least 70% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
20. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 80% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 80% identical or at least 80% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
21. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 90% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 90% identical or at least 90% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
22. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 95% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 95% identical or at least 95% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
23. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
24. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 50% identical or at least 50% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
25. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 60% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 60% identical or at least 60% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
26. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 70% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 70% identical or at least 70% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
27. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 80% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 80% identical or at least 80% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
28. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 90% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 90% identical or at least 90% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
29. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 95% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 95% identical or at least 95% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
30. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
31. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 50% identical or at least 50% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
32. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 60% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 60% identical or at least 60% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
33. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 70% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 70% identical or at least 70% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
34. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 80% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 80% identical or at least 80% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
35. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 90% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 90% identical or at least 90% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
36. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 95% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 95% identical or at least 95% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
37. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
38. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 50% identical or at least 50% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
39. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 60% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 60% identical or at least 60% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
40. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 70% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 70% identical or at least 70% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
41. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 80% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 80% identical or at least 80% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
42. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 90% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 90% identical or at least 90% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
43. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 95% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 95% identical or at least 95% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
44. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
45. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 50% identical or at least 50% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
46. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 60% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 60% identical or at least 60% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
47. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 70% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 70% identical or at least 70% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
48. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 80% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 80% identical or at least 80% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
49. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 90% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 90% identical or at least 90% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
50. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 95% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 95% identical or at least 95% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
51. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
52. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 50% identical or at least 50% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
53. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 60% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 60% identical or at least 60% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
54. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 70% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 70% identical or at least 70% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
55. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 80% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 80% identical or at least 80% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
56. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 90% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 90% identical or at least 90% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
57. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 95% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is at least 95% identical or at least 95% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
58. A composition comprising an effector protein, and an engineered guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the engineered guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
59. The composition of any one of claims 1-58, wherein at least a portion of the guide nucleic acid binds the effector protein.
60. The composition of any one of claims 1-59, wherein the guide nucleic acid comprises a crRNA.
61. The composition of any one of claims 1-60, wherein the guide nucleic acid comprises a tracrRNA.
62. The composition of any one of claims 1-60, wherein the composition does not comprise a tracrRNA.
63. The composition of any one of claims 1-61, wherein the guide nucleic acid comprises a crRNA covalently linked to a tracrRNA.
64. The composition of any one of claims 1-63, wherein the guide nucleic acid comprises a first sequence and a second sequence, wherein the first sequence is heterologous with the second sequence.
65. The composition of claim 64, wherein the first sequence comprises at least five amino acids and the second sequence comprises at least five amino acids.
66. The composition of any one of claims 1-65, wherein at least one of the effector protein, the guide nucleic acid, and the combination thereof, are not naturally occurring.
67. The composition of any one of claims 1-66, wherein at least one of the effector protein and the guide nucleic acid is recombinant or engineered.
68. The composition of any one of claims 1-67, wherein the guide nucleic acid comprises a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or 100% identical to a nucleotide sequence selected from SEQ ID NOS: 10,485-15,015 or 24,166-31,319.
69. The composition of any one of claims 1-68, wherein the guide nucleic acid comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of a nucleotide sequence selected from SEQ ID NOS: 10,485-15,015 or 24,166-31,319.
70. The composition of any one of claims 1-69, wherein the guide nucleic acid comprises at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, or at least 220 contiguous nucleotides of a nucleotide sequence selected from SEQ ID NOS: 10,485-15,015 or 24,166-33,309.
71. The composition of any one of claims 1-70, wherein the guide nucleic acid comprises a sequence that hybridizes to a target sequence of a target nucleic acid, and wherein the target nucleic acid comprises a protospacer adjacent motif (PAM).
72. The composition of claim 71, wherein the PAM is located within 1, 5, 10, 15, 20, 40, 60, 80 or 100 nucleotides of the 5 end of the target sequence.
73. The composition of any one of claims 1-72, wherein the effector protein comprises a nuclear localization signal.
74. The composition of any one of claims 1-73, comprising a donor nucleic acid.
75. The composition of any one of claims 1-74, comprising a fusion partner protein linked to the effector protein.
76. The composition of claim 75, wherein the fusion partner protein is directly fused to the N terminus or C terminus of the effector protein via an amide bond.
77. The composition of claim 75, wherein the fusion partner protein is directly fused to the N terminus or C terminus of the effector protein via a peptide linker.
78. The composition of any one of claims 75-77, wherein the fusion partner protein comprises a polypeptide selected from a deaminase, a transcriptional activator, a transcriptional repressor, or a functional domain thereof.
79. The composition of any one of claims 1-78, wherein the effector protein comprises at least one mutation that reduces its nuclease activity relative to the effector protein without the mutation as measured in a cleavage assay, optionally wherein the effector protein is a catalytically inactive nuclease.
80. A composition comprising a nucleic acid expression vector, wherein the nucleic acid vector encodes at least one of the effector protein and the guide nucleic acid of the composition of any one of claims 1-79.
81. The composition of claim 80, comprising a donor nucleic acid, optionally wherein the donor nucleic acid is encoded by the nucleic acid expression vector or an additional nucleic acid expression vector.
82. The composition of claim 80 or 81, wherein the nucleic acid expression vector is a viral vector.
83. The composition of claim 82, wherein the viral vector is an adeno associated viral (AAV) vector.
84. A composition comprising a virus, wherein the virus comprises the composition of any one of claims 80-83.
85. A pharmaceutical composition, comprising the composition of any one of claims 1-84, and a pharmaceutically acceptable excipient.
86. A system comprising the composition of any one of claims 1-84, and at least one detection reagent for detecting a target nucleic acid.
87. The system of claim 86, wherein the at least one detection reagent is selected from a reporter nucleic acid, a detection moiety, an additional effector protein, or a combination thereof, optionally wherein the reporter nucleic acid comprises a fluorophore, a quencher, or a combination thereof.
88. The system of claim 86 or 87, comprising at least one amplification reagent for amplifying a target nucleic acid.
89. The system of claim 88, wherein the at least one amplification reagent is selected from the group consisting of a primer, a polymerase, a deoxynucleoside triphosphate (dNTP), a ribonucleoside triphosphate (rNTP), and combinations thereof.
90. The system of any one of claims 86-89, wherein the system comprises a device with a chamber or solid support for containing the composition, target nucleic acid, detection reagent or combination thereof.
91. A method of detecting a target nucleic acid in a sample, comprising the steps of: (a) contacting the sample with: (i) the composition of any one of claims 1-84 or the system of any one of claims 86-89; and (ii) a reporter nucleic acid comprising a detectable moiety that produces a detectable signal in the presence of the target nucleic acid and the composition or system, and (b) detecting the detectable signal.
92. The method of claim 91, wherein the reporter nucleic acid comprises a fluorophore, a quencher, or a combination thereof, and wherein the detecting comprises detecting a fluorescent signal.
93. The method of claim 91 or 92, comprising reverse transcribing the target nucleic acid, amplifying the target nucleic acid, in vitro transcribing the target nucleic acid, or any combination thereof.
94. The method of any one of claims 91-93, comprising reverse transcribing the target nucleic acid and/or amplifying the target nucleic acid before contacting the sample with the composition.
95. The method of any one of claims 91-93, comprising reverse transcribing the target nucleic acid and/or amplifying the target nucleic acid after contacting the sample with the composition.
96. The method of any one of claims 93-95, wherein amplifying comprises isothermal amplification.
97. The method of any one of claims 91-96, wherein the target nucleic acid is from a pathogen.
98. The method of claim 97, wherein the pathogen is a virus.
99. The method of any one of claims 91-98, wherein the target nucleic acid comprises RNA.
100. The method of any one of claims 91-99, wherein the target nucleic acid comprises DNA.
101. A method of modifying a target nucleic acid, the method comprising contacting the target nucleic acid with the composition of any one of claims 1-84, or the system of any one of claims 86-90, thereby modifying the target nucleic acid.
102. The method of claim 101, wherein modifying the target nucleic acid comprises cleaving the target nucleic acid, deleting a nucleotide of the target nucleic acid, inserting a nucleotide into the target nucleic acid, substituting a nucleotide of the target nucleic acid with an alternative nucleotide or an additional nucleotide, or any combination thereof.
103. The method of claim 101 or 102, comprising contacting the target nucleic acid with a donor nucleic acid.
104. The method of any one of claims 101-103, wherein the target nucleic acid comprises a mutation associated with a disease.
105. The method of claim 104, wherein the disease is selected from an autoimmune disease, a cancer, an inherited disorder, an ophthalmological disorder, a metabolic disorder, or a combination thereof.
106. The method of claim 104, wherein the disease is cystic fibrosis, thalassemia, Duchenne muscular dystrophy, myotonic dystrophy Type 1, or sickle cell anemia.
107. The method of any one of claims 101-106, wherein contacting the target nucleic acid comprises contacting a cell, wherein the target nucleic acid is located in the cell.
108. The method of claim 107, wherein the contacting occurs in vitro.
109. The method of claim 107, wherein the contacting occurs in vivo.
110. The method of claim 107, wherein the contacting occurs ex vivo.
111. A cell comprising the composition of any one of claims 1-84.
112. A cell modified by the composition of any one of claims 1-84.
113. A cell modified by the system of any one of claims 86-90.
114. A cell comprising a modified target nucleic acid, wherein the modified target nucleic acid is a target nucleic acid modified according to any one of the methods of claims 101-110.
115. The cell of any one of claims 111-114, wherein the cell is a eukaryotic cell.
116. The cell of any one of claims 111-114, wherein the cell is a mammalian cell.
117. The cell of any one of claims 111-114, wherein the cell is a prokaryotic cell.
118. The cell of any one of claims 111-114, wherein the cell is a plant cell.
119. The cell of any one of claims 111-114, wherein the cell is an animal cell.
120. The cell of claim 119, wherein the cell is a T cell, optionally wherein the T cell is a natural killer T cell (NKT).
121. The cell of claim 115, wherein the cell is a chimeric antigen receptor T cell (CAR T-cell).
122. The cell of claim 115, wherein the cell is an induced pluripotent stem cell (iPSC).
123. A population of cells according to any one of claims 111-122.
124. A method of producing a protein, the method comprising, (i) contacting a cell comprising a target nucleic acid with the composition of any one of claims 1-84, thereby editing the target nucleic acid to produce a modified cell comprising a modified target nucleic acid; and (ii) producing a protein from the cell that is encoded, transcriptionally affected, or translationally affected by the modified nucleic acid.
125. A method of treating a disease comprising administering to a subject in need thereof a composition according to any one of claims 1-84, or a cell according to any one of claims 111-122.
Description
DETAILED DESCRIPTION OF THE INVENTION
[0031] It is to be understood that both the foregoing general description and the following detailed description are exemplary, and explanatory only, and are not restrictive of the disclosure.
[0032] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0033] All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose.
II. Definitions
[0034] Unless otherwise indicated, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless otherwise indicated or obvious from context, the following terms have the following meanings:
[0035] As used in this specification and the appended claims, the singular forms a, an, and the, as used herein, include plural references unless the context clearly dictates otherwise.
[0036] Any reference to or herein is intended to encompass and/or unless otherwise stated. As used herein, the term and/or includes any and all combinations of one or more of the associated listed items.
[0037] Use of the term including as well as other forms, such as includes and included, is not limiting.
[0038] As used herein, the term comprise and its grammatical equivalents specifies the presence of stated features, integers, steps, operations, elements, and/or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.
[0039] As used herein, the term about in reference to a number or range of numbers, is understood to mean the stated number and numbers +/?10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.
[0040] The terms, percent identity, % identity, and % identical, grammatical equivalents thereof, as used herein refer to the extent to which two sequences (nucleotide or amino acid) have the same residue at the same positions in an alignment. For example, an amino acid sequence is X % identical to SEQ ID NO: Y can refer to % identity of the amino acid sequence to SEQ ID NO: Y and is elaborated as X % of residues that are identical between respective positions of two sequences when the two sequences are aligned for maximum sequence identity. The % identity is calculated by dividing the total number of the aligned residues by the number of the residues that are identical between the respective positions of the at least two sequences and multiplying by 100. Generally, computer programs can be employed for such calculations. Illustrative programs that compare and align pairs of sequences, include ALIGN (Myers and Miller, Comput Appl Biosci. 1988 March; 4(1):11-7), FASTA (Pearson and Lipman, Proc Natl Acad Sci USA. 1988 April; 85(8):2444-8; Pearson, Methods Enzymol. 1990; 183:63-98) and gapped BLAST (Altschul et al., Nucleic Acids Res. 1997 Sep. 1; 25(17):3389-40), BLASTP, BLASTN, or GCG (Devereux et al., Nucleic Acids Res. 1984 Jan. 11; 12(1 Pt 1):387-95).
[0041] The term, amplification and amplifying, as used herein refers to a process by which a nucleic acid molecule is enzymatically copied to generate a plurality of nucleic acid molecules containing the same sequence as the original nucleic acid molecule or a distinguishable portion thereof.
[0042] The term, base editing enzyme, as used herein refers to a protein, polypeptide or fragment thereof that is capable of catalyzing the chemical modification of a nucleobase of a deoxyribonucleotide or a ribonucleotide. Such a base editing enzyme, for example, is capable of catalyzing a reaction that modifies a nucleobase that is present in a nucleic acid molecule, such as DNA or RNA (single stranded or double stranded). Non-limiting examples of the type of modification that a base editing enzyme is capable of catalyzing includes converting an existing nucleobase to a different nucleobase, such as converting a cytosine to a guanine or thymine or converting an adenine to a guanine, hydrolytic deamination of an adenine or adenosine, or methylation of cytosine (e.g., CpG, CpA, CpT or CpC). A base editing enzyme itself may or may not bind to the nucleic acid molecule containing the nucleobase.
[0043] The term, base editor, as used herein, refers to a fusion protein comprising a base editing enzyme fused to or linked to an effector protein. The base editing enzyme may be referred to as a fusion partner. The base editing enzyme can differ from a naturally occurring base editing enzyme. It is understood that any reference to a base editing enzyme herein also refers to a base editing enzyme variant. The base editor is functional when the effector protein is coupled to a guide nucleic acid. The guide nucleic acid imparts sequence specific activity to the base editor. By way of non-limiting example, the effector protein may comprise a catalytically inactive effector protein (e.g., a catalytically inactive variant of an effector protein described herein). Also, by way of non-limiting example, the base editing enzyme may comprise deaminase activity. Additional base editors are described herein.
[0044] The term, catalytically inactive effector protein, as used herein, refers to an effector protein that is modified relative to a naturally-occurring effector protein to have a reduced or eliminated catalytic activity relative to that of the naturally-occurring effector protein, but retains its ability to interact with a guide nucleic acid. The catalytic activity that is reduced or eliminated is often a nuclease activity. The naturally-occurring effector protein may be a wildtype protein. In some instances, the catalytically inactive effector protein is referred to as a catalytically inactive variant of an effector protein, e.g., a Cas effector protein.
[0045] The term, cis cleavage, as used herein, refers to cleavage (hydrolysis of a phosphodiester bond) of a target nucleic acid by a complex of an effector protein and a guide nucleic acid (e.g., an RNP complex), wherein at least a portion of the guide nucleic acid is hybridized to at least a portion of the target nucleic acid. Cleavage may occur within or directly adjacent to the portion of the target nucleic acid that is hybridized to the portion of the guide nucleic acid.
[0046] The terms, complementary and complementarity, as used herein, in the context of a nucleic acid molecule or nucleotide sequence, refer to the characteristic of a polynucleotide having nucleotides that can undergo cumulative base pairing with their Watson-Crick counterparts (C with G; or A with T) in a reference nucleic acid in antiparallel orientation. For example, when every nucleotide in a polynucleotide or a specified portion thereof forms a base pair with every nucleotide in an equal length sequence of a reference nucleic acid, that polynucleotide is said to be 100% complementary to the sequence of the reference nucleic acid. In a double stranded DNA or RNA sequence, the upper (sense) strand sequence is, in general, understood as going in the direction from its 5- to 3-end, and the complementary sequence is thus understood as the sequence of the lower (antisense) strand in the same direction as the upper strand. Following the same logic, the reverse sequence is understood as the sequence of the upper strand in the direction from its 3- to its 5-end, while the reverse complement sequence or the reverse complementary sequence is understood as the sequence of the lower strand in the direction of its 5- to its 3-end. Each nucleotide in a double stranded DNA or RNA molecule that is paired with its Watson-Crick counterpart can be referred to as its complementary nucleotide. The complementarity of modified or artificial base pairs can be based on other types of hydrogen bonding and/or hydrophobicity of bases and/or shape complementarity between bases.
[0047] The term, cleavage assay, as used herein, refers to an assay designed to visualize, quantitate or identify cleavage of a nucleic acid. In some instances, the cleavage activity may be cis-cleavage activity. In some instances, the cleavage activity may be trans-cleavage activity.
[0048] The term, clustered regularly interspaced short palindromic repeats (CRISPR), as used herein, refers to a segment of DNA found in the genomes of certain prokaryotic organisms, including some bacteria and archaea, that includes repeated short sequences of nucleotides interspersed at regular intervals between unique sequences of nucleotides derived from the DNA of a pathogen (e.g., virus) that had previously infected the organism and that functions to protect the organism against future infections by the same pathogen.
[0049] The terms, CRISPR RNA and crRNA, as used herein, refer to a type of guide nucleic acid that is RNA comprising a first sequence, often referred to as a spacer sequence, that is capable of hybridizing to a target sequence of a target nucleic acid and a second sequence that is capable of interacting with an effector protein either directly (by being bound by an effector protein) or indirectly crRNA (e.g., by hybridization with a second nucleic acid molecule that can be bound by an effector).
[0050] The first sequence and the second sequence are directly connected to each other or by a linker.
[0051] The term, detectable signal, as used herein, refers to a signal that can be detected using optical, fluorescent, chemiluminescent, electrochemical or other detection methods known in the art.
[0052] The term, donor nucleic acid, as used herein, refers to a nucleic acid that is (designed or intended to be) incorporated into a target nucleic acid or target sequence.
[0053] The term, effector protein, as used herein, refers to a protein, polypeptide, or peptide that is capable of interacting with a nucleic acid, such as a guide nucleic acid, to form a complex that contacts a target nucleic acid, wherein at least a portion of the guide nucleic acid hybridizes to a target sequence of the target nucleic acid. In some embodiments, the complex comprises multiple effector proteins. In some embodiments, the effector protein modifies the target nucleic acid when the (e.g., a RNP complex contacts the target nucleic acid. In some embodiments, the effector protein does not modify the target nucleic acid, but it is fused to a fusion partner protein that modifies the target nucleic acid. A non-limiting example of modifying a target nucleic acid is cleaving (hydrolysis) of a phosphodiester bond. Additional examples of modifying target nucleic acids are described herein.
[0054] The term functional domain, as used herein, refers to a region of one or more amino acids in a protein that is required for an activity of the protein, or the full extent of that activity, as measured in an in vitro assay. Activities include, but are not limited to nucleic acid binding, nucleic acid editing, nucleic acid modifying, nucleic acid cleaving, protein binding. The absence of the functional domain, including mutations of the functional domain, would abolish or reduce activity.
[0055] The term functional fragment, as used herein, refers to a fragment of a protein that retains some function relative to the entire protein. Non-limiting examples of functions are nucleic acid binding, nucleic acid editing, protein binding, nuclease activity, nickase activity, deaminase activity, demethylase activity, or acetylation activity. A functional fragment may be a recognized functional domain, e.g., a catalytic domain such as, but not limited to, a RuvC domain.
[0056] The term, fusion effector, fusion protein, and fusion polypeptide, as used herein, refer to a protein comprising at least two heterologous polypeptides. The fusion protein may comprise one or more effector protein and fusion partner. In some instances, an effector protein and fusion partner are not found connected to one another as a native protein or complex that occurs together in nature.
[0057] As used herein, the terms fusion partner protein or fusion partner, refer to a protein, polypeptide or peptide that is fused, or linked by a linker, to one or more effector protein. The fusion partner can impart some function to the fusion protein that is not provided by the effector protein. The fusion partner may provide a detectable signal. The fusion partner may modify a target nucleic acid, including changing a nucleobase of the target nucleic acid and making a chemical modification to one or more nucleotides of the target nucleic acid. The fusion partner may be capable of modulating the expression of a target nucleic acid. The fusion partner may inhibit, reduce, activate or increase expression of a target nucleic acid via additional proteins or nucleic acid modifications to the target sequence.
[0058] The term, guide nucleic acid, as used herein, refers to a nucleic acid that, when in a complex with one or more polypeptides described herein (e.g., an RNP complex) can impart sequence selectivity to the complex when the complex interacts with a target nucleic acid. A guide nucleic acid may be referred to interchangeably as a guide RNA, however it is understood that guide nucleic acids may comprise deoxyribonucleotides (DNA), ribonucleotides (RNA), a combination thereof (e.g., RNA with a thymine base), biochemically or chemically modified nucleobases (e.g., one or more engineered modifications described herein), or combinations thereof.
[0059] The term, heterologous, as used herein, refers to at least two different polypeptide or nucleic acid sequences that are not found similarly connected to one another in a native nucleic acid or protein, respectively. In some embodiments, fusion proteins comprise an effector protein and a fusion partner protein, wherein the fusion partner protein is heterologous to an effector protein. These fusion proteins may be referred to as a heterologous protein. A protein that is heterologous to the effector protein is a protein that is not covalently linked by an amide bond to the effector protein in nature. In some instances, a heterologous protein is not encoded by a species that encodes the effector protein. In some embodiments, the heterologous protein exhibits an activity (e.g., enzymatic activity) when it is fused to the effector protein. In some embodiments, the heterologous protein exhibits increased or reduced activity (e.g., enzymatic activity) when it is fused to the effector protein, relative to when it is not fused to the effector protein. In some embodiments, the heterologous protein exhibits an activity (e.g., enzymatic activity) that it does not exhibit when it is fused to the effector protein. A guide nucleic acid may comprise heterologous sequences, e.g., a guide nucleic acid may comprise a first sequence and a second sequence, wherein the first sequence and the second sequence are not found covalently linked by a phosphodiester bond in nature. Thus, the first sequence is considered to be heterologous with the second sequence, and the guide nucleic acid may be referred to as a heterologous guide nucleic acid.
[0060] The term, in vitro, as used herein, refers to describing something outside an organism. An in vitro system, composition or method may take place in a container for holding laboratory reagents such that it is separated from the biological source from which a material in the container is obtained. In vitro assays can encompass cell-based assays in which living or dead cells are employed. In vitro assays can also encompass a cell-free assay in which no intact cells are employed. The term in vivo is used to describe an event that takes place within an organism. The term ex vivo is used to describe an event that takes place in a cell that has been obtained from an organism. An ex vivo assay is not performed on a subject. Rather, it is performed upon a sample separate from a subject.
[0061] The term, linked amino acids as used herein refers to at least two amino acids linked by an amide bond.
[0062] The term, linker, as used herein, refers to a covalent bond or molecule that links a first polypeptide to a second polypeptide (e.g., by an amide bond) or a first nucleic acid to a second nucleic acid (e.g., by a phosphodiester bond).
[0063] The term, edited target nucleic acid, as used herein, refers to a target nucleic acid, wherein the target nucleic acid has undergone an editing, for example, after contact with an effector protein. In some instances, the editing is an alteration in the sequence of the target nucleic acid. In some instances, the edited target nucleic acid comprises an insertion, deletion, or substitution of one or more nucleotides compared to the unedited target nucleic acid.
[0064] The terms, mutation associated with a disease and mutation associated with a genetic disorder, as used herein, refer to the co-occurrence of a mutation and the phenotype of a disease. The mutation may occur in a gene, wherein transcription or translation products from the gene occur at a significantly abnormal level or in an abnormal form in a cell or subject harboring the mutation as compared to a non-disease control subject not having the mutation.
[0065] The terms, non-naturally occurring and engineered, as used herein, refer to indicate involvement of the hand of man. The terms, when referring to a nucleic acid, nucleotide, protein, polypeptide, peptide or amino acid, refer to a molecule, such as but not limited to, a nucleic acid, nucleotide, protein, polypeptide, peptide or amino acid that is at least substantially free from at least one other feature with which it is naturally associated in nature and as found in nature, and/or contains or to a modification of that molecule (e.g., chemical modification, nucleotide sequence, or amino acid sequence) that is not present in the naturally occurring molecule. The terms, when referring to a composition or system described herein, refer to a composition or system having at least one component that is not naturally associated with the other components of the composition or system. By way of a non-limiting example, a composition may include an effector protein and a guide nucleic acid that do not naturally occur together. Conversely, and as a non-limiting further clarifying example, an effector protein or guide nucleic acid that is natural, naturally-occurring, or found in nature includes an effector protein and a guide nucleic acid from a cell or organism that have not been genetically modified by the hand of man.
[0066] The terms, nuclease and endonuclease as used herein, refer to an enzyme which possesses catalytic activity for nucleic acid cleavage.
[0067] The term, nuclease activity, as used herein, refers to catalytic activity that results in nucleic acid cleavage (e.g., ribonuclease activity (ribonucleic acid cleavage), or deoxyribonuclease activity (deoxyribonucleic acid cleavage), etc.).
[0068] The term, nucleic acid expression vector, as used herein, refers to a plasmid that can be used to express a nucleic acid of interest.
[0069] The term, nuclear localization signal (NLS), as used herein, refers to an entity (e.g., peptide) that facilitates localization of a nucleic acid, protein, or small molecule to the nucleus, when present in a cell that contains a nuclear compartment.
[0070] The term, prime editing enzyme, as used herein, refers to a protein, polypeptide, or fragment thereof that is capable of catalyzing the editing (insertion, deletion, or base-to-base conversion) of a target nucleotide or nucleotide sequence in a nucleic acid. A prime editing enzyme capable of catalyzing such a reaction includes a reverse transcriptase. A prime editing enzyme may require a prime editing guide RNA (pegRNA) to catalyze the modification. Such a pegRNA can be capable of identifying the nucleotide or nucleotide sequence in the target nucleic acid to be edited and encoding the new genetic information that replaces the targeted nucleotide or nucleotide sequence in the nucleic acid. A prime editing enzyme may require a prime editing guide RNA (pegRNA) and a single guide RNA to catalyze the modification.
[0071] The terms protospacer adjacent motif and PAM, as used herein, refer to a nucleotide sequence found in a target nucleic acid that directs an effector protein to edit the target nucleic acid at a specific location. In some instances, a PAM is required for a complex of an effector protein and a guide nucleic acid (e.g., an RNP complex) to hybridize to and edit the target nucleic acid. In some instances, the complex does not require a PAM to edit the target nucleic acid.
[0072] The term recombinant, as used herein, in the context of proteins, polypeptides, peptides and nucleic acids, refers to proteins, polypeptides, peptides and nucleic acids that are products of various combinations of cloning, restriction, and/or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems. Generally, DNA sequences encoding the structural coding sequence can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system. Such sequences can be provided in the form of an open reading frame uninterrupted by internal non translated sequences, or introns, which are typically present in eukaryotic genes. Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of non-translated DNA may be present 5 or 3 from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions and may act to modulate production of a desired product by various mechanisms (see DNA regulatory sequences, below).
[0073] The term recombinant polynucleotide or recombinant nucleic acid refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. The term, recombinant polypeptide, refers to a polypeptide which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of amino sequence through human intervention. Thus, e.g., a polypeptide that comprises a heterologous amino acid sequence is recombinant.
[0074] The terms, reporter and reporter nucleic acid, as used herein, refer to a non-target nucleic acid molecule that can provide a detectable signal upon cleavage by an effector protein. Examples of detectable signals and detectable moieties that generate detectable signals are provided herein.
[0075] The term, sample, as used herein, refers to something comprising a target nucleic acid. In some instances, the sample is a biological sample, such as a biological fluid or tissue sample. In some instances, the sample is an environmental sample. The sample may be a biological sample or environmental sample that is modified or manipulated. By way of non-limiting example, samples may be modified or manipulated with purification techniques, heat, nucleic acid amplification, salts and buffers.
[0076] The term, subject, as used herein can be a biological entity containing expressed genetic materials. The biological entity can be a plant, animal, or microorganism, including, for example, bacteria, viruses, fungi, and protozoa. The subject can be tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro. The subject can be a mammal. The mammal can be a human. The subject may be diagnosed or suspected of being at high risk for a disease. In some embodiments, the subject is not necessarily diagnosed or suspected of being at high risk for the disease.
[0077] The term, target nucleic acid, as used herein, refers to a nucleic acid that is selected as the nucleic acid for editing, binding, hybridization or any other activity of or interaction with a nucleic acid, protein, polypeptide, or peptide described herein. A target nucleic acid may comprise RNA, DNA, or a combination thereof. A target nucleic acid may be single-stranded (e.g., single-stranded RNA or single-stranded DNA) or double-stranded (e.g., double-stranded DNA).
[0078] The term, target sequence, as used herein, in the context of a target nucleic acid, refers to a nucleotide sequence found within a target nucleic acid. Such a nucleotide sequence can, for example, hybridize to a respective length portion of a guide nucleic acid.
[0079] The term, trans-activating RNA (tracrRNA), transactivating RNA, and tracrRNA, as used herein refers to a nucleic acid that comprises a first sequence that is capable of being non-covalently bound by an effector protein. TracrRNAs may comprise a second sequence that hybridizes to a portion of a crRNA, which may be referred to as a repeat hybridization sequence. In some embodiments, tracrRNAs are covalently linked to a crRNA.
[0080] The term, transcriptional activator, as used herein, refers to a polypeptide or a fragment thereof that can activate or increase transcription of a target nucleic acid molecule.
[0081] The term, transcriptional repressor, as used herein, refers to a polypeptide or a fragment thereof that is capable of arresting, preventing, or reducing transcription of a target nucleic acid.
[0082] The terms, treatment and treating, as used herein, refer to a pharmaceutical or other intervention regimen for obtaining beneficial or desired results in the recipient. Beneficial or desired results include but are not limited to a therapeutic benefit and/or a prophylactic benefit. A therapeutic benefit may refer to eradication or amelioration of symptoms or of an underlying disorder being treated. Also, a therapeutic benefit can be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder. A prophylactic effect includes delaying, preventing, or eliminating the appearance of a disease or condition, delaying, or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof. For prophylactic benefit, a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease may undergo treatment, even though a diagnosis of this disease may not have been made.
[0083] The term, viral vector, as used herein, refers to a nucleic acid to be delivered into a host cell by a recombinantly produced virus or viral particle. The nucleic acid may be single-stranded or double stranded, linear or circular, segmented or non-segmented. The nucleic acid may comprise DNA, RNA, or a combination thereof.
III. Introduction
[0084] Disclosed herein are compositions, systems and methods comprising at least one of: [0085] (a) a polypeptide or a nucleic acid encoding the polypeptide; and [0086] (b) a guide nucleic acid or a nucleic acid encoding the guide nucleic acid.
[0087] Polypeptides described herein may bind and, optionally, cleave nucleic acids in a sequence-specific manner. The term nucleic acid refers to a polymer of nucleotides. A nucleic acid may comprise ribonucleotides, deoxyribonucleotides, combinations thereof, and modified versions of the same. A nucleic acid may be single-stranded or double-stranded, unless specified. Non-limiting examples of nucleic acids are double stranded DNA (dsDNA), single stranded (ssDNA), messenger RNA, genomic DNA, cDNA, DNA-RNA hybrids, and a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. Accordingly, nucleic acids as described herein may comprise one or more mutations, one or more engineered modifications, or both. The terms nucleotide(s) and nucleoside(s) as used herein, in the context of a nucleic acid molecule having multiple residues, refer to describing the sugar and base of the residue contained in the nucleic acid molecule. Similarly, a skilled artisan could understand that linked nucleotides and/or linked nucleosides, as used in the context of a nucleic acid having multiple linked residues, are interchangeable and describe linked sugars and bases of residues contained in a nucleic acid molecule. When referring to a nucleobase(s), or linked nucleobase, as used in the context of a nucleic acid molecule, it can be understood as describing the base of the residue contained in the nucleic acid molecule, for example, the base of a nucleotide, nucleosides, or linked nucleotides or linked nucleosides. A person of ordinary skill in the art when referring to nucleotides, nucleosides, and/or nucleobases would also understand the differences between RNA and DNA (generally the exchange of uridine for thymidine or vice versa) and the presence of nucleoside analogs, such as modified uridines, do not contribute to differences in identity or complementarity among polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement). Thus, for example, the sequence 5-AXG where X is any modified uridine, such as pseudouridine, NI-methyl pseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5-CAU).
[0088] The terms polypeptide and protein refer to a polymeric form of amino acids. A polypeptide may include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. Accordingly, polypeptides as described herein may comprise one or more mutations, one or more engineered modifications, or both. It is understood that when describing coding sequences of polypeptides described herein, said coding sequences do not necessarily require a codon encoding an N-terminal Methionine (M) or a Valine (V) as described for the effector proteins described herein. One skilled in the art would understand that a start codon could be replaced or substituted with a start codon that encodes for an amino acid residue sufficient for initiating translation in a host cell. In some embodiments, when a heterologous peptide, such as a fusion partner protein, protein tag or NLS, is located at the N terminus of the effector protein, a start codon for the heterologous peptide serves as a start codon for the effector protein as well. Thus, the natural start codon encoding an amino acid residue sufficient for initiating translation (e.g., Methionine (M) or a Valine (V)) of the effector protein may be removed or absent.
[0089] Polypeptides described herein may also cleave the target nucleic acid within a target sequence or at a position adjacent to the target sequence. In some embodiments, a polypeptide is activated when it binds a certain sequence of a nucleic acid described herein, allowing the polypeptide to cleave a region of a target nucleic acid that is near, but not adjacent to the target sequence. A polypeptide may be an effector protein, such as a CRISPR-associated (Cas) protein, which may bind a guide nucleic acid that imparts activity or sequence selectivity to the polypeptide.
[0090] The terms cleave, cleaving, and cleavage in the context of a nucleic acid molecule or nuclease activity of an effector protein, refer to the hydrolysis of a phosphodiester bond of a nucleic acid molecule that results in breakage of that bond. The result of this breakage can be a nick (hydrolysis of a single phosphodiester bond on one side of a double-stranded molecule), single strand break (hydrolysis of a single phosphodiester bond on a single-stranded molecule) or double strand break (hydrolysis of two phosphodiester bonds on both sides of a double-stranded molecule) depending upon whether the nucleic acid molecule is single-stranded (e.g., ssDNA or ssRNA) or double-stranded (e.g., dsDNA) and the type of nuclease activity being catalyzed by the effector protein . . .
[0091] In some embodiments, compositions, systems, and methods comprising effector proteins and guide nucleic acids comprise a first sequence, at least a portion of which interacts with a polypeptide. In some embodiments, the first sequence comprises a sequence that is similar or identical to a repeat sequence. The term repeat sequence refers to a sequence of nucleotides in a guide nucleic acid that is capable of, at least partially, interacting with an effector protein. In some embodiments, compositions, systems, and methods comprising effector proteins and guide nucleic acids comprise a second sequence that is at least partially complementary to a target nucleic acid, and which may be referred to as a spacer sequence. Spacer sequence, as used herein, refers to a nucleotide sequence in a guide nucleic acid that is capable of, at least partially, hybridizing to an equal length portion of a sequence (e.g., a target sequence) of a target nucleic acid.
[0092] Effector proteins disclosed herein may cleave nucleic acids, including single stranded RNA (ssRNA), double stranded DNA (dsDNA), and single-stranded DNA (ssDNA). Polypeptides disclosed herein may provide cis cleavage activity, nickase activity, nuclease activity, or a combination thereof. In some embodiments, the present disclosure provides a viral vector comprising a nucleic acid encoding an effector protein. Non-limiting examples of viral vectors include retroviral vectors (e.g., lentiviruses and ?-retroviruses), adenoviruses, arenaviruses, alphaviruses, adeno-associated viruses (AAVs), baculoviruses, vaccinia viruses, herpes simplex viruses and poxviruses. A viral vector may be replication competent, replication deficient or replication defective.
[0093] The compositions, systems and methods described herein are non-naturally occurring. In some embodiments, compositions, systems and methods comprise an engineered guide nucleic acid (also referred to herein as a guide nucleic acid) or a use thereof. In some embodiments, compositions, systems and methods comprise an engineered protein or a use thereof. In some embodiments, compositions, systems and methods comprise an isolated polypeptide or a use thereof. In general, compositions, methods and systems described herein are not found in nature. In some embodiments, compositions, methods and systems described herein comprise at least one non-naturally occurring component. For example, disclosed compositions, methods and systems may comprise a guide nucleic acid, wherein the sequence of the guide nucleic acid is different or modified from that of a naturally-occurring guide nucleic acid.
[0094] In some embodiments, compositions, systems, and methods comprise at least two components that do not naturally occur together. For example, disclosed compositions, systems and methods may comprise a guide nucleic acid comprising a first region, at least a portion of which, interacts with a polypeptide (e.g., a repeat sequence), and a second region that is at least partially complementary to a target nucleic acid (e.g., a spacer sequence), wherein the first region and second region do not naturally occur together. Also, by way of non-limiting example, disclosed compositions, systems, and methods may comprise a guide nucleic acid and an effector protein that do not naturally occur together. Likewise, by way of non-limiting example, disclosed compositions, systems, and methods may comprise a ribonucleotide-protein (RNP) complex comprising an effector protein and a guide nucleic acid that do not occur together in nature. Conversely, and for clarity, an effector protein or guide nucleic acid that is natural, naturally-occurring, or found in nature includes effector proteins and guide nucleic acids from cells or organisms that have not been genetically modified by a human or machine.
[0095] The terms, ribonucleotide protein complex and RNP as used herein, refer to a complex of one or more nucleic acids and one or more polypeptides described herein. While the term utilizes ribonucleotides it is understood that the one or more nucleic acid may comprise deoxyribonucleotides (DNA), ribonucleotides (RNA), a combination thereof (e.g., RNA with a thymine base), biochemically or chemically modified nucleobases (e.g., one or more engineered modifications described herein), or combinations thereof.
[0096] The terms, % complementary, % complementarity, percent complementary, percent complementarity and grammatical equivalents thereof in the context of two or more nucleic acid molecules, refer to the percent of nucleotides in two nucleotide sequences in said nucleic acid molecules of equal length that can undergo cumulative base pairing at two or more individual corresponding positions in an antiparallel orientation. Accordingly, the terms include nucleic acid sequences that are not completely complementary over their entire length, which indicates that the two or more nucleic acid molecules include one or more mismatches. A mismatch is present at any position in the two opposed nucleotides that are not complementary. The % complementary is calculated by dividing the total number of the complementary residues by the total number of the nucleotides in one of the equal length sequences, and multiplying by 100. Complete or total complementarity describes nucleotide sequences in 100% of the residues of a nucleotide sequence are complementary to residues in a reference nucleotide sequence. Partially complementarity describes nucleotide sequences in which at least 20%, but less than 100%, of the residues of a nucleotide sequence are complementary to residues in a reference nucleotide sequence. In some instances, at least 50%, but less than 100%, of the residues of a nucleotide sequence are complementary to residues in a reference nucleotide sequence. In some instances, at least 70%, 80%, 90% or 95%, but less than 100%, of the residues of a nucleotide sequence are complementary to residues in a reference nucleotide sequence. Noncomplementary describes nucleotide sequences in which less than 20% of the residues of a nucleotide sequence are complementary to residues in a reference nucleotide sequence.
[0097] In some embodiments, the guide nucleic acid comprises a non-natural nucleotide sequence. In some embodiments, the non-natural nucleotide sequence is a nucleotide sequence that is not found in nature. The non-natural nucleotide sequence may comprise a portion of a naturally-occurring sequence, wherein the portion of the naturally-occurring sequence is not present in nature absent the remainder of the naturally-occurring sequence. In some embodiments, the guide nucleic acid comprises two naturally-occurring sequences arranged in an order or proximity that is not observed in nature. In some embodiments, compositions and systems comprise a ribonucleotide complex comprising an effector protein and a guide nucleic acid that do not occur together in nature. Guide nucleic acids may comprise a first sequence and a second sequence that do not occur naturally together. For example, a guide nucleic acid may comprise a naturally-occurring repeat sequence and a spacer sequence that is complementary to a naturally-occurring eukaryotic sequence. The guide nucleic acid may comprise a repeat sequence that occurs naturally in an organism and a spacer sequence that does not occur naturally in that organism. A guide nucleic acid may comprise a first sequence that occurs in a first organism and a second sequence that occurs in a second organism, wherein the first organism and the second organism are different. The guide nucleic acid may comprise a third sequence disposed at a 3 or 5 end of the guide nucleic acid, or between the first and second sequences of the guide nucleic acid. In some embodiments, the guide nucleic acid comprises two heterologous sequences arranged in an order or proximity that is not observed in nature. Therefore, compositions and systems described herein are not naturally occurring.
[0098] In some embodiments, compositions, systems, and methods described herein comprise an effector protein that is similar to a naturally occurring effector protein. The effector protein may lack a portion of the naturally occurring effector protein. The effector protein may comprise a mutation relative to the naturally-occurring effector protein, wherein the mutation is not found in nature. The term mutation refers to an alteration that changes an amino acid residue or a nucleotide as described herein. Such an alteration can include, for example, deletions, insertions, and/or substitutions. The mutation can refer to a change in structure of an amino acid residue or nucleotide relative to the starting or reference residue or nucleotide. A mutation of an amino acid residue includes, for example, deletions, insertions and substituting one amino acid residue for a structurally different amino acid residue. Such substitutions can be a conservative substitution, a non-conservative substitution, a substitution to a specific sub-class of amino acids, or a combination thereof as described herein. A mutation of a nucleotide includes, for example, changing one naturally occurring base for a different naturally occurring base, such as changing an adenine to a thymine or a guanine to a cytosine or an adenine to a cytosine or a guanine to a thymine. A mutation of a nucleotide base may result in a structural and/or functional alteration of the encoding peptide, polypeptide or protein by changing the encoded amino acid residue of the peptide, polypeptide or protein. A mutation of a nucleotide base may not result in an alteration of the amino acid sequence or function of encoded peptide, polypeptide or protein, also known as a silent mutation. Methods of mutating an amino acid residue or a nucleotide are well known.
[0099] The effector protein may also comprise at least one additional amino acid relative to the naturally-occurring effector protein. In some embodiments, the effector protein may comprise a heterologous polypeptide. For example, the effector protein may comprise an addition of a nuclear localization signal relative to the natural occurring effector protein. In some embodiments, a nucleotide sequence encoding the effector protein is codon optimized (e.g., for expression in a eukaryotic cell) relative to the naturally occurring sequence.
[0100] The term codon optimized refers to a mutation of a nucleotide sequence encoding a polypeptide, such as a nucleotide sequence encoding an effector protein, to mimic the codon preferences of the intended host organism or cell while encoding the same polypeptide. Thus, the codons can be changed, but the encoded polypeptide remains unchanged. For example, if the intended target cell was a human cell, a human codon-optimized nucleotide sequence encoding an effector protein could be used. As another non-limiting example, if the intended host cell were a mouse cell, then a mouse codon-optimized nucleotide sequence encoding an effector protein could be generated. As another non-limiting example, if the intended host cell were a eukaryotic cell, then a eukaryote codon-optimized nucleotide sequence encoding an effector protein could be generated. As another non-limiting example, if the intended host cell were a prokaryotic cell, then a prokaryote codon-optimized nucleotide sequence encoding an effector protein could be generated. Codon usage tables are readily available, for example, at the Codon Usage Database available at www.kazusa.or.jp/codon.
IV. Polypeptide Systems
Effector Proteins
[0101] Provided herein are compositions, systems, and methods comprising one or more effector proteins or a use thereof. In some embodiments, provided herein are compositions that comprise a nucleic acid, wherein the nucleic acid encodes any of one the effector proteins described herein. The nucleic acid may be a nucleic acid expression vector. By way of non-limiting example, the nucleic acid expression vector may be a viral vector, such as an AAV vector. In general, effector proteins disclosed herein are CRISPR-associated (Cas) proteins.
[0102] An effector protein provided herein interacts with a guide nucleic acid to form a complex. In some embodiments, the complex interacts with a target nucleic acid. In some embodiments, an interaction between the complex and a target nucleic acid comprises one or more of: recognition of a protospacer adjacent motif (PAM) sequence within the target nucleic acid by the effector protein, hybridization of the guide nucleic acid to the target nucleic acid, modification of the target nucleic acid by the effector protein, or combinations thereof. In some embodiments, recognition of a PAM sequence within a target nucleic acid may direct the modification activity of an effector protein.
[0103] The terms, hybridize, hybridizable and grammatical equivalents thereof, refer to a nucleotide sequence that is able to noncovalently interact, i.e. form Watson-Crick base pairs and/or G/U base pairs, or anneal, to another nucleotide sequence in a sequence-specific, antiparallel, manner (i.e., a nucleotide sequence specifically interacts to a complementary nucleotide sequence) under the appropriate in vitro and/or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C) for both DNA and RNA. In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization of a DNA molecule with an RNA molecule (e.g., when a DNA target nucleic acid base pairs with a guide RNA, etc.): guanine (G) can also base pair with uracil (U). For example, G/U base-pairing is at least partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. Thus, a guanine (G) can be considered complementary to both an uracil (U) and to an adenine (A). Accordingly, when a G/U base-pair can be made at a given nucleotide position, the position is not considered to be non-complementary, but is instead considered to be complementary. While hybridization typically occurs between two nucleotide sequences that are complementary, mismatches between bases are possible. It is understood that two nucleotide sequences need not be 100% complementary to be specifically hybridizable, hybridizable, partially hybridizable, or for hybridization to occur. Moreover, a nucleotide sequence may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a bulge, a loop structure or hairpin structure, etc.). The conditions appropriate for hybridization between two nucleotide sequences depend on the length of the sequence and the degree of complementarity, variables which are well known in the art. For hybridizations between nucleic acids with short stretches of complementarity (e.g. complementarity over 35 or less, 30 or less, 25 or less, 22 or less, 20 or less, or 18 or less nucleotides) the position of mismatches may become important (see Sambrook et al., supra, 11.7-11.8). Typically, the length for a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more). Any suitable in vitro assay may be utilized to assess whether two sequences hybridize. One such assay is a melting point analysis where the greater the degree of complementarity between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. The conditions of temperature and ionic strength determine the stringency of the hybridization. Temperature, wash solution salt concentration, and other conditions may be adjusted as necessary according to factors such as length of the region of complementation and the degree of complementation. Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11.1 therein; and Sambrook, J. and Russell, W., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001).
[0104] Modification activity of an effector protein or an engineered protein described herein may be cleavage activity, binding activity, insertion activity, substitution activity, and the like. Modification activity of an effector protein may result in: cleavage of at least one strand of a target nucleic acid, deletion of one or more nucleotides of a target nucleic acid, insertion of one or more nucleotides into a target nucleic acid, substitution of one or more nucleotides of a target nucleic acid with an alternative nucleotide, more than one of the foregoing, or any combination thereof. In some embodiments, an ability of an effector protein to edit a target nucleic acid may depend upon the effector protein being complexed with a guide nucleic acid, the guide nucleic acid being hybridized to a target sequence of the target nucleic acid, the distance between the target sequence and a PAM sequence, or combinations thereof. A target nucleic acid comprises a target strand and a non-target strand. Accordingly, in some embodiments, the effector protein may edit a target strand and/or a non-target strand of a target nucleic acid.
[0105] The terms, bind, binding, interact and interacting, refer to a non-covalent interaction between macromolecules (e.g., between two polypeptides, between a polypeptide and a nucleic acid; between a polypeptide/guide nucleic acid complex and a target nucleic acid; and the like). While in a state of noncovalent interaction, the macromolecules are said to be associated or interacting or binding (e.g., when a molecule X is said to interact with a molecule Y, it is meant the molecule X binds to molecule Y in a non-covalent manner). Non-limiting examples of non-covalent interactions are ionic bonds, hydrogen bonds, van der Waals and hydrophobic interactions. Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), but some portions of a binding interaction may be sequence-specific.
[0106] The modification of the target nucleic acid generated by an effector protein may, as a non-limiting example, result in modulation of the expression of the target nucleic acid (e.g., increasing or decreasing expression of the nucleic acid) or modulation of the activity of a translation product of the target nucleic acid (e.g., inactivation of a protein binding to an RNA molecule or hybridization). Accordingly, in some embodiments, provided herein are methods of editing a target nucleic acid using an effector protein of the present disclosure, or compositions or systems thereof. Also provided herein are methods of modulating expression of a target nucleic acid using an effector protein of the present disclosure, or compositions or systems thereof. Further provided herein are methods of modulating the activity of a translation product of a target nucleic acid using an effector protein of the present disclosure, or compositions or systems thereof.
[0107] In some embodiments, effector proteins disclosed herein may provide cleavage activity, such as cis cleavage activity, nickase activity, nuclease activity, or a combination thereof. In general, effector proteins described herein edit a target nucleic acid by cis cleavage activity on the target nucleic acid. Effector proteins disclosed herein may cleave nucleic acids, including single stranded RNA (ssRNA), double stranded DNA (dsDNA), and single-stranded DNA (ssDNA). An effector protein may be a modified effector protein having increased modification activity and/or increased substrate binding activity (e.g., substrate selectivity, specificity, and/or affinity). Alternatively, or in addition, an effector protein may be a catalytically inactive effector protein having reduced modification activity or no modification activity. An effector protein may recognize a protospacer adjacent motif (PAM) sequence present in the target nucleic acid, which may direct the modification activity of the effector protein. The term nickase refers to an enzyme that possess catalytic activity for single stranded nucleic acid cleavage of a double stranded nucleic acid. The term, nickase activity refers to catalytic activity that results in single stranded nucleic acid cleavage of a double stranded nucleic acid.
[0108] An effector protein may be a CRISPR-associated (Cas) protein. An effector protein may function as a single protein, including a single protein that is capable of binding to a guide nucleic acid and editing a target nucleic acid. Alternatively, an effector protein may function as part of a multiprotein complex, including, for example, a complex having two or more effector proteins, including two or more of the same effector proteins (e.g., dimer or multimer). An effector protein, when functioning in a multiprotein complex, may have only one functional activity (e.g., binding to a guide nucleic acid), while other effector proteins present in the multiprotein complex are capable of the other functional activity (e.g., modifying a target nucleic acid). The first and second effector proteins may be the same. The first and second effector proteins may be different. The sequences of the first and second effector proteins may be 15% to 20% identical, 20% to 25% identical, 25% to 30% identical, 30% to 35% identical, 35% to 40% identical, 40% to 45% identical, 45% to 50% identical, 50% to 55% identical, 55% to 60% identical, 60% to 65% identical, 65% to 70% identical, 70% to 75% identical, 75% to 80% identical, 80% to 85% identical, 85% to 90% identical, 90% to 95% identical, 95% to 99.9% identical, or 100% identical. An effector protein, when functioning in a multiprotein complex, may have differing and/or complementary functional activity to other effector proteins in the multiprotein complex. Multimeric complexes, and functions thereof, are described in further detail below.
[0109] Effector proteins may be a modified effector protein having reduced modification activity (e.g., a catalytically defective effector protein). Effector proteins may be a modified effector protein having no modification activity (e.g., a catalytically inactive effector protein). In some embodiments, the effector protein may have a mutation in a nuclease domain. In some embodiments, the nuclease domain is a RuvC domain. In some embodiments, the nuclease domain is an HNH domain. An HNH domain may be characterized as comprising two antiparallel ?-strands connected with a loop of varying length, and flanked by an ?-helix, with a metal (divalent cation) binding site between the two ?-strands. A RuvC domain may be characterized by a six-stranded beta sheet surrounded by four alpha helices, with three conserved subdomains contributing catalytic to the activity of the RuvC domain.
[0110] The terms, RuvC and RuvC domain, as used herein, refer to a region of an effector protein that is capable of cleaving a target nucleic acid, and in certain instances, of processing a pre-crRNA. In some instances, the RuvC domain is located near the C-terminus of the effector protein. A single RuvC domain may comprise RuvC subdomains, for example a RuvCI subdomain, a RuvCII subdomain and a RuvCIII subdomain. The term RuvC domain can also refer to a RuvC-like domain. Various RuvC-like domains are known in the art and are easily identified using online tools such as InterPro (https://www.ebi.ac.uk/interpro/). For example, a RuvC-like domain may be a domain which shares homology with a region of TnpB proteins of the IS605 and other related families of transposons.
[0111] An effector protein may be brought into proximity of a target nucleic acid in the presence of a guide nucleic acid when the guide nucleic acid includes a nucleotide sequence that is complementary with a target sequence in the target nucleic acid. The ability of an effector protein to modify a target nucleic acid may be dependent upon the effector protein being bound to a guide nucleic acid and the guide nucleic acid being hybridized to a target nucleic acid. An effector protein may recognize a protospacer adjacent motif (PAM) sequence present in the target nucleic acid, which may direct the modification activity of the effector protein.
[0112] In some instances, effector proteins comprise an amino acid sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist essentially of an amino acid sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 65%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 65% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 70%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 70% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 75%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 75% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 80%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 85%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 85% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 90%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 90% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 95%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 95% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 97%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 97% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 98%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 98% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is at least 99%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is at least 99% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise an amino acid sequence that is 100%, identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins consist of an amino acid sequence that is 100% identical to a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165.
[0113] TABLE 1 provides illustrative amino acid sequences of effector proteins that are useful in the compositions, systems and methods described herein.
[0114] In some embodiments, compositions, systems and methods described herein comprise an effector protein, or a nucleic acid encoding the effector protein, wherein the amino acid sequence of the effector protein comprises at least about 200 contiguous amino acids or more of any one of the sequences recited in TABLE 1. In some embodiments, the amino acid sequence of an effector protein provided herein comprises at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, at least about 200, at least about 220, at least about 240, at least about 260, at least about 280, at least about 300, at least about 320, at least about 340, at least about 360, at least about 380, at least about 400 contiguous amino acids, at least about 420, at least about 440, at least about 460, at least about 480, at least about 500, at least about 520, at least about 540, at least about 560, at least about 580, at least about 600, at least about 620, at least about 640, at least about 660, at least about 680, at least about 700, at least about 720, at least about 740, at least about 760, at least about 780, at least about 800, at least about 820, at least about 840, at least about 860, at least about 880, at least about 900, at least about 920, at least about 940, at least about 960, at least about 980, at least about 1000, at least about 1020, at least about 1040, at least about 1060, at least about 1080, at least about 1100, at least about 1120, at least about 1140, at least about 1160, at least about 1180, or at least about 1200 contiguous amino acids of a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165. In some instances, effector proteins comprise less than about 1900, less than about 1850, less than about 1800, less than about 1750, less than about 1700, or less than about 1650 contiguous amino acids of a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165.
[0115] In some instances, effector proteins comprise about 100, about 120, about 140, about 160, about 180, about 200, about 220, about 240, about 260, about 280, about 300, about 320, about 340, about 360, about 380, about 400, about 420, about 440, about 460, about 480, about 500, about 520, about 540, about 560, about 580, about 600, about 620, about 640, about 660, about 680, about 700, about 720, about 740, about 760, about 780, about 800, about 820, about 840, about 860, about 880, about 900, about 920, about 940, about 960, about 980, about 1000, about 1020, about 1040, about 1060, about 1080, about 1100, about 1120, about 1140, about 1160, about 1180, about 1200, about 1220, about 1240, about 1260, about 1280, about 1300, about 1320, about 1340, about 1360, about 1380, or about 1400 contiguous amino acids of a sequence selected from any one of SEQ ID NOS: 1-10,484 or 15,022-24,165.
[0116] In some instances, compositions comprise an engineered guide nucleic acid (also referred to simply as a guide nucleic acid), wherein the guide nucleic acid comprises a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319. In some instances, guide nucleic acids comprise a sequence that is complementary to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319. In some instances, guide nucleic acids comprise a sequence that is reverse complementary to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319. In some instances, guide nucleic acids comprise a sequence that is at least 65% identical to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof. In some instances, guide nucleic acids comprise a sequence that is at least 70% identical to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof. In some instances, guide nucleic acids comprise a sequence that is at least 75% identical to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof. In some instances, guide nucleic acids comprise a sequence that is at least 80% identical to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof. In some instances, guide nucleic acids comprise a sequence that is at least 85% identical to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof. In some instances, guide nucleic acids comprise a sequence that is at least 90% identical to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof. In some instances, guide nucleic acids comprise a sequence that is 100% identical to a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof.
[0117] In some instances, guide nucleic acids comprise at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39 or at least 40 contiguous nucleotides of a nucleobase sequence selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof. In some instances, guide nucleic acids contain less than 32, less than 34, less than 36, less than 37, less than 38, less than 39, less than 40, less than 41, less than 42, less than 43, less than 44, or less than 45 contiguous nucleotides of any one of the nucleobase sequences selected from any one of SEQ ID NOS: 10,485-15,015 or 24,166-31,319, the complement thereof, or the reverse complement thereof. In some instances, guide nucleic acids comprise 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 contiguous nucleotides of any one of the nucleobase sequences selected from any one of SEQ ID NOS: 10,485-15,015 or 24, 166-31,319, the complement thereof, or the reverse complement thereof.
[0118] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
[0119] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
[0120] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
[0121] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 50% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 50% identical or at least about 50% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
[0122] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 60% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 60% identical or at least about 60% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
[0123] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 70% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 70% identical or at least about 70% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
[0124] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 80% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about or 80% identical or at least about 80% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
[0125] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 90% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 90% identical or at least about 90% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
[0126] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 95% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 95% identical or at least 95% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
[0127] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column A1 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column B1 of TABLE 1, wherein the sequence from Column A1 and the sequence from Column B1 are in the same row of TABLE 1.
[0128] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 50% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 50% identical or at least about 50% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
[0129] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 60% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 60% identical or at least about 60% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
[0130] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 70% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 70% identical or at least about 70% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
[0131] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 80% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 80% identical or at least about 80% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
[0132] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 90% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 90% identical or at least about 90% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
[0133] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 95% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 95% identical or at least about 95% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
[0134] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column A2 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column B2 of TABLE 1, wherein the sequence from Column A2 and the sequence from Column B2 are in the same row of TABLE 1.
[0135] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 50% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 50% identical or at least about 50% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
[0136] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 60% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 60% identical or at least about 60% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
[0137] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 70% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 70% identical or at least about 70% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
[0138] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 80% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 80% identical or at least about 80% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
[0139] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 90% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 90% identical or at least about 90% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
[0140] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 95% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 95% identical or at least about 95% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
[0141] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column A3 of TABLE 1, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column B3 of TABLE 1, wherein the sequence from Column A3 and the sequence from Column B3 are in the same row of TABLE 1.
[0142] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
[0143] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 50% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 50% identical or at least about 50% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
[0144] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 60% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 60% identical or at least about 60% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
[0145] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 70% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 70% identical or at least about 70% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
[0146] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 80% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about or 80% identical or at least about 80% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
[0147] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 90% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 90% identical or at least about 90% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
[0148] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 95% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 95% identical or at least 95% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
[0149] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column D1 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column C1 of TABLE 2, wherein the sequence from Column D1 and the sequence from Column C1 are in the same row of TABLE 2.
[0150] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
[0151] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 50% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 50% identical or at least about 50% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
[0152] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 60% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 60% identical or at least about 60% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
[0153] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 70% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 70% identical or at least about 70% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
[0154] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 80% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about or 80% identical or at least about 80% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
[0155] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 90% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 90% identical or at least about 90% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
[0156] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 95% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 95% identical or at least 95% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
[0157] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column D2 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column C2 of TABLE 2, wherein the sequence from Column D2 and the sequence from Column C2 are in the same row of TABLE 2.
[0158] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
[0159] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 50% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 50% identical or at least about 50% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
[0160] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 60% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 60% identical or at least about 60% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
[0161] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 70% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 70% identical or at least about 70% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
[0162] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 80% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about or 80% identical or at least about 80% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
[0163] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 90% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 90% identical or at least about 90% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
[0164] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 95% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 95% identical or at least 95% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
[0165] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column D3 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column C3 of TABLE 2, wherein the sequence from Column D3 and the sequence from Column C3 are in the same row of TABLE 2.
[0166] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
[0167] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 50% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 50% identical or at least about 50% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
[0168] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 60% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 60% identical or at least about 60% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
[0169] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 70% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 70% identical or at least about 70% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
[0170] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 80% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about or 80% identical or at least about 80% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
[0171] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 90% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 90% identical or at least about 90% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
[0172] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is at least about 95% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is at least about 95% identical or at least 95% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
[0173] In some instances, compositions comprise an effector protein or a fusion protein thereof, and a guide nucleic acid, wherein the amino acid sequence of the effector protein is 100% identical to a sequence selected from Column D4 of TABLE 2, and wherein at least a portion of the guide nucleic acid comprises a nucleobase sequence that is 100% identical or 100% reverse complementary to a sequence selected from Column C4 of TABLE 2, wherein the sequence from Column D4 and the sequence from Column C4 are in the same row of TABLE 2.
[0174] In some instances, the portion of the guide nucleic acid is the repeat region of the guide nucleic acid. In some instances, the portion of the guide nucleic acid binds the effector protein.
TABLE-US-00001 TABLE 1 Effector Proteins A1 B1 A2 B2 A3 B3 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: 1 10485 1747 11996 3493 13520 1 11112 1748 11997 3494 13521 2 10485 1749 11998 3495 13522 2 11112 1750 11999 3496 13523 3 10486 1751 12000 3497 13524 4 10487 1752 12001 3498 13525 5 10488 1753 12001 3499 13526 6 10489 1754 12001 3500 13527 7 10489 1755 12002 3501 13528 8 10489 1756 12003 3502 13528 9 10489 1757 12004 3503 13528 10 10490 1758 12005 3504 13528 11 10491 1759 12006 3505 13529 11 14123 1760 12007 3506 13529 12 10492 1761 12008 3507 13530 12 12592 1762 12009 3508 13531 13 10493 1763 12010 3509 13532 14 10494 1764 12011 3510 13533 15 10495 1765 12012 3511 13533 16 10496 1766 12013 3512 13534 17 10497 1767 12014 3513 13535 18 10497 1768 12015 3514 13536 19 10498 1769 12016 3515 13537 20 10499 1770 12017 3515 13556 21 10500 1771 12018 3516 13538 22 10501 1772 12019 3517 13539 23 10502 1773 12020 3518 13540 24 10503 1774 12021 3519 13541 25 10504 1775 12022 3520 13541 26 10505 1776 12023 3521 13541 27 10506 1777 12024 3522 13542 28 10507 1778 12025 3523 13543 29 10508 1779 12026 3524 13544 30 10509 1780 12027 3525 13545 31 10510 1781 12028 3526 13546 32 10511 1782 12029 3527 13547 33 10511 1783 12030 3528 13548 34 10512 1784 12030 3529 13549 35 10513 1785 12031 3530 13550 36 10514 1786 12032 3531 13551 37 10515 1787 12033 3532 13552 38 10516 1788 12034 3533 13553 39 10517 1789 12035 3534 13554 40 10518 1790 12036 3535 13555 41 10519 1791 12037 3536 13557 42 10520 1792 12038 3537 13558 43 10521 1793 12039 3538 13559 44 10522 1794 12040 3539 13560 45 10523 1795 12041 3540 13561 46 10524 1796 12042 3541 13562 47 10524 1797 12043 3542 13563 48 10525 1798 12044 3543 13564 49 10526 1799 12045 3544 13565 50 10527 1800 12046 3545 13566 51 10528 1801 12046 3546 13567 52 10528 1802 12047 3547 13568 53 10529 1803 12048 3548 13569 54 10529 1804 12049 3549 13570 55 10530 1805 12050 3550 13571 56 10531 1806 12051 3551 13572 57 10532 1807 12052 3552 13572 58 10533 1808 12053 3553 13572 59 10533 1809 12054 3554 13572 60 10533 1810 12055 3555 13573 61 10534 1811 12056 3556 13574 62 10534 1812 12057 3557 13575 63 10535 1813 12058 3558 13576 64 10536 1814 12059 3559 13577 65 10537 1815 12060 3560 13578 66 10537 1816 12061 3561 13579 67 10538 1817 12062 3562 13579 68 10539 1818 12063 3563 13580 69 10539 1819 12064 3564 13581 70 10539 1820 12065 3565 13582 71 10539 1821 12066 3566 13583 72 10539 1822 12067 3567 13584 73 10539 1823 12068 3568 13585 74 10539 1824 12069 3569 13586 75 10539 1825 12070 3570 13587 76 10539 1826 12071 3571 13588 77 10539 1827 12072 3572 13589 78 10539 1828 12072 3573 13590 79 10539 1829 12073 3574 13591 80 10539 1830 12074 3575 13592 81 10539 1831 12075 3576 13594 82 10539 1832 12076 3577 13595 83 10539 1833 12077 3578 13595 84 10539 1834 12078 3579 13595 85 10539 1835 12079 3580 13596 86 10539 1836 12079 3581 13597 87 10539 1837 12080 3582 13598 88 10539 1838 12081 3583 13599 89 10539 1838 12083 3584 13600 90 10540 1839 12082 3585 13601 91 10541 1840 12083 3586 13602 91 10542 1841 12084 3587 13603 91 14888 1842 12085 3588 13604 92 10543 1843 12086 3589 13605 93 10544 1844 12087 3590 13606 94 10545 1845 12088 3591 13607 95 10545 1846 12089 3592 13607 96 10545 1847 12089 3593 13608 97 10545 1848 12089 3594 13608 98 10546 1849 12090 3595 13608 99 10547 1850 12091 3596 13609 100 10548 1851 12092 3597 13610 101 10549 1852 12093 3598 13611 102 10550 1853 12094 3599 13612 103 10551 1854 12095 3600 13613 104 10552 1854 13505 3601 13614 105 10553 1855 12096 3602 13615 106 10554 1856 12097 3603 13616 107 10555 1857 12098 3604 13617 108 10556 1858 12099 3605 13618 109 10557 1859 12100 3606 13619 110 10558 1860 12101 3607 13620 111 10559 1861 12102 3608 13621 112 10560 1862 12103 3609 13622 113 10561 1863 12104 3610 13622 114 10562 1864 12105 3611 13623 115 10563 1865 12106 3612 13624 116 10564 1866 12107 3613 13625 117 10565 1867 12108 3614 13626 118 10566 1868 12109 3615 13627 119 10567 1869 12110 3616 13628 120 10568 1870 12111 3617 13629 121 10569 1871 12112 3618 13630 122 10570 1872 12113 3619 13631 123 10571 1873 12114 3620 13632 124 10572 1874 12115 3621 13633 125 10573 1875 12116 3622 13634 126 10573 1876 12117 3623 13635 127 10573 1877 12118 3624 13635 128 10574 1878 12119 3625 13636 129 10575 1879 12120 3626 13637 130 10576 1880 12121 3627 13638 131 10576 1881 12122 3628 13638 132 10577 1882 12123 3629 13639 133 10578 1883 12124 3630 13640 134 10579 1884 12125 3631 13641 135 10580 1885 12126 3632 13642 136 10581 1886 12126 3633 13643 137 10582 1887 12127 3634 13644 138 10583 1888 12128 3635 13645 139 10584 1889 12129 3636 13646 140 10585 1890 12130 3637 13647 141 10586 1891 12131 3638 13648 142 10587 1892 12132 3639 13649 143 10587 1893 12133 3640 13650 144 10588 1894 12134 3641 13651 145 10589 1895 12135 3642 13652 146 10590 1896 12136 3643 13653 147 10591 1897 12137 3644 13654 148 10592 1898 12138 3645 13655 149 10593 1899 12139 3646 13656 150 10594 1900 12140 3647 13657 151 10595 1901 12141 3648 13658 152 10596 1902 12142 3649 13659 153 10597 1903 12143 3650 13660 154 10598 1904 12144 3651 13661 155 10599 1905 12145 3652 13662 156 10600 1906 12146 3653 13663 157 10601 1907 12147 3654 13664 158 10602 1908 12148 3655 13665 159 10603 1909 12149 3656 13666 160 10604 1910 12150 3657 13667 161 10605 1911 12151 3658 13668 162 10606 1912 12152 3659 13669 163 10607 1913 12153 3660 13670 164 10608 1913 12284 3661 13671 165 10609 1914 12153 3662 13672 166 10610 1914 12284 3663 13673 167 10611 1915 12154 3664 13674 168 10612 1916 12155 3665 13675 169 10613 1917 12156 3666 13676 170 10614 1918 12157 3667 13677 171 10615 1919 12158 3668 13678 172 10616 1920 12159 3669 13679 173 10617 1921 12160 3670 13680 174 10618 1922 12161 3671 13681 175 10619 1923 12162 3672 13682 176 10620 1924 12163 3673 13683 177 10621 1925 12164 3674 13684 178 10622 1926 12165 3675 13685 179 10623 1927 12166 3676 13686 180 10624 1928 12166 3677 13687 181 10625 1929 12167 3678 13688 182 10626 1930 12168 3679 13689 183 10627 1931 12169 3680 13690 184 10628 1932 12170 3681 13691 185 10629 1933 12171 3682 13692 186 10630 1934 12172 3683 13693 187 10631 1935 12173 3684 13694 188 10632 1936 12174 3685 13695 189 10633 1937 12175 3686 13696 190 10634 1938 12176 3687 13697 191 10635 1939 12177 3688 13698 192 10636 1940 12178 3689 13699 193 10636 1941 12179 3690 13700 194 10637 1942 12180 3691 13701 195 10637 1943 12181 3692 13702 196 10638 1944 12182 3693 13703 197 10639 1945 12183 3694 13704 198 10639 1946 12184 3695 13705 199 10640 1947 12185 3696 13706 200 10641 1948 12186 3697 13707 201 10641 1949 12187 3698 13708 202 10642 1950 12188 3699 13709 203 10643 1951 12189 3700 13710 204 10644 1952 12190 3701 13711 205 10645 1953 12191 3702 13712 206 10646 1954 12192 3703 13713 207 10647 1954 12193 3704 13714 208 10648 1954 14998 3705 13715 209 10649 1955 12192 3706 13716 210 10650 1955 12193 3707 13717 210 14873 1955 14998 3708 13718 211 10651 1956 12194 3709 13719 212 10652 1957 12194 3710 13720 213 10653 1958 12195 3711 13721 214 10654 1959 12195 3712 13722 215 10655 1959 12196 3713 13723 216 10655 1960 12197 3714 13724 217 10656 1961 12198 3715 13725 218 10657 1962 12199 3716 13726 219 10657 1963 12199 3717 13727 220 10658 1964 12200 3718 13728 221 10659 1965 12201 3719 13729 222 10660 1966 12202 3720 13730 223 10661 1967 12203 3721 13731 224 10662 1968 12204 3722 13732 225 10663 1969 12204 3723 13733 226 10664 1970 12205 3724 13734 227 10665 1971 12206 3725 13735 228 10666 1972 12207 3726 13736 229 10667 1973 12208 3727 13737 230 10668 1974 12209 3728 13738 231 10669 1975 12210 3729 13739 232 10670 1976 12211 3730 13740 233 10671 1976 14225 3731 13741 234 10672 1977 12212 3732 13742 235 10673 1978 12213 3733 13743 236 10674 1979 12213 3734 13744 237 10675 1980 12213 3735 13745 238 10676 1981 12213 3736 13746 239 10677 1982 12214 3737 13747 240 10678 1983 12215 3738 13748 241 10679 1984 12216 3739 13748 242 10680 1985 12217 3740 13748 243 10681 1986 12218 3741 13749 244 10682 1987 12219 3742 13750 245 10683 1988 12220 3743 13751 246 10684 1989 12221 3744 13752 247 10685 1990 12222 3745 13753 248 10686 1991 12223 3746 13754 249 10687 1992 12224 3747 13755 250 10688 1993 12225 3748 13756 251 10689 1994 12226 3749 13757 252 10690 1995 12227 3750 13758 253 10691 1996 12228 3751 13759 254 10692 1997 12229 3752 13760 255 10693 1998 12230 3753 13761 256 10694 1999 12231 3754 13762 257 10695 2000 12232 3755 13763 258 10696 2001 12233 3756 13764 259 10697 2002 12234 3757 13766 260 10698 2003 12235 3758 13767 261 10698 2004 12236 3759 13768 262 10699 2005 12237 3760 13769 263 10700 2006 12237 3761 13770 264 10701 2007 12238 3762 13771 265 10702 2008 12239 3763 13772 266 10703 2009 12240 3764 13773 267 10703 2010 12241 3765 13774 268 10703 2011 12242 3766 13775 269 10704 2012 12243 3767 13776 270 10705 2013 12244 3768 13777 271 10706 2014 12245 3769 13778 272 10706 2015 12246 3770 13779 273 10706 2016 12247 3771 13780 274 10707 2017 12248 3772 13781 275 10708 2018 12249 3773 13782 276 10708 2019 12250 3774 13782 277 10708 2020 12251 3775 13783 278 10709 2021 12252 3776 13784 279 10710 2022 12253 3777 13785 280 10710 2023 12254 3778 13786 281 10710 2024 12255 3779 13787 282 10710 2025 12256 3780 13788 283 10710 2026 12257 3781 13789 284 10710 2027 12258 3782 13790 285 10710 2028 12259 3783 13791 286 10710 2029 12260 3784 13792 287 10711 2030 12261 3785 13793 288 10712 2031 12262 3786 13794 289 10713 2032 12263 3787 13794 290 10714 2033 12264 3788 13795 291 10715 2034 12265 3789 13795 292 10716 2035 12266 3790 13796 293 10717 2036 12267 3791 13797 294 10717 2037 12268 3792 13798 295 10718 2038 12269 3793 13799 296 10719 2039 12270 3794 13800 297 10720 2040 12271 3795 13801 298 10721 2041 12272 3796 13802 299 10722 2042 12273 3797 13803 300 10723 2043 12274 3798 13804 301 10724 2044 12275 3799 13805 302 10725 2045 12276 3800 13806 303 10726 2046 12277 3801 13807 304 10727 2047 12278 3802 13808 305 10728 2048 12279 3803 13809 306 10729 2049 12280 3804 13810 307 10730 2050 12281 3805 13811 308 10731 2051 12281 3806 13812 309 10731 2052 12282 3807 13813 310 10732 2053 12283 3808 13814 311 10733 2054 12285 3809 13815 312 10734 2055 12286 3810 13815 313 10735 2056 12287 3811 13815 314 10736 2057 12288 3812 13816 315 10737 2058 12289 3813 13817 316 10738 2059 12290 3814 13817 317 10739 2060 12291 3815 13817 318 10740 2061 12292 3816 13817 319 10741 2062 12293 3817 13817 320 10742 2063 12294 3818 13817 321 10743 2064 12295 3819 13817 322 10744 2065 12296 3820 13818 323 10745 2066 12297 3821 13818 324 10746 2067 12298 3822 13819 325 10747 2068 12299 3823 13820 326 10748 2069 12300 3824 13821 327 10748 2070 12301 3825 13821 328 10749 2071 12302 3826 13822 329 10750 2072 12303 3827 13822 330 10751 2073 12304 3828 13822 331 10752 2074 12305 3829 13822 332 10753 2075 12306 3830 13823 333 10754 2076 12307 3831 13824 334 10755 2077 12308 3832 13825 335 10756 2078 12309 3833 13825 335 10758 2079 12310 3834 13826 336 10757 2080 12311 3835 13827 337 10757 2081 12312 3836 13828 338 10759 2082 12313 3837 13829 339 10760 2083 12314 3838 13830 340 10761 2084 12315 3839 13831 341 10762 2085 12316 3840 13832 342 10763 2086 12317 3841 13833 343 10764 2087 12318 3842 13834 344 10765 2088 12319 3843 13835 345 10766 2089 12320 3844 13836 346 10767 2090 12321 3845 13836 347 10768 2091 12321 3846 13837 348 10769 2092 12322 3847 13838 349 10770 2093 12322 3848 13839 350 10771 2094 12323 3849 13840 351 10772 2095 12324 3850 13841 352 10773 2096 12325 3851 13842 353 10774 2097 12326 3852 13843 354 10775 2098 12327 3853 13844 355 10776 2099 12328 3854 13845 356 10777 2100 12329 3855 13846 357 10777 2101 12329 3856 13847 358 10778 2102 12330 3857 13848 359 10779 2103 12331 3858 13849 360 10780 2104 12332 3859 13850 361 10780 2105 12333 3860 13851 362 10781 2106 12334 3861 13852 363 10782 2107 12335 3862 13853 364 10783 2108 12336 3863 13854 365 10784 2109 12337 3864 13855 366 10785 2110 12338 3865 13856 367 10785 2111 12339 3866 13857 368 10785 2112 12340 3867 13858 369 10786 2113 12341 3868 13859 370 10786 2114 12342 3869 13860 371 10787 2115 12343 3870 13861 372 10788 2116 12344 3871 13862 373 10789 2117 12345 3872 13863 374 10790 2118 12346 3873 13864 375 10791 2119 12347 3874 13865 376 10792 2120 12348 3875 13866 377 10793 2121 12349 3876 13867 378 10794 2122 12350 3877 13867 379 10794 2123 12351 3878 13868 380 10795 2124 12352 3879 13869 381 10796 2125 12353 3880 13870 382 10797 2126 12354 3881 13871 383 10798 2127 12355 3882 13872 384 10799 2128 12356 3883 13873 385 10800 2129 12357 3884 13874 386 10801 2130 12358 3885 13875 387 10802 2131 12359 3886 13876 388 10803 2132 12360 3887 13877 389 10804 2133 12361 3888 13878 390 10805 2134 12362 3889 13879 391 10806 2134 14621 3890 13880 392 10807 2134 14627 3891 13881 393 10808 2135 12363 3892 13881 394 10809 2136 12364 3893 13882 395 10810 2137 12365 3894 13883 396 10811 2138 12366 3895 13884 397 10812 2139 12367 3896 13885 398 10812 2140 12367 3897 13886 399 10813 2141 12368 3898 13887 400 10814 2142 12369 3899 13888 401 10814 2143 12370 3900 13889 402 10815 2144 12371 3901 13889 403 10815 2145 12372 3902 13889 404 10815 2146 12373 3903 13890 405 10815 2147 12374 3904 13891 406 10816 2148 12374 3905 13892 407 10817 2149 12375 3906 13893 408 10818 2150 12376 3907 13893 409 10819 2151 12377 3908 13893 410 10820 2152 12378 3909 13894 411 10821 2153 12379 3910 13895 412 10822 2154 12380 3911 13896 413 10823 2155 12381 3912 13897 414 10824 2156 12382 3913 13897 415 10825 2157 12383 3914 13897 416 10826 2158 12384 3915 13897 417 10827 2159 12385 3916 13898 418 10828 2160 12386 3917 13899 419 10829 2161 12387 3918 13900 420 10829 2162 12388 3919 13901 421 10830 2163 12389 3920 13902 422 10831 2164 12390 3921 13903 423 10832 2165 12391 3922 13904 424 10833 2165 14453 3923 13905 425 10834 2166 12392 3924 13906 426 10835 2166 14417 3925 13907 427 10836 2167 12393 3926 13907 428 10837 2168 12394 3927 13908 429 10838 2169 12395 3928 13908 430 10839 2170 12396 3929 13909 431 10840 2171 12397 3930 13909 432 10841 2172 12398 3931 13910 433 10842 2173 12399 3932 13911 434 10843 2174 12400 3933 13912 435 10844 2175 12401 3934 13913 436 10845 2176 12402 3935 13914 437 10846 2177 12403 3936 13915 438 10847 2178 12404 3937 13915 439 10848 2179 12405 3938 13916 440 10849 2180 12406 3939 13917 441 10850 2181 12407 3940 13918 441 10851 2182 12408 3941 13919 442 10852 2183 12409 3942 13919 443 10853 2184 12410 3943 13919 444 10854 2185 12411 3944 13920 445 10855 2186 12412 3945 13920 446 10856 2187 12413 3946 13921 447 10857 2188 12414 3947 13921 448 10858 2189 12415 3948 13921 449 10859 2190 12416 3949 13921 450 10860 2191 12417 3950 13921 451 10861 2192 12418 3951 13921 452 10862 2193 12418 3952 13921 453 10862 2194 12418 3953 13921 454 10863 2195 12418 3954 13921 455 10864 2196 12419 3955 13921 456 10865 2197 12420 3956 13921 457 10866 2197 13189 3957 13921 458 10867 2198 12421 3958 13921 459 10868 2199 12422 3959 13921 460 10869 2200 12423 3960 13921 461 10870 2201 12424 3961 13921 462 10871 2202 12425 3962 13921 463 10872 2203 12426 3963 13921 464 10873 2204 12427 3964 13922 465 10874 2205 12428 3965 13922 466 10875 2206 12429 3966 13922 467 10876 2207 12430 3967 13923 468 10877 2208 12431 3968 13924 469 10878 2209 12432 3969 13925 470 10878 2210 12433 3970 13926 471 10879 2211 12434 3971 13927 472 10880 2212 12436 3972 13927 473 10881 2213 12437 3973 13927 474 10882 2214 12438 3974 13927 475 10883 2215 12439 3975 13927 476 10884 2216 12440 3976 13928 477 10885 2217 12441 3977 13929 478 10886 2218 12442 3978 13930 479 10887 2219 12443 3979 13931 480 10887 2220 12444 3980 13932 481 10888 2221 12445 3981 13932 482 10889 2222 12446 3982 13932 483 10890 2223 12447 3983 13933 484 10891 2224 12448 3984 13934 485 10892 2225 12449 3985 13934 486 10893 2226 12450 3986 13934 487 10894 2227 12451 3987 13934 488 10895 2228 12452 3988 13935 489 10895 2229 12453 3989 13936 490 10896 2230 12453 3990 13937 49 10897 2231 12454 3991 13938 492 10898 2232 12455 3992 13939 493 10899 2233 12455 3993 13940 494 10900 2234 12456 3994 13941 495 10901 2235 12457 3995 13942 496 10902 2236 12458 3996 13943 497 10903 2237 12459 3997 13944 498 10904 2238 12460 3998 13945 499 10905 2239 12461 3999 13946 500 10906 2240 12462 4000 13947 501 10907 2241 12463 4001 13948 502 10908 2242 12464 4002 13949 503 10909 2243 12465 4003 13950 504 10910 2244 12466 4004 13950 505 10911 2245 12467 4005 13951 506 10911 2246 12468 4006 13951 507 10912 2247 12469 4007 13952 508 10913 2248 12470 4008 13953 509 10914 2249 12471 4009 13954 510 10915 2250 12472 4010 13955 511 10916 2251 12473 4011 13956 512 10917 2252 12474 4012 13957 513 10918 2253 12475 4013 13958 514 10919 2254 12477 4014 13959 515 10920 2255 12478 4015 13960 516 10921 2255 14171 4016 13961 517 10922 2256 12479 4017 13962 518 10923 2257 12480 4018 13963 519 10924 2258 12481 4019 13964 520 10925 2259 12482 4020 13964 521 10926 2260 12483 4021 13965 522 10927 2261 12484 4022 13966 523 10928 2262 12485 4023 13967 524 10929 2263 12486 4024 13968 525 10930 2264 12487 4025 13969 526 10931 2265 12488 4026 13970 527 10932 2266 12489 4027 13971 528 10933 2267 12490 4028 13972 528 10934 2268 12491 4029 13973 529 10935 2269 12491 4030 13974 530 10936 2270 12492 4031 13975 531 10937 2271 12493 4032 13976 532 10938 2272 12494 4033 13977 533 10939 2273 12495 4034 13978 534 10940 2274 12496 4035 13979 535 10941 2275 12497 4036 13980 536 10942 2276 12498 4037 13982 537 10943 2277 12499 4038 13982 538 10944 2278 12500 4039 13983 539 10945 2279 12501 4040 13984 540 10945 2280 12502 4041 13985 541 10945 2281 12503 4042 13986 542 10945 2282 12504 4043 13987 543 10945 2283 12505 4044 13988 544 10946 2284 12505 4045 13988 545 10947 2285 12506 4046 13989 546 10948 2286 12507 4047 13990 547 10949 2287 12508 4048 13991 548 10950 2288 12509 4049 13991 549 10950 2289 12510 4050 13991 550 10951 2289 12511 4051 13992 551 10952 2290 12512 4052 13993 552 10953 2291 12513 4053 13994 553 10954 2292 12514 4054 13995 554 10955 2293 12515 4055 13996 555 10956 2294 12516 4056 13997 556 10957 2295 12517 4057 13998 557 10958 2296 12518 4058 13999 558 10959 2297 12519 4059 14000 559 10960 2298 12520 4060 14001 560 10961 2299 12521 4061 14002 561 10962 2300 12522 4062 14003 562 10963 2301 12523 4063 14004 563 10964 2302 12524 4064 14005 564 10965 2303 12525 4065 14006 565 10966 2304 12526 4066 14007 566 10966 2305 12527 4067 14008 567 10967 2306 12528 4068 14009 568 10968 2307 12529 4069 14010 569 10969 2308 12530 4070 14011 570 10970 2309 12531 4071 14012 571 10970 2310 12532 4072 14013 572 10971 2311 12533 4073 14014 573 10972 2312 12534 4074 14015 574 10973 2313 12535 4075 14016 575 10974 2314 12536 4076 14017 576 10974 2315 12537 4077 14018 577 10975 2316 12538 4078 14019 578 10976 2317 12539 4079 14020 579 10977 2318 12540 4080 14021 580 10978 2319 12541 4081 14022 581 10978 2320 12542 4082 14023 582 10979 2321 12543 4083 14024 583 10980 2322 12543 4084 14025 584 10981 2323 12544 4085 14025 585 10982 2324 12545 4086 14026 586 10983 2325 12546 4087 14027 587 10984 2326 12547 4088 14027 588 10985 2327 12548 4089 14027 589 10986 2328 12549 4090 14028 590 10986 2329 12550 4091 14029 591 10987 2330 12551 4092 14030 592 10988 2331 12552 4093 14031 593 10989 2332 12553 4094 14032 594 10990 2333 12554 4095 14033 595 10991 2334 12555 4096 14034 596 10991 2335 12555 4097 14035 597 10991 2336 12556 4098 14036 598 10991 2337 12557 4099 14037 599 10991 2338 12558 4100 14038 600 10991 2339 12559 4101 14039 601 10992 2340 12560 4102 14040 602 10993 2341 12561 4103 14041 603 10994 2342 12562 4104 14042 604 10995 2343 12563 4105 14043 605 10995 2344 12563 4106 14044 606 10996 2345 12563 4107 14045 607 10997 2346 12564 4108 14046 608 10998 2347 12564 4109 14047 609 10999 2348 12564 4110 14048 610 11000 2349 12564 4111 14049 611 11001 2350 12564 4112 14050 612 11002 2351 12564 4113 14051 613 11003 2352 12564 4114 14052 614 11003 2353 12564 4115 14053 615 11004 2354 12564 4116 14054 616 11005 2355 12564 4117 14055 617 11006 2356 12565 4118 14056 618 11006 2357 12566 4119 14057 619 11006 2358 12567 4120 14058 620 11006 2359 12568 4121 14059 621 11007 2360 12569 4122 14060 621 11627 2361 12570 4123 14060 622 11008 2362 12571 4124 14060 623 11008 2363 12572 4125 14061 624 11008 2364 12573 4126 14062 625 11008 2365 12573 4127 14063 626 11009 2366 12574 4128 14064 627 11010 2367 12574 4129 14065 628 11011 2368 12574 4130 14065 629 11012 2369 12574 4131 14066 630 11013 2370 12575 4132 14067 631 11014 2371 12576 4133 14068 632 11015 2372 12577 4134 14069 633 11016 2373 12578 4135 14070 634 11017 2374 12578 4136 14071 635 11018 2375 12578 4137 14072 636 11019 2376 12579 4138 14073 637 11020 2377 12580 4139 14074 638 11021 2378 12581 4140 14075 639 11022 2379 12582 4141 14076 640 11023 2380 12582 4142 14077 641 11024 2381 12583 4143 14078 642 11025 2382 12584 4144 14079 643 11026 2383 12586 4145 14080 644 11027 2384 12587 4146 14081 645 11028 2385 12588 4147 14082 646 11029 2386 12589 4148 14083 647 11030 2387 12590 4149 14083 648 11031 2388 12591 4150 14084 649 11032 2389 12593 4151 14085 650 11033 2390 12594 4152 14086 651 11034 2391 12596 4153 14086 652 11035 2392 12597 4154 14087 653 11036 2393 12598 4155 14088 654 11037 2394 12599 4156 14089 654 11735 2395 12600 4157 14090 655 11038 2396 12601 4158 14091 656 11039 2397 12602 4159 14092 656 13162 2398 12603 4160 14093 657 11040 2399 12604 4161 14094 658 11041 2400 12605 4162 14095 659 11042 2401 12606 4163 14096 660 11043 2402 12607 4164 14097 661 11044 2403 12607 4165 14098 662 11045 2404 12608 4166 14099 663 11046 2405 12609 4167 14100 663 13409 2406 12610 4168 14100 664 11047 2407 12611 4169 14101 665 11048 2408 12612 4170 14102 665 13593 2409 12613 4171 14103 666 11049 2410 12613 4172 14104 667 11050 2411 12614 4173 14105 668 11051 2412 12615 4174 14106 669 11052 2413 12616 4175 14107 670 11053 2414 12616 4176 14107 671 11054 2415 12617 4177 14108 672 11055 2416 12618 4178 14109 673 11056 2417 12619 4179 14110 674 11057 2418 12620 4180 14111 675 11058 2419 12621 4181 14111 676 11059 2420 12621 4182 14112 677 11060 2421 12621 4183 14113 678 11061 2422 12622 4184 14114 679 11062 2423 12623 4185 14115 680 11063 2424 12623 4186 14116 681 11064 2425 12624 4187 14117 682 11064 2426 12625 4188 14118 683 11065 2427 12626 4189 14119 684 11066 2428 12626 4190 14120 685 11067 2429 12627 4191 14121 686 11068 2430 12628 4192 14122 687 11069 2431 12629 4193 14122 688 11070 2432 12630 4194 14122 689 11071 2433 12631 4195 14122 690 11072 2434 12632 4196 14122 691 11073 2435 12633 4197 14122 692 11074 2436 12634 4198 14122 693 11075 2437 12635 4199 14124 694 11076 2438 12636 4200 14125 695 11077 2439 12637 4201 14127 696 11077 2440 12638 4202 14128 697 11078 2441 12639 4203 14128 698 11079 2442 12640 4204 14129 699 11080 2443 12641 4205 14130 700 11081 2444 12641 4206 14131 701 11082 2445 12642 4207 14132 702 11083 2446 12643 4208 14133 703 11084 2447 12644 4209 14133 704 11085 2448 12645 4210 14134 705 11086 2449 12646 4211 14135 706 11087 2450 12647 4212 14136 707 11088 2451 12648 4213 14137 708 11089 2452 12649 4214 14138 709 11090 2453 12650 4215 14139 710 11091 2454 12651 4216 14140 711 11091 2455 12652 4217 14141 712 11092 2456 12653 4218 14142 713 11093 2457 12654 4219 14143 714 11094 2458 12655 4220 14144 715 11095 2459 12656 4221 14145 716 11096 2460 12657 4222 14145 717 11097 2461 12658 4223 14146 718 11098 2462 12659 4224 14147 719 11099 2463 12660 4225 14148 720 11100 2464 12661 4226 14149 721 11100 2465 12662 4227 14149 722 11101 2466 12663 4228 14150 723 11102 2467 12664 4229 14151 724 11103 2468 12665 4230 14152 725 11104 2469 12666 4231 14153 726 11105 2470 12667 4232 14154 727 11106 2471 12668 4233 14155 728 11107 2471 12677 4234 14156 729 11108 2472 12669 4235 14157 730 11109 2473 12670 4236 14158 731 11110 2474 12671 4237 14158 732 11111 2475 12672 4238 14159 732 14274 2476 12673 4239 14160 732 14361 2477 12673 4240 14161 733 11113 2478 12673 4241 14161 734 11114 2479 12674 4242 14161 735 11114 2480 12675 4243 14162 736 11115 2481 12676 4244 14163 737 11116 2482 12678 4245 14164 738 11117 2483 12679 4246 14164 739 11118 2484 12680 4247 14164 740 11119 2485 12681 4248 14165 741 11120 2486 12682 4249 14166 742 11121 2487 12683 4250 14167 743 11122 2488 12684 4251 14168 744 11123 2489 12685 4252 14169 745 11123 2490 12686 4253 14170 746 11124 2491 12687 4254 14172 747 11125 2492 12688 4255 14172 748 11126 2493 12689 4256 14173 749 11127 2494 12690 4257 14174 750 11128 2495 12691 4258 14174 751 11129 2496 12692 4259 14176 751 11741 2497 12693 4260 14177 752 11130 2498 12694 4261 14178 752 11139 2499 12695 4262 14179 753 11131 2500 12696 4263 14180 754 11132 2501 12697 4264 14180 755 11133 2502 12698 4265 14181 756 11134 2503 12699 4266 14181 757 11135 2504 12699 4267 14182 758 11136 2505 12700 4268 14183 759 11137 2506 12701 4269 14184 760 11138 2507 12702 4270 14185 761 11140 2508 12703 4271 14186 762 11141 2509 12704 4272 14187 763 11142 2510 12705 4273 14188 764 11143 2511 12706 4274 14188 765 11144 2512 12707 4275 14189 766 11145 2513 12708 4276 14190 767 11146 2514 12709 4277 14191 768 11147 2515 12710 4278 14191 769 11148 2516 12710 4279 14191 770 11149 2517 12711 4280 14191 770 11478 2518 12711 4281 14191 771 11150 2519 12712 4282 14192 772 11151 2520 12713 4283 14192 773 11152 2521 12714 4284 14193 774 11153 2522 12715 4285 14193 775 11154 2523 12716 4286 14193 776 11154 2524 12717 4287 14194 777 11155 2524 14370 4288 14195 777 13993 2524 14496 4289 14196 778 11156 2525 12718 4290 14197 779 11157 2526 12719 4291 14198 780 11158 2527 12720 4292 14199 781 11159 2528 12721 4293 14200 782 11160 2529 12722 4294 14201 782 12585 2530 12722 4295 14202 783 11161 2531 12723 4296 14203 784 11162 2532 12724 4297 14204 785 11163 2533 12724 4298 14205 786 11164 2534 12725 4299 14206 787 11165 2535 12726 4300 14206 788 11166 2536 12727 4301 14207 789 11167 2537 12728 4302 14208 790 11168 2538 12729 4303 14209 791 11169 2539 12730 4304 14210 792 11170 2540 12730 4305 14211 793 11171 2541 12730 4306 14212 794 11172 2542 12731 4307 14213 795 11173 2543 12732 4308 14214 796 11174 2544 12733 4309 14215 797 11175 2545 12733 4310 14216 798 11176 2546 12734 4311 14217 799 11177 2547 12735 4312 14218 800 11178 2548 12736 4313 14219 801 11179 2549 12737 4314 14220 802 11180 2550 12738 4315 14221 803 11181 2551 12739 4316 14221 804 11181 2552 12740 4317 14222 805 11182 2553 12741 4318 14223 806 11183 2554 12741 4319 14224 807 11184 2555 12742 4320 14226 808 11185 2556 12743 4321 14227 809 11186 2557 12744 4322 14228 810 11187 2558 12745 4323 14229 811 11188 2559 12746 4324 14230 812 11189 2560 12747 4325 14231 813 11190 2561 12747 4326 14232 814 11191 2562 12747 4327 14233 815 11192 2563 12748 4328 14234 816 11193 2564 12749 4329 14235 817 11194 2565 12750 4330 14236 818 11195 2566 12751 4331 14237 819 11196 2567 12751 4332 14238 820 11197 2568 12752 4333 14239 821 11198 2569 12753 4334 14239 822 11199 2570 12754 4335 14239 823 11199 2571 12755 4336 14240 824 11200 2572 12756 4337 14241 825 11201 2573 12757 4338 14242 826 11202 2574 12758 4339 14243 827 11203 2575 12759 4340 14244 828 11204 2576 12759 4341 14245 829 11205 2577 12759 4342 14246 830 11206 2578 12759 4343 14247 831 11207 2579 12759 4344 14248 832 11208 2580 12759 4345 14248 833 11208 2581 12760 4346 14248 834 11208 2582 12761 4347 14248 835 11209 2583 12762 4348 14248 836 11210 2584 12763 4349 14249 837 11211 2585 12764 4350 14250 838 11211 2586 12765 4351 14251 839 11211 2587 12766 4352 14252 840 11212 2588 12767 4353 14253 841 11213 2589 12768 4354 14254 842 11214 2590 12769 4355 14255 843 11215 2591 12770 4356 14256 844 11216 2592 12771 4357 14257 844 11423 2593 12772 4358 14258 845 11217 2594 12773 4359 14259 846 11218 2595 12773 4360 14260 847 11219 2596 12774 4361 14261 848 11220 2597 12775 4362 14261 849 11221 2598 12776 4363 14262 850 11222 2598 12777 4364 14263 851 11223 2599 12777 4365 14264 852 11224 2600 12777 4366 14264 853 11225 2601 12777 4367 14265 854 11226 2602 12778 4368 14265 855 11227 2603 12779 4369 14266 856 11227 2604 12780 4370 14267 857 11227 2605 12781 4371 14268 857 12435 2606 12782 4372 14269 858 11227 2607 12783 4373 14270 859 11227 2608 12784 4374 14271 860 11227 2609 12785 4375 14271 861 11227 2610 12786 4376 14272 862 11227 2611 12787 4377 14273 863 11228 2612 12788 4378 14275 864 11229 2613 12789 4379 14276 865 11230 2614 12790 4380 14277 866 11231 2615 12791 4381 14277 867 11232 2616 12792 4382 14278 868 11233 2617 12793 4383 14279 869 11234 2618 12794 4384 14280 870 11235 2619 12795 4385 14281 871 11236 2620 12796 4386 14281 872 11237 2620 13765 4387 14282 873 11238 2621 12797 4388 14283 874 11239 2622 12798 4389 14284 875 11240 2623 12799 4390 14285 876 11241 2624 12800 4391 14286 877 11242 2625 12801 4392 14287 878 11243 2626 12802 4393 14287 879 11244 2627 12803 4394 14287 880 11245 2628 12804 4395 14288 881 11246 2629 12805 4396 14288 882 11247 2630 12806 4397 14289 883 11248 2631 12807 4398 14289 884 11249 2632 12808 4399 14289 885 11250 2633 12809 4400 14290 886 11251 2634 12810 4401 14291 887 11252 2635 12811 4402 14292 888 11253 2636 12812 4403 14293 889 11254 2637 12813 4404 14294 890 11255 2638 12814 4405 14295 891 11256 2639 12814 4406 14296 892 11257 2640 12815 4407 14296 893 11257 2641 12816 4408 14297 894 11257 2642 12817 4409 14298 895 11258 2643 12818 4410 14299 896 11259 2644 12819 4411 14300 897 11260 2645 12820 4412 14301 898 11261 2646 12821 4413 14302 899 11262 2647 12822 4414 14303 900 11262 2648 12823 4415 14304 901 11263 2649 12823 4416 14305 902 11263 2650 12824 4417 14306 903 11263 2651 12825 4418 14307 904 11264 2652 12826 4419 14308 905 11265 2653 12827 4420 14309 906 11266 2654 12828 4421 14310 907 11267 2655 12829 4422 14311 908 11268 2656 12830 4423 14312 909 11269 2657 12831 4424 14313 910 11270 2658 12832 4425 14313 911 11271 2659 12833 4426 14313 912 11272 2660 12834 4427 14313 913 11273 2661 12835 4428 14314 914 11274 2662 12836 4429 14315 915 11275 2663 12836 4430 14316 916 11276 2664 12837 4431 14316 917 11277 2665 12838 4432 14317 918 11278 2666 12839 4433 14318 919 11279 2667 12840 4434 14319 920 11280 2668 12841 4435 14320 921 11281 2669 12842 4436 14321 922 11282 2670 12843 4437 14322 923 11282 2671 12844 4438 14323 924 11283 2672 12845 4439 14324 925 11284 2673 12846 4440 14325 926 11285 2674 12847 4441 14326 927 11285 2675 12848 4442 14326 928 11285 2676 12849 4443 14327 929 11285 2677 12850 4444 14328 930 11285 2678 12851 4445 14329 931 11285 2679 12852 4446 14330 932 11285 2680 12853 4447 14331 933 11286 2681 12854 4448 14332 934 11287 2682 12855 4449 14333 935 11288 2683 12856 4450 14334 936 11288 2684 12856 4451 14335 937 11288 2684 14923 4452 14336 938 11288 2685 12857 4453 14337 939 11289 2686 12858 4454 14338 940 11289 2687 12859 4455 14339 941 11290 2688 12860 4456 14340 942 11291 2689 12861 4457 14341 943 11292 2690 12862 4458 14342 944 11293 2691 12863 4459 14343 945 11294 2692 12864 4460 14344 946 11295 2693 12865 4461 14345 947 11295 2694 12865 4462 14346 948 11296 2695 12866 4463 14347 949 11297 2696 12867 4464 14348 950 11298 2697 12867 4465 14349 951 11299 2698 12868 4466 14350 952 11300 2699 12869 4467 14351 953 11301 2700 12870 4468 14352 954 11302 2701 12871 4468 14956 955 11303 2702 12872 4469 14353 956 11304 2703 12873 4470 14354 957 11305 2704 12874 4471 14355 958 11306 2705 12875 4472 14356 959 11307 2706 12876 4473 14357 960 11308 2707 12877 4474 14358 961 11309 2708 12878 4475 14359 962 11310 2709 12879 4476 14360 963 11311 2710 12880 4477 14362 964 11312 2711 12881 4478 14363 965 11313 2712 12882 4479 14363 966 11314 2713 12883 4480 14364 967 11315 2714 12884 4481 14365 968 11316 2715 12885 4482 14366 969 11317 2716 12885 4483 14367 970 11318 2717 12886 4484 14367 970 12476 2718 12887 4485 14368 971 11319 2719 12888 4486 14369 972 11320 2720 12889 4487 14371 973 11321 2721 12890 4488 14372 974 11322 2722 12891 4489 14373 975 11323 2723 12892 4490 14373 976 11324 2724 12893 4491 14374 977 11324 2725 12894 4492 14374 978 11324 2726 12895 4493 14375 979 11325 2727 12896 4494 14376 980 11325 2728 12897 4495 14377 981 11326 2729 12898 4496 14378 982 11326 2729 12899 4497 14379 983 11327 2730 12900 4498 14380 984 11327 2731 12901 4499 14381 985 11327 2732 12902 4500 14382 986 11328 2733 12903 4501 14383 987 11329 2734 12904 4502 14384 988 11330 2735 12905 4503 14385 989 11331 2736 12906 4504 14386 990 11332 2737 12906 4505 14387 991 11333 2738 12907 4506 14388 992 11334 2739 12907 4507 14389 993 11335 2740 12908 4508 14390 994 11336 2741 12909 4509 14390 995 11337 2742 12910 4510 14390 996 11338 2743 12911 4511 14390 997 11339 2744 12912 4512 14391 998 11340 2745 12913 4513 14392 999 11341 2746 12914 4514 14393 1000 11341 2747 12914 4515 14394 1001 11342 2748 12915 4516 14395 1002 11343 2749 12916 4517 14396 1003 11344 2750 12917 4518 14397 1004 11345 2751 12918 4519 14398 1005 11346 2752 12919 4520 14398 1006 11347 2753 12920 4521 14399 1007 11348 2754 12921 4522 14400 1008 11349 2755 12922 4523 14401 1009 11350 2756 12923 4524 14401 1010 11351 2757 12924 4525 14402 1011 11352 2758 12925 4526 14402 1012 11353 2759 12926 4527 14403 1013 11354 2760 12927 4528 14403 1014 11355 2761 12928 4529 14404 1015 11356 2762 12929 4530 14405 1016 11357 2763 12930 4531 14406 1017 11358 2764 12931 4532 14407 1018 11359 2765 12932 4533 14408 1019 11360 2766 12933 4534 14409 1020 11361 2767 12934 4535 14410 1021 11362 2768 12935 4536 14411 1022 11363 2769 12936 4537 14412 1023 11364 2770 12937 4538 14413 1024 11365 2771 12939 4539 14414 1025 11366 2772 12940 4540 14415 1026 11367 2773 12940 4541 14416 1027 11368 2774 12941 4542 14417 1028 11369 2775 12942 4543 14417 1029 11370 2776 12943 4544 14418 1030 11371 2777 12944 4545 14419 1031 11372 2778 12945 4546 14419 1032 11373 2779 12946 4547 14419 1033 11374 2780 12947 4548 14420 1034 11375 2781 12948 4549 14421 1035 11376 2782 12949 4550 14422 1036 11377 2783 12950 4551 14423 1037 11378 2784 12951 4552 14424 1038 11379 2785 12952 4553 14425 1039 11380 2786 12953 4554 14425 1040 11380 2787 12954 4555 14425 1041 11380 2788 12954 4556 14425 1042 11381 2789 12955 4557 14425 1043 11382 2790 12956 4558 14426 1044 11383 2791 12956 4559 14427 1045 11384 2792 12956 4560 14428 1046 11385 2793 12957 4561 14429 1047 11386 2794 12958 4562 14430 1048 11387 2795 12959 4563 14431 1049 11388 2795 13149 4564 14432 1050 11389 2796 12960 4565 14433 1051 11390 2797 12961 4566 14434 1052 11391 2798 12962 4567 14435 1053 11392 2799 12962 4567 14436 1054 11393 2799 12963 4568 14437 1055 11394 2799 14904 4569 14438 1056 11395 2800 12964 4570 14439 1057 11396 2801 12965 4571 14440 1058 11397 2802 12966 4572 14441 1059 11398 2803 12967 4573 14442 1060 11399 2804 12968 4574 14443 1061 11400 2805 12969 4575 14444 1062 11401 2806 12970 4576 14445 1063 11402 2807 12970 4577 14446 1064 11402 2808 12970 4578 14447 1064 11472 2809 12971 4579 14448 1065 11403 2810 12972 4580 14449 1066 11404 2811 12972 4581 14450 1067 11405 2812 12972 4582 14451 1068 11406 2813 12972 4583 14452 1069 11407 2814 12972 4584 14454 1070 11408 2815 12973 4585 14455 1071 11409 2816 12974 4586 14456 1072 11409 2817 12975 4587 14457 1073 11410 2818 12976 4588 14458 1074 11411 2819 12976 4589 14459 1075 11412 2820 12977 4590 14460 1076 11413 2821 12977 4591 14461 1077 11414 2822 12978 4592 14462 1078 11415 2823 12979 4593 14463 1079 11415 2824 12980 4594 14464 1080 11415 2825 12981 4595 14465 1081 11416 2826 12982 4596 14466 1082 11417 2827 12983 4597 14467 1083 11418 2828 12984 4597 14891 1084 11418 2829 12985 4598 14468 1085 11418 2830 12986 4599 14469 1086 11418 2831 12987 4600 14470 1087 11418 2832 12988 4601 14471 1088 11419 2833 12989 4602 14471 1089 11420 2834 12990 4603 14472 1090 11421 2835 12991 4604 14473 1091 11422 2836 12992 4605 14474 1092 11424 2837 12993 4606 14475 1093 11425 2838 12994 4607 14476 1094 11426 2839 12995 4608 14477 1095 11427 2840 12996 4609 14477 1096 11428 2841 12997 4610 14477 1097 11429 2842 12998 4611 14478 1098 11430 2843 12999 4612 14479 1099 11431 2844 13000 4613 14479 1100 11432 2845 13001 4614 14480 1101 11433 2846 13002 4615 14481 1102 11434 2847 13003 4616 14482 1103 11435 2848 13004 4617 14483 1104 11436 2849 13005 4618 14484 1105 11437 2849 13006 4619 14485 1106 11438 2850 13007 4620 14486 1107 11438 2851 13008 4621 14487 1108 11438 2852 13009 4622 14488 1109 11439 2853 13010 4623 14489 1110 11440 2854 13011 4624 14489 1111 11441 2855 13012 4625 14490 1112 11442 2856 13013 4626 14491 1113 11443 2857 13014 4627 14492 1114 11444 2858 13015 4628 14493 1115 11445 2859 13016 4629 14494 1116 11446 2860 13017 4630 14495 1117 11447 2861 13018 4631 14497 1118 11448 2862 13019 4632 14498 1119 11449 2863 13020 4633 14499 1120 11450 2864 13020 4634 14500 1121 11451 2865 13021 4635 14501 1122 11452 2866 13022 4636 14502 1123 11453 2867 13023 4637 14502 1124 11454 2868 13024 4638 14503 1125 11455 2869 13024 4639 14504 1126 11456 2870 13024 4639 14505 1127 11457 2871 13024 4640 14506 1128 11458 2872 13024 4641 14507 1129 11459 2873 13024 4642 14508 1130 11460 2874 13024 4643 14509 1131 11461 2875 13024 4643 14509 1132 11462 2876 13024 4643 14677 1133 11463 2877 13024 4644 14509 1134 11464 2878 13024 4644 14509 1135 11465 2879 13024 4644 14677 1136 11465 2880 13025 4645 14510 1137 11466 2881 13026 4646 14511 1138 11467 2882 13027 4647 14512 1139 11468 2883 13027 4648 14513 1140 11469 2884 13027 4649 14514 1141 11469 2885 13027 4650 14515 1142 11469 2886 13027 4651 14516 1143 11469 2887 13028 4652 14517 1144 11469 2888 13029 4653 14518 1145 11469 2889 13030 4654 14519 1146 11470 2890 13031 4655 14519 1147 11471 2891 13031 4656 14520 1148 11473 2892 13032 4657 14521 1149 11473 2893 13033 4658 14521 1150 11473 2894 13034 4659 14522 1151 11473 2895 13035 4660 14523 1152 11474 2896 13036 4661 14524 1153 11474 2897 13037 4662 14525 1154 11475 2898 13038 4663 14526 1155 11476 2899 13039 4664 14527 1156 11477 2900 13040 4665 14528 1157 11479 2901 13041 4666 14529 1158 11480 2902 13042 4667 14530 1159 11481 2903 13043 4668 14531 1160 11482 2904 13044 4669 14532 1161 11483 2905 13045 4670 14533 1162 11484 2906 13045 4671 14534 1163 11485 2907 13045 4672 14535 1164 11486 2908 13045 4673 14536 1165 11487 2909 13046 4674 14536 1166 11488 2910 13047 4675 14537 1167 11489 2911 13047 4676 14538 1168 11490 2912 13047 4677 14539 1169 11491 2913 13047 4678 14539 1170 11492 2914 13047 4679 14540 1171 11492 2915 13047 4680 14541 1172 11492 2916 13048 4681 14542 1173 11492 2917 13048 4682 14543 1174 11492 2918 13048 4683 14543 1175 11492 2919 13048 4684 14543 1176 11492 2920 13049 4685 14544 1177 11492 2921 13050 4686 14544 1178 11493 2922 13051 4687 14545 1179 11494 2923 13052 4688 14545 1180 11495 2924 13052 4689 14546 1181 11496 2925 13053 4690 14547 1182 11496 2926 13054 4691 14548 1183 11497 2927 13055 4692 14549 1184 11498 2928 13056 4693 14549 1185 11498 2929 13056 4694 14550 1186 11498 2930 13056 4695 14551 1187 11498 2931 13056 4696 14552 1188 11498 2932 13057 4697 14553 1189 11498 2933 13058 4698 14554 1190 11498 2934 13058 4699 14554 1191 11498 2935 13058 4700 14555 1192 11498 2936 13058 4701 14555 1193 11499 2937 13059 4702 14555 1194 11500 2938 13059 4703 14555 1195 11501 2939 13059 4704 14556 1196 11502 2940 13060 4705 14557 1197 11503 2941 13061 4706 14558 1198 11504 2942 13062 4707 14559 1199 11505 2943 13062 4708 14560 1200 11505 2944 13062 4709 14561 1201 11505 2945 13062 4710 14562 1202 11506 2946 13062 4711 14563 1203 11507 2947 13063 4712 14564 1204 11508 2948 13063 4713 14565 1205 11509 2949 13063 4714 14566 1206 11510 2950 13064 4715 14567 1207 11511 2951 13064 4716 14568 1208 11512 2952 13064 4717 14568 1209 11513 2953 13064 4718 14568 1210 11514 2954 13064 4719 14568 1211 11515 2955 13064 4720 14568 1212 11516 2956 13065 4721 14568 1213 11517 2957 13065 4722 14568 1214 11518 2958 13066 4723 14568 1215 11519 2959 13066 4724 14568 1216 11520 2960 13066 4725 14569 1217 11521 2961 13067 4726 14570 1218 11522 2962 13067 4727 14571 1219 11523 2963 13067 4728 14572 1220 11524 2964 13067 4729 14573 1221 11525 2965 13068 4730 14574 1222 11526 2966 13068 4731 14575 1223 11527 2967 13068 4732 14576 1224 11528 2968 13069 4733 14577 1225 11529 2969 13070 4734 14577 1226 11530 2970 13071 4735 14578 1227 11531 2971 13071 4736 14579 1228 11532 2972 13072 4737 14580 1229 11533 2973 13072 4738 14581 1230 11534 2974 13072 4739 14581 1231 11535 2975 13072 4740 14582 1232 11535 2976 13072 4741 14583 1233 11536 2977 13072 4742 14584 1234 11537 2978 13072 4743 14585 1235 11538 2979 13073 4744 14586 1236 11539 2980 13073 4745 14587 1237 11540 2981 13073 4746 14588 1238 11541 2982 13073 4747 14589 1239 11542 2983 13074 4748 14590 1240 11543 2984 13075 4749 14591 1241 11544 2985 13076 4750 14592 1241 14175 2986 13077 4751 14593 1242 11545 2987 13078 4752 14594 1243 11546 2988 13079 4753 14595 1244 11547 2989 13080 4754 14596 1245 11548 2990 13081 4755 14597 1246 11549 2991 13082 4756 14598 1247 11550 2992 13083 4757 14599 1248 11551 2993 13084 4758 14600 1249 11552 2994 13085 4759 14601 1250 11553 2995 13086 4760 14602 1251 11554 2996 13086 4761 14603 1252 11555 2997 13087 4762 14603 1253 11556 2998 13088 4762 14963 1254 11557 2999 13089 4763 14604 1255 11558 3000 13090 4764 14605 1256 11559 3001 13091 4765 14606 1257 11560 3001 15000 4766 14606 1257 11621 3002 13091 4767 14607 1258 11561 3002 15000 4768 14608 1259 11562 3003 13092 4769 14609 1260 11563 3004 13093 4770 14610 1261 11564 3005 13094 4771 14611 1262 11564 3006 13095 4772 14612 1263 11564 3007 13096 4773 14612 1264 11565 3008 13097 4774 14613 1265 11565 3009 13098 4775 14614 1266 11565 3010 13099 4776 14615 1267 11566 3011 13100 4777 14616 1268 11567 3012 13102 4778 14617 1269 11568 3013 13103 4779 14618 1270 11569 3014 13104 4780 14619 1271 11569 3015 13105 4781 14620 1272 11570 3016 13106 4782 14622 1273 11571 3017 13107 4783 14623 1274 11572 3018 13108 4784 14624 1275 11573 3019 13109 4785 14625 1276 11574 3020 13110 4786 14626 1277 11575 3021 13111 4787 14626 1278 11576 3022 13112 4788 14628 1279 11577 3023 13113 4789 14628 1280 11578 3024 13114 4790 14629 1281 11579 3025 13115 4791 14629 1282 11580 3026 13116 4792 14630 1283 11581 3027 13117 4793 14631 1284 11582 3028 13118 4794 14632 1284 12938 3029 13118 4795 14633 1285 11583 3030 13119 4796 14634 1286 11583 3031 13120 4797 14635 1287 11584 3032 13120 4798 14636 1288 11585 3033 13120 4799 14637 1289 11585 3034 13120 4800 14638 1290 11586 3035 13121 4801 14639 1291 11587 3036 13122 4802 14640 1292 11588 3037 13123 4803 14641 1293 11589 3038 13124 4804 14641 1294 11590 3039 13125 4805 14641 1295 11591 3040 13126 4806 14642 1296 11592 3041 13127 4807 14643 1297 11593 3042 13128 4808 14644 1298 11594 3043 13129 4809 14644 1299 11595 3044 13130 4810 14644 1300 11596 3045 13131 4811 14644 1301 11597 3046 13132 4812 14644 1302 11598 3047 13133 4813 14644 1303 11599 3048 13134 4814 14644 1304 11600 3049 13135 4815 14644 1305 11601 3050 13136 4816 14644 1306 11602 3051 13137 4817 14644 1307 11603 3052 13138 4818 14644 1308 11603 3053 13139 4819 14644 1309 11604 3054 13140 4820 14644 1310 11605 3055 13141 4821 14644 1311 11606 3056 13141 4822 14644 1312 11607 3057 13142 4823 14644 1313 11608 3058 13143 4824 14645 1314 11609 3059 13144 4825 14645 1315 11610 3060 13145 4826 14646 1316 11611 3061 13146 4827 14646 1317 11612 3062 13146 4828 14647 1318 11613 3063 13147 4829 14648 1319 11614 3064 13148 4830 14649 1320 11615 3065 13149 4831 14650 1321 11616 3066 13150 4832 14650 1322 11617 3067 13151 4833 14650 1323 11617 3068 13152 4834 14650 1323 14025 3069 13153 4835 14651 1324 11618 3070 13153 4836 14652 1325 11619 3071 13154 4837 14653 1326 11620 3072 13155 4838 14654 1327 11622 3073 13156 4839 14654 1328 11623 3074 13156 4840 14655 1329 11624 3075 13157 4841 14656 1330 11624 3076 13158 4842 14657 1331 11625 3077 13159 4843 14658 1332 11625 3078 13160 4844 14659 1333 11625 3079 13161 4845 14660 1334 11625 3080 13162 4846 14661 1335 11626 3081 13163 4847 14662 1336 11628 3082 13163 4848 14663 1337 11629 3083 13163 4849 14664 1338 11630 3084 13164 4850 14665 1339 11631 3085 13164 4851 14666 1340 11632 3086 13164 4852 14667 1341 11633 3087 13165 4853 14668 1342 11634 3088 13166 4854 14669 1343 11635 3089 13167 4855 14670 1344 11636 3090 13168 4856 14671 1345 11637 3091 13169 4857 14672 1346 11638 3092 13170 4858 14673 1347 11639 3093 13171 4859 14674 1348 11640 3094 13171 4860 14675 1349 11641 3095 13172 4861 14676 1350 11642 3096 13173 4862 14678 1351 11643 3097 13174 4863 14679 1352 11644 3098 13175 4864 14680 1353 11645 3099 13176 4865 14681 1354 11646 3100 13176 4866 14682 1355 11647 3101 13177 4867 14683 1356 11648 3102 13178 4868 14684 1357 11649 3103 13179 4869 14685 1358 11650 3104 13180 4870 14686 1359 11651 3105 13181 4871 14687 1360 11652 3106 13182 4872 14688 1361 11653 3107 13183 4873 14689 1362 11654 3108 13184 4873 14690 1363 11654 3109 13185 4874 14691 1364 11655 3110 13186 4875 14692 1365 11656 3111 13187 4876 14692 1366 11657 3112 13188 4877 14692 1367 11658 3113 13190 4878 14692 1368 11659 3114 13191 4879 14692 1369 11660 3115 13192 4880 14693 1370 11661 3116 13193 4881 14694 1371 11662 3117 13194 4882 14695 1372 11663 3118 13194 4883 14696 1373 11664 3119 13195 4884 14696 1374 11665 3120 13196 4885 14697 1375 11666 3121 13197 4886 14698 1376 11667 3122 13198 4887 14699 1377 11668 3123 13199 4888 14700 1378 11669 3124 13201 4889 14701 1379 11670 3125 13202 4890 14702 1380 11671 3126 13203 4891 14702 1381 11672 3127 13204 4892 14703 1382 11673 3128 13205 4893 14704 1383 11674 3129 13206 4894 14705 1384 11675 3130 13207 4895 14706 1385 11676 3131 13208 4896 14707 1386 11677 3132 13209 4897 14708 1387 11678 3133 13210 4898 14709 1388 11679 3134 13211 4899 14710 1389 11680 3135 13212 4900 14711 1390 11681 3136 13213 4901 14712 1391 11682 3137 13214 4902 14713 1392 11683 3138 13215 4903 14713 1393 11683 3139 13216 4904 14713 1394 11684 3140 13217 4905 14714 1394 13101 3141 13218 4906 14715 1395 11685 3142 13219 4907 14716 1396 11686 3143 13220 4908 14717 1397 11687 3144 13221 4909 14718 1398 11688 3145 13222 4910 14719 1399 11689 3146 13223 4911 14720 1400 11690 3147 13223 4912 14721 1400 14960 3148 13224 4913 14722 1401 11690 3149 13225 4914 14722 1401 14960 3150 13226 4915 14723 1402 11691 3151 13227 4916 14724 1403 11692 3152 13228 4917 14725 1404 11693 3153 13229 4918 14726 1405 11694 3154 13230 4919 14727 1406 11695 3155 13231 4920 14727 1407 11696 3156 13232 4921 14728 1408 11697 3157 13233 4922 14729 1409 11698 3158 13234 4923 14730 1410 11699 3159 13235 4924 14730 1411 11700 3160 13236 4925 14730 1412 11701 3161 13237 4926 14730 1413 11702 3162 13238 4927 14731 1414 11703 3163 13239 4928 14732 1415 11704 3164 13239 4929 14733 1416 11705 3165 13240 4930 14734 1417 11706 3166 13240 4931 14734 1418 11707 3167 13241 4932 14735 1419 11708 3168 13241 4933 14736 1420 11709 3169 13241 4934 14737 1421 11710 3170 13242 4935 14738 1422 11711 3171 13243 4936 14739 1423 11712 3172 13244 4937 14740 1424 11712 3173 13245 4938 14741 1425 11713 3174 13245 4939 14742 1426 11714 3175 13246 4940 14742 1427 11715 3176 13247 4941 14742 1428 11716 3177 13248 4942 14742 1429 11717 3178 13249 4943 14743 1429 12595 3179 13250 4944 14744 1430 11718 3180 13251 4945 14745 1431 11719 3181 13252 4946 14746 1432 11720 3182 13253 4947 14747 1433 11721 3183 13254 4948 14748 1434 11722 3184 13254 4949 14749 1435 11723 3185 13255 4950 14750 1436 11724 3186 13256 4951 14751 1437 11725 3187 13257 4952 14752 1438 11726 3187 13319 4953 14753 1439 11727 3188 13258 4954 14754 1440 11728 3189 13259 4955 14755 1441 11729 3189 13260 4956 14756 1442 11730 3190 13261 4957 14757 1443 11731 3191 13262 4958 14758 1444 11732 3192 13263 4959 14759 1445 11733 3193 13264 4960 14760 1446 11734 3194 13265 4961 14761 1447 11736 3195 13266 4962 14762 1448 11737 3196 13267 4963 14763 1449 11738 3197 13267 4964 14764 1450 11738 3198 13267 4965 14765 1451 11739 3199 13268 4966 14766 1452 11740 3200 13269 4967 14767 1453 11742 3201 13270 4968 14767 1454 11743 3202 13271 4969 14768 1455 11744 3203 13272 4970 14769 1455 13200 3204 13273 4971 14770 1456 11745 3205 13274 4972 14771 1457 11746 3206 13275 4973 14772 1458 11747 3207 13276 4974 14773 1459 11748 3208 13277 4975 14774 1460 11749 3209 13278 4976 14775 1461 11750 3210 13279 4977 14776 1462 11751 3211 13280 4978 14777 1463 11752 3212 13281 4979 14778 1464 11753 3213 13282 4980 14779 1465 11754 3214 13283 4981 14780 1466 11754 3215 13284 4982 14781 1467 11755 3216 13285 4983 14782 1468 11756 3217 13286 4984 14783 1469 11757 3218 13287 4985 14783 1470 11758 3219 13288 4986 14784 1471 11758 3219 13981 4987 14785 1472 11759 3220 13289 4988 14785 1473 11760 3221 13290 4989 14786 1474 11761 3222 13291 4990 14787 1475 11762 3223 13292 4991 14788 1476 11763 3224 13293 4992 14789 1477 11764 3225 13294 4993 14790 1478 11765 3226 13294 4994 14791 1479 11766 3227 13295 4995 14792 1480 11767 3228 13296 4996 14792 1481 11768 3229 13297 4996 14795 1482 11769 3230 13298 4997 14792 1483 11770 3231 13299 4997 14794 1484 11771 3232 13300 4998 14792 1485 11772 3233 13301 4999 14792 1486 11773 3234 13302 5000 14792 1487 11774 3235 13303 5001 14792 1488 11775 3236 13304 5002 14792 1489 11776 3237 13305 5003 14792 1490 11777 3238 13306 5004 14792 1491 11778 3239 13307 5005 14792 1492 11779 3240 13308 5006 14792 1493 11780 3241 13309 5007 14792 1494 11781 3242 13310 5008 14792 1495 11782 3243 13311 5009 14792 1496 11783 3244 13312 5010 14792 1497 11784 3245 13313 5011 14792 1498 11785 3246 13314 5012 14793 1499 11785 3247 13315 5013 14794 1500 11785 3248 13316 5014 14794 1501 11785 3248 13318 5015 14794 1502 11786 3249 13316 5016 14796 1503 11787 3250 13317 5017 14797 1504 11788 3251 13318 5018 14797 1505 11789 3252 13318 5019 14797 1506 11790 3253 13318 5020 14797 1507 11791 3254 13318 5021 14797 1508 11792 3255 13320 5022 14798 1509 11793 3256 13321 5023 14799 1510 11794 3257 13322 5024 14800 1511 11795 3258 13323 5025 14801 1512 11796 3259 13324 5026 14802 1513 11797 3260 13325 5027 14803 1514 11798 3261 13326 5028 14804 1515 11799 3262 13327 5029 14805 1516 11800 3263 13328 5030 14806 1517 11801 3264 13329 5031 14807 1518 11802 3265 13330 5032 14808 1519 11803 3266 13331 5033 14809 1520 11804 3267 13331 5034 14810 1521 11805 3268 13332 5035 14811 1522 11806 3269 13332 5036 14811 1523 11806 3270 13333 5037 14811 1524 11807 3271 13334 5038 14812 1525 11808 3272 13335 5039 14813 1526 11809 3273 13336 5040 14814 1527 11810 3274 13337 5041 14815 1528 11811 3274 13338 5042 14816 1529 11812 3275 13339 5043 14817 1530 11813 3276 13340 5044 14818 1531 11814 3277 13341 5045 14819 1532 11815 3278 13341 5046 14819 1533 11816 3279 13342 5047 14819 1534 11817 3280 13343 5048 14820 1535 11818 3281 13343 5049 14821 1536 11819 3282 13344 5050 14822 1537 11820 3283 13345 5051 14823 1538 11821 3284 13346 5052 14824 1539 11822 3285 13347 5053 14825 1540 11823 3286 13348 5054 14826 1541 11824 3287 13349 5055 14827 1542 11825 3288 13350 5056 14828 1543 11826 3289 13351 5057 14829 1544 11827 3290 13352 5058 14830 1545 11827 3291 13353 5059 14831 1546 11828 3292 13353 5060 14832 1547 11829 3293 13353 5061 14833 1548 11830 3294 13354 5062 14834 1549 11830 3295 13355 5063 14835 1550 11831 3296 13356 5064 14836 1551 11832 3297 13357 5065 14837 1552 11832 3298 13358 5066 14838 1553 11833 3299 13359 5067 14838 1554 11834 3300 13359 5068 14838 1555 11835 3301 13360 5069 14839 1556 11836 3302 13361 5070 14840 1557 11836 3303 13362 5071 14841 1558 11837 3304 13363 5072 14842 1559 11838 3305 13364 5073 14843 1560 11839 3306 13365 5074 14843 1561 11840 3307 13366 5075 14843 1562 11841 3308 13366 5076 14844 1563 11842 3309 13367 5077 14845 1564 11843 3310 13368 5078 14846 1565 11844 3311 13369 5079 14847 1566 11845 3312 13370 5080 14847 1567 11846 3313 13371 5081 14848 1568 11847 3314 13372 5082 14849 1569 11848 3315 13373 5083 14850 1570 11849 3316 13374 5084 14851 1571 11850 3317 13375 5085 14852 1572 11851 3318 13376 5086 14852 1573 11852 3319 13377 5087 14852 1574 11853 3320 13378 5088 14852 1575 11854 3321 13379 5089 14852 1576 11855 3322 13380 5090 14853 1577 11856 3323 13380 5091 14853 1578 11857 3324 13381 5092 14854 1579 11858 3325 13382 5093 14855 1580 11858 3326 13383 5094 14856 1581 11858 3327 13384 5095 14857 1582 11858 3328 13384 5096 14858 1583 11858 3329 13384 5097 14859 1584 11859 3330 13384 5098 14860 1585 11859 3331 13384 5099 14860 1586 11860 3332 13384 5100 14861 1587 11861 3333 13384 5101 14861 1588 11861 3334 13385 5102 14862 1589 11861 3335 13386 5103 14863 1590 11862 3336 13387 5104 14863 1591 11863 3337 13388 5105 14863 1592 11864 3338 13389 5106 14863 1593 11865 3339 13390 5107 14863 1594 11866 3340 13391 5108 14863 1595 11867 3341 13392 5109 14863 1596 11868 3342 13393 5110 14863 1597 11869 3343 13394 5111 14863 1598 11870 3344 13395 5112 14863 1598 14126 3344 14917 5113 14863 1599 11871 3345 13396 5114 14863 1600 11872 3346 13397 5115 14864 1601 11873 3347 13398 5116 14865 1602 11874 3348 13399 5117 14866 1603 11875 3349 13400 5118 14867 1604 11876 3350 13401 5119 14868 1605 11877 3351 13402 5120 14869 1606 11878 3352 13403 5121 14869 1607 11879 3353 13404 5122 14869 1608 11880 3354 13405 5123 14869 1609 11880 3355 13405 5124 14870 1610 11880 3356 13406 5125 14871 1611 11880 3357 13407 5126 14872 1612 11880 3358 13408 5127 14874 1613 11880 3359 13409 5128 14875 1614 11880 3360 13410 5129 14876 1615 11881 3361 13411 5130 14877 1616 11882 3362 13412 5131 14878 1617 11883 3363 13413 5132 14879 1618 11884 3363 13421 5133 14880 1619 11885 3364 13414 5134 14881 1620 11886 3365 13415 5135 14882 1621 11887 3366 13416 5136 14883 1622 11888 3367 13417 5137 14884 1623 11889 3368 13417 5138 14885 1624 11890 3369 13418 5139 14886 1625 11891 3370 13419 5140 14887 1626 11892 3371 13420 5141 14889 1627 11892 3372 13422 5142 14890 1628 11893 3373 13423 5143 14892 1629 11894 3374 13424 5144 14893 1630 11895 3375 13425 5145 14894 1631 11896 3376 13426 5146 14895 1632 11897 3377 13426 5147 14896 1633 11898 3378 13427 5148 14897 1634 11899 3379 13427 5149 14898 1635 11900 3380 13427 5150 14899 1636 11901 3381 13427 5151 14900 1637 11901 3382 13428 5152 14901 1638 11902 3383 13429 5153 14902 1639 11903 3384 13429 5154 14903 1640 11904 3385 13430 5155 14905 1641 11905 3386 13431 5156 14906 1642 11906 3387 13432 5157 14907 1643 11907 3388 13433 5158 14908 1644 11908 3389 13434 5159 14909 1645 11909 3390 13435 5160 14910 1646 11910 3391 13435 5161 14911 1647 11911 3392 13435 5162 14911 1648 11912 3393 13435 5163 14912 1649 11913 3394 13436 5164 14913 1650 11914 3395 13437 5165 14914 1651 11915 3396 13438 5166 14915 1652 11916 3397 13439 5167 14916 1653 11917 3398 13440 5168 14918 1654 11918 3399 13441 5169 14919 1655 11919 3400 13442 5170 14920 1656 11920 3401 13443 5171 14921 1657 11921 3402 13444 5172 14921 1658 11922 3403 13445 5173 14922 1659 11922 3404 13445 5174 14924 1660 11922 3405 13445 5175 14925 1661 11922 3406 13446 5176 14926 1662 11922 3407 13446 5177 14927 1663 11922 3408 13446 5178 14928 1664 11922 3409 13446 5179 14929 1665 11922 3410 13446 5180 14930 1666 11923 3411 13446 5181 14931 1667 11924 3412 13447 5182 14932 1668 11925 3413 13448 5183 14933 1669 11926 3414 13449 5184 14934 1670 11927 3415 13450 5185 14935 1671 11928 3416 13451 5186 14935 1672 11929 3417 13452 5187 14936 1673 11930 3418 13453 5188 14937 1674 11931 3419 13454 5189 14938 1675 11932 3420 13455 5190 14939 1676 11933 3421 13456 5191 14940 1677 11933 3422 13457 5192 14941 1678 11933 3423 13458 5193 14942 1679 11934 3424 13459 5194 14943 1680 11935 3425 13460 5195 14944 1681 11936 3426 13461 5196 14945 1682 11937 3427 13462 5197 14946 1683 11938 3428 13463 5198 14947 1684 11939 3429 13464 5199 14948 1685 11940 3430 13464 5200 14949 1686 11941 3431 13465 5201 14950 1687 11942 3432 13466 5202 14951 1688 11943 3433 13467 5203 14952 1689 11944 3434 13467 5204 14953 1690 11945 3435 13468 5205 14954 1691 11946 3436 13469 5206 14955 1692 11947 3437 13470 5207 14957 1693 11948 3438 13471 5208 14958 1694 11949 3439 13472 5209 14959 1695 11950 3440 13473 5210 14961 1696 11951 3441 13474 5211 14962 1697 11951 3442 13474 5212 14964 1698 11952 3443 13474 5213 14965 1699 11953 3444 13475 5214 14966 1700 11954 3445 13475 5215 14967 1701 11955 3446 13475 5216 14968 1702 11956 3447 13475 5217 14969 1702 12762 3448 13475 5218 14970 1703 11957 3449 13476 5219 14971 1704 11958 3450 13477 5220 14972 1705 11959 3451 13478 5221 14973 1706 11960 3452 13479 5222 14974 1707 11961 3453 13480 5223 14975 1708 11962 3454 13481 5224 14976 1709 11963 3455 13482 5225 14977 1710 11964 3456 13483 5226 14978 1711 11965 3457 13484 5227 14979 1712 11966 3458 13485 5228 14980 1713 11967 3459 13486 5229 14981 1714 11968 3460 13487 5230 14982 1715 11969 3461 13488 5231 14983 1716 11970 3462 13489 5232 14984 1717 11971 3463 13490 5233 14985 1718 11972 3464 13491 5234 14986 1719 11973 3465 13492 5235 14987 1720 11974 3466 13493 5236 14988 1721 11975 3467 13494 5237 14989 1722 11976 3468 13495 5238 14990 1723 11976 3469 13496 5239 14991 1724 11976 3470 13497 5240 14992 1725 11976 3471 13498 5241 14993 1726 11977 3472 13499 5242 14994 1727 11978 3473 13500 5243 14995 1728 11979 3474 13501 5244 14996 1729 11980 3475 13502 5245 14997 1730 11980 3476 13503 5246 14999 1731 11981 3477 13503 5247 15001 1732 11982 3478 13504 5248 15002 1733 11983 3479 13506 5249 15003 1734 11984 3480 13507 5250 15004 1735 11985 3481 13508 5251 15005 1736 11986 3482 13509 5252 15006 1737 11987 3483 13510 5253 15007 1738 11988 3484 13511 5254 15008 1739 11989 3485 13512 5255 15009 1740 11989 3486 13513 5256 15010 1741 11990 3487 13514 5257 15011 1742 11991 3488 13515 5258 15012 1743 11992 3489 13516 5259 15013 1744 11993 3490 13517 5260 15014 1745 11994 3491 13518 5261 15015 1746 11995 3492 13519
TABLE-US-00002 TABLE 2 Effector Protein C1 D1 C2 D2 C3 D3 C4 D4 SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: 24166 15022 26452 17308 28738 19594 31024 21880 24167 15023 26453 17309 28739 19595 31025 21881 24168 15024 26454 17310 28740 19596 31026 21882 24169 15025 26455 17311 28741 19597 31027 21883 24170 15026 26456 17312 28742 19598 31028 21884 24171 15027 26457 17313 28743 19599 31029 21885 24172 15028 26458 17314 28744 19600 31030 21886 24173 15029 26459 17315 28745 19601 31031 21887 24174 15030 26460 17316 28746 19602 31032 21888 24175 15031 26461 17317 28747 19603 31033 21889 24176 15032 26462 17318 28748 19604 31034 21890 24177 15033 26463 17319 28749 19605 31035 21891 24178 15034 26464 17320 28750 19606 31036 21892 24179 15035 26465 17321 28751 19607 31037 21893 24180 15036 26466 17322 28752 19608 31038 21894 24181 15037 26467 17323 28753 19609 31039 21895 24182 15038 26468 17324 28754 19610 31040 21896 24183 15039 26469 17325 28755 19611 31041 21897 24184 15040 26470 17326 28756 19612 31042 21898 24185 15041 26471 17327 28757 19613 31043 21899 24186 15042 26472 17328 28758 19614 31044 21900 24187 15043 26473 17329 28759 19615 31045 21901 24188 15044 26474 17330 28760 19616 31046 21902 24189 15045 26475 17331 28761 19617 31047 21903 24190 15046 26476 17332 28762 19618 31048 21904 24191 15047 26477 17333 28763 19619 31049 21905 24192 15048 26478 17334 28764 19620 31050 21906 24193 15049 26479 17335 28765 19621 31051 21907 24194 15050 26480 17336 28766 19622 31052 21908 24195 15051 26481 17337 28767 19623 31053 21909 24196 15052 26482 17338 28768 19624 31054 21910 24197 15053 26483 17339 28769 19625 31055 21911 24198 15054 26484 17340 28770 19626 31056 21912 24199 15055 26485 17341 28771 19627 31057 21913 24200 15056 26486 17342 28772 19628 31058 21914 24201 15057 26487 17343 28773 19629 31059 21915 24202 15058 26488 17344 28774 19630 31060 21916 24203 15059 26489 17345 28775 19631 31061 21917 24204 15060 26490 17346 28776 19632 31062 21918 24205 15061 26491 17347 28777 19633 31063 21919 24206 15062 26492 17348 28778 19634 31064 21920 24207 15063 26493 17349 28779 19635 31065 21921 24208 15064 26494 17350 28780 19636 31066 21922 24209 15065 26495 17351 28781 19637 31067 21923 24210 15066 26496 17352 28782 19638 31068 21924 24211 15067 26497 17353 28783 19639 31069 21925 24212 15068 26498 17354 28784 19640 31070 21926 24213 15069 26499 17355 28785 19641 31071 21927 24214 15070 26500 17356 28786 19642 31072 21928 24215 15071 26501 17357 28787 19643 31073 21929 24216 15072 26502 17358 28788 19644 31074 21930 24217 15073 26503 17359 28789 19645 31075 21931 24218 15074 26504 17360 28790 19646 31076 21932 24219 15075 26505 17361 28791 19647 31077 21933 24220 15076 26506 17362 28792 19648 31078 21934 24221 15077 26507 17363 28793 19649 31079 21935 24222 15078 26508 17364 28794 19650 31080 21936 24223 15079 26509 17365 28795 19651 31081 21937 24224 15080 26510 17366 28796 19652 31082 21938 24225 15081 26511 17367 28797 19653 31083 21939 24226 15082 26512 17368 28798 19654 31084 21940 24227 15083 26513 17369 28799 19655 31085 21941 24228 15084 26514 17370 28800 19656 31086 21942 24229 15085 26515 17371 28801 19657 31087 21943 24230 15086 26516 17372 28802 19658 31088 21944 24231 15087 26517 17373 28803 19659 31089 21945 24232 15088 26518 17374 28804 19660 31090 21946 24233 15089 26519 17375 28805 19661 31091 21947 24234 15090 26520 17376 28806 19662 31092 21948 24235 15091 26521 17377 28807 19663 31093 21949 24236 15092 26522 17378 28808 19664 31094 21950 24237 15093 26523 17379 28809 19665 31095 21951 24238 15094 26524 17380 28810 19666 31096 21952 24239 15095 26525 17381 28811 19667 31097 21953 24240 15096 26526 17382 28812 19668 31098 21954 24241 15097 26527 17383 28813 19669 31099 21955 24242 15098 26528 17384 28814 19670 31100 21956 24243 15099 26529 17385 28815 19671 31101 21957 24244 15100 26530 17386 28816 19672 31102 21958 24245 15101 26531 17387 28817 19673 31103 21959 24246 15102 26532 17388 28818 19674 31104 21960 24247 15103 26533 17389 28819 19675 31105 21961 24248 15104 26534 17390 28820 19676 31106 21962 24249 15105 26535 17391 28821 19677 31107 21963 24250 15106 26536 17392 28822 19678 31108 21964 24251 15107 26537 17393 28823 19679 31109 21965 24252 15108 26538 17394 28824 19680 31110 21966 24253 15109 26539 17395 28825 19681 31111 21967 24254 15110 26540 17396 28826 19682 31112 21968 24255 15111 26541 17397 28827 19683 31113 21969 24256 15112 26542 17398 28828 19684 31114 21970 24257 15113 26543 17399 28829 19685 31115 21971 24258 15114 26544 17400 28830 19686 31116 21972 24259 15115 26545 17401 28831 19687 31117 21973 24260 15116 26546 17402 28832 19688 31118 21974 24261 15117 26547 17403 28833 19689 31119 21975 24262 15118 26548 17404 28834 19690 31120 21976 24263 15119 26549 17405 28835 19691 31121 21977 24264 15120 26550 17406 28836 19692 31122 21978 24265 15121 26551 17407 28837 19693 31123 21979 24266 15122 26552 17408 28838 19694 31124 21980 24267 15123 26553 17409 28839 19695 31125 21981 24268 15124 26554 17410 28840 19696 31126 21982 24269 15125 26555 17411 28841 19697 31127 21983 24270 15126 26556 17412 28842 19698 31128 21984 24271 15127 26557 17413 28843 19699 31129 21985 24272 15128 26558 17414 28844 19700 31130 21986 24273 15129 26559 17415 28845 19701 31131 21987 24274 15130 26560 17416 28846 19702 31132 21988 24275 15131 26561 17417 28847 19703 31133 21989 24276 15132 26562 17418 28848 19704 31134 21990 24277 15133 26563 17419 28849 19705 31135 21991 24278 15134 26564 17420 28850 19706 31136 21992 24279 15135 26565 17421 28851 19707 31137 21993 24280 15136 26566 17422 28852 19708 31138 21994 24281 15137 26567 17423 28853 19709 31139 21995 24282 15138 26568 17424 28854 19710 31140 21996 24283 15139 26569 17425 28855 19711 31141 21997 24284 15140 26570 17426 28856 19712 31142 21998 24285 15141 26571 17427 28857 19713 31143 21999 24286 15142 26572 17428 28858 19714 31144 22000 24287 15143 26573 17429 28859 19715 31145 22001 24288 15144 26574 17430 28860 19716 31146 22002 24289 15145 26575 17431 28861 19717 31147 22003 24290 15146 26576 17432 28862 19718 31148 22004 24291 15147 26577 17433 28863 19719 31149 22005 24292 15148 26578 17434 28864 19720 31150 22006 24293 15149 26579 17435 28865 19721 31151 22007 24294 15150 26580 17436 28866 19722 31152 22008 24295 15151 26581 17437 28867 19723 31153 22009 24296 15152 26582 17438 28868 19724 31154 22010 24297 15153 26583 17439 28869 19725 31155 22011 24298 15154 26584 17440 28870 19726 31156 22012 24299 15155 26585 17441 28871 19727 31157 22013 24300 15156 26586 17442 28872 19728 31158 22014 24301 15157 26587 17443 28873 19729 31159 22015 24302 15158 26588 17444 28874 19730 31160 22016 24303 15159 26589 17445 28875 19731 31161 22017 24304 15160 26590 17446 28876 19732 31162 22018 24305 15161 26591 17447 28877 19733 31163 22019 24306 15162 26592 17448 28878 19734 31164 22020 24307 15163 26593 17449 28879 19735 31165 22021 24308 15164 26594 17450 28880 19736 31166 22022 24309 15165 26595 17451 28881 19737 31167 22023 24310 15166 26596 17452 28882 19738 31168 22024 24311 15167 26597 17453 28883 19739 31169 22025 24312 15168 26598 17454 28884 19740 31170 22026 24313 15169 26599 17455 28885 19741 31171 22027 24314 15170 26600 17456 28886 19742 31172 22028 24315 15171 26601 17457 28887 19743 31173 22029 24316 15172 26602 17458 28888 19744 31174 22030 24317 15173 26603 17459 28889 19745 31175 22031 24318 15174 26604 17460 28890 19746 31176 22032 24319 15175 26605 17461 28891 19747 31177 22033 24320 15176 26606 17462 28892 19748 31178 22034 24321 15177 26607 17463 28893 19749 31179 22035 24322 15178 26608 17464 28894 19750 31180 22036 24323 15179 26609 17465 28895 19751 31181 22037 24324 15180 26610 17466 28896 19752 31182 22038 24325 15181 26611 17467 28897 19753 31183 22039 24326 15182 26612 17468 28898 19754 31184 22040 24327 15183 26613 17469 28899 19755 31185 22041 24328 15184 26614 17470 28900 19756 31186 22042 24329 15185 26615 17471 28901 19757 31187 22043 24330 15186 26616 17472 28902 19758 31188 22044 24331 15187 26617 17473 28903 19759 31189 22045 24332 15188 26618 17474 28904 19760 31190 22046 24333 15189 26619 17475 28905 19761 31191 22047 24334 15190 26620 17476 28906 19762 31192 22048 24335 15191 26621 17477 28907 19763 31193 22049 24336 15192 26622 17478 28908 19764 31194 22050 24337 15193 26623 17479 28909 19765 31195 22051 24338 15194 26624 17480 28910 19766 31196 22052 24339 15195 26625 17481 28911 19767 31197 22053 24340 15196 26626 17482 28912 19768 31198 22054 24341 15197 26627 17483 28913 19769 31199 22055 24342 15198 26628 17484 28914 19770 31200 22056 24343 15199 26629 17485 28915 19771 31201 22057 24344 15200 26630 17486 28916 19772 31202 22058 24345 15201 26631 17487 28917 19773 31203 22059 24346 15202 26632 17488 28918 19774 31204 22060 24347 15203 26633 17489 28919 19775 31205 22061 24348 15204 26634 17490 28920 19776 31206 22062 24349 15205 26635 17491 28921 19777 31207 22063 24350 15206 26636 17492 28922 19778 31208 22064 24351 15207 26637 17493 28923 19779 31209 22065 24352 15208 26638 17494 28924 19780 31210 22066 24353 15209 26639 17495 28925 19781 31211 22067 24354 15210 26640 17496 28926 19782 31212 22068 24355 15211 26641 17497 28927 19783 31213 22069 24356 15212 26642 17498 28928 19784 31214 22070 24357 15213 26643 17499 28929 19785 31215 22071 24358 15214 26644 17500 28930 19786 31216 22072 24359 15215 26645 17501 28931 19787 31217 22073 24360 15216 26646 17502 28932 19788 31218 22074 24361 15217 26647 17503 28933 19789 31219 22075 24362 15218 26648 17504 28934 19790 31220 22076 24363 15219 26649 17505 28935 19791 31221 22077 24364 15220 26650 17506 28936 19792 31222 22078 24365 15221 26651 17507 28937 19793 31223 22079 24366 15222 26652 17508 28938 19794 31224 22080 24367 15223 26653 17509 28939 19795 31225 22081 24368 15224 26654 17510 28940 19796 31226 22082 24369 15225 26655 17511 28941 19797 31227 22083 24370 15226 26656 17512 28942 19798 31228 22084 24371 15227 26657 17513 28943 19799 31229 22085 24372 15228 26658 17514 28944 19800 31230 22086 24373 15229 26659 17515 28945 19801 31231 22087 24374 15230 26660 17516 28946 19802 31232 22088 24375 15231 26661 17517 28947 19803 31233 22089 24376 15232 26662 17518 28948 19804 31234 22090 24377 15233 26663 17519 28949 19805 31235 22091 24378 15234 26664 17520 28950 19806 31236 22092 24379 15235 26665 17521 28951 19807 31237 22093 24380 15236 26666 17522 28952 19808 31238 22094 24381 15237 26667 17523 28953 19809 31239 22095 24382 15238 26668 17524 28954 19810 31240 22096 24383 15239 26669 17525 28955 19811 31241 22097 24384 15240 26670 17526 28956 19812 31242 22098 24385 15241 26671 17527 28957 19813 31243 22099 24386 15242 26672 17528 28958 19814 31244 22100 24387 15243 26673 17529 28959 19815 31245 22101 24388 15244 26674 17530 28960 19816 31246 22102 24389 15245 26675 17531 28961 19817 31247 22103 24390 15246 26676 17532 28962 19818 31248 22104 24391 15247 26677 17533 28963 19819 31249 22105 24392 15248 26678 17534 28964 19820 31250 22106 24393 15249 26679 17535 28965 19821 31251 22107 24394 15250 26680 17536 28966 19822 31252 22108 24395 15251 26681 17537 28967 19823 31253 22109 24396 15252 26682 17538 28968 19824 31254 22110 24397 15253 26683 17539 28969 19825 31255 22111 24398 15254 26684 17540 28970 19826 31256 22112 24399 15255 26685 17541 28971 19827 31257 22113 24400 15256 26686 17542 28972 19828 31258 22114 24401 15257 26687 17543 28973 19829 31259 22115 24402 15258 26688 17544 28974 19830 31260 22116 24403 15259 26689 17545 28975 19831 31261 22117 24404 15260 26690 17546 28976 19832 31262 22118 24405 15261 26691 17547 28977 19833 31263 22119 24406 15262 26692 17548 28978 19834 31264 22120 24407 15263 26693 17549 28979 19835 31265 22121 24408 15264 26694 17550 28980 19836 31266 22122 24409 15265 26695 17551 28981 19837 31267 22123 24410 15266 26696 17552 28982 19838 31268 22124 24411 15267 26697 17553 28983 19839 31269 22125 24412 15268 26698 17554 28984 19840 31270 22126 24413 15269 26699 17555 28985 19841 31271 22127 24414 15270 26700 17556 28986 19842 31272 22128 24415 15271 26701 17557 28987 19843 31273 22129 24416 15272 26702 17558 28988 19844 31274 22130 24417 15273 26703 17559 28989 19845 31275 22131 24418 15274 26704 17560 28990 19846 31276 22132 24419 15275 26705 17561 28991 19847 31277 22133 24420 15276 26706 17562 28992 19848 31278 22134 24421 15277 26707 17563 28993 19849 31279 22135 24422 15278 26708 17564 28994 19850 31280 22136 24423 15279 26709 17565 28995 19851 31281 22137 24424 15280 26710 17566 28996 19852 31282 22138 24425 15281 26711 17567 28997 19853 31283 22139 24426 15282 26712 17568 28998 19854 31284 22140 24427 15283 26713 17569 28999 19855 31285 22141 24428 15284 26714 17570 29000 19856 31286 22142 24429 15285 26715 17571 29001 19857 31287 22143 24430 15286 26716 17572 29002 19858 31288 22144 24431 15287 26717 17573 29003 19859 31289 22145 24432 15288 26718 17574 29004 19860 31290 22146 24433 15289 26719 17575 29005 19861 31291 22147 24434 15290 26720 17576 29006 19862 31292 22148 24435 15291 26721 17577 29007 19863 31293 22149 24436 15292 26722 17578 29008 19864 31294 22150 24437 15293 26723 17579 29009 19865 31295 22151 24438 15294 26724 17580 29010 19866 31296 22152 24439 15295 26725 17581 29011 19867 31297 22153 24440 15296 26726 17582 29012 19868 31298 22154 24441 15297 26727 17583 29013 19869 31299 22155 24442 15298 26728 17584 29014 19870 31300 22156 24443 15299 26729 17585 29015 19871 31301 22157 24444 15300 26730 17586 29016 19872 31302 22158 24445 15301 26731 17587 29017 19873 31303 22159 24446 15302 26732 17588 29018 19874 31304 22160 24447 15303 26733 17589 29019 19875 31305 22161 24448 15304 26734 17590 29020 19876 31306 22162 24449 15305 26735 17591 29021 19877 31307 22163 24450 15306 26736 17592 29022 19878 31308 22164 24451 15307 26737 17593 29023 19879 31309 22165 24452 15308 26738 17594 29024 19880 31310 22166 24453 15309 26739 17595 29025 19881 31311 22167 24454 15310 26740 17596 29026 19882 31312 22168 24455 15311 26741 17597 29027 19883 31313 22169 24456 15312 26742 17598 29028 19884 31314 22170 24457 15313 26743 17599 29029 19885 31315 22171 24458 15314 26744 17600 29030 19886 31316 22172 24459 15315 26745 17601 29031 19887 31317 22173 24460 15316 26746 17602 29032 19888 31318 22174 24461 15317 26747 17603 29033 19889 31319 22175 24462 15318 26748 17604 29034 19890 22176 24463 15319 26749 17605 29035 19891 22177 24464 15320 26750 17606 29036 19892 22178 24465 15321 26751 17607 29037 19893 22179 24466 15322 26752 17608 29038 19894 22180 24467 15323 26753 17609 29039 19895 22181 24468 15324 26754 17610 29040 19896 22182 24469 15325 26755 17611 29041 19897 22183 24470 15326 26756 17612 29042 19898 22184 24471 15327 26757 17613 29043 19899 22185 24472 15328 26758 17614 29044 19900 22186 24473 15329 26759 17615 29045 19901 22187 24474 15330 26760 17616 29046 19902 22188 24475 15331 26761 17617 29047 19903 22189 24476 15332 26762 17618 29048 19904 22190 24477 15333 26763 17619 29049 19905 22191 24478 15334 26764 17620 29050 19906 22192 24479 15335 26765 17621 29051 19907 22193 24480 15336 26766 17622 29052 19908 22194 24481 15337 26767 17623 29053 19909 22195 24482 15338 26768 17624 29054 19910 22196 24483 15339 26769 17625 29055 19911 22197 24484 15340 26770 17626 29056 19912 22198 24485 15341 26771 17627 29057 19913 22199 24486 15342 26772 17628 29058 19914 22200 24487 15343 26773 17629 29059 19915 22201 24488 15344 26774 17630 29060 19916 22202 24489 15345 26775 17631 29061 19917 22203 24490 15346 26776 17632 29062 19918 22204 24491 15347 26777 17633 29063 19919 22205 24492 15348 26778 17634 29064 19920 22206 24493 15349 26779 17635 29065 19921 22207 24494 15350 26780 17636 29066 19922 22208 24495 15351 26781 17637 29067 19923 22209 24496 15352 26782 17638 29068 19924 22210 24497 15353 26783 17639 29069 19925 22211 24498 15354 26784 17640 29070 19926 22212 24499 15355 26785 17641 29071 19927 22213 24500 15356 26786 17642 29072 19928 22214 24501 15357 26787 17643 29073 19929 22215 24502 15358 26788 17644 29074 19930 22216 24503 15359 26789 17645 29075 19931 22217 24504 15360 26790 17646 29076 19932 22218 24505 15361 26791 17647 29077 19933 22219 24506 15362 26792 17648 29078 19934 22220 24507 15363 26793 17649 29079 19935 22221 24508 15364 26794 17650 29080 19936 22222 24509 15365 26795 17651 29081 19937 22223 24510 15366 26796 17652 29082 19938 22224 24511 15367 26797 17653 29083 19939 22225 24512 15368 26798 17654 29084 19940 22226 24513 15369 26799 17655 29085 19941 22227 24514 15370 26800 17656 29086 19942 22228 24515 15371 26801 17657 29087 19943 22229 24516 15372 26802 17658 29088 19944 22230 24517 15373 26803 17659 29089 19945 22231 24518 15374 26804 17660 29090 19946 22232 24519 15375 26805 17661 29091 19947 22233 24520 15376 26806 17662 29092 19948 22234 24521 15377 26807 17663 29093 19949 22235 24522 15378 26808 17664 29094 19950 22236 24523 15379 26809 17665 29095 19951 22237 24524 15380 26810 17666 29096 19952 22238 24525 15381 26811 17667 29097 19953 22239 24526 15382 26812 17668 29098 19954 22240 24527 15383 26813 17669 29099 19955 22241 24528 15384 26814 17670 29100 19956 22242 24529 15385 26815 17671 29101 19957 22243 24530 15386 26816 17672 29102 19958 22244 24531 15387 26817 17673 29103 19959 22245 24532 15388 26818 17674 29104 19960 22246 24533 15389 26819 17675 29105 19961 22247 24534 15390 26820 17676 29106 19962 22248 24535 15391 26821 17677 29107 19963 22249 24536 15392 26822 17678 29108 19964 22250 24537 15393 26823 17679 29109 19965 22251 24538 15394 26824 17680 29110 19966 22252 24539 15395 26825 17681 29111 19967 22253 24540 15396 26826 17682 29112 19968 22254 24541 15397 26827 17683 29113 19969 22255 24542 15398 26828 17684 29114 19970 22256 24543 15399 26829 17685 29115 19971 22257 24544 15400 26830 17686 29116 19972 22258 24545 15401 26831 17687 29117 19973 22259 24546 15402 26832 17688 29118 19974 22260 24547 15403 26833 17689 29119 19975 22261 24548 15404 26834 17690 29120 19976 22262 24549 15405 26835 17691 29121 19977 22263 24550 15406 26836 17692 29122 19978 22264 24551 15407 26837 17693 29123 19979 22265 24552 15408 26838 17694 29124 19980 22266 24553 15409 26839 17695 29125 19981 22267 24554 15410 26840 17696 29126 19982 22268 24555 15411 26841 17697 29127 19983 22269 24556 15412 26842 17698 29128 19984 22270 24557 15413 26843 17699 29129 19985 22271 24558 15414 26844 17700 29130 19986 22272 24559 15415 26845 17701 29131 19987 22273 24560 15416 26846 17702 29132 19988 22274 24561 15417 26847 17703 29133 19989 22275 24562 15418 26848 17704 29134 19990 22276 24563 15419 26849 17705 29135 19991 22277 24564 15420 26850 17706 29136 19992 22278 24565 15421 26851 17707 29137 19993 22279 24566 15422 26852 17708 29138 19994 22280 24567 15423 26853 17709 29139 19995 22281 24568 15424 26854 17710 29140 19996 22282 24569 15425 26855 17711 29141 19997 22283 24570 15426 26856 17712 29142 19998 22284 24571 15427 26857 17713 29143 19999 22285 24572 15428 26858 17714 29144 20000 22286 24573 15429 26859 17715 29145 20001 22287 24574 15430 26860 17716 29146 20002 22288 24575 15431 26861 17717 29147 20003 22289 24576 15432 26862 17718 29148 20004 22290 24577 15433 26863 17719 29149 20005 22291 24578 15434 26864 17720 29150 20006 22292 24579 15435 26865 17721 29151 20007 22293 24580 15436 26866 17722 29152 20008 22294 24581 15437 26867 17723 29153 20009 22295 24582 15438 26868 17724 29154 20010 22296 24583 15439 26869 17725 29155 20011 22297 24584 15440 26870 17726 29156 20012 22298 24585 15441 26871 17727 29157 20013 22299 24586 15442 26872 17728 29158 20014 22300 24587 15443 26873 17729 29159 20015 22301 24588 15444 26874 17730 29160 20016 22302 24589 15445 26875 17731 29161 20017 22303 24590 15446 26876 17732 29162 20018 22304 24591 15447 26877 17733 29163 20019 22305 24592 15448 26878 17734 29164 20020 22306 24593 15449 26879 17735 29165 20021 22307 24594 15450 26880 17736 29166 20022 22308 24595 15451 26881 17737 29167 20023 22309 24596 15452 26882 17738 29168 20024 22310 24597 15453 26883 17739 29169 20025 22311 24598 15454 26884 17740 29170 20026 22312 24599 15455 26885 17741 29171 20027 22313 24600 15456 26886 17742 29172 20028 22314 24601 15457 26887 17743 29173 20029 22315 24602 15458 26888 17744 29174 20030 22316 24603 15459 26889 17745 29175 20031 22317 24604 15460 26890 17746 29176 20032 22318 24605 15461 26891 17747 29177 20033 22319 24606 15462 26892 17748 29178 20034 22320 24607 15463 26893 17749 29179 20035 22321 24608 15464 26894 17750 29180 20036 22322 24609 15465 26895 17751 29181 20037 22323 24610 15466 26896 17752 29182 20038 22324 24611 15467 26897 17753 29183 20039 22325 24612 15468 26898 17754 29184 20040 22326 24613 15469 26899 17755 29185 20041 22327 24614 15470 26900 17756 29186 20042 22328 24615 15471 26901 17757 29187 20043 22329 24616 15472 26902 17758 29188 20044 22330 24617 15473 26903 17759 29189 20045 22331 24618 15474 26904 17760 29190 20046 22332 24619 15475 26905 17761 29191 20047 22333 24620 15476 26906 17762 29192 20048 22334 24621 15477 26907 17763 29193 20049 22335 24622 15478 26908 17764 29194 20050 22336 24623 15479 26909 17765 29195 20051 22337 24624 15480 26910 17766 29196 20052 22338 24625 15481 26911 17767 29197 20053 22339 24626 15482 26912 17768 29198 20054 22340 24627 15483 26913 17769 29199 20055 22341 24628 15484 26914 17770 29200 20056 22342 24629 15485 26915 17771 29201 20057 22343 24630 15486 26916 17772 29202 20058 22344 24631 15487 26917 17773 29203 20059 22345 24632 15488 26918 17774 29204 20060 22346 24633 15489 26919 17775 29205 20061 22347 24634 15490 26920 17776 29206 20062 22348 24635 15491 26921 17777 29207 20063 22349 24636 15492 26922 17778 29208 20064 22350 24637 15493 26923 17779 29209 20065 22351 24638 15494 26924 17780 29210 20066 22352 24639 15495 26925 17781 29211 20067 22353 24640 15496 26926 17782 29212 20068 22354 24641 15497 26927 17783 29213 20069 22355 24642 15498 26928 17784 29214 20070 22356 24643 15499 26929 17785 29215 20071 22357 24644 15500 26930 17786 29216 20072 22358 24645 15501 26931 17787 29217 20073 22359 24646 15502 26932 17788 29218 20074 22360 24647 15503 26933 17789 29219 20075 22361 24648 15504 26934 17790 29220 20076 22362 24649 15505 26935 17791 29221 20077 22363 24650 15506 26936 17792 29222 20078 22364 24651 15507 26937 17793 29223 20079 22365 24652 15508 26938 17794 29224 20080 22366 24653 15509 26939 17795 29225 20081 22367 24654 15510 26940 17796 29226 20082 22368 24655 15511 26941 17797 29227 20083 22369 24656 15512 26942 17798 29228 20084 22370 24657 15513 26943 17799 29229 20085 22371 24658 15514 26944 17800 29230 20086 22372 24659 15515 26945 17801 29231 20087 22373 24660 15516 26946 17802 29232 20088 22374 24661 15517 26947 17803 29233 20089 22375 24662 15518 26948 17804 29234 20090 22376 24663 15519 26949 17805 29235 20091 22377 24664 15520 26950 17806 29236 20092 22378 24665 15521 26951 17807 29237 20093 22379 24666 15522 26952 17808 29238 20094 22380 24667 15523 26953 17809 29239 20095 22381 24668 15524 26954 17810 29240 20096 22382 24669 15525 26955 17811 29241 20097 22383 24670 15526 26956 17812 29242 20098 22384 24671 15527 26957 17813 29243 20099 22385 24672 15528 26958 17814 29244 20100 22386 24673 15529 26959 17815 29245 20101 22387 24674 15530 26960 17816 29246 20102 22388 24675 15531 26961 17817 29247 20103 22389 24676 15532 26962 17818 29248 20104 22390 24677 15533 26963 17819 29249 20105 22391 24678 15534 26964 17820 29250 20106 22392 24679 15535 26965 17821 29251 20107 22393 24680 15536 26966 17822 29252 20108 22394 24681 15537 26967 17823 29253 20109 22395 24682 15538 26968 17824 29254 20110 22396 24683 15539 26969 17825 29255 20111 22397 24684 15540 26970 17826 29256 20112 22398 24685 15541 26971 17827 29257 20113 22399 24686 15542 26972 17828 29258 20114 22400 24687 15543 26973 17829 29259 20115 22401 24688 15544 26974 17830 29260 20116 22402 24689 15545 26975 17831 29261 20117 22403 24690 15546 26976 17832 29262 20118 22404 24691 15547 26977 17833 29263 20119 22405 24692 15548 26978 17834 29264 20120 22406 24693 15549 26979 17835 29265 20121 22407 24694 15550 26980 17836 29266 20122 22408 24695 15551 26981 17837 29267 20123 22409 24696 15552 26982 17838 29268 20124 22410 24697 15553 26983 17839 29269 20125 22411 24698 15554 26984 17840 29270 20126 22412 24699 15555 26985 17841 29271 20127 22413 24700 15556 26986 17842 29272 20128 22414 24701 15557 26987 17843 29273 20129 22415 24702 15558 26988 17844 29274 20130 22416 24703 15559 26989 17845 29275 20131 22417 24704 15560 26990 17846 29276 20132 22418 24705 15561 26991 17847 29277 20133 22419 24706 15562 26992 17848 29278 20134 22420 24707 15563 26993 17849 29279 20135 22421 24708 15564 26994 17850 29280 20136 22422 24709 15565 26995 17851 29281 20137 22423 24710 15566 26996 17852 29282 20138 22424 24711 15567 26997 17853 29283 20139 22425 24712 15568 26998 17854 29284 20140 22426 24713 15569 26999 17855 29285 20141 22427 24714 15570 27000 17856 29286 20142 22428 24715 15571 27001 17857 29287 20143 22429 24716 15572 27002 17858 29288 20144 22430 24717 15573 27003 17859 29289 20145 22431 24718 15574 27004 17860 29290 20146 22432 24719 15575 27005 17861 29291 20147 22433 24720 15576 27006 17862 29292 20148 22434 24721 15577 27007 17863 29293 20149 22435 24722 15578 27008 17864 29294 20150 22436 24723 15579 27009 17865 29295 20151 22437 24724 15580 27010 17866 29296 20152 22438 24725 15581 27011 17867 29297 20153 22439 24726 15582 27012 17868 29298 20154 22440 24727 15583 27013 17869 29299 20155 22441 24728 15584 27014 17870 29300 20156 22442 24729 15585 27015 17871 29301 20157 22443 24730 15586 27016 17872 29302 20158 22444 24731 15587 27017 17873 29303 20159 22445 24732 15588 27018 17874 29304 20160 22446 24733 15589 27019 17875 29305 20161 22447 24734 15590 27020 17876 29306 20162 22448 24735 15591 27021 17877 29307 20163 22449 24736 15592 27022 17878 29308 20164 22450 24737 15593 27023 17879 29309 20165 22451 24738 15594 27024 17880 29310 20166 22452 24739 15595 27025 17881 29311 20167 22453 24740 15596 27026 17882 29312 20168 22454 24741 15597 27027 17883 29313 20169 22455 24742 15598 27028 17884 29314 20170 22456 24743 15599 27029 17885 29315 20171 22457 24744 15600 27030 17886 29316 20172 22458 24745 15601 27031 17887 29317 20173 22459 24746 15602 27032 17888 29318 20174 22460 24747 15603 27033 17889 29319 20175 22461 24748 15604 27034 17890 29320 20176 22462 24749 15605 27035 17891 29321 20177 22463 24750 15606 27036 17892 29322 20178 22464 24751 15607 27037 17893 29323 20179 22465 24752 15608 27038 17894 29324 20180 22466 24753 15609 27039 17895 29325 20181 22467 24754 15610 27040 17896 29326 20182 22468 24755 15611 27041 17897 29327 20183 22469 24756 15612 27042 17898 29328 20184 22470 24757 15613 27043 17899 29329 20185 22471 24758 15614 27044 17900 29330 20186 22472 24759 15615 27045 17901 29331 20187 22473 24760 15616 27046 17902 29332 20188 22474 24761 15617 27047 17903 29333 20189 22475 24762 15618 27048 17904 29334 20190 22476 24763 15619 27049 17905 29335 20191 22477 24764 15620 27050 17906 29336 20192 22478 24765 15621 27051 17907 29337 20193 22479 24766 15622 27052 17908 29338 20194 22480 24767 15623 27053 17909 29339 20195 22481 24768 15624 27054 17910 29340 20196 22482 24769 15625 27055 17911 29341 20197 22483 24770 15626 27056 17912 29342 20198 22484 24771 15627 27057 17913 29343 20199 22485 24772 15628 27058 17914 29344 20200 22486 24773 15629 27059 17915 29345 20201 22487 24774 15630 27060 17916 29346 20202 22488 24775 15631 27061 17917 29347 20203 22489 24776 15632 27062 17918 29348 20204 22490 24777 15633 27063 17919 29349 20205 22491 24778 15634 27064 17920 29350 20206 22492 24779 15635 27065 17921 29351 20207 22493 24780 15636 27066 17922 29352 20208 22494 24781 15637 27067 17923 29353 20209 22495 24782 15638 27068 17924 29354 20210 22496 24783 15639 27069 17925 29355 20211 22497 24784 15640 27070 17926 29356 20212 22498 24785 15641 27071 17927 29357 20213 22499 24786 15642 27072 17928 29358 20214 22500 24787 15643 27073 17929 29359 20215 22501 24788 15644 27074 17930 29360 20216 22502 24789 15645 27075 17931 29361 20217 22503 24790 15646 27076 17932 29362 20218 22504 24791 15647 27077 17933 29363 20219 22505 24792 15648 27078 17934 29364 20220 22506 24793 15649 27079 17935 29365 20221 22507 24794 15650 27080 17936 29366 20222 22508 24795 15651 27081 17937 29367 20223 22509 24796 15652 27082 17938 29368 20224 22510 24797 15653 27083 17939 29369 20225 22511 24798 15654 27084 17940 29370 20226 22512 24799 15655 27085 17941 29371 20227 22513 24800 15656 27086 17942 29372 20228 22514 24801 15657 27087 17943 29373 20229 22515 24802 15658 27088 17944 29374 20230 22516 24803 15659 27089 17945 29375 20231 22517 24804 15660 27090 17946 29376 20232 22518 24805 15661 27091 17947 29377 20233 22519 24806 15662 27092 17948 29378 20234 22520 24807 15663 27093 17949 29379 20235 22521 24808 15664 27094 17950 29380 20236 22522 24809 15665 27095 17951 29381 20237 22523 24810 15666 27096 17952 29382 20238 22524 24811 15667 27097 17953 29383 20239 22525 24812 15668 27098 17954 29384 20240 22526 24813 15669 27099 17955 29385 20241 22527 24814 15670 27100 17956 29386 20242 22528 24815 15671 27101 17957 29387 20243 22529 24816 15672 27102 17958 29388 20244 22530 24817 15673 27103 17959 29389 20245 22531 24818 15674 27104 17960 29390 20246 22532 24819 15675 27105 17961 29391 20247 22533 24820 15676 27106 17962 29392 20248 22534 24821 15677 27107 17963 29393 20249 22535 24822 15678 27108 17964 29394 20250 22536 24823 15679 27109 17965 29395 20251 22537 24824 15680 27110 17966 29396 20252 22538 24825 15681 27111 17967 29397 20253 22539 24826 15682 27112 17968 29398 20254 22540 24827 15683 27113 17969 29399 20255 22541 24828 15684 27114 17970 29400 20256 22542 24829 15685 27115 17971 29401 20257 22543 24830 15686 27116 17972 29402 20258 22544 24831 15687 27117 17973 29403 20259 22545 24832 15688 27118 17974 29404 20260 22546 24833 15689 27119 17975 29405 20261 22547 24834 15690 27120 17976 29406 20262 22548 24835 15691 27121 17977 29407 20263 22549 24836 15692 27122 17978 29408 20264 22550 24837 15693 27123 17979 29409 20265 22551 24838 15694 27124 17980 29410 20266 22552 24839 15695 27125 17981 29411 20267 22553 24840 15696 27126 17982 29412 20268 22554 24841 15697 27127 17983 29413 20269 22555 24842 15698 27128 17984 29414 20270 22556 24843 15699 27129 17985 29415 20271 22557 24844 15700 27130 17986 29416 20272 22558 24845 15701 27131 17987 29417 20273 22559 24846 15702 27132 17988 29418 20274 22560 24847 15703 27133 17989 29419 20275 22561 24848 15704 27134 17990 29420 20276 22562 24849 15705 27135 17991 29421 20277 22563 24850 15706 27136 17992 29422 20278 22564 24851 15707 27137 17993 29423 20279 22565 24852 15708 27138 17994 29424 20280 22566 24853 15709 27139 17995 29425 20281 22567 24854 15710 27140 17996 29426 20282 22568 24855 15711 27141 17997 29427 20283 22569 24856 15712 27142 17998 29428 20284 22570 24857 15713 27143 17999 29429 20285 22571 24858 15714 27144 18000 29430 20286 22572 24859 15715 27145 18001 29431 20287 22573 24860 15716 27146 18002 29432 20288 22574 24861 15717 27147 18003 29433 20289 22575 24862 15718 27148 18004 29434 20290 22576 24863 15719 27149 18005 29435 20291 22577 24864 15720 27150 18006 29436 20292 22578 24865 15721 27151 18007 29437 20293 22579 24866 15722 27152 18008 29438 20294 22580 24867 15723 27153 18009 29439 20295 22581 24868 15724 27154 18010 29440 20296 22582 24869 15725 27155 18011 29441 20297 22583 24870 15726 27156 18012 29442 20298 22584 24871 15727 27157 18013 29443 20299 22585 24872 15728 27158 18014 29444 20300 22586 24873 15729 27159 18015 29445 20301 22587 24874 15730 27160 18016 29446 20302 22588 24875 15731 27161 18017 29447 20303 22589 24876 15732 27162 18018 29448 20304 22590 24877 15733 27163 18019 29449 20305 22591 24878 15734 27164 18020 29450 20306 22592 24879 15735 27165 18021 29451 20307 22593 24880 15736 27166 18022 29452 20308 22594 24881 15737 27167 18023 29453 20309 22595 24882 15738 27168 18024 29454 20310 22596 24883 15739 27169 18025 29455 20311 22597 24884 15740 27170 18026 29456 20312 22598 24885 15741 27171 18027 29457 20313 22599 24886 15742 27172 18028 29458 20314 22600 24887 15743 27173 18029 29459 20315 22601 24888 15744 27174 18030 29460 20316 22602 24889 15745 27175 18031 29461 20317 22603 24890 15746 27176 18032 29462 20318 22604 24891 15747 27177 18033 29463 20319 22605 24892 15748 27178 18034 29464 20320 22606 24893 15749 27179 18035 29465 20321 22607 24894 15750 27180 18036 29466 20322 22608 24895 15751 27181 18037 29467 20323 22609 24896 15752 27182 18038 29468 20324 22610 24897 15753 27183 18039 29469 20325 22611 24898 15754 27184 18040 29470 20326 22612 24899 15755 27185 18041 29471 20327 22613 24900 15756 27186 18042 29472 20328 22614 24901 15757 27187 18043 29473 20329 22615 24902 15758 27188 18044 29474 20330 22616 24903 15759 27189 18045 29475 20331 22617 24904 15760 27190 18046 29476 20332 22618 24905 15761 27191 18047 29477 20333 22619 24906 15762 27192 18048 29478 20334 22620 24907 15763 27193 18049 29479 20335 22621 24908 15764 27194 18050 29480 20336 22622 24909 15765 27195 18051 29481 20337 22623 24910 15766 27196 18052 29482 20338 22624 24911 15767 27197 18053 29483 20339 22625 24912 15768 27198 18054 29484 20340 22626 24913 15769 27199 18055 29485 20341 22627 24914 15770 27200 18056 29486 20342 22628 24915 15771 27201 18057 29487 20343 22629 24916 15772 27202 18058 29488 20344 22630 24917 15773 27203 18059 29489 20345 22631 24918 15774 27204 18060 29490 20346 22632 24919 15775 27205 18061 29491 20347 22633 24920 15776 27206 18062 29492 20348 22634 24921 15777 27207 18063 29493 20349 22635 24922 15778 27208 18064 29494 20350 22636 24923 15779 27209 18065 29495 20351 22637 24924 15780 27210 18066 29496 20352 22638 24925 15781 27211 18067 29497 20353 22639 24926 15782 27212 18068 29498 20354 22640 24927 15783 27213 18069 29499 20355 22641 24928 15784 27214 18070 29500 20356 22642 24929 15785 27215 18071 29501 20357 22643 24930 15786 27216 18072 29502 20358 22644 24931 15787 27217 18073 29503 20359 22645 24932 15788 27218 18074 29504 20360 22646 24933 15789 27219 18075 29505 20361 22647 24934 15790 27220 18076 29506 20362 22648 24935 15791 27221 18077 29507 20363 22649 24936 15792 27222 18078 29508 20364 22650 24937 15793 27223 18079 29509 20365 22651 24938 15794 27224 18080 29510 20366 22652 24939 15795 27225 18081 29511 20367 22653 24940 15796 27226 18082 29512 20368 22654 24941 15797 27227 18083 29513 20369 22655 24942 15798 27228 18084 29514 20370 22656 24943 15799 27229 18085 29515 20371 22657 24944 15800 27230 18086 29516 20372 22658 24945 15801 27231 18087 29517 20373 22659 24946 15802 27232 18088 29518 20374 22660 24947 15803 27233 18089 29519 20375 22661 24948 15804 27234 18090 29520 20376 22662 24949 15805 27235 18091 29521 20377 22663 24950 15806 27236 18092 29522 20378 22664 24951 15807 27237 18093 29523 20379 22665 24952 15808 27238 18094 29524 20380 22666 24953 15809 27239 18095 29525 20381 22667 24954 15810 27240 18096 29526 20382 22668 24955 15811 27241 18097 29527 20383 22669 24956 15812 27242 18098 29528 20384 22670 24957 15813 27243 18099 29529 20385 22671 24958 15814 27244 18100 29530 20386 22672 24959 15815 27245 18101 29531 20387 22673 24960 15816 27246 18102 29532 20388 22674 24961 15817 27247 18103 29533 20389 22675 24962 15818 27248 18104 29534 20390 22676 24963 15819 27249 18105 29535 20391 22677 24964 15820 27250 18106 29536 20392 22678 24965 15821 27251 18107 29537 20393 22679 24966 15822 27252 18108 29538 20394 22680 24967 15823 27253 18109 29539 20395 22681 24968 15824 27254 18110 29540 20396 22682 24969 15825 27255 18111 29541 20397 22683 24970 15826 27256 18112 29542 20398 22684 24971 15827 27257 18113 29543 20399 22685 24972 15828 27258 18114 29544 20400 22686 24973 15829 27259 18115 29545 20401 22687 24974 15830 27260 18116 29546 20402 22688 24975 15831 27261 18117 29547 20403 22689 24976 15832 27262 18118 29548 20404 22690 24977 15833 27263 18119 29549 20405 22691 24978 15834 27264 18120 29550 20406 22692 24979 15835 27265 18121 29551 20407 22693 24980 15836 27266 18122 29552 20408 22694 24981 15837 27267 18123 29553 20409 22695 24982 15838 27268 18124 29554 20410 22696 24983 15839 27269 18125 29555 20411 22697 24984 15840 27270 18126 29556 20412 22698 24985 15841 27271 18127 29557 20413 22699 24986 15842 27272 18128 29558 20414 22700 24987 15843 27273 18129 29559 20415 22701 24988 15844 27274 18130 29560 20416 22702 24989 15845 27275 18131 29561 20417 22703 24990 15846 27276 18132 29562 20418 22704 24991 15847 27277 18133 29563 20419 22705 24992 15848 27278 18134 29564 20420 22706 24993 15849 27279 18135 29565 20421 22707 24994 15850 27280 18136 29566 20422 22708 24995 15851 27281 18137 29567 20423 22709 24996 15852 27282 18138 29568 20424 22710 24997 15853 27283 18139 29569 20425 22711 24998 15854 27284 18140 29570 20426 22712 24999 15855 27285 18141 29571 20427 22713 25000 15856 27286 18142 29572 20428 22714 25001 15857 27287 18143 29573 20429 22715 25002 15858 27288 18144 29574 20430 22716 25003 15859 27289 18145 29575 20431 22717 25004 15860 27290 18146 29576 20432 22718 25005 15861 27291 18147 29577 20433 22719 25006 15862 27292 18148 29578 20434 22720 25007 15863 27293 18149 29579 20435 22721 25008 15864 27294 18150 29580 20436 22722 25009 15865 27295 18151 29581 20437 22723 25010 15866 27296 18152 29582 20438 22724 25011 15867 27297 18153 29583 20439 22725 25012 15868 27298 18154 29584 20440 22726 25013 15869 27299 18155 29585 20441 22727 25014 15870 27300 18156 29586 20442 22728 25015 15871 27301 18157 29587 20443 22729 25016 15872 27302 18158 29588 20444 22730 25017 15873 27303 18159 29589 20445 22731 25018 15874 27304 18160 29590 20446 22732 25019 15875 27305 18161 29591 20447 22733 25020 15876 27306 18162 29592 20448 22734 25021 15877 27307 18163 29593 20449 22735 25022 15878 27308 18164 29594 20450 22736 25023 15879 27309 18165 29595 20451 22737 25024 15880 27310 18166 29596 20452 22738 25025 15881 27311 18167 29597 20453 22739 25026 15882 27312 18168 29598 20454 22740 25027 15883 27313 18169 29599 20455 22741 25028 15884 27314 18170 29600 20456 22742 25029 15885 27315 18171 29601 20457 22743 25030 15886 27316 18172 29602 20458 22744 25031 15887 27317 18173 29603 20459 22745 25032 15888 27318 18174 29604 20460 22746 25033 15889 27319 18175 29605 20461 22747 25034 15890 27320 18176 29606 20462 22748 25035 15891 27321 18177 29607 20463 22749 25036 15892 27322 18178 29608 20464 22750 25037 15893 27323 18179 29609 20465 22751 25038 15894 27324 18180 29610 20466 22752 25039 15895 27325 18181 29611 20467 22753 25040 15896 27326 18182 29612 20468 22754 25041 15897 27327 18183 29613 20469 22755 25042 15898 27328 18184 29614 20470 22756 25043 15899 27329 18185 29615 20471 22757 25044 15900 27330 18186 29616 20472 22758 25045 15901 27331 18187 29617 20473 22759 25046 15902 27332 18188 29618 20474 22760 25047 15903 27333 18189 29619 20475 22761 25048 15904 27334 18190 29620 20476 22762 25049 15905 27335 18191 29621 20477 22763 25050 15906 27336 18192 29622 20478 22764 25051 15907 27337 18193 29623 20479 22765 25052 15908 27338 18194 29624 20480 22766 25053 15909 27339 18195 29625 20481 22767 25054 15910 27340 18196 29626 20482 22768 25055 15911 27341 18197 29627 20483 22769 25056 15912 27342 18198 29628 20484 22770 25057 15913 27343 18199 29629 20485 22771 25058 15914 27344 18200 29630 20486 22772 25059 15915 27345 18201 29631 20487 22773 25060 15916 27346 18202 29632 20488 22774 25061 15917 27347 18203 29633 20489 22775 25062 15918 27348 18204 29634 20490 22776 25063 15919 27349 18205 29635 20491 22777 25064 15920 27350 18206 29636 20492 22778 25065 15921 27351 18207 29637 20493 22779 25066 15922 27352 18208 29638 20494 22780 25067 15923 27353 18209 29639 20495 22781 25068 15924 27354 18210 29640 20496 22782 25069 15925 27355 18211 29641 20497 22783 25070 15926 27356 18212 29642 20498 22784 25071 15927 27357 18213 29643 20499 22785 25072 15928 27358 18214 29644 20500 22786 25073 15929 27359 18215 29645 20501 22787 25074 15930 27360 18216 29646 20502 22788 25075 15931 27361 18217 29647 20503 22789 25076 15932 27362 18218 29648 20504 22790 25077 15933 27363 18219 29649 20505 22791 25078 15934 27364 18220 29650 20506 22792 25079 15935 27365 18221 29651 20507 22793 25080 15936 27366 18222 29652 20508 22794 25081 15937 27367 18223 29653 20509 22795 25082 15938 27368 18224 29654 20510 22796 25083 15939 27369 18225 29655 20511 22797 25084 15940 27370 18226 29656 20512 22798 25085 15941 27371 18227 29657 20513 22799 25086 15942 27372 18228 29658 20514 22800 25087 15943 27373 18229 29659 20515 22801 25088 15944 27374 18230 29660 20516 22802 25089 15945 27375 18231 29661 20517 22803 25090 15946 27376 18232 29662 20518 22804 25091 15947 27377 18233 29663 20519 22805 25092 15948 27378 18234 29664 20520 22806 25093 15949 27379 18235 29665 20521 22807 25094 15950 27380 18236 29666 20522 22808 25095 15951 27381 18237 29667 20523 22809 25096 15952 27382 18238 29668 20524 22810 25097 15953 27383 18239 29669 20525 22811 25098 15954 27384 18240 29670 20526 22812 25099 15955 27385 18241 29671 20527 22813 25100 15956 27386 18242 29672 20528 22814 25101 15957 27387 18243 29673 20529 22815 25102 15958 27388 18244 29674 20530 22816 25103 15959 27389 18245 29675 20531 22817 25104 15960 27390 18246 29676 20532 22818 25105 15961 27391 18247 29677 20533 22819 25106 15962 27392 18248 29678 20534 22820 25107 15963 27393 18249 29679 20535 22821 25108 15964 27394 18250 29680 20536 22822 25109 15965 27395 18251 29681 20537 22823 25110 15966 27396 18252 29682 20538 22824 25111 15967 27397 18253 29683 20539 22825 25112 15968 27398 18254 29684 20540 22826 25113 15969 27399 18255 29685 20541 22827 25114 15970 27400 18256 29686 20542 22828 25115 15971 27401 18257 29687 20543 22829 25116 15972 27402 18258 29688 20544 22830 25117 15973 27403 18259 29689 20545 22831 25118 15974 27404 18260 29690 20546 22832 25119 15975 27405 18261 29691 20547 22833 25120 15976 27406 18262 29692 20548 22834 25121 15977 27407 18263 29693 20549 22835 25122 15978 27408 18264 29694 20550 22836 25123 15979 27409 18265 29695 20551 22837 25124 15980 27410 18266 29696 20552 22838 25125 15981 27411 18267 29697 20553 22839 25126 15982 27412 18268 29698 20554 22840 25127 15983 27413 18269 29699 20555 22841 25128 15984 27414 18270 29700 20556 22842 25129 15985 27415 18271 29701 20557 22843 25130 15986 27416 18272 29702 20558 22844 25131 15987 27417 18273 29703 20559 22845 25132 15988 27418 18274 29704 20560 22846 25133 15989 27419 18275 29705 20561 22847 25134 15990 27420 18276 29706 20562 22848 25135 15991 27421 18277 29707 20563 22849 25136 15992 27422 18278 29708 20564 22850 25137 15993 27423 18279 29709 20565 22851 25138 15994 27424 18280 29710 20566 22852 25139 15995 27425 18281 29711 20567 22853 25140 15996 27426 18282 29712 20568 22854 25141 15997 27427 18283 29713 20569 22855 25142 15998 27428 18284 29714 20570 22856 25143 15999 27429 18285 29715 20571 22857 25144 16000 27430 18286 29716 20572 22858 25145 16001 27431 18287 29717 20573 22859 25146 16002 27432 18288 29718 20574 22860 25147 16003 27433 18289 29719 20575 22861 25148 16004 27434 18290 29720 20576 22862 25149 16005 27435 18291 29721 20577 22863 25150 16006 27436 18292 29722 20578 22864 25151 16007 27437 18293 29723 20579 22865 25152 16008 27438 18294 29724 20580 22866 25153 16009 27439 18295 29725 20581 22867 25154 16010 27440 18296 29726 20582 22868 25155 16011 27441 18297 29727 20583 22869 25156 16012 27442 18298 29728 20584 22870 25157 16013 27443 18299 29729 20585 22871 25158 16014 27444 18300 29730 20586 22872 25159 16015 27445 18301 29731 20587 22873 25160 16016 27446 18302 29732 20588 22874 25161 16017 27447 18303 29733 20589 22875 25162 16018 27448 18304 29734 20590 22876 25163 16019 27449 18305 29735 20591 22877 25164 16020 27450 18306 29736 20592 22878 25165 16021 27451 18307 29737 20593 22879 25166 16022 27452 18308 29738 20594 22880 25167 16023 27453 18309 29739 20595 22881 25168 16024 27454 18310 29740 20596 22882 25169 16025 27455 18311 29741 20597 22883 25170 16026 27456 18312 29742 20598 22884 25171 16027 27457 18313 29743 20599 22885 25172 16028 27458 18314 29744 20600 22886 25173 16029 27459 18315 29745 20601 22887 25174 16030 27460 18316 29746 20602 22888 25175 16031 27461 18317 29747 20603 22889 25176 16032 27462 18318 29748 20604 22890 25177 16033 27463 18319 29749 20605 22891 25178 16034 27464 18320 29750 20606 22892 25179 16035 27465 18321 29751 20607 22893 25180 16036 27466 18322 29752 20608 22894 25181 16037 27467 18323 29753 20609 22895 25182 16038 27468 18324 29754 20610 22896 25183 16039 27469 18325 29755 20611 22897 25184 16040 27470 18326 29756 20612 22898 25185 16041 27471 18327 29757 20613 22899 25186 16042 27472 18328 29758 20614 22900 25187 16043 27473 18329 29759 20615 22901 25188 16044 27474 18330 29760 20616 22902 25189 16045 27475 18331 29761 20617 22903 25190 16046 27476 18332 29762 20618 22904 25191 16047 27477 18333 29763 20619 22905 25192 16048 27478 18334 29764 20620 22906 25193 16049 27479 18335 29765 20621 22907 25194 16050 27480 18336 29766 20622 22908 25195 16051 27481 18337 29767 20623 22909 25196 16052 27482 18338 29768 20624 22910 25197 16053 27483 18339 29769 20625 22911 25198 16054 27484 18340 29770 20626 22912 25199 16055 27485 18341 29771 20627 22913 25200 16056 27486 18342 29772 20628 22914 25201 16057 27487 18343 29773 20629 22915 25202 16058 27488 18344 29774 20630 22916 25203 16059 27489 18345 29775 20631 22917 25204 16060 27490 18346 29776 20632 22918 25205 16061 27491 18347 29777 20633 22919 25206 16062 27492 18348 29778 20634 22920 25207 16063 27493 18349 29779 20635 22921 25208 16064 27494 18350 29780 20636 22922 25209 16065 27495 18351 29781 20637 22923 25210 16066 27496 18352 29782 20638 22924 25211 16067 27497 18353 29783 20639 22925 25212 16068 27498 18354 29784 20640 22926 25213 16069 27499 18355 29785 20641 22927 25214 16070 27500 18356 29786 20642 22928 25215 16071 27501 18357 29787 20643 22929 25216 16072 27502 18358 29788 20644 22930 25217 16073 27503 18359 29789 20645 22931 25218 16074 27504 18360 29790 20646 22932 25219 16075 27505 18361 29791 20647 22933 25220 16076 27506 18362 29792 20648 22934 25221 16077 27507 18363 29793 20649 22935 25222 16078 27508 18364 29794 20650 22936 25223 16079 27509 18365 29795 20651 22937 25224 16080 27510 18366 29796 20652 22938 25225 16081 27511 18367 29797 20653 22939 25226 16082 27512 18368 29798 20654 22940 25227 16083 27513 18369 29799 20655 22941 25228 16084 27514 18370 29800 20656 22942 25229 16085 27515 18371 29801 20657 22943 25230 16086 27516 18372 29802 20658 22944 25231 16087 27517 18373 29803 20659 22945 25232 16088 27518 18374 29804 20660 22946 25233 16089 27519 18375 29805 20661 22947 25234 16090 27520 18376 29806 20662 22948 25235 16091 27521 18377 29807 20663 22949 25236 16092 27522 18378 29808 20664 22950 25237 16093 27523 18379 29809 20665 22951 25238 16094 27524 18380 29810 20666 22952 25239 16095 27525 18381 29811 20667 22953 25240 16096 27526 18382 29812 20668 22954 25241 16097 27527 18383 29813 20669 22955 25242 16098 27528 18384 29814 20670 22956 25243 16099 27529 18385 29815 20671 22957 25244 16100 27530 18386 29816 20672 22958 25245 16101 27531 18387 29817 20673 22959 25246 16102 27532 18388 29818 20674 22960 25247 16103 27533 18389 29819 20675 22961 25248 16104 27534 18390 29820 20676 22962 25249 16105 27535 18391 29821 20677 22963 25250 16106 27536 18392 29822 20678 22964 25251 16107 27537 18393 29823 20679 22965 25252 16108 27538 18394 29824 20680 22966 25253 16109 27539 18395 29825 20681 22967 25254 16110 27540 18396 29826 20682 22968 25255 16111 27541 18397 29827 20683 22969 25256 16112 27542 18398 29828 20684 22970 25257 16113 27543 18399 29829 20685 22971 25258 16114 27544 18400 29830 20686 22972 25259 16115 27545 18401 29831 20687 22973 25260 16116 27546 18402 29832 20688 22974 25261 16117 27547 18403 29833 20689 22975 25262 16118 27548 18404 29834 20690 22976 25263 16119 27549 18405 29835 20691 22977 25264 16120 27550 18406 29836 20692 22978 25265 16121 27551 18407 29837 20693 22979 25266 16122 27552 18408 29838 20694 22980 25267 16123 27553 18409 29839 20695 22981 25268 16124 27554 18410 29840 20696 22982 25269 16125 27555 18411 29841 20697 22983 25270 16126 27556 18412 29842 20698 22984 25271 16127 27557 18413 29843 20699 22985 25272 16128 27558 18414 29844 20700 22986 25273 16129 27559 18415 29845 20701 22987 25274 16130 27560 18416 29846 20702 22988 25275 16131 27561 18417 29847 20703 22989 25276 16132 27562 18418 29848 20704 22990 25277 16133 27563 18419 29849 20705 22991 25278 16134 27564 18420 29850 20706 22992 25279 16135 27565 18421 29851 20707 22993 25280 16136 27566 18422 29852 20708 22994 25281 16137 27567 18423 29853 20709 22995 25282 16138 27568 18424 29854 20710 22996 25283 16139 27569 18425 29855 20711 22997 25284 16140 27570 18426 29856 20712 22998 25285 16141 27571 18427 29857 20713 22999 25286 16142 27572 18428 29858 20714 23000 25287 16143 27573 18429 29859 20715 23001 25288 16144 27574 18430 29860 20716 23002 25289 16145 27575 18431 29861 20717 23003 25290 16146 27576 18432 29862 20718 23004 25291 16147 27577 18433 29863 20719 23005 25292 16148 27578 18434 29864 20720 23006 25293 16149 27579 18435 29865 20721 23007 25294 16150 27580 18436 29866 20722 23008 25295 16151 27581 18437 29867 20723 23009 25296 16152 27582 18438 29868 20724 23010 25297 16153 27583 18439 29869 20725 23011 25298 16154 27584 18440 29870 20726 23012 25299 16155 27585 18441 29871 20727 23013 25300 16156 27586 18442 29872 20728 23014 25301 16157 27587 18443 29873 20729 23015 25302 16158 27588 18444 29874 20730 23016 25303 16159 27589 18445 29875 20731 23017 25304 16160 27590 18446 29876 20732 23018 25305 16161 27591 18447 29877 20733 23019 25306 16162 27592 18448 29878 20734 23020 25307 16163 27593 18449 29879 20735 23021 25308 16164 27594 18450 29880 20736 23022 25309 16165 27595 18451 29881 20737 23023 25310 16166 27596 18452 29882 20738 23024 25311 16167 27597 18453 29883 20739 23025 25312 16168 27598 18454 29884 20740 23026 25313 16169 27599 18455 29885 20741 23027 25314 16170 27600 18456 29886 20742 23028 25315 16171 27601 18457 29887 20743 23029 25316 16172 27602 18458 29888 20744 23030 25317 16173 27603 18459 29889 20745 23031 25318 16174 27604 18460 29890 20746 23032 25319 16175 27605 18461 29891 20747 23033 25320 16176 27606 18462 29892 20748 23034 25321 16177 27607 18463 29893 20749 23035 25322 16178 27608 18464 29894 20750 23036 25323 16179 27609 18465 29895 20751 23037 25324 16180 27610 18466 29896 20752 23038 25325 16181 27611 18467 29897 20753 23039 25326 16182 27612 18468 29898 20754 23040 25327 16183 27613 18469 29899 20755 23041 25328 16184 27614 18470 29900 20756 23042 25329 16185 27615 18471 29901 20757 23043 25330 16186 27616 18472 29902 20758 23044 25331 16187 27617 18473 29903 20759 23045 25332 16188 27618 18474 29904 20760 23046 25333 16189 27619 18475 29905 20761 23047 25334 16190 27620 18476 29906 20762 23048 25335 16191 27621 18477 29907 20763 23049 25336 16192 27622 18478 29908 20764 23050 25337 16193 27623 18479 29909 20765 23051 25338 16194 27624 18480 29910 20766 23052 25339 16195 27625 18481 29911 20767 23053 25340 16196 27626 18482 29912 20768 23054 25341 16197 27627 18483 29913 20769 23055 25342 16198 27628 18484 29914 20770 23056 25343 16199 27629 18485 29915 20771 23057 25344 16200 27630 18486 29916 20772 23058 25345 16201 27631 18487 29917 20773 23059 25346 16202 27632 18488 29918 20774 23060 25347 16203 27633 18489 29919 20775 23061 25348 16204 27634 18490 29920 20776 23062 25349 16205 27635 18491 29921 20777 23063 25350 16206 27636 18492 29922 20778 23064 25351 16207 27637 18493 29923 20779 23065 25352 16208 27638 18494 29924 20780 23066 25353 16209 27639 18495 29925 20781 23067 25354 16210 27640 18496 29926 20782 23068 25355 16211 27641 18497 29927 20783 23069 25356 16212 27642 18498 29928 20784 23070 25357 16213 27643 18499 29929 20785 23071 25358 16214 27644 18500 29930 20786 23072 25359 16215 27645 18501 29931 20787 23073 25360 16216 27646 18502 29932 20788 23074 25361 16217 27647 18503 29933 20789 23075 25362 16218 27648 18504 29934 20790 23076 25363 16219 27649 18505 29935 20791 23077 25364 16220 27650 18506 29936 20792 23078 25365 16221 27651 18507 29937 20793 23079 25366 16222 27652 18508 29938 20794 23080 25367 16223 27653 18509 29939 20795 23081 25368 16224 27654 18510 29940 20796 23082 25369 16225 27655 18511 29941 20797 23083 25370 16226 27656 18512 29942 20798 23084 25371 16227 27657 18513 29943 20799 23085 25372 16228 27658 18514 29944 20800 23086 25373 16229 27659 18515 29945 20801 23087 25374 16230 27660 18516 29946 20802 23088 25375 16231 27661 18517 29947 20803 23089 25376 16232 27662 18518 29948 20804 23090 25377 16233 27663 18519 29949 20805 23091 25378 16234 27664 18520 29950 20806 23092 25379 16235 27665 18521 29951 20807 23093 25380 16236 27666 18522 29952 20808 23094 25381 16237 27667 18523 29953 20809 23095 25382 16238 27668 18524 29954 20810 23096 25383 16239 27669 18525 29955 20811 23097 25384 16240 27670 18526 29956 20812 23098 25385 16241 27671 18527 29957 20813 23099 25386 16242 27672 18528 29958 20814 23100 25387 16243 27673 18529 29959 20815 23101 25388 16244 27674 18530 29960 20816 23102 25389 16245 27675 18531 29961 20817 23103 25390 16246 27676 18532 29962 20818 23104 25391 16247 27677 18533 29963 20819 23105 25392 16248 27678 18534 29964 20820 23106 25393 16249 27679 18535 29965 20821 23107 25394 16250 27680 18536 29966 20822 23108 25395 16251 27681 18537 29967 20823 23109 25396 16252 27682 18538 29968 20824 23110 25397 16253 27683 18539 29969 20825 23111 25398 16254 27684 18540 29970 20826 23112 25399 16255 27685 18541 29971 20827 23113 25400 16256 27686 18542 29972 20828 23114 25401 16257 27687 18543 29973 20829 23115 25402 16258 27688 18544 29974 20830 23116 25403 16259 27689 18545 29975 20831 23117 25404 16260 27690 18546 29976 20832 23118 25405 16261 27691 18547 29977 20833 23119 25406 16262 27692 18548 29978 20834 23120 25407 16263 27693 18549 29979 20835 23121 25408 16264 27694 18550 29980 20836 23122 25409 16265 27695 18551 29981 20837 23123 25410 16266 27696 18552 29982 20838 23124 25411 16267 27697 18553 29983 20839 23125 25412 16268 27698 18554 29984 20840 23126 25413 16269 27699 18555 29985 20841 23127 25414 16270 27700 18556 29986 20842 23128 25415 16271 27701 18557 29987 20843 23129 25416 16272 27702 18558 29988 20844 23130 25417 16273 27703 18559 29989 20845 23131 25418 16274 27704 18560 29990 20846 23132 25419 16275 27705 18561 29991 20847 23133 25420 16276 27706 18562 29992 20848 23134 25421 16277 27707 18563 29993 20849 23135 25422 16278 27708 18564 29994 20850 23136 25423 16279 27709 18565 29995 20851 23137 25424 16280 27710 18566 29996 20852 23138 25425 16281 27711 18567 29997 20853 23139 25426 16282 27712 18568 29998 20854 23140 25427 16283 27713 18569 29999 20855 23141 25428 16284 27714 18570 30000 20856 23142 25429 16285 27715 18571 30001 20857 23143 25430 16286 27716 18572 30002 20858 23144 25431 16287 27717 18573 30003 20859 23145 25432 16288 27718 18574 30004 20860 23146 25433 16289 27719 18575 30005 20861 23147 25434 16290 27720 18576 30006 20862 23148 25435 16291 27721 18577 30007 20863 23149 25436 16292 27722 18578 30008 20864 23150 25437 16293 27723 18579 30009 20865 23151 25438 16294 27724 18580 30010 20866 23152 25439 16295 27725 18581 30011 20867 23153 25440 16296 27726 18582 30012 20868 23154 25441 16297 27727 18583 30013 20869 23155 25442 16298 27728 18584 30014 20870 23156 25443 16299 27729 18585 30015 20871 23157 25444 16300 27730 18586 30016 20872 23158 25445 16301 27731 18587 30017 20873 23159 25446 16302 27732 18588 30018 20874 23160 25447 16303 27733 18589 30019 20875 23161 25448 16304 27734 18590 30020 20876 23162 25449 16305 27735 18591 30021 20877 23163 25450 16306 27736 18592 30022 20878 23164 25451 16307 27737 18593 30023 20879 23165 25452 16308 27738 18594 30024 20880 23166 25453 16309 27739 18595 30025 20881 23167 25454 16310 27740 18596 30026 20882 23168 25455 16311 27741 18597 30027 20883 23169 25456 16312 27742 18598 30028 20884 23170 25457 16313 27743 18599 30029 20885 23171 25458 16314 27744 18600 30030 20886 23172 25459 16315 27745 18601 30031 20887 23173 25460 16316 27746 18602 30032 20888 23174 25461 16317 27747 18603 30033 20889 23175 25462 16318 27748 18604 30034 20890 23176 25463 16319 27749 18605 30035 20891 23177 25464 16320 27750 18606 30036 20892 23178 25465 16321 27751 18607 30037 20893 23179 25466 16322 27752 18608 30038 20894 23180 25467 16323 27753 18609 30039 20895 23181 25468 16324 27754 18610 30040 20896 23182 25469 16325 27755 18611 30041 20897 23183 25470 16326 27756 18612 30042 20898 23184 25471 16327 27757 18613 30043 20899 23185 25472 16328 27758 18614 30044 20900 23186 25473 16329 27759 18615 30045 20901 23187 25474 16330 27760 18616 30046 20902 23188 25475 16331 27761 18617 30047 20903 23189 25476 16332 27762 18618 30048 20904 23190 25477 16333 27763 18619 30049 20905 23191 25478 16334 27764 18620 30050 20906 23192 25479 16335 27765 18621 30051 20907 23193 25480 16336 27766 18622 30052 20908 23194 25481 16337 27767 18623 30053 20909 23195 25482 16338 27768 18624 30054 20910 23196 25483 16339 27769 18625 30055 20911 23197 25484 16340 27770 18626 30056 20912 23198 25485 16341 27771 18627 30057 20913 23199 25486 16342 27772 18628 30058 20914 23200 25487 16343 27773 18629 30059 20915 23201 25488 16344 27774 18630 30060 20916 23202 25489 16345 27775 18631 30061 20917 23203 25490 16346 27776 18632 30062 20918 23204 25491 16347 27777 18633 30063 20919 23205 25492 16348 27778 18634 30064 20920 23206 25493 16349 27779 18635 30065 20921 23207 25494 16350 27780 18636 30066 20922 23208 25495 16351 27781 18637 30067 20923 23209 25496 16352 27782 18638 30068 20924 23210 25497 16353 27783 18639 30069 20925 23211 25498 16354 27784 18640 30070 20926 23212 25499 16355 27785 18641 30071 20927 23213 25500 16356 27786 18642 30072 20928 23214 25501 16357 27787 18643 30073 20929 23215 25502 16358 27788 18644 30074 20930 23216 25503 16359 27789 18645 30075 20931 23217 25504 16360 27790 18646 30076 20932 23218 25505 16361 27791 18647 30077 20933 23219 25506 16362 27792 18648 30078 20934 23220 25507 16363 27793 18649 30079 20935 23221 25508 16364 27794 18650 30080 20936 23222 25509 16365 27795 18651 30081 20937 23223 25510 16366 27796 18652 30082 20938 23224 25511 16367 27797 18653 30083 20939 23225 25512 16368 27798 18654 30084 20940 23226 25513 16369 27799 18655 30085 20941 23227 25514 16370 27800 18656 30086 20942 23228 25515 16371 27801 18657 30087 20943 23229 25516 16372 27802 18658 30088 20944 23230 25517 16373 27803 18659 30089 20945 23231 25518 16374 27804 18660 30090 20946 23232 25519 16375 27805 18661 30091 20947 23233 25520 16376 27806 18662 30092 20948 23234 25521 16377 27807 18663 30093 20949 23235 25522 16378 27808 18664 30094 20950 23236 25523 16379 27809 18665 30095 20951 23237 25524 16380 27810 18666 30096 20952 23238 25525 16381 27811 18667 30097 20953 23239 25526 16382 27812 18668 30098 20954 23240 25527 16383 27813 18669 30099 20955 23241 25528 16384 27814 18670 30100 20956 23242 25529 16385 27815 18671 30101 20957 23243 25530 16386 27816 18672 30102 20958 23244 25531 16387 27817 18673 30103 20959 23245 25532 16388 27818 18674 30104 20960 23246 25533 16389 27819 18675 30105 20961 23247 25534 16390 27820 18676 30106 20962 23248 25535 16391 27821 18677 30107 20963 23249 25536 16392 27822 18678 30108 20964 23250 25537 16393 27823 18679 30109 20965 23251 25538 16394 27824 18680 30110 20966 23252 25539 16395 27825 18681 30111 20967 23253 25540 16396 27826 18682 30112 20968 23254 25541 16397 27827 18683 30113 20969 23255 25542 16398 27828 18684 30114 20970 23256 25543 16399 27829 18685 30115 20971 23257 25544 16400 27830 18686 30116 20972 23258 25545 16401 27831 18687 30117 20973 23259 25546 16402 27832 18688 30118 20974 23260 25547 16403 27833 18689 30119 20975 23261 25548 16404 27834 18690 30120 20976 23262 25549 16405 27835 18691 30121 20977 23263 25550 16406 27836 18692 30122 20978 23264 25551 16407 27837 18693 30123 20979 23265 25552 16408 27838 18694 30124 20980 23266 25553 16409 27839 18695 30125 20981 23267 25554 16410 27840 18696 30126 20982 23268 25555 16411 27841 18697 30127 20983 23269 25556 16412 27842 18698 30128 20984 23270 25557 16413 27843 18699 30129 20985 23271 25558 16414 27844 18700 30130 20986 23272 25559 16415 27845 18701 30131 20987 23273 25560 16416 27846 18702 30132 20988 23274 25561 16417 27847 18703 30133 20989 23275 25562 16418 27848 18704 30134 20990 23276 25563 16419 27849 18705 30135 20991 23277 25564 16420 27850 18706 30136 20992 23278 25565 16421 27851 18707 30137 20993 23279 25566 16422 27852 18708 30138 20994 23280 25567 16423 27853 18709 30139 20995 23281 25568 16424 27854 18710 30140 20996 23282 25569 16425 27855 18711 30141 20997 23283 25570 16426 27856 18712 30142 20998 23284 25571 16427 27857 18713 30143 20999 23285 25572 16428 27858 18714 30144 21000 23286 25573 16429 27859 18715 30145 21001 23287 25574 16430 27860 18716 30146 21002 23288 25575 16431 27861 18717 30147 21003 23289 25576 16432 27862 18718 30148 21004 23290 25577 16433 27863 18719 30149 21005 23291 25578 16434 27864 18720 30150 21006 23292 25579 16435 27865 18721 30151 21007 23293 25580 16436 27866 18722 30152 21008 23294 25581 16437 27867 18723 30153 21009 23295 25582 16438 27868 18724 30154 21010 23296 25583 16439 27869 18725 30155 21011 23297 25584 16440 27870 18726 30156 21012 23298 25585 16441 27871 18727 30157 21013 23299 25586 16442 27872 18728 30158 21014 23300 25587 16443 27873 18729 30159 21015 23301 25588 16444 27874 18730 30160 21016 23302 25589 16445 27875 18731 30161 21017 23303 25590 16446 27876 18732 30162 21018 23304 25591 16447 27877 18733 30163 21019 23305 25592 16448 27878 18734 30164 21020 23306 25593 16449 27879 18735 30165 21021 23307 25594 16450 27880 18736 30166 21022 23308 25595 16451 27881 18737 30167 21023 23309 25596 16452 27882 18738 30168 21024 23310 25597 16453 27883 18739 30169 21025 23311 25598 16454 27884 18740 30170 21026 23312 25599 16455 27885 18741 30171 21027 23313 25600 16456 27886 18742 30172 21028 23314 25601 16457 27887 18743 30173 21029 23315 25602 16458 27888 18744 30174 21030 23316 25603 16459 27889 18745 30175 21031 23317 25604 16460 27890 18746 30176 21032 23318 25605 16461 27891 18747 30177 21033 23319 25606 16462 27892 18748 30178 21034 23320 25607 16463 27893 18749 30179 21035 23321 25608 16464 27894 18750 30180 21036 23322 25609 16465 27895 18751 30181 21037 23323 25610 16466 27896 18752 30182 21038 23324 25611 16467 27897 18753 30183 21039 23325 25612 16468 27898 18754 30184 21040 23326 25613 16469 27899 18755 30185 21041 23327 25614 16470 27900 18756 30186 21042 23328 25615 16471 27901 18757 30187 21043 23329 25616 16472 27902 18758 30188 21044 23330 25617 16473 27903 18759 30189 21045 23331 25618 16474 27904 18760 30190 21046 23332 25619 16475 27905 18761 30191 21047 23333 25620 16476 27906 18762 30192 21048 23334 25621 16477 27907 18763 30193 21049 23335 25622 16478 27908 18764 30194 21050 23336 25623 16479 27909 18765 30195 21051 23337 25624 16480 27910 18766 30196 21052 23338 25625 16481 27911 18767 30197 21053 23339 25626 16482 27912 18768 30198 21054 23340 25627 16483 27913 18769 30199 21055 23341 25628 16484 27914 18770 30200 21056 23342 25629 16485 27915 18771 30201 21057 23343 25630 16486 27916 18772 30202 21058 23344 25631 16487 27917 18773 30203 21059 23345 25632 16488 27918 18774 30204 21060 23346 25633 16489 27919 18775 30205 21061 23347 25634 16490 27920 18776 30206 21062 23348 25635 16491 27921 18777 30207 21063 23349 25636 16492 27922 18778 30208 21064 23350 25637 16493 27923 18779 30209 21065 23351 25638 16494 27924 18780 30210 21066 23352 25639 16495 27925 18781 30211 21067 23353 25640 16496 27926 18782 30212 21068 23354 25641 16497 27927 18783 30213 21069 23355 25642 16498 27928 18784 30214 21070 23356 25643 16499 27929 18785 30215 21071 23357 25644 16500 27930 18786 30216 21072 23358 25645 16501 27931 18787 30217 21073 23359 25646 16502 27932 18788 30218 21074 23360 25647 16503 27933 18789 30219 21075 23361 25648 16504 27934 18790 30220 21076 23362 25649 16505 27935 18791 30221 21077 23363 25650 16506 27936 18792 30222 21078 23364 25651 16507 27937 18793 30223 21079 23365 25652 16508 27938 18794 30224 21080 23366 25653 16509 27939 18795 30225 21081 23367 25654 16510 27940 18796 30226 21082 23368 25655 16511 27941 18797 30227 21083 23369 25656 16512 27942 18798 30228 21084 23370 25657 16513 27943 18799 30229 21085 23371 25658 16514 27944 18800 30230 21086 23372 25659 16515 27945 18801 30231 21087 23373 25660 16516 27946 18802 30232 21088 23374 25661 16517 27947 18803 30233 21089 23375 25662 16518 27948 18804 30234 21090 23376 25663 16519 27949 18805 30235 21091 23377 25664 16520 27950 18806 30236 21092 23378 25665 16521 27951 18807 30237 21093 23379 25666 16522 27952 18808 30238 21094 23380 25667 16523 27953 18809 30239 21095 23381 25668 16524 27954 18810 30240 21096 23382 25669 16525 27955 18811 30241 21097 23383 25670 16526 27956 18812 30242 21098 23384 25671 16527 27957 18813 30243 21099 23385 25672 16528 27958 18814 30244 21100 23386 25673 16529 27959 18815 30245 21101 23387 25674 16530 27960 18816 30246 21102 23388 25675 16531 27961 18817 30247 21103 23389 25676 16532 27962 18818 30248 21104 23390 25677 16533 27963 18819 30249 21105 23391 25678 16534 27964 18820 30250 21106 23392 25679 16535 27965 18821 30251 21107 23393 25680 16536 27966 18822 30252 21108 23394 25681 16537 27967 18823 30253 21109 23395 25682 16538 27968 18824 30254 21110 23396 25683 16539 27969 18825 30255 21111 23397 25684 16540 27970 18826 30256 21112 23398 25685 16541 27971 18827 30257 21113 23399 25686 16542 27972 18828 30258 21114 23400 25687 16543 27973 18829 30259 21115 23401 25688 16544 27974 18830 30260 21116 23402 25689 16545 27975 18831 30261 21117 23403 25690 16546 27976 18832 30262 21118 23404 25691 16547 27977 18833 30263 21119 23405 25692 16548 27978 18834 30264 21120 23406 25693 16549 27979 18835 30265 21121 23407 25694 16550 27980 18836 30266 21122 23408 25695 16551 27981 18837 30267 21123 23409 25696 16552 27982 18838 30268 21124 23410 25697 16553 27983 18839 30269 21125 23411 25698 16554 27984 18840 30270 21126 23412 25699 16555 27985 18841 30271 21127 23413 25700 16556 27986 18842 30272 21128 23414 25701 16557 27987 18843 30273 21129 23415 25702 16558 27988 18844 30274 21130 23416 25703 16559 27989 18845 30275 21131 23417 25704 16560 27990 18846 30276 21132 23418 25705 16561 27991 18847 30277 21133 23419 25706 16562 27992 18848 30278 21134 23420 25707 16563 27993 18849 30279 21135 23421 25708 16564 27994 18850 30280 21136 23422 25709 16565 27995 18851 30281 21137 23423 25710 16566 27996 18852 30282 21138 23424 25711 16567 27997 18853 30283 21139 23425 25712 16568 27998 18854 30284 21140 23426 25713 16569 27999 18855 30285 21141 23427 25714 16570 28000 18856 30286 21142 23428 25715 16571 28001 18857 30287 21143 23429 25716 16572 28002 18858 30288 21144 23430 25717 16573 28003 18859 30289 21145 23431 25718 16574 28004 18860 30290 21146 23432 25719 16575 28005 18861 30291 21147 23433 25720 16576 28006 18862 30292 21148 23434 25721 16577 28007 18863 30293 21149 23435 25722 16578 28008 18864 30294 21150 23436 25723 16579 28009 18865 30295 21151 23437 25724 16580 28010 18866 30296 21152 23438 25725 16581 28011 18867 30297 21153 23439 25726 16582 28012 18868 30298 21154 23440 25727 16583 28013 18869 30299 21155 23441 25728 16584 28014 18870 30300 21156 23442 25729 16585 28015 18871 30301 21157 23443 25730 16586 28016 18872 30302 21158 23444 25731 16587 28017 18873 30303 21159 23445 25732 16588 28018 18874 30304 21160 23446 25733 16589 28019 18875 30305 21161 23447 25734 16590 28020 18876 30306 21162 23448 25735 16591 28021 18877 30307 21163 23449 25736 16592 28022 18878 30308 21164 23450 25737 16593 28023 18879 30309 21165 23451 25738 16594 28024 18880 30310 21166 23452 25739 16595 28025 18881 30311 21167 23453 25740 16596 28026 18882 30312 21168 23454 25741 16597 28027 18883 30313 21169 23455 25742 16598 28028 18884 30314 21170 23456 25743 16599 28029 18885 30315 21171 23457 25744 16600 28030 18886 30316 21172 23458 25745 16601 28031 18887 30317 21173 23459 25746 16602 28032 18888 30318 21174 23460 25747 16603 28033 18889 30319 21175 23461 25748 16604 28034 18890 30320 21176 23462 25749 16605 28035 18891 30321 21177 23463 25750 16606 28036 18892 30322 21178 23464 25751 16607 28037 18893 30323 21179 23465 25752 16608 28038 18894 30324 21180 23466 25753 16609 28039 18895 30325 21181 23467 25754 16610 28040 18896 30326 21182 23468 25755 16611 28041 18897 30327 21183 23469 25756 16612 28042 18898 30328 21184 23470 25757 16613 28043 18899 30329 21185 23471 25758 16614 28044 18900 30330 21186 23472 25759 16615 28045 18901 30331 21187 23473 25760 16616 28046 18902 30332 21188 23474 25761 16617 28047 18903 30333 21189 23475 25762 16618 28048 18904 30334 21190 23476 25763 16619 28049 18905 30335 21191 23477 25764 16620 28050 18906 30336 21192 23478 25765 16621 28051 18907 30337 21193 23479 25766 16622 28052 18908 30338 21194 23480 25767 16623 28053 18909 30339 21195 23481 25768 16624 28054 18910 30340 21196 23482 25769 16625 28055 18911 30341 21197 23483 25770 16626 28056 18912 30342 21198 23484 25771 16627 28057 18913 30343 21199 23485 25772 16628 28058 18914 30344 21200 23486 25773 16629 28059 18915 30345 21201 23487 25774 16630 28060 18916 30346 21202 23488 25775 16631 28061 18917 30347 21203 23489 25776 16632 28062 18918 30348 21204 23490 25777 16633 28063 18919 30349 21205 23491 25778 16634 28064 18920 30350 21206 23492 25779 16635 28065 18921 30351 21207 23493 25780 16636 28066 18922 30352 21208 23494 25781 16637 28067 18923 30353 21209 23495 25782 16638 28068 18924 30354 21210 23496 25783 16639 28069 18925 30355 21211 23497 25784 16640 28070 18926 30356 21212 23498 25785 16641 28071 18927 30357 21213 23499 25786 16642 28072 18928 30358 21214 23500 25787 16643 28073 18929 30359 21215 23501 25788 16644 28074 18930 30360 21216 23502 25789 16645 28075 18931 30361 21217 23503 25790 16646 28076 18932 30362 21218 23504 25791 16647 28077 18933 30363 21219 23505 25792 16648 28078 18934 30364 21220 23506 25793 16649 28079 18935 30365 21221 23507 25794 16650 28080 18936 30366 21222 23508 25795 16651 28081 18937 30367 21223 23509 25796 16652 28082 18938 30368 21224 23510 25797 16653 28083 18939 30369 21225 23511 25798 16654 28084 18940 30370 21226 23512 25799 16655 28085 18941 30371 21227 23513 25800 16656 28086 18942 30372 21228 23514 25801 16657 28087 18943 30373 21229 23515 25802 16658 28088 18944 30374 21230 23516 25803 16659 28089 18945 30375 21231 23517 25804 16660 28090 18946 30376 21232 23518 25805 16661 28091 18947 30377 21233 23519 25806 16662 28092 18948 30378 21234 23520 25807 16663 28093 18949 30379 21235 23521 25808 16664 28094 18950 30380 21236 23522 25809 16665 28095 18951 30381 21237 23523 25810 16666 28096 18952 30382 21238 23524 25811 16667 28097 18953 30383 21239 23525 25812 16668 28098 18954 30384 21240 23526 25813 16669 28099 18955 30385 21241 23527 25814 16670 28100 18956 30386 21242 23528 25815 16671 28101 18957 30387 21243 23529 25816 16672 28102 18958 30388 21244 23530 25817 16673 28103 18959 30389 21245 23531 25818 16674 28104 18960 30390 21246 23532 25819 16675 28105 18961 30391 21247 23533 25820 16676 28106 18962 30392 21248 23534 25821 16677 28107 18963 30393 21249 23535 25822 16678 28108 18964 30394 21250 23536 25823 16679 28109 18965 30395 21251 23537 25824 16680 28110 18966 30396 21252 23538 25825 16681 28111 18967 30397 21253 23539 25826 16682 28112 18968 30398 21254 23540 25827 16683 28113 18969 30399 21255 23541 25828 16684 28114 18970 30400 21256 23542 25829 16685 28115 18971 30401 21257 23543 25830 16686 28116 18972 30402 21258 23544 25831 16687 28117 18973 30403 21259 23545 25832 16688 28118 18974 30404 21260 23546 25833 16689 28119 18975 30405 21261 23547 25834 16690 28120 18976 30406 21262 23548 25835 16691 28121 18977 30407 21263 23549 25836 16692 28122 18978 30408 21264 23550 25837 16693 28123 18979 30409 21265 23551 25838 16694 28124 18980 30410 21266 23552 25839 16695 28125 18981 30411 21267 23553 25840 16696 28126 18982 30412 21268 23554 25841 16697 28127 18983 30413 21269 23555 25842 16698 28128 18984 30414 21270 23556 25843 16699 28129 18985 30415 21271 23557 25844 16700 28130 18986 30416 21272 23558 25845 16701 28131 18987 30417 21273 23559 25846 16702 28132 18988 30418 21274 23560 25847 16703 28133 18989 30419 21275 23561 25848 16704 28134 18990 30420 21276 23562 25849 16705 28135 18991 30421 21277 23563 25850 16706 28136 18992 30422 21278 23564 25851 16707 28137 18993 30423 21279 23565 25852 16708 28138 18994 30424 21280 23566 25853 16709 28139 18995 30425 21281 23567 25854 16710 28140 18996 30426 21282 23568 25855 16711 28141 18997 30427 21283 23569 25856 16712 28142 18998 30428 21284 23570 25857 16713 28143 18999 30429 21285 23571 25858 16714 28144 19000 30430 21286 23572 25859 16715 28145 19001 30431 21287 23573 25860 16716 28146 19002 30432 21288 23574 25861 16717 28147 19003 30433 21289 23575 25862 16718 28148 19004 30434 21290 23576 25863 16719 28149 19005 30435 21291 23577 25864 16720 28150 19006 30436 21292 23578 25865 16721 28151 19007 30437 21293 23579 25866 16722 28152 19008 30438 21294 23580 25867 16723 28153 19009 30439 21295 23581 25868 16724 28154 19010 30440 21296 23582 25869 16725 28155 19011 30441 21297 23583 25870 16726 28156 19012 30442 21298 23584 25871 16727 28157 19013 30443 21299 23585 25872 16728 28158 19014 30444 21300 23586 25873 16729 28159 19015 30445 21301 23587 25874 16730 28160 19016 30446 21302 23588 25875 16731 28161 19017 30447 21303 23589 25876 16732 28162 19018 30448 21304 23590 25877 16733 28163 19019 30449 21305 23591 25878 16734 28164 19020 30450 21306 23592 25879 16735 28165 19021 30451 21307 23593 25880 16736 28166 19022 30452 21308 23594 25881 16737 28167 19023 30453 21309 23595 25882 16738 28168 19024 30454 21310 23596 25883 16739 28169 19025 30455 21311 23597 25884 16740 28170 19026 30456 21312 23598 25885 16741 28171 19027 30457 21313 23599 25886 16742 28172 19028 30458 21314 23600 25887 16743 28173 19029 30459 21315 23601 25888 16744 28174 19030 30460 21316 23602 25889 16745 28175 19031 30461 21317 23603 25890 16746 28176 19032 30462 21318 23604 25891 16747 28177 19033 30463 21319 23605 25892 16748 28178 19034 30464 21320 23606 25893 16749 28179 19035 30465 21321 23607 25894 16750 28180 19036 30466 21322 23608 25895 16751 28181 19037 30467 21323 23609 25896 16752 28182 19038 30468 21324 23610 25897 16753 28183 19039 30469 21325 23611 25898 16754 28184 19040 30470 21326 23612 25899 16755 28185 19041 30471 21327 23613 25900 16756 28186 19042 30472 21328 23614 25901 16757 28187 19043 30473 21329 23615 25902 16758 28188 19044 30474 21330 23616 25903 16759 28189 19045 30475 21331 23617 25904 16760 28190 19046 30476 21332 23618 25905 16761 28191 19047 30477 21333 23619 25906 16762 28192 19048 30478 21334 23620 25907 16763 28193 19049 30479 21335 23621 25908 16764 28194 19050 30480 21336 23622 25909 16765 28195 19051 30481 21337 23623 25910 16766 28196 19052 30482 21338 23624 25911 16767 28197 19053 30483 21339 23625 25912 16768 28198 19054 30484 21340 23626 25913 16769 28199 19055 30485 21341 23627 25914 16770 28200 19056 30486 21342 23628 25915 16771 28201 19057 30487 21343 23629 25916 16772 28202 19058 30488 21344 23630 25917 16773 28203 19059 30489 21345 23631 25918 16774 28204 19060 30490 21346 23632 25919 16775 28205 19061 30491 21347 23633 25920 16776 28206 19062 30492 21348 23634 25921 16777 28207 19063 30493 21349 23635 25922 16778 28208 19064 30494 21350 23636 25923 16779 28209 19065 30495 21351 23637 25924 16780 28210 19066 30496 21352 23638 25925 16781 28211 19067 30497 21353 23639 25926 16782 28212 19068 30498 21354 23640 25927 16783 28213 19069 30499 21355 23641 25928 16784 28214 19070 30500 21356 23642 25929 16785 28215 19071 30501 21357 23643 25930 16786 28216 19072 30502 21358 23644 25931 16787 28217 19073 30503 21359 23645 25932 16788 28218 19074 30504 21360 23646 25933 16789 28219 19075 30505 21361 23647 25934 16790 28220 19076 30506 21362 23648 25935 16791 28221 19077 30507 21363 23649 25936 16792 28222 19078 30508 21364 23650 25937 16793 28223 19079 30509 21365 23651 25938 16794 28224 19080 30510 21366 23652 25939 16795 28225 19081 30511 21367 23653 25940 16796 28226 19082 30512 21368 23654 25941 16797 28227 19083 30513 21369 23655 25942 16798 28228 19084 30514 21370 23656 25943 16799 28229 19085 30515 21371 23657 25944 16800 28230 19086 30516 21372 23658 25945 16801 28231 19087 30517 21373 23659 25946 16802 28232 19088 30518 21374 23660 25947 16803 28233 19089 30519 21375 23661 25948 16804 28234 19090 30520 21376 23662 25949 16805 28235 19091 30521 21377 23663 25950 16806 28236 19092 30522 21378 23664 25951 16807 28237 19093 30523 21379 23665 25952 16808 28238 19094 30524 21380 23666 25953 16809 28239 19095 30525 21381 23667 25954 16810 28240 19096 30526 21382 23668 25955 16811 28241 19097 30527 21383 23669 25956 16812 28242 19098 30528 21384 23670 25957 16813 28243 19099 30529 21385 23671 25958 16814 28244 19100 30530 21386 23672 25959 16815 28245 19101 30531 21387 23673 25960 16816 28246 19102 30532 21388 23674 25961 16817 28247 19103 30533 21389 23675 25962 16818 28248 19104 30534 21390 23676 25963 16819 28249 19105 30535 21391 23677 25964 16820 28250 19106 30536 21392 23678 25965 16821 28251 19107 30537 21393 23679 25966 16822 28252 19108 30538 21394 23680 25967 16823 28253 19109 30539 21395 23681 25968 16824 28254 19110 30540 21396 23682 25969 16825 28255 19111 30541 21397 23683 25970 16826 28256 19112 30542 21398 23684 25971 16827 28257 19113 30543 21399 23685 25972 16828 28258 19114 30544 21400 23686 25973 16829 28259 19115 30545 21401 23687 25974 16830 28260 19116 30546 21402 23688 25975 16831 28261 19117 30547 21403 23689 25976 16832 28262 19118 30548 21404 23690 25977 16833 28263 19119 30549 21405 23691 25978 16834 28264 19120 30550 21406 23692 25979 16835 28265 19121 30551 21407 23693 25980 16836 28266 19122 30552 21408 23694 25981 16837 28267 19123 30553 21409 23695 25982 16838 28268 19124 30554 21410 23696 25983 16839 28269 19125 30555 21411 23697 25984 16840 28270 19126 30556 21412 23698 25985 16841 28271 19127 30557 21413 23699 25986 16842 28272 19128 30558 21414 23700 25987 16843 28273 19129 30559 21415 23701 25988 16844 28274 19130 30560 21416 23702 25989 16845 28275 19131 30561 21417 23703 25990 16846 28276 19132 30562 21418 23704 25991 16847 28277 19133 30563 21419 23705 25992 16848 28278 19134 30564 21420 23706 25993 16849 28279 19135 30565 21421 23707 25994 16850 28280 19136 30566 21422 23708 25995 16851 28281 19137 30567 21423 23709 25996 16852 28282 19138 30568 21424 23710 25997 16853 28283 19139 30569 21425 23711 25998 16854 28284 19140 30570 21426 23712 25999 16855 28285 19141 30571 21427 23713 26000 16856 28286 19142 30572 21428 23714 26001 16857 28287 19143 30573 21429 23715 26002 16858 28288 19144 30574 21430 23716 26003 16859 28289 19145 30575 21431 23717 26004 16860 28290 19146 30576 21432 23718 26005 16861 28291 19147 30577 21433 23719 26006 16862 28292 19148 30578 21434 23720 26007 16863 28293 19149 30579 21435 23721 26008 16864 28294 19150 30580 21436 23722 26009 16865 28295 19151 30581 21437 23723 26010 16866 28296 19152 30582 21438 23724 26011 16867 28297 19153 30583 21439 23725 26012 16868 28298 19154 30584 21440 23726 26013 16869 28299 19155 30585 21441 23727 26014 16870 28300 19156 30586 21442 23728 26015 16871 28301 19157 30587 21443 23729 26016 16872 28302 19158 30588 21444 23730 26017 16873 28303 19159 30589 21445 23731 26018 16874 28304 19160 30590 21446 23732 26019 16875 28305 19161 30591 21447 23733 26020 16876 28306 19162 30592 21448 23734 26021 16877 28307 19163 30593 21449 23735 26022 16878 28308 19164 30594 21450 23736 26023 16879 28309 19165 30595 21451 23737 26024 16880 28310 19166 30596 21452 23738 26025 16881 28311 19167 30597 21453 23739 26026 16882 28312 19168 30598 21454 23740 26027 16883 28313 19169 30599 21455 23741 26028 16884 28314 19170 30600 21456 23742 26029 16885 28315 19171 30601 21457 23743 26030 16886 28316 19172 30602 21458 23744 26031 16887 28317 19173 30603 21459 23745 26032 16888 28318 19174 30604 21460 23746 26033 16889 28319 19175 30605 21461 23747 26034 16890 28320 19176 30606 21462 23748 26035 16891 28321 19177 30607 21463 23749 26036 16892 28322 19178 30608 21464 23750 26037 16893 28323 19179 30609 21465 23751 26038 16894 28324 19180 30610 21466 23752 26039 16895 28325 19181 30611 21467 23753 26040 16896 28326 19182 30612 21468 23754 26041 16897 28327 19183 30613 21469 23755 26042 16898 28328 19184 30614 21470 23756 26043 16899 28329 19185 30615 21471 23757 26044 16900 28330 19186 30616 21472 23758 26045 16901 28331 19187 30617 21473 23759 26046 16902 28332 19188 30618 21474 23760 26047 16903 28333 19189 30619 21475 23761 26048 16904 28334 19190 30620 21476 23762 26049 16905 28335 19191 30621 21477 23763 26050 16906 28336 19192 30622 21478 23764 26051 16907 28337 19193 30623 21479 23765 26052 16908 28338 19194 30624 21480 23766 26053 16909 28339 19195 30625 21481 23767 26054 16910 28340 19196 30626 21482 23768 26055 16911 28341 19197 30627 21483 23769 26056 16912 28342 19198 30628 21484 23770 26057 16913 28343 19199 30629 21485 23771 26058 16914 28344 19200 30630 21486 23772 26059 16915 28345 19201 30631 21487 23773 26060 16916 28346 19202 30632 21488 23774 26061 16917 28347 19203 30633 21489 23775 26062 16918 28348 19204 30634 21490 23776 26063 16919 28349 19205 30635 21491 23777 26064 16920 28350 19206 30636 21492 23778 26065 16921 28351 19207 30637 21493 23779 26066 16922 28352 19208 30638 21494 23780 26067 16923 28353 19209 30639 21495 23781 26068 16924 28354 19210 30640 21496 23782 26069 16925 28355 19211 30641 21497 23783 26070 16926 28356 19212 30642 21498 23784 26071 16927 28357 19213 30643 21499 23785 26072 16928 28358 19214 30644 21500 23786 26073 16929 28359 19215 30645 21501 23787 26074 16930 28360 19216 30646 21502 23788 26075 16931 28361 19217 30647 21503 23789 26076 16932 28362 19218 30648 21504 23790 26077 16933 28363 19219 30649 21505 23791 26078 16934 28364 19220 30650 21506 23792 26079 16935 28365 19221 30651 21507 23793 26080 16936 28366 19222 30652 21508 23794 26081 16937 28367 19223 30653 21509 23795 26082 16938 28368 19224 30654 21510 23796 26083 16939 28369 19225 30655 21511 23797 26084 16940 28370 19226 30656 21512 23798 26085 16941 28371 19227 30657 21513 23799 26086 16942 28372 19228 30658 21514 23800 26087 16943 28373 19229 30659 21515 23801 26088 16944 28374 19230 30660 21516 23802 26089 16945 28375 19231 30661 21517 23803 26090 16946 28376 19232 30662 21518 23804 26091 16947 28377 19233 30663 21519 23805 26092 16948 28378 19234 30664 21520 23806 26093 16949 28379 19235 30665 21521 23807 26094 16950 28380 19236 30666 21522 23808 26095 16951 28381 19237 30667 21523 23809 26096 16952 28382 19238 30668 21524 23810 26097 16953 28383 19239 30669 21525 23811 26098 16954 28384 19240 30670 21526 23812 26099 16955 28385 19241 30671 21527 23813 26100 16956 28386 19242 30672 21528 23814 26101 16957 28387 19243 30673 21529 23815 26102 16958 28388 19244 30674 21530 23816 26103 16959 28389 19245 30675 21531 23817 26104 16960 28390 19246 30676 21532 23818 26105 16961 28391 19247 30677 21533 23819 26106 16962 28392 19248 30678 21534 23820 26107 16963 28393 19249 30679 21535 23821 26108 16964 28394 19250 30680 21536 23822 26109 16965 28395 19251 30681 21537 23823 26110 16966 28396 19252 30682 21538 23824 26111 16967 28397 19253 30683 21539 23825 26112 16968 28398 19254 30684 21540 23826 26113 16969 28399 19255 30685 21541 23827 26114 16970 28400 19256 30686 21542 23828 26115 16971 28401 19257 30687 21543 23829 26116 16972 28402 19258 30688 21544 23830 26117 16973 28403 19259 30689 21545 23831 26118 16974 28404 19260 30690 21546 23832 26119 16975 28405 19261 30691 21547 23833 26120 16976 28406 19262 30692 21548 23834 26121 16977 28407 19263 30693 21549 23835 26122 16978 28408 19264 30694 21550 23836 26123 16979 28409 19265 30695 21551 23837 26124 16980 28410 19266 30696 21552 23838 26125 16981 28411 19267 30697 21553 23839 26126 16982 28412 19268 30698 21554 23840 26127 16983 28413 19269 30699 21555 23841 26128 16984 28414 19270 30700 21556 23842 26129 16985 28415 19271 30701 21557 23843 26130 16986 28416 19272 30702 21558 23844 26131 16987 28417 19273 30703 21559 23845 26132 16988 28418 19274 30704 21560 23846 26133 16989 28419 19275 30705 21561 23847 26134 16990 28420 19276 30706 21562 23848 26135 16991 28421 19277 30707 21563 23849 26136 16992 28422 19278 30708 21564 23850 26137 16993 28423 19279 30709 21565 23851 26138 16994 28424 19280 30710 21566 23852 26139 16995 28425 19281 30711 21567 23853 26140 16996 28426 19282 30712 21568 23854 26141 16997 28427 19283 30713 21569 23855 26142 16998 28428 19284 30714 21570 23856 26143 16999 28429 19285 30715 21571 23857 26144 17000 28430 19286 30716 21572 23858 26145 17001 28431 19287 30717 21573 23859 26146 17002 28432 19288 30718 21574 23860 26147 17003 28433 19289 30719 21575 23861 26148 17004 28434 19290 30720 21576 23862 26149 17005 28435 19291 30721 21577 23863 26150 17006 28436 19292 30722 21578 23864 26151 17007 28437 19293 30723 21579 23865 26152 17008 28438 19294 30724 21580 23866 26153 17009 28439 19295 30725 21581 23867 26154 17010 28440 19296 30726 21582 23868 26155 17011 28441 19297 30727 21583 23869 26156 17012 28442 19298 30728 21584 23870 26157 17013 28443 19299 30729 21585 23871 26158 17014 28444 19300 30730 21586 23872 26159 17015 28445 19301 30731 21587 23873 26160 17016 28446 19302 30732 21588 23874 26161 17017 28447 19303 30733 21589 23875 26162 17018 28448 19304 30734 21590 23876 26163 17019 28449 19305 30735 21591 23877 26164 17020 28450 19306 30736 21592 23878 26165 17021 28451 19307 30737 21593 23879 26166 17022 28452 19308 30738 21594 23880 26167 17023 28453 19309 30739 21595 23881 26168 17024 28454 19310 30740 21596 23882 26169 17025 28455 19311 30741 21597 23883 26170 17026 28456 19312 30742 21598 23884 26171 17027 28457 19313 30743 21599 23885 26172 17028 28458 19314 30744 21600 23886 26173 17029 28459 19315 30745 21601 23887 26174 17030 28460 19316 30746 21602 23888 26175 17031 28461 19317 30747 21603 23889 26176 17032 28462 19318 30748 21604 23890 26177 17033 28463 19319 30749 21605 23891 26178 17034 28464 19320 30750 21606 23892 26179 17035 28465 19321 30751 21607 23893 26180 17036 28466 19322 30752 21608 23894 26181 17037 28467 19323 30753 21609 23895 26182 17038 28468 19324 30754 21610 23896 26183 17039 28469 19325 30755 21611 23897 26184 17040 28470 19326 30756 21612 23898 26185 17041 28471 19327 30757 21613 23899 26186 17042 28472 19328 30758 21614 23900 26187 17043 28473 19329 30759 21615 23901 26188 17044 28474 19330 30760 21616 23902 26189 17045 28475 19331 30761 21617 23903 26190 17046 28476 19332 30762 21618 23904 26191 17047 28477 19333 30763 21619 23905 26192 17048 28478 19334 30764 21620 23906 26193 17049 28479 19335 30765 21621 23907 26194 17050 28480 19336 30766 21622 23908 26195 17051 28481 19337 30767 21623 23909 26196 17052 28482 19338 30768 21624 23910 26197 17053 28483 19339 30769 21625 23911 26198 17054 28484 19340 30770 21626 23912 26199 17055 28485 19341 30771 21627 23913 26200 17056 28486 19342 30772 21628 23914 26201 17057 28487 19343 30773 21629 23915 26202 17058 28488 19344 30774 21630 23916 26203 17059 28489 19345 30775 21631 23917 26204 17060 28490 19346 30776 21632 23918 26205 17061 28491 19347 30777 21633 23919 26206 17062 28492 19348 30778 21634 23920 26207 17063 28493 19349 30779 21635 23921 26208 17064 28494 19350 30780 21636 23922 26209 17065 28495 19351 30781 21637 23923 26210 17066 28496 19352 30782 21638 23924 26211 17067 28497 19353 30783 21639 23925 26212 17068 28498 19354 30784 21640 23926 26213 17069 28499 19355 30785 21641 23927 26214 17070 28500 19356 30786 21642 23928 26215 17071 28501 19357 30787 21643 23929 26216 17072 28502 19358 30788 21644 23930 26217 17073 28503 19359 30789 21645 23931 26218 17074 28504 19360 30790 21646 23932 26219 17075 28505 19361 30791 21647 23933 26220 17076 28506 19362 30792 21648 23934 26221 17077 28507 19363 30793 21649 23935 26222 17078 28508 19364 30794 21650 23936 26223 17079 28509 19365 30795 21651 23937 26224 17080 28510 19366 30796 21652 23938 26225 17081 28511 19367 30797 21653 23939 26226 17082 28512 19368 30798 21654 23940 26227 17083 28513 19369 30799 21655 23941 26228 17084 28514 19370 30800 21656 23942 26229 17085 28515 19371 30801 21657 23943 26230 17086 28516 19372 30802 21658 23944 26231 17087 28517 19373 30803 21659 23945 26232 17088 28518 19374 30804 21660 23946 26233 17089 28519 19375 30805 21661 23947 26234 17090 28520 19376 30806 21662 23948 26235 17091 28521 19377 30807 21663 23949 26236 17092 28522 19378 30808 21664 23950 26237 17093 28523 19379 30809 21665 23951 26238 17094 28524 19380 30810 21666 23952 26239 17095 28525 19381 30811 21667 23953 26240 17096 28526 19382 30812 21668 23954 26241 17097 28527 19383 30813 21669 23955 26242 17098 28528 19384 30814 21670 23956 26243 17099 28529 19385 30815 21671 23957 26244 17100 28530 19386 30816 21672 23958 26245 17101 28531 19387 30817 21673 23959 26246 17102 28532 19388 30818 21674 23960 26247 17103 28533 19389 30819 21675 23961 26248 17104 28534 19390 30820 21676 23962 26249 17105 28535 19391 30821 21677 23963 26250 17106 28536 19392 30822 21678 23964 26251 17107 28537 19393 30823 21679 23965 26252 17108 28538 19394 30824 21680 23966 26253 17109 28539 19395 30825 21681 23967 26254 17110 28540 19396 30826 21682 23968 26255 17111 28541 19397 30827 21683 23969 26256 17112 28542 19398 30828 21684 23970 26257 17113 28543 19399 30829 21685 23971 26258 17114 28544 19400 30830 21686 23972 26259 17115 28545 19401 30831 21687 23973 26260 17116 28546 19402 30832 21688 23974 26261 17117 28547 19403 30833 21689 23975 26262 17118 28548 19404 30834 21690 23976 26263 17119 28549 19405 30835 21691 23977 26264 17120 28550 19406 30836 21692 23978 26265 17121 28551 19407 30837 21693 23979 26266 17122 28552 19408 30838 21694 23980 26267 17123 28553 19409 30839 21695 23981 26268 17124 28554 19410 30840 21696 23982 26269 17125 28555 19411 30841 21697 23983 26270 17126 28556 19412 30842 21698 23984 26271 17127 28557 19413 30843 21699 23985 26272 17128 28558 19414 30844 21700 23986 26273 17129 28559 19415 30845 21701 23987 26274 17130 28560 19416 30846 21702 23988 26275 17131 28561 19417 30847 21703 23989 26276 17132 28562 19418 30848 21704 23990 26277 17133 28563 19419 30849 21705 23991 26278 17134 28564 19420 30850 21706 23992 26279 17135 28565 19421 30851 21707 23993 26280 17136 28566 19422 30852 21708 23994 26281 17137 28567 19423 30853 21709 23995 26282 17138 28568 19424 30854 21710 23996 26283 17139 28569 19425 30855 21711 23997 26284 17140 28570 19426 30856 21712 23998 26285 17141 28571 19427 30857 21713 23999 26286 17142 28572 19428 30858 21714 24000 26287 17143 28573 19429 30859 21715 24001 26288 17144 28574 19430 30860 21716 24002 26289 17145 28575 19431 30861 21717 24003 26290 17146 28576 19432 30862 21718 24004 26291 17147 28577 19433 30863 21719 24005 26292 17148 28578 19434 30864 21720 24006 26293 17149 28579 19435 30865 21721 24007 26294 17150 28580 19436 30866 21722 24008 26295 17151 28581 19437 30867 21723 24009 26296 17152 28582 19438 30868 21724 24010 26297 17153 28583 19439 30869 21725 24011 26298 17154 28584 19440 30870 21726 24012 26299 17155 28585 19441 30871 21727 24013 26300 17156 28586 19442 30872 21728 24014 26301 17157 28587 19443 30873 21729 24015 26302 17158 28588 19444 30874 21730 24016 26303 17159 28589 19445 30875 21731 24017 26304 17160 28590 19446 30876 21732 24018 26305 17161 28591 19447 30877 21733 24019 26306 17162 28592 19448 30878 21734 24020 26307 17163 28593 19449 30879 21735 24021 26308 17164 28594 19450 30880 21736 24022 26309 17165 28595 19451 30881 21737 24023 26310 17166 28596 19452 30882 21738 24024 26311 17167 28597 19453 30883 21739 24025 26312 17168 28598 19454 30884 21740 24026 26313 17169 28599 19455 30885 21741 24027 26314 17170 28600 19456 30886 21742 24028 26315 17171 28601 19457 30887 21743 24029 26316 17172 28602 19458 30888 21744 24030 26317 17173 28603 19459 30889 21745 24031 26318 17174 28604 19460 30890 21746 24032 26319 17175 28605 19461 30891 21747 24033 26320 17176 28606 19462 30892 21748 24034 26321 17177 28607 19463 30893 21749 24035 26322 17178 28608 19464 30894 21750 24036 26323 17179 28609 19465 30895 21751 24037 26324 17180 28610 19466 30896 21752 24038 26325 17181 28611 19467 30897 21753 24039 26326 17182 28612 19468 30898 21754 24040 26327 17183 28613 19469 30899 21755 24041 26328 17184 28614 19470 30900 21756 24042 26329 17185 28615 19471 30901 21757 24043 26330 17186 28616 19472 30902 21758 24044 26331 17187 28617 19473 30903 21759 24045 26332 17188 28618 19474 30904 21760 24046 26333 17189 28619 19475 30905 21761 24047 26334 17190 28620 19476 30906 21762 24048 26335 17191 28621 19477 30907 21763 24049 26336 17192 28622 19478 30908 21764 24050 26337 17193 28623 19479 30909 21765 24051 26338 17194 28624 19480 30910 21766 24052 26339 17195 28625 19481 30911 21767 24053 26340 17196 28626 19482 30912 21768 24054 26341 17197 28627 19483 30913 21769 24055 26342 17198 28628 19484 30914 21770 24056 26343 17199 28629 19485 30915 21771 24057 26344 17200 28630 19486 30916 21772 24058 26345 17201 28631 19487 30917 21773 24059 26346 17202 28632 19488 30918 21774 24060 26347 17203 28633 19489 30919 21775 24061 26348 17204 28634 19490 30920 21776 24062 26349 17205 28635 19491 30921 21777 24063 26350 17206 28636 19492 30922 21778 24064 26351 17207 28637 19493 30923 21779 24065 26352 17208 28638 19494 30924 21780 24066 26353 17209 28639 19495 30925 21781 24067 26354 17210 28640 19496 30926 21782 24068 26355 17211 28641 19497 30927 21783 24069 26356 17212 28642 19498 30928 21784 24070 26357 17213 28643 19499 30929 21785 24071 26358 17214 28644 19500 30930 21786 24072 26359 17215 28645 19501 30931 21787 24073 26360 17216 28646 19502 30932 21788 24074 26361 17217 28647 19503 30933 21789 24075 26362 17218 28648 19504 30934 21790 24076 26363 17219 28649 19505 30935 21791 24077 26364 17220 28650 19506 30936 21792 24078 26365 17221 28651 19507 30937 21793 24079 26366 17222 28652 19508 30938 21794 24080 26367 17223 28653 19509 30939 21795 24081 26368 17224 28654 19510 30940 21796 24082 26369 17225 28655 19511 30941 21797 24083 26370 17226 28656 19512 30942 21798 24084 26371 17227 28657 19513 30943 21799 24085 26372 17228 28658 19514 30944 21800 24086 26373 17229 28659 19515 30945 21801 24087 26374 17230 28660 19516 30946 21802 24088 26375 17231 28661 19517 30947 21803 24089 26376 17232 28662 19518 30948 21804 24090 26377 17233 28663 19519 30949 21805 24091 26378 17234 28664 19520 30950 21806 24092 26379 17235 28665 19521 30951 21807 24093 26380 17236 28666 19522 30952 21808 24094 26381 17237 28667 19523 30953 21809 24095 26382 17238 28668 19524 30954 21810 24096 26383 17239 28669 19525 30955 21811 24097 26384 17240 28670 19526 30956 21812 24098 26385 17241 28671 19527 30957 21813 24099 26386 17242 28672 19528 30958 21814 24100 26387 17243 28673 19529 30959 21815 24101 26388 17244 28674 19530 30960 21816 24102 26389 17245 28675 19531 30961 21817 24103 26390 17246 28676 19532 30962 21818 24104 26391 17247 28677 19533 30963 21819 24105 26392 17248 28678 19534 30964 21820 24106 26393 17249 28679 19535 30965 21821 24107 26394 17250 28680 19536 30966 21822 24108 26395 17251 28681 19537 30967 21823 24109 26396 17252 28682 19538 30968 21824 24110 26397 17253 28683 19539 30969 21825 24111 26398 17254 28684 19540 30970 21826 24112 26399 17255 28685 19541 30971 21827 24113 26400 17256 28686 19542 30972 21828 24114 26401 17257 28687 19543 30973 21829 24115 26402 17258 28688 19544 30974 21830 24116 26403 17259 28689 19545 30975 21831 24117 26404 17260 28690 19546 30976 21832 24118 26405 17261 28691 19547 30977 21833 24119 26406 17262 28692 19548 30978 21834 24120 26407 17263 28693 19549 30979 21835 24121 26408 17264 28694 19550 30980 21836 24122 26409 17265 28695 19551 30981 21837 24123 26410 17266 28696 19552 30982 21838 24124 26411 17267 28697 19553 30983 21839 24125 26412 17268 28698 19554 30984 21840 24126 26413 17269 28699 19555 30985 21841 24127 26414 17270 28700 19556 30986 21842 24128 26415 17271 28701 19557 30987 21843 24129 26416 17272 28702 19558 30988 21844 24130 26417 17273 28703 19559 30989 21845 24131 26418 17274 28704 19560 30990 21846 24132 26419 17275 28705 19561 30991 21847 24133 26420 17276 28706 19562 30992 21848 24134 26421 17277 28707 19563 30993 21849 24135 26422 17278 28708 19564 30994 21850 24136 26423 17279 28709 19565 30995 21851 24137 26424 17280 28710 19566 30996 21852 24138 26425 17281 28711 19567 30997 21853 24139 26426 17282 28712 19568 30998 21854 24140 26427 17283 28713 19569 30999 21855 24141 26428 17284 28714 19570 31000 21856 24142 26429 17285 28715 19571 31001 21857 24143 26430 17286 28716 19572 31002 21858 24144 26431 17287 28717 19573 31003 21859 24145 26432 17288 28718 19574 31004 21860 24146 26433 17289 28719 19575 31005 21861 24147 26434 17290 28720 19576 31006 21862 24148 26435 17291 28721 19577 31007 21863 24149 26436 17292 28722 19578 31008 21864 24150 26437 17293 28723 19579 31009 21865 24151 26438 17294 28724 19580 31010 21866 24152 26439 17295 28725 19581 31011 21867 24153 26440 17296 28726 19582 31012 21868 24154 26441 17297 28727 19583 31013 21869 24155 26442 17298 28728 19584 31014 21870 24156 26443 17299 28729 19585 31015 21871 24157 26444 17300 28730 19586 31016 21872 24158 26445 17301 28731 19587 31017 21873 24159 26446 17302 28732 19588 31018 21874 24160 26447 17303 28733 19589 31019 21875 24161 26448 17304 28734 19590 31020 21876 24162 26449 17305 28735 19591 31021 21877 24163 26450 17306 28736 19592 31022 21878 24164 26451 17307 28737 19593 31023 21879 24165
[0175] In some embodiments, compositions comprise an effector protein wherein the effector protein comprises about 100, about 120, about 140, about 160, about 180, about 200, about 220, about 240, about 260, about 280, about 300, about 320, about 340, about 360, about 380, about 400, about 420, about 440, about 460, about 480, about 500, about 520, about 540, about 560, about 580, about 600, about 620, about 640, about 660, about 680, about 700, about 720, about 740, about 760, about 780, about 800, about 820, about 840, about 860, about 880, about 900, about 920, about 940, about 960, about 980, about 1000, about 1020, about 1040, about 1060, about 1080, about 1100, about 1120, about 1140, about 1160, about 1180, about 1200, about 1220, about 1240, about 1260, about 1280, about 1300, about 1320, about 1340, about 1360, about 1380, about 1400, about 1420, about 1440, about 1460, about 1480, about 1490, about 1500, about 1520, about 1540, about 1560, about 1580, about 1600, about 1620, about 1640, about 1660, about 1680, about 1700, about 1720, about 1740, about 1760, about 1780, about 1800, about 1820, about 1840, about 1860, about 1880, about 1900, or about 1920 contiguous amino acids of a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165.
[0176] In some embodiments, compositions comprise an effector protein wherein the effector protein comprises the amino acid sequence located at positions 1-100, 150-250, 101-200, 250-350, 201-300, 350-450, 301-400, 350-450, 401-500, 450-550, 501-600, 550-650, 601-700, 650-750, 701-800, 750-850, 801-900, 850-950, 901-1000, 950-1050, 1001-1100, 1050-1150, 1101-1200, 1150-1250, 1201-1300, 1250-1350, 1301-1400, 1350-1450, 1401-1500, 1450-1550, 1501-1600, 1550-1650, 1601-1700, 1650-1750, 1701-1800, 1850-1950, 1801-1900, or 1850-1950 of a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165.
[0177] In some embodiments, compositions comprise an effector protein wherein the effector protein comprises an amino acid sequence that is at least 90%, at least 95%, or 100% identical to a portion of a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165, and wherein the portion of the sequence is about 30%, about 40% about 50%, about 60%, about 70%, about 80%, or about 90% of a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165.
[0178] In some embodiments, compositions comprise an effector protein, wherein portion of the amino acid sequence of the effector protein is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 98%, at least 99%, or 100% identical to an equal length portion of a sequence selected from SEQ ID NOs: 1-21. In some embodiments, the length of the portion is selected from: 20 to 40, 40 to 60, 60 to 80, 80 to 100, 100 to 120, 120 to 140, 140 to 160, 160 to 180, 180 to 200, 200 to 220, 220 to 240, 240 to 260, 260 to 280, 280 to 300, 320 to 340, 340 to 360, 360 to 380, and 380 to 400 linked amino acids. In some embodiments, the length of the portion is selected from: 400 to 420, 420 to 440, 440 to 460, 460 to 480, 480 to 500, 520 to 540, 540 to 560, 560 to 580, 580 to 600, 600 to 620, 620 to 640, 640 to 660, 660 to 680, and 680 to 700, 700 to 720, 720 to 740, 740 to 760, 760 to 780, 780 to 800, 820 to 840, 840 to 860, 860 to 880, 880 to 900, 900 to 920, 920 to 940, 940 to 960, 960 to 980, 980 to 1000 linked amino acids. In some embodiments, the length of the portion is selected from: 1000 to 1020, 1020 to 1040, 1040 to 1060, 1060 to 1080, 1080 to 1100, 1100 to 1120, 1120 to 1140, 1140 to 1160, 1160 to 1180, 1180 to 1200, 1220 to 1240, 1240 to 1260, 1260 to 1280, 1280 to 1300, 1300 to 1320, 1320 to 1340, 1340 to 1360, 1360 to 1380, 1380 to 1400, 1420 to 1440, 1440 to 1460, 1460 to 1480, 1480 to 1500, 1500 to 1520, 1520 to 1540, 1540 to 1560, 1560 to 1580, 1580 to 1600 linked amino acids.
[0179] In some embodiments, effector proteins comprise a functional domain. The functional domain may comprise nucleic acid binding activity. The functional domain may comprise catalytic activity, also referred to as enzymatic activity. The catalytic activity may be nuclease activity. The nuclease activity may comprise cleaving a strand of a nucleic acid. The nuclease activity may comprise cleaving only one strand of a double stranded nucleic acid, also referred to as nicking. In some embodiments, the functional domain is an HNH domain. In some embodiments, the functional domain is a RuvC domain. In some embodiments, the RuvC domain comprises multiple subdomains. In some embodiments, the functional domain is a zinc finger binding domain. In some embodiments, the functional domain is a HEPN domain. In some embodiments, effector proteins lack a certain functional domain. In some embodiments, the effector protein lacks an HNH domain. In some embodiments, effector proteins lack a zinc finger binding domain.
[0180] In some embodiments, effector proteins catalyze cleavage of a target nucleic acid in a cell or a sample. In some embodiments, the target nucleic acid is single stranded (ss). In some embodiments, the target nucleic acid is double stranded (ds). In some embodiments, the target nucleic acid is dsDNA. In some embodiments, the target nucleic acid is ssDNA. In some embodiments, the target nucleic acid is RNA. In some embodiments, effector proteins cleave the target nucleic acid within a target sequence of the target nucleic acid.
[0181] In some embodiments, effector proteins catalyze cis cleavage activity. In some embodiments, effector proteins cleave both strands of dsDNA.
[0182] In some embodiments, effector proteins cleave or nick a target nucleic acid within or near a protospacer adjacent motif (PAM) sequence of the target nucleic acid. In some embodiments, cleavage occurs within 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides of a 5 or 3 terminus of a PAM sequence. A target nucleic acid may comprise a PAM sequence adjacent to a sequence that is complementary to a guide nucleic acid spacer sequence. In some embodiments, effector proteins do not require a PAM sequence to cleave or a nick a target nucleic acid.
Engineered Proteins
[0183] In some embodiments, effector proteins disclosed herein are engineered proteins. Engineered proteins are not identical to a naturally-occurring protein. Engineered proteins may not comprise an amino acid sequence that is identical to that of a naturally-occurring protein. In some embodiments, the amino acid sequence of an engineered protein is not identical to that of a naturally occurring protein. Engineered proteins may provide an increased activity relative to a naturally occurring protein. Engineered proteins may provide a reduced activity relative to a naturally occurring protein. The activity may be nuclease activity. The activity may be nickase activity. The activity may be nucleic acid binding activity. In some embodiments, a modification of the effector proteins may include addition of one or more amino acids, deletion of one or more amino acids, substitution of one or more amino acids, or combinations thereof. In some embodiments, effector proteins disclosed herein are engineered proteins. Unless otherwise indicated, reference to effector proteins throughout the present disclosure include engineered proteins thereof.
[0184] Engineered proteins may provide an increased or reduced activity relative to a naturally occurring protein under a given condition of a cell or sample in which the activity occurs. The condition may be temperature. The temperature may be greater than 20? C., greater than 25? C., greater than 30? C., greater than 35? C., greater than 40? C., greater than 45? C., greater than 50? C., greater than 55? C., greater than 60? C., greater than 65? C., or greater than 70? C., but not greater than 80? C. The condition may be the presence of a salt. The salt may be a magnesium salt, a zinc salt, a potassium salt, a calcium salt or a sodium salt. The condition may be the concentration of one or more salts.
[0185] In some embodiments, the amino acid sequence of an engineered protein comprises at least one residue that is different from that of a naturally occurring protein. In some embodiments, the amino acid sequence of an engineered protein comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 residues that are different from that of a naturally occurring protein. The residues in the engineered protein that differ from those at corresponding positions of the naturally occurring protein (when the engineered and naturally occurring proteins are aligned for maximal identity) may be referred to as substituted residues or amino acid substitutions. In some embodiments, the substituted residues are non-conserved residues relative to the residues at corresponding positions of the naturally occurring protein. A non-conserved residue has a different physicochemical property from the amino acid for which it substitutes. Physicochemical properties include aliphatic, cyclic, aromatic, basic, acidic and hydroxyl-containing. Glycine, alanine, valine, leucine and isoleucine are aliphatic. Serine, Cysteine, threonine and methionine are hydroxyl-containing. Proline is cyclic. Phenylalanine, tyrosine, tryptophan are basic. Aspartate, Glutamate, Asparagine and glutamine are acidic.
[0186] In some embodiments, engineered proteins are designed to be catalytically inactive or to have reduced catalytic activity relative to a naturally occurring protein. A catalytically inactive effector protein may be generated by substituting an amino acid that confers a catalytic activity (also referred to as a catalytic residue) with a substituted residue that does not support the catalytic activity. In some embodiments, the substituted residue has an aliphatic side chain. In some embodiments, the substituted residue is glycine. In some embodiments, the substituted residue is valine. In some embodiments, the substituted residue is leucine. In some embodiments, the substituted residue is alanine. In some embodiments, the amino acid is aspartate and it is substituted with asparagine. In some embodiments, the amino acid is glutamate and it is substituted with glutamine. An amino acid that confers catalytic activity may be identified by performing sequence alignment of an unmodified effector protein with a similar enzyme having at least one identified catalytic residue; selecting at least one putative catalytic residue in the unmodified effector protein within the portion of the unmodified effector protein that aligns with a portion of the similar enzyme that comprises the identified catalytic residue; substituting the at least one putative catalytic residue of the unmodified effector protein with the different amino acid; and comparing the catalytic activity of the unmodified effector protein to the modified effector protein. A similar enzyme may be an enzyme that is at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% identical to the unmodified effector protein. A similar enzyme may be an enzyme that is not greater than 99.9% identical to the unmodified effector protein. In some embodiments, the portion of the unmodified effector protein that aligns with a portion of the similar enzyme is at least 10 amino acids, at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, at least 60 amino acids, at least 70 amino acids, at least 80 amino acids, at least 90 amino acids, or at least 100 amino acids in length. In some embodiments, the portion of the unmodified effector protein that aligns with a portion of the similar enzyme is not greater than 200 amino acids. In some embodiments, the portion of the unmodified effector protein that aligns with a portion of the similar enzyme comprises a functional domain (e.g., HEPN, HNH, RuvC, zinc finger binding). In some embodiments, comparing the catalytic activity comprises performing a cleavage assay. An example of generating a catalytically inactive effector protein is provided in Example 7.
[0187] In some embodiments, compositions, systems, and methods described herein comprise an effector protein, or a nucleic acid encoding the effector protein, wherein the effector protein comprises an amino acid sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 65% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 70% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 75% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 80% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 85% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 90% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 95% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 97% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 98% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is at least 99% identical to any one of the sequences as set forth in TABLE 1. In some embodiments, an effector protein provided herein comprises an amino acid sequence that is identical to any one of the sequences as set forth in TABLE 1.
[0188] In some embodiments, compositions, systems, and methods described herein comprise an effector protein, or a nucleic acid encoding the effector protein, wherein the effector protein comprises one or more amino acid alterations relative to any one of the sequences recited in TABLE 1. In some embodiments, the effector protein comprising one or more amino acid alterations is a variant of an effector protein described herein. It is understood that any reference to an effector protein herein also refers to an effector protein variant as described herein. The term variant refers to a form or version of a protein that differs from the wild-type protein. A variant may have a different function or activity relative to the wild-type protein.
[0189] In some embodiments, the one or more amino acid alterations comprises conservative substitutions, non-conservative substitutions, conservative deletions, non-conservative deletions, or combinations thereof. In some embodiments, an effector protein or a nucleic acid encoding the effector protein comprises 1 amino acid alteration, 2 amino acid alterations, 3 amino acid alterations, 4 amino acid alterations, 5 amino acid alterations, 6 amino acid alterations, 7 amino acid alterations, 8 amino acid alterations, 9 amino acid alterations, 10 amino acid alterations or more relative to any one of the sequences recited in TABLE 1.
[0190] The term conservative substitution refers to the replacement of one amino acid for another such that the replacement takes place within a family of amino acids that are related in their side chains. Conversely, the term non-conservative substitution as used herein refers to the replacement of one amino acid residue for another that does not have a related side chain. Genetically encoded amino acids can be divided into four families having related side chains: (1) acidic (negatively charged): Asp (D), Glu (E); (2) basic (positively charged): Lys (K), Arg (R), His (H); (3) non-polar (hydrophobic): Cys (C), Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Met (M), Trp (W), Gly (G), Tyr (Y), with non-polar also being subdivided into: (i) strongly hydrophobic: Ala (A), Val (V), Leu (L), Ile (I), Met (M), Phe (F); and (ii) moderately hydrophobic: Gly (G), Pro (P), Cys (C), Tyr (Y), Trp (W); and (4) uncharged polar: Asn (N), Gln (Q), Ser (S), Thr (T). Amino acids may be related by aliphatic side chains: Gly (G), Ala (A), Val (V), Leu (L), Ile (I), Ser (S), Thr (T), with Ser (S) and Thr (T) optionally being grouped separately as aliphatic-hydroxyl; Amino acids may be related by aromatic side chains: Phe (F), Tyr (Y), Trp (W). Amino acids may be related by amide side chains: Asn (N), Gln (Q). Amino acids may be related by sulfur-containing side chains: Cys (C) and Met (M).
[0191] In some embodiments, the one or more amino acid alterations may result in a change in activity of the effector protein relative to a naturally-occurring counterpart. For example, and as described in further detail below, the one or more amino acid alteration increases or decreases catalytic activity of the effector protein relative to a naturally-occurring counterpart. In some embodiments, the one or more amino acid alterations results in a catalytically inactive effector protein variant.
[0192] In some embodiments, effector proteins described herein are encoded by a codon optimized nucleic acid. In some embodiments, a nucleic acid sequence encoding an effector protein described herein, is codon optimized. In some embodiments, effector proteins described herein may be codon optimized for expression in a specific cell, for example, a bacterial cell, a plant cell, a eukaryotic cell, an animal cell, a mammalian cell, or a human cell. In some embodiments, the effector protein is codon optimized for a human cell.
[0193] In some embodiments, effector proteins may comprise one or more modifications that may provide altered activity as compared to a naturally-occurring counterpart (e.g., a naturally-occurring nuclease or nickase, etc. activity which may be a naturally-occurring effector protein). In some embodiments, activity (e.g., nickase, nuclease, binding, etc, activity) of effector proteins described herein can be measured relative to a naturally-occurring effector protein or compositions containing the same in a cleavage assay. For example, effector proteins may comprise one or more modifications that may provide increased activity as compared to a naturally-occurring counterpart. As another example, effector proteins may provide increased catalytic activity (e.g., nickase, nuclease, binding, etc. activity) as compared to a naturally-occurring counterpart. Effector proteins may provide enhanced nucleic acid binding activity (e.g., enhanced binding of a guide nucleic acid, and/or target nucleic acid) as compared to a naturally-occurring counterpart. An effector protein may have a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, or more, increase of the activity of a naturally-occurring counterpart.
[0194] Alternatively, effector proteins may comprise one or more modifications that reduce the activity of the effector proteins relative to a naturally occurring nuclease, or nickase etc. . . . An effector protein may have a 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 1%, or less, decrease of the activity of a naturally occurring counterpart. Decreased activity may be decreased catalytic activity (e.g., nickase, nuclease, binding, etc. activity) as compared to a naturally-occurring counterpart.
[0195] An effector protein that has decreased catalytic activity may be referred to as catalytically or enzymatically inactive, catalytically or enzymatically dead, as a dead protein or a dCas protein. In some embodiments, such a protein may comprise an enzymatically inactive domain (e.g. inactive nuclease domain). For example, a nuclease domain (e.g., RuvC domain) of an effector protein may be deleted or mutated relative to a wildtype counterpart so that it is no longer functional or comprises reduced nuclease activity. In some embodiments, a catalytically inactive effector protein may bind to a guide nucleic acid and/or a target nucleic acid but does not cleave the target nucleic acid. In some embodiments, a catalytically inactive effector protein may associate with a guide nucleic acid to activate or repress transcription of a target nucleic acid. In some embodiments, a catalytically inactive effector protein is fused to a fusion partner protein that confers an alternative activity to an effector protein activity. Such fusion proteins are described herein and throughout. The term, fused, as used herein, refers to at least two sequences that are connected together, such as by a linker, or by conjugation (e.g., chemical conjugation or enzymatic conjugation). The term fused includes a linker.
Fusion Proteins
[0196] In some embodiments, compositions, systems, and methods comprise a fusion protein or uses thereof. A fusion protein generally comprises an effector protein and a fusion partner protein (also referred to as a fusion partner). In some embodiments, the fusion partner. In general, the effector protein and the fusion partner are heterologous proteins. In some embodiments, the fusion protein comprises a polypeptide or peptide that is fused or linked to the effector protein. In some embodiments, the fusion protein is a heterologous peptide or polypeptide as described herein. In some embodiments, the amino terminus of the fusion partner is linked/fused to the carboxy terminus of the effector protein. In some embodiments, the carboxy terminus of the fusion partner protein is linked/fused to the amino terminus of the effector protein by the linker. In some embodiments, the fusion partner is not an effector protein as described herein. In some embodiments, the fusion partner comprises a second effector protein or a multimeric form thereof. Accordingly, in some embodiments, the fusion protein comprises more than one effector protein. In such embodiments, the fusion protein can comprise at least two effector proteins that are same. In some embodiments, the fusion protein comprises at least two effector proteins that are different. In some embodiments, the multimeric form is a homomeric form. In some embodiments, the multimeric form is a heteromeric form. Unless otherwise indicated, reference to effector proteins throughout the present disclosure include fusion proteins comprising the effector protein described herein and a fusion partner.
[0197] In some embodiments, effector proteins described herein can be modified with the addition of one or more heterologous peptides or heterologous polypeptides (referred to collectively herein as a heterologous polypeptide). In some embodiments, an effector protein modified with the addition of one or more heterologous peptides or heterologous polypeptides may be referred to herein as a fusion protein. Such fusion proteins are described herein and throughout.
[0198] In some embodiments, a heterologous peptide or heterologous polypeptide comprises a subcellular localization signal. In some embodiments, a subcellular localization signal can be a nuclear localization signal (NLS). In some embodiments, the NLS facilitates localization of a nucleic acid, protein, or small molecule to the nucleus, when present in a cell that contains a nuclear compartment. In some embodiments, the subcellular localization signal is a nuclear export signal (NES), a sequence to keep an effector protein retained in the cytoplasm, a mitochondrial localization signal for targeting to the mitochondria, a chloroplast localization signal for targeting to a chloroplast, an ER retention signal, and the like. In some embodiments, an effector protein described herein is not modified with a subcellular localization signal so that the polypeptide is not targeted to the nucleus, which can be advantageous depending on the circumstance (e.g., when the target nucleic acid is an RNA that is present in the cytosol).
[0199] In some embodiments, a heterologous peptide or heterologous polypeptide comprises a chloroplast transit peptide (CTP), also referred to as a chloroplast localization signal or a plastid transit peptide, which targets the effector protein to a chloroplast. Chromosomal transgenes from bacterial sources may require a sequence encoding a CTP sequence fused to a sequence encoding an expressed protein (e.g., the effector protein) if the expressed protein is to be compartmentalized in the plant plastid (e.g., chloroplast). The CTP may be removed in a processing step during translocation into the plastid. Accordingly, localization of an effector protein to a chloroplast is often accomplished by means of operably linking a polynucleotide sequence encoding a CTP sequence to the 5 region of a polynucleotide encoding the exogenous protein.
[0200] In some embodiments, the heterologous polypeptide is an endosomal escape peptide (EEP). An EEP is an agent that quickly disrupts the endosome in order to minimize the amount of time that a delivered molecule, such an effector protein, spends in the endosome-like environment, and to avoid getting trapped in the endosomal vesicles and degraded in the lysosomal compartment.
[0201] In some embodiments, the heterologous polypeptide is a cell penetrating peptide (CPP), also known as a Protein Transduction Domain (PTD). A CPP or PTD is a polypeptide, polynucleotide, carbohydrate, or organic or inorganic compound that facilitates traversing a lipid bilayer, micelle, cell membrane, organelle membrane, or vesicle membrane.
[0202] Further suitable heterologous polypeptides include, but are not limited to, proteins (or fragments/domains thereof) that are boundary elements (e.g., CTCF), proteins and fragments thereof that provide periphery recruitment (e.g., Lamin A, Lamin B, etc.), and protein docking elements (e.g., FKBP/FRB, Pil1/Aby1, etc.).
[0203] In some embodiments, a heterologous peptide or heterologous polypeptide comprises a protein tag. In some embodiments, the protein tag is referred to as purification tag or a fluorescent protein. The protein tag may be detectable for use in detection of the effector protein and/or purification of the effector protein. Accordingly, in some embodiments, compositions, systems and methods comprise a protein tag or use thereof. Any suitable protein tag may be used depending on the purpose of its use. Non-limiting examples of protein tags include a fluorescent protein, a histidine tag, e.g., a 6?His tag; a hemagglutinin (HA) tag; a FLAG tag; a Myc tag; and maltose binding protein (MBP). In some embodiments, the protein tag is a portion of MBP that can be detected and/or purified. Non-limiting examples of fluorescent proteins include green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), cyan fluorescent protein (CFP), mCherry, and tdTomato.
[0204] A heterologous polypeptide may be located at or near the amino terminus (N-terminus) of the effector protein disclosed herein. A heterologous polypeptide may be located at or near the carboxy terminus (C-terminus) of the effector proteins disclosed herein. In some embodiments, a heterologous polypeptide is located internally in an effector protein described herein (i.e., is not at the N- or C-terminus of an effector protein described herein) at a suitable insertion site.
[0205] In some embodiments, an effector protein described herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more heterologous polypeptides at or near the N-terminus, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more heterologous polypeptides at or near the C-terminus, or a combination of these (e.g., one or more heterologous polypeptides at the amino-terminus and one or more heterologous polypeptides at the carboxy terminus). When more than one heterologous polypeptide is present, each may be selected independently of the others, such that a single heterologous polypeptide may be present in more than one copy and/or in combination with one or more other heterologous polypeptides present in one or more copies. In some embodiments, a heterologous polypeptide is considered near the N- or C-terminus when the nearest amino acid of the heterologous polypeptide is within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, or more amino acids along the polypeptide chain from the N- or C-terminus.
[0206] In some embodiments, a fusion partner imparts some function or activity to a fusion protein that is not provided by an effector protein. Such activities may include but are not limited to nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, dimer forming activity (e.g., pyrimidine dimer forming activity), integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity or demyristoylation activity, modification of a polypeptide associated with target nucleic acid (e.g., a histone), and/or signaling activity.
[0207] In some embodiments, effector proteins are targeted by a guide nucleic acid (e.g., a guide RNA) to a specific location in the target nucleic acid where they exert locus-specific regulation. Non-limiting examples of locus-specific regulation include blocking RNA polymerase binding to a promoter (which selectively inhibits transcription activator function), and/or modifying local chromatin (e.g., when a fusion sequence is used that modifies the target nucleic acid or modifies a protein associated with the target nucleic acid). The guide RNA may bind to a target nucleic acid (e.g., a single strand of a target nucleic acid) or a portion thereof, an amplicon thereof, or a portion thereof. By way of non-limiting example, a guide nucleic acid may bind to a target nucleic acid, such as DNA or RNA, from a cancer gene or gene associated with a genetic disorder, or an amplicon thereof, as described herein.
[0208] In some embodiments, a fusion partner may provide signaling activity. In some embodiments, a fusion partner may inhibit or promote the formation of multimeric complex of an effector protein. In an additional example, the fusion partner may directly or indirectly edit a target nucleic acid. Edits can be of a nucleobase, nucleotide, or nucleotide sequence of a target nucleic acid. In some embodiments, the fusion partner may interact with additional proteins, or functional fragments thereof, to make modifications to a target nucleic acid. In other embodiments, the fusion partner may modify proteins associated with a target nucleic acid. In some embodiments, a fusion partner may modulate transcription (e.g., inhibits transcription, increases transcription) of a target nucleic acid. In yet another example, a fusion partner may directly or indirectly inhibit, reduce, activate or increase expression of a target nucleic acid.
[0209] In some cases, fusion effector proteins modify a target nucleic acid or the expression thereof. In some cases, the modifications are transient (e.g., transcription repression or activation). In some cases, the modifications are inheritable. For instance, epigenetic modifications made to a target nucleic acid, or to proteins associated with the target nucleic acid, e.g., nucleosomal histones, in a cell, are observed in cells produced by proliferation of the cell.
[0210] In some embodiments, fusion partners inhibit or reduce expression of a target nucleic acid. In some embodiments, fusion partners reduce expression of the target nucleic acid relative to its expression in the absence of the fusion effector protein. Relative expression, including transcription and RNA levels, may be assessed, quantified, and compared, e.g., by RT-qPCR. In some embodiments, fusion partners may comprise a transcriptional repressor. Transcriptional repressors may inhibit transcription via: recruitment of other transcription factor proteins; modification of target DNA such as methylation; recruitment of a DNA modifier; modulation of histones associated with target DNA; recruitment of a histone modifier such as those that modify acetylation and/or methylation of histones; or a combination thereof. Non-limiting examples of fusion partners that decrease or inhibit transcription include, but are not limited to: histone lysine methyltransferases; histone lysine demethylases; histone lysine deacetylases; and DNA methylases; and functional domains thereof.
[0211] In some embodiments, fusion partners activate or increase expression of a target nucleic acid. In some embodiments, fusion partners increase expression of the target nucleic acid relative to its expression in the absence of the fusion effector protein. Relative expression, including transcription and RNA levels, may be assessed, quantified, and compared, e.g., by RT-qPCR. In some embodiments, fusion partners comprise a transcriptional activator. Transcriptional activators may promote transcription via: recruitment of other transcription factor proteins; modification of target DNA such as demethylation; recruitment of a DNA modifier; modulation of histones associated with target DNA; recruitment of a histone modifier such as those that modify acetylation and/or methylation of histones; or a combination thereof. Non-limiting examples of fusion partners that activate or increase transcription include, but are not limited to: histone lysine methyltransferases; histone lysine demethylases; histone acetyltransferases; and DNA demethylases; and functional domains thereof.
[0212] In some embodiments, fusion partners comprise an RNA splicing factor. The RNA splicing factor may be used (in whole or as fragments thereof) for modular organization, with separate sequence-specific RNA binding modules and splicing effector domains. Non-limiting examples of RNA splicing factors include members of the Serine/Arginine-rich (SR) protein family contain N-terminal RNA recognition motifs (RRMs) that bind to exonic splicing enhancers (ESEs) in pre-mRNAs and C-terminal RS domains that promote exon inclusion. As another example, the hnRNP protein hnRNP A1 binds to exonic splicing silencers (ESSs) through its RRM domains and inhibits exon inclusion through a C-terminal Glycine-rich domain. Some splicing factors may regulate alternative use of splice site (ss) by binding to regulatory sequences between the two alternative sites. For example, ASF/SF2 may recognize ESEs and promote the use of intron proximal sites, whereas hnRNP A1 may bind to ESSs and shift splicing towards the use of intron distal sites. One application for such factors is to generate ESFs that modulate alternative splicing of endogenous genes, particularly disease associated genes. For example, Bcl-x pre-mRNA produces two splicing isoforms with two alternative 5 splice sites to encode proteins of opposite functions. The long splicing isoform Bcl-xL is a potent apoptosis inhibitor expressed in long-lived postmitotic cells and is up-regulated in many cancer cells, protecting cells against apoptotic signals. The short isoform Bcl-xS is a pro-apoptotic isoform and expressed at high levels in cells with a high turnover rate (e.g., developing lymphocytes). The ratio of the two Bcl-x splicing isoforms is regulated by multiple c{acute over (?)}-elements that are located in either the core exon region or the exon extension region (i.e., between the two alternative 5 splice sites). For more examples, see WO2010075303, which is hereby incorporated by reference in its entirety.
[0213] In some cases, fusion effector proteins modify a target nucleic acid or the expression thereof, wherein the target nucleic acid comprises a deoxyribonucleoside, a ribonucleoside or a combination thereof. The target nucleic acid may comprise or consist of a single stranded RNA (ssRNA), a double-stranded RNA (dsRNA), a single-stranded DNA (ssDNA), or a double stranded DNA (dsDNA). Non-limiting examples of fusion partners for modifying ssRNA include, but are not limited to, splicing factors (e.g., RS domains); protein translation components (e.g., translation initiation, elongation, and/or release factors; e.g., eIF4G); RNA methylases; RNA editing enzymes (e.g., RNA deaminases, e.g., adenosine deaminase acting on RNA (ADAR), including A to I and/or C to U editing enzymes); helicases; and RNA-binding proteins.
Multimeric Complex Formation Modification Activity
[0214] In some embodiments, a fusion partner may inhibit the formation of a multimeric complex of an effector protein. Alternatively, the fusion partner promotes the formation of a multimeric complex of the effector protein. By way of non-limiting example, the fusion protein may comprise an effector protein described herein and a fusion partner comprising a Calcineurin A tag, wherein the fusion protein dimerizes in the presence of Tacrolimus (FK506). Also, by way of non-limiting example, the fusion protein may comprise an effector protein described herein and a SpyTag configured to dimerize or associate with another effector protein in a multimeric complex. Multimeric complex formation is further described herein.
Nucleic Acid Modification Activity
[0215] In some embodiments, fusion partners have enzymatic activity that modifies a nucleic acid, such as a target nucleic acid. In some embodiments, the target nucleic acid may comprise or consist of a ssRNA, dsRNA, ssDNA, or a dsDNA. Examples of enzymatic activity that modifies the target nucleic acid include, but are not limited to: nuclease activity, which comprises the enzymatic activity of an enzyme which allows the enzyme to cleave the phosphodiester bonds between the nucleotide subunits of nucleic acids, such as that provided by a restriction enzyme, or a nuclease (e.g., FokI nuclease); methyltransferase activity such as that provided by a methyltransferase (e.g., HhaI DNA m5c-methyltransferase (M.HhaI), DNA methyltransferase 1 (DNMT1), DNA methyltransferase 3a (DNMT3a), DNA methyltransferase 3b (DNMT3b), METI, DRM3 (plants), ZMET2, CMT1, CMT2 (plants)); demethylase activity such as that provided by a demethylase (e.g., Ten-Eleven Translocation (TET) dioxygenase 1 (TET1CD), TET1, DME, DML1, DML2, ROS1); DNA repair activity; DNA damage (e.g., oxygenation) activity; deamination activity such as that provided by a deaminase (e.g., a cytosine deaminase enzyme such as rat APOBEC1); dismutase activity; alkylation activity; depurination activity; oxidation activity; pyrimidine dimer forming activity; integrase activity such as that provided by an integrase and/or resolvase (e.g., Gin invertase such as the hyperactive mutant of the Gin invertase, GinH106Y, human immunodeficiency virus type 1 integrase (IN), Tn3 resolvase); transposase activity; recombinase activity such as that provided by a recombinase (e.g., catalytic domain of Gin recombinase); polymerase activity; ligase activity; helicase activity; photolyase activity; and glycosylase activity.
[0216] The term transposase activity refers to catalytic activity that results in the transposition of a first nucleic acid into a second nucleic acid.
[0217] In some embodiments, fusion partners target a ssRNA, dsRNA, ssDNA, or a dsDNA. In some embodiments, fusion partners target ssRNA. Non-limiting examples of fusion partners for targeting ssRNA include, but are not limited to, splicing factors (e.g., RS domains); protein translation components (e.g., translation initiation, elongation, and/or release factors; e.g., eIF4G); RNA methylases; RNA editing enzymes (e.g., RNA deaminases, e.g., adenosine deaminase acting on RNA (ADAR), including A to I and/or C to U editing enzymes); helicases; and RNA-binding proteins.
[0218] It is understood that a fusion partner may include an entire protein, or in some embodiments, may include a fragment of the protein (e.g., a functional domain). In some embodiments, the functional domain binds or interacts with a nucleic acid, such as ssRNA, including intramolecular and/or intermolecular secondary structures thereof (e.g., hairpins, stem-loops, etc.). The functional domain may interact transiently or irreversibly, directly, or indirectly. In some embodiments, a functional domain comprises a region of one or more amino acids in a protein that is required for an activity of the protein, or the full extent of that activity, as measured in an in vitro assay. Activities include but are not limited to nucleic acid binding, nucleic acid editing, nucleic acid mutating, nucleic acid modifying, nucleic acid cleaving, protein binding or combinations thereof. The absence of the functional domain, including mutations of the functional domain, would abolish or reduce activity.
[0219] Accordingly, fusion partners may comprise a protein or domain thereof selected from: endonucleases (e.g., RNase III, the CRR22 DYW domain, Dicer, and PIN (PilT N-terminus); SMG5 and SMG6; domains responsible for stimulating RNA cleavage (e.g., CPSF, CstF, CFIm and CFIIm); exonucleases such as XRN-1 or Exonuclease T; deadenylases such as HNT3; protein domains responsible for nonsense mediated RNA decay (e.g., UPF1, UPF2, UPF3, UPF3b, RNP S1, Y14, DEK, REF2, and SRm160); protein domains responsible for stabilizing RNA (e.g., PABP); proteins and protein domains responsible for polyadenylation of RNA (e.g., PAP1, GLD-2, and Star-PAP); proteins and protein domains responsible for polyuridinylation of RNA (e.g., CI D1 and terminal uridylate transferase); and other suitable domains that affect nucleic acid modifications.
[0220] In some embodiments, an effector protein is a fusion protein, wherein the effector protein is fused to a chromatin-modifying enzyme. In some embodiments, the fusion protein chemically modifies a target nucleic acid, for example by methylating, demethylating, or acetylating the target nucleic acid in a sequence specific or non-specific manner.
Base Editors
[0221] In some embodiments, fusion partners edit a nucleobase of a target nucleic acid. Fusion proteins comprising such a fusion partner and an effector protein may be referred to as base editors. Such a fusion partner may be referred to as a base editing enzyme. In some embodiments, a base editor comprises a base editing enzyme variant that differs from a naturally occurring base editing enzyme, but it is understood that any reference to a base editing enzyme herein also refers to a base editing enzyme variant. In some embodiments, a base editor may be a fusion protein comprising a base editing enzyme fused or linked to an effector protein. In some embodiments, the amino terminus of the fusion partner protein is linked to the carboxy terminus of the effector protein by the linker. In some embodiments, the carboxy terminus of the fusion partner protein is linked to the amino terminus of the effector protein by the linker. The base editor may be functional when the effector protein is coupled to a guide nucleic acid. The base editor may be functional when the effector protein is coupled to a guide nucleic acid. The guide nucleic acid imparts sequence specific activity to the base editor. By way of non-limiting example, the effector protein may comprise a catalytically inactive effector protein (e.g., a catalytically inactive variant of an effector protein described herein). Also, by way of non-limiting example, the base editing enzyme may comprise deaminase activity. Additional base editors are described herein.
[0222] In some embodiments, base editors are capable of catalyzing editing (e.g., a chemical modification) of a nucleobase of a nucleic acid molecule, such as DNA or RNA (single stranded or double stranded). In some embodiments, a base editing enzyme, and therefore a base editor, is capable of converting an existing nucleobase to a different nucleobase, such as: an adenine (A) to guanine (G); cytosine (C) to thymine (T); cytosine (C) to guanine (G); uracil (U) to cytosine (C); guanine (G) to adenine (A); hydrolytic deamination of an adenine or adenosine, or methylation of cytosine (e.g., CpG, CpA, CpT or CpC). In some embodiments, base editors edit a nucleobase on a ssDNA. In some embodiments, base editors edit a nucleobase on both strands of dsDNA. In some embodiments, base editors edit a nucleobase of an RNA.
[0223] In some embodiments, a base editing enzyme itself may or may not bind to the nucleic acid molecule containing the nucleobase. In some embodiments, upon binding to its target locus in the target nucleic acid (e.g., a DNA molecule), base pairing between the guide nucleic acid and target strand leads to displacement of a small segment of ssDNA in an R-loop. In some embodiments, DNA bases within the R-loop are edited by the base editor having the deaminase enzyme activity. In some embodiments, base editors for improved efficiency in eukaryotic cells comprise a catalytically inactive effector protein that may generate a nick in the non-edited strand, inducing repair of the non-edited strand using the edited strand as a template.
[0224] In some embodiments, a base editing enzyme comprises a deaminase enzyme. Exemplary deaminases are described in US20210198330, WO2021041945, WO2021050571A1, and WO2020123887, all of which are incorporated herein by reference in their entirety. Exemplary deaminase domains are described WO 2018027078 and WO2017070632, and each are hereby incorporated in its entirety by reference. Also, additional exemplary deaminase domains are described in Komor et al., Nature, 533, 420-424 (2016); Gaudelli et al., Nature, 551, 464-471 (2017); Komor et al., Science Advances, 3:eaao4774 (2017), and Rees et al., Nat Rev Genet. 2018 December; 19(12):770-788. doi: 10.1038/s41576-018-0059-1, which are hereby incorporated by reference in their entirety. In some embodiments, the deaminase functions as a monomer. In some embodiments, the deaminase functions as heterodimer with an additional protein. In some embodiments, base editors comprise a DNA glycosylase inhibitor (e.g., an uracil glycosylase inhibitor (UGI) or uracil N-glycosylase (UNG)). In some embodiments, the fusion partner is a deaminase, e.g., ADAR1/2, ADAR-2, AID, or any function variant thereof.
[0225] In some embodiments, a base editor is a cytosine base editor (CBE). In some embodiments, the CBE may convert a cytosine to a thymine. In some embodiments, a cytosine base editing enzyme may accept ssDNA as a substrate but may not be capable of cleaving dsDNA, as fused to a catalytically inactive effector protein. In some embodiments, when bound to its cognate DNA, the catalytically inactive effector protein of the CBE may perform local denaturation of the DNA duplex to generate an R-loop in which the DNA strand not paired with a guide nucleic acid exists as a disordered single-stranded bubble. In some embodiments, the catalytically inactive effector protein generated ssDNA R-loop may enable the CBE to perform efficient and localized cytosine deamination in vitro. In some embodiments, deamination activity is exhibited in a window of about 4 to about 10 base pairs. In some embodiments, fusion to the catalytically inactive effector protein presents a target site to the cytosine base editing enzyme in high effective molarity, which may enable the CBE to deaminate cytosines located in a variety of different sequence motifs, with differing efficacies. In some embodiments, the CBE is capable of mediating RNA-programmed deamination of target cytosines in vitro or in vivo. In some embodiments, the cytosine base editing enzyme is a cytidine deaminase. In some embodiments, the cytosine base editing enzyme is a cytosine base editing enzyme described by Koblan et al. (2018) Nature Biotechnology 36:848-846; Komor et al. (2016) Nature 533:420-424; Koblan et al. (2021) Efficient C.Math.G-to-G.Math.C base editors developed using CRISPRi screens, target-library analysis, and machine learning, Nature Biotechnology; Kurt et al. (2021) Nature Biotechnology 39:41-46; Zhao et al. (2021) Nature Biotechnology 39:35-40; and Chen et al. (2021) Nature Communications 12:1384, all incorporated herein by reference.
[0226] In some embodiments, CBEs comprise a uracil glycosylase inhibitor (UGI) or uracil N-glycosylase (UNG). In some embodiments, base excision repair (BER) of U.Math.G in DNA is initiated by a UNG, which recognizes a U.Math.G mismatch and cleaves the glyosidic bond between a uracil and a deoxyribose backbone of DNA. In some embodiments, BER results in the reversion of the U?G intermediate created by the first CBE back to a C?G base pair. In some embodiments, the UNG may be inhibited by fusion of a UGI. In some embodiments, the CBE comprises a UGI. In some embodiments, a C-terminus of the CBE comprises the UGI. In some embodiments, the UGI is a small protein from bacteriophage PBS. In some embodiments, the UGI is a DNA mimic that potently inhibits both human and bacterial UNG. In some embodiments, the UGI inhibitor is any protein or polypeptide that inhibits UNG. In some embodiments, the CBE may mediate efficient base editing in bacterial cells and moderately efficient editing in mammalian cells, enabling conversion of a C?G base pair to a T?A base pair through a U?G intermediate. In some embodiments, the CBE is modified to increase base editing efficiency while editing more than one strand of DNA.
[0227] In some embodiments, a CBE nicks a non-edited DNA strand. In some embodiments, the non-edited DNA strand nicked by the CBE biases cellular repair of a U?G mismatch to favor a U?A outcome, elevating base editing efficiency. In some embodiments, a APOBEC1-nickase-UGI fusion efficiently edits in mammalian cells, while minimizing frequency of non-target indels. In some embodiments, base editors do not comprise a functional fragment of the base editing enzyme. In some embodiments, base editors do not comprise a function fragment of a UGI, where such a fragment may be capable of excising a uracil residue from DNA by cleaving an N-glycosidic bond.
[0228] In some embodiments, the fusion protein further comprises a non-protein uracil-DNA glycosylase inhibitor (npUGI). In some embodiments, the npUGI is selected from a group of small molecule inhibitors of uracil-DNA glycosylase (UDG), or a nucleic acid inhibitor of UDG. In some embodiments, the npUGI is a small molecule derived from uracil. Examples of small molecule non-protein uracil-DNA glycosylase inhibitors, fusion proteins, and Cas-CRISPR systems comprising base editing activity are described in WO2021087246, which is incorporated by reference in its entirety.
[0229] In some embodiments, a cytosine base editing enzyme, and therefore a cytosine base editor, is a cytidine deaminase. In some embodiments, the cytidine deaminase base editor is generated by ancestral sequence reconstruction as described in WO2019226953, which is hereby incorporated by reference in its entirety. Non-limiting exemplary cytidine deaminases suitable for use with effector proteins described herein include: APOBEC1, APOBEC2, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, APOBEC3A, BE1 (APOBEC1-XTEN-dCas9), BE2 (APOBEC1-XTEN-dCas9-UGI), BE3 (APOBEC1-XTEN-dCas9(A840H)-UGI), BE3-Gam, saBE3, saBE4-Gam, BE4, BE4-Gam, saBE4, and saBE4-Gam as described in WO2021163587, WO2021087246, WO2021062227, and WO2020123887, which are incorporated herein by reference in their entirety.
[0230] In some embodiments, a base editor is a cytosine to guanine base editor (CGBE). A CGBE may convert a cytosine to a guanine.
[0231] In some embodiments, a base editor is an adenine base editor (ABE). An ABE may convert an adenine to a guanine. In some embodiments, an ABE converts an A?T base pair to a G?C base pair. In some embodiments, the ABE converts a target A?T base pair to G?C in vivo or in vitro. In some embodiments, ABEs provided herein reverse spontaneous cytosine deamination, which has been linked to pathogenic point mutations. In some embodiments, ABEs provided herein enable correction of pathogenic SNPs (?47% of disease-associated point mutations). In some embodiments, the adenine comprises exocyclic amine that has been deaminated (e.g., resulting in altering its base pairing preferences). In some embodiments, deamination of adenosine yields inosine. In some embodiments, inosine exhibits the base-pairing preference of guanine in the context of a polymerase active site, although inosine in the third position of a tRNA anticodon is capable of pairing with A, U, or C in mRNA during translation. Non-limiting exemplary adenine base editing enzymes suitable for use with effector proteins described herein include: ABE8e, ABE8.20m, APOBEC3A, Anc APOBEC (a.k.a. AncBE4Max), and BtAPOBEC2. Non-limiting exemplary ABEs suitable for use herein include: ABE7, ABE8.1m, ABE8.2m, ABE8.3m, ABE8.4m, ABE8.5m, ABE8.6m, ABE8.7m, ABE8.8m, ABE8.9m, ABE8.10m, ABE8.11m, ABE8.12m, ABE8.13m, ABE8.14m, ABE8.15m, ABE8.16m, ABE8.17m, ABE8.18m, ABE8.19m, ABE8.20m, ABE8.21m, ABE8.22m, ABE8.23m, ABE8.24m, ABE8.1d, ABE8.2d, ABE8.3d, ABE8.4d, ABE8.5d, ABE8.6d, ABE8.7d, ABE8.8d, ABE8.9d, ABE8.10d, ABE8.11d, ABE8.12d, ABE8.13d, ABE8.14d, ABE8.15d, ABE8.16d, ABE8.17d, ABE8.18d, ABE8.19d, ABE8.20d, ABE8.21d, ABE8.22d, ABE8.23d, and ABE8.24d. In some embodiments, the adenine base editing enzyme is an adenine base editing enzyme described in Chu et al., (2021) The CRISPR Journal 4:2:169-177, incorporated herein by reference. In some embodiments, the adenine deaminase is an adenine deaminase described by Koblan et al. (2018) Nature Biotechnology 36:848-846, incorporated herein by reference. In some embodiments, the adenine base editing enzyme is an adenine base editing enzyme described by Tran et al. (2020) Nature Communications 11:4871.
[0232] In some embodiments, an adenine base editing enzyme of an ABE is an adenosine deaminase. Non-limiting exemplary adenosine base editors suitable for use herein include ABE9. In some embodiments, the ABE comprises an engineered adenosine deaminase enzyme capable of acting on ssDNA. The engineered adenosine deaminase enzyme may be an adenosine deaminase variant that differs from a naturally occurring deaminase. Relative to the naturally occurring deaminase, the adenosine deaminase variant may comprise one or more amino acid alteration, including a V82S alteration, a T166R alteration, a Y147T alteration, a Y147R alteration, a Q154S alteration, a Y123H alteration, a Q154R alteration, or a combination thereof.
[0233] In some embodiments, a base editor comprises a deaminase dimer. In some embodiments, the base editor further comprising a base editing enzyme and an adenine deaminase (e.g., TadA). In some embodiments, the adenosine deaminase is a TadA monomer (e.g., Tad*7.10, TadA*8 or TadA*9). In some embodiments, the adenosine deaminase is a TadA*8 variant (e.g., any one of TadA*8.1, TadA*8.2, TadA*8.3, TadA*8.4, TadA*8.5, TadA*8.6, TadA*8.7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15, TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or TadA*8.24 as described in WO2021163587 and WO2021050571, which are each hereby incorporated by reference in its entirety).
[0234] In some embodiments, the base editor comprises a base editing enzyme fused to TadA by a linker (e.g., wherein the base editing enzyme is fused to TadA at N-terminus or C-terminus by a linker).
[0235] In some embodiments, a base editing enzyme is a deaminase dimer comprising an ABE. In some embodiments, the deaminase dimer comprises an adenosine deaminase. In some embodiments, the deaminase dimer comprises TadA fused to a suitable adenine base editing enzyme including an: ABE8e, ABE8.20m, APOBEC3A, Anc APOBEC (a.k.a. AncBE4Max), BtAPOBEC2, and variants thereof. In some embodiments, the adenine base editing enzyme is fused to amino-terminus or the carboxy-terminus of TadA.
[0236] In some embodiments, RNA base editors comprise an adenosine deaminase. In some embodiments, ADAR proteins bind to RNAs and alter their sequence by changing an adenosine into an inosine. In some embodiments, RNA base editors comprise an effector protein that is activated by or binds RNA.
[0237] In some embodiments, base editors are used to treat a subject having or a subject suspected of having a disease related to a gene of interest. In some embodiments, base editors are useful for treating a disease or a disorder caused by a point mutation in a gene of interest. In some embodiments, compositions, systems, and methods described herein comprise a base editor and a guide nucleic acid, wherein the guide nucleic acid directs the base editor to a sequence in a target gene. The target gene may be associated with a disease. In some embodiments, the guide nucleic acid directs that base editor to or near a mutation in the sequence of a target gene. The mutation may be the deletion of one more nucleotides. The mutation may be the addition of one or more nucleotides. The mutation may be the substitution of one or more nucleotides. The mutation may be the insertion, deletion or substitution of a single nucleotide, also referred to as a point mutation. The point mutation may be a SNP. The mutation may be associated with a disease. In some embodiments, the guide nucleic acid directs the the base editor to bind a target sequence within the target nucleic acid that is within 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides of the mutation. In some embodiments, the guide nucleic acid comprises a sequence that is identical, complementary or reverse complementary to a target sequence of a target nucleic acid that comprises the mutation. In some embodiments, the guide nucleic acid comprises a sequence that is identical, complementary or reverse complementary to a target sequence of a target nucleic acid that is within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides of the mutation.
Prime Editing
[0238] In some embodiments, a fusion protein and/or a fusion partner can comprise a prime editing enzyme. In some embodiments, a prime editing enzyme comprises a reverse transcriptase. A non-limiting example of a reverse transcriptase is an M-MLV RT enzyme and variants thereof having polymerase activity. In some embodiments, the M-MLV RT enzyme comprises at least one mutation selected from D200N, L603W, T330P, T306K, and W313F relative to wildtype M-MLV RT enzyme.
[0239] In some embodiments, a prime editing enzyme may require a prime editing guide RNA (pegRNA) to catalyze an editing. Such a pegRNA may be capable of identifying a target nucleotide or target sequence in a target nucleic acid to be edited and encoding a new genetic information that replaces the target nucleotide or target sequence in the target nucleic acid. A prime editing enzyme may require a pegRNA and a single guide RNA to catalyze the editing. In some embodiments, the target nucleic acid is a dsDNA molecule. In some embodiments, the pegRNA comprises a guide RNA comprising a first region that is bound by the effector protein, and a second region comprising a spacer sequence that is complementary to a target sequence of the dsDNA molecule; a template RNA comprising a primer binding sequence that hybridizes to a primer sequence of the dsDNA molecule that is formed when target nucleic acid is cleaved, and a template sequence that is complementary to at least a portion of the target sequence of the dsDNA molecule with the exception of at least one nucleotide. In some embodiments, the spacer sequence is complementary to the target sequence on a target strand of the dsDNA molecule. In some embodiments, the spacer sequence is complementary to the target sequence on a non-target strand of the dsDNA molecule. In some embodiments, the primer binding sequence hybridizes to a primer sequence on the non-target strand of the dsDNA molecule. In some embodiments, the primer binding sequence hybridizes to a primer sequence on the target strand of the dsDNA molecule. In some embodiments, the target strand is cleaved. In some embodiments, the non-target strand is cleaved.
Protein Modification Activity
[0240] In some embodiments, a fusion partner provides enzymatic activity that modifies a protein associated with a target nucleic acid. The protein may be a histone, an RNA binding protein, or a DNA binding protein. Examples of such protein modification activities include: methyltransferase activity, such as that provided by a histone methyltransferase (HMT) (e.g., suppressor of variegation 3-9 homolog 1 (SUV39H1, also known as KMT1A), euchromatic histone lysine methyltransferase 2 (G9A, also known as KMT1C and EHMT2), SUV39H2, ESET/SETDB1, SET1A, SET1B, MLL1 to 5, ASH1, SYMD2, NSD1, DOT1L, Pr-SET7/8, SUV4-20H1, EZH2, RIZ1); demethylase activity such as that provided by a histone demethylase (e.g., Lysine Demethylase 1A (KDM1A also known as LSD1), JHDM2a/b, JMJD2A/JHDM3A, JMJD2B, JMJD2C/GASC1, JMJD2D, JARID1A/RBP2, JARID1B/PLU-1, JARID1C/SMCX, JARID1D/SMCY, UTX, JMJD3); acetyltransferase activity such as that provided by a histone acetylase transferase (e.g., catalytic core/fragment of the human acetyltransferase p300, GCN5, PCAF, CBP, TAF1, TIP60/PLIP, MOZ/MYST3, MORF/MYST4, HBO1/MYST2, HMOF/MYST1, SRC1, ACTR, P160, CLOCK); deacetylase activity such as that provided by a histone deacetylase (e.g., HDAC1, HDAC2, HDAC3, HDAC8, HDAC4, HDAC5, HDAC7, HDAC9, SIRT1, SIRT2, HDAC11); kinase activity; phosphatase activity; ubiquitin ligase activity; deubiquitinating activity; adenylation activity; deadenylation activity; SUMOylating activity; deSUMOylating activity; ribosylation activity; deribosylation activity; myristoylation activity; and demyristoylation activity.
CRISPRa Fusions and CRISPRi Fusions
[0241] In some embodiments, fusion partners include, but are not limited to, a protein that directly and/or indirectly provides for increased or decreased transcription and/or translation of a target nucleic acid (e.g., a transcription activator or a fragment thereof, a protein or fragment thereof that recruits a transcription activator, a small molecule/drug-responsive transcription and/or translation regulator, a translation-regulating protein, etc.). In some embodiments, fusion partners that increase or decrease transcription include a transcription activator domain or a transcription repressor domain, respectively.
[0242] In some embodiments, fusion partners activate or increase expression of a target nucleic acid. Such fusion proteins comprising the described fusion partners and an effector protein may be referred to as CRISPRa fusions. In some embodiments, fusion partners increase expression of the target nucleic acid relative to its expression in the absence of the fusion effector protein. Relative expression, including transcription and RNA levels, may be assessed, quantified, and compared, e.g., by RT-qPCR. In some embodiments, fusion partners comprise a transcriptional activator. In some embodiments, the transcriptional activators may promote transcription by: recruitment of other transcription factor proteins; modification of target DNA such as demethylation; recruitment of a DNA modifier; modulation of histones associated with target DNA; recruitment of a histone modifier such as those that modify acetylation and/or methylation of histones; or a combination thereof. In some embodiments, the fusion partner is a reverse transcriptase.
[0243] Non-limiting examples of fusion partners that promote or increase transcription include: transcriptional activators such as VP16, VP64, VP48, VP160, p65 subdomain (e.g., from NFkB), and activation domain of EDLL and/or TAL activation domain (e.g., for activity in plants); histone lysine methyltransferases such as SET1A, SET1B, MLL1 to 5, ASH1, SYMD2, NSD1; histone lysine demethylases such as JHDM2a/b, UTX, JMJD3; histone acetyltransferases such as GCN5, PCAF, CBP, p300, TAF1, TIP60/PLIP, MOZ/MYST3, MORF/MYST4, SRC1, ACTR, P160, CLOCK; and DNA demethylases such as Ten-Eleven Translocation (TET) dioxygenase 1 (TET1CD), TET1, DME, DML1, DML2, and ROS1; and functional domains thereof. Other non-limiting examples of suitable fusion partners include: proteins and protein domains responsible for stimulating translation (e.g., Staufen); proteins and protein domains responsible for (e.g., capable of) modulating translation (e.g., translation factors such as initiation factors, elongation factors, release factors, etc., e.g., eIF4G); proteins and protein domains responsible for stimulation of RNA splicing (e.g., Serine/Arginine-rich (SR) domains); and proteins and protein domains responsible for stimulating transcription (e.g., CDK7 and HIV Tat).
[0244] In some embodiments, fusions partners inhibit or reduce expression of a target nucleic acid. Such fusion proteins comprising described fusion partners and an effector protein may be referred to as CRISPRi fusions. In some embodiments, fusion partners reduce expression of the target nucleic acid relative to its expression in the absence of the fusion effector protein. Relative expression, including transcription and RNA levels, may be assessed, quantified, and compared, e.g., by RT-qPCR. In some embodiments, fusion partners may comprise a transcriptional repressor. In some embodiments, the transcriptional repressors may inhibit transcription by: recruitment of other transcription factor proteins; modification of target DNA such as methylation; recruitment of a DNA modifier; modulation of histones associated with target DNA; recruitment of a histone modifier such as those that modify acetylation and/or methylation of histones; or a combination thereof.
[0245] Non-limiting examples of fusion partners that decrease or inhibit transcription include: transcriptional repressors such as the Kr?ppel associated box (KRAB or SKD); KOX1 repression domain; the Mad mSIN3 interaction domain (SID); the ERF repressor domain (ERD), the SRDX repression domain (e.g., for repression in plants); histone lysine methyltransferases such as Pr-SET7/8, SUV4-20H1, RIZ1, and the like; histone lysine demethylases such as JMJD2A/JHDM3A, JMJD2B, JMJD2C/GASC1, JMJD2D, JARID1A/RBP2, JARID1B/PLU-1, JARID1C/SMCX, JARID1D/SMCY; histone lysine deacetylases such as HDAC1, HDAC2, HDAC3, HDAC8, HDAC4, HDAC5, HDAC7, HDAC9, SIRT1, SIRT2, HDAC11; DNA methylases such as HhaI DNA m5c-methyltransferase (M.HhaI), DNA methyltransferase 1 (DNMT1), DNA methyltransferase 3a (DNMT3a), DNA methyltransferase 3b (DNMT3b), METI, DRM3 (plants), ZMET2, CMT1, CMT2 (plants); and periphery recruitment elements such as Lamin A, and Lamin B; and functional domains thereof. Other non-limiting examples of suitable fusion partners include: proteins and protein domains responsible for repressing translation (e.g., Ago2 and Ago4); proteins and protein domains responsible for repression of RNA splicing (e.g., PTB, Sam68, and hnRNP A1); proteins and protein domains responsible for reducing the efficiency of transcription (e.g., FUS (TLS)).
[0246] In some embodiments, fusion proteins are targeted by a guide nucleic acid (e.g., guide RNA) to a specific location in a target nucleic acid and exert locus-specific regulation such as blocking RNA polymerase binding to a promoter (which selectively inhibits transcription activator function), and/or changes a local chromatin status (e.g., when a fusion sequence is used that edits the target nucleic acid or modifies a protein associated with the target nucleic acid). In some embodiments, the modifications are transient (e.g., transcription repression or activation). In some embodiments, the modifications are inheritable. For example, epigenetic modifications made to a target nucleic acid, or to proteins associated with the target nucleic acid, e.g., nucleosomal histones, in a cell, can be observed in a successive generation.
[0247] In some embodiments, fusion partner comprises an RNA splicing factor. The RNA splicing factor may be used (in whole or as fragments thereof) for modular organization, with separate sequence-specific RNA binding modules and splicing effector domains. In some embodiments, the RNA splicing factors comprise members of the Serine/Arginine-rich (SR) protein family containing N-terminal RNA recognition motifs (RRMs) that bind to exonic splicing enhancers (ESEs) in pre-mRNAs and C-terminal RS domains that promote exon inclusion. In some embodiments, a hnRNP protein hnRNP A1 binds to exonic splicing silencers (ESSs) through its RRM domains and inhibits exon inclusion through a C-terminal Glycine-rich domain. In some embodiments, the RNA splicing factors may regulate alternative use of splice site (ss) by binding to regulatory sequences between two alternative sites. For example, in some embodiments, ASF/SF2 may recognize ESEs and promote the use of intron proximal sites, whereas hnRNP A1 may bind to ESSs and shift splicing towards the use of intron distal sites. One application for such factors is to generate ESFs that modulate alternative splicing of endogenous genes, particularly disease associated genes. For example, Bcl-x pre-mRNA produces two splicing isoforms with two alternative 5 splice sites to encode proteins of opposite functions. Long splicing isoform Bcl-xL is a potent apoptosis inhibitor expressed in long-lived postmitotic cells and is up-regulated in many cancer cells, protecting cells against apoptotic signals. Short isoform Bcl-xS is a pro-apoptotic isoform and expressed at high levels in cells with a high turnover rate (e.g., developing lymphocytes). A ratio of the two Bcl-x splicing isoforms is regulated by multiple c{acute over (?)}-elements that are located in either core exon region or exon extension region (i.e., between the two alternative 5 splice sites). For more examples, see WO2010075303, which is hereby incorporated by reference in its entirety.
Recombinases
[0248] In some embodiments, fusion partners comprise a recombinase. In some embodiments, effector proteins described herein are fused with the recombinase. In some embodiments, the effector proteins have reduced nuclease activity or no nuclease activity. In some embodiments, the recombinase is a site-specific recombinase.
[0249] In some embodiments, a catalytically inactive effector protein is fused with a recombinase, wherein the recombinase can be a site-specific recombinase. Such polypeptides can be used for site-directed transgene insertion. The term transgene refers to a nucleotide sequence that is inserted into a cell for expression of said nucleotide sequence in the cell. A transgene is meant to include (1) a nucleotide sequence that is not naturally found in the cell (e.g., a heterologous nucleotide sequence); (2) a nucleotide sequence that is a mutant form of a nucleotide sequence naturally found in the cell into which it has been introduced; (3) a nucleotide sequence that serves to add additional copies of the same (e.g., exogenous or homologous) or a similar nucleotide sequence naturally occurring in the cell into which it has been introduced; or (4) a silent naturally occurring or homologous nucleotide sequence whose expression is induced in the cell into which it has been introduced. A donor nucleic acid can comprise a transgene. The cell in which transgene expression occurs can be a target cell, such as a host cell. Non-limiting examples of site-specific recombinases include a tyrosine recombinase (e.g., Cre, Flp or lambda integrase), a serine recombinase (e.g., gamma-delta resolvase, Tn3 resolvase, Sin resolvase, Gin invertase, Hin invertase, Tn5044 resolvase, IS607 transposase and integrase), or mutants or variants thereof. In some embodiments, the recombinase is a serine recombinase. Non-limiting examples of serine recombinases include gamma-delta resolvase, Tn3 resolvase, Sin resolvase, Gin invertase, Hin invertase, Tn5044 resolvase, IS607 transposase, and IS607 integrase. In some embodiments, the site-specific recombinase is an integrase. Non-limiting examples of integrases include: Bxb1, wBeta, BL3, phiR4, A118, TG1, MR11, phi370, SPBc, TP901-1, phiRV, FC1, K38, phiBT1, and phiC31. Further discussion and examples of suitable recombinase fusion partners are described in U.S. Pat. No. 10,975,392, which is incorporated herein by reference in its entirety. In some embodiments, the fusion protein comprises a linker that links the recombinase to the Cas-CRISPR domain of the effector protein. In some embodiments, the linker is The-Ser.
[0250] In some embodiments, the fusion partner protein is fused to the 3 end of the effector protein. In some embodiments, the effector protein is located at an internal location of the fusion partner protein. In some embodiments, the fusion partner protein is located at an internal location of the Cas effector protein. For example, a base editing enzyme (e.g., a deaminase enzyme) is inserted at an internal location of a Cas effector protein. The effector protein may be fused directly or indirectly (e.g., via a linker) to the fusion partner protein. Exemplary linkers are described herein.
[0251] In some embodiments, the fusion effector protein or the guide nucleic acid comprises a chemical modification that allows for direct crosslinking between the guide nucleic acid or the effector protein and the fusion partner. By way of non-limiting example, the chemical modification may comprise any one of a SNAP-tag, CLIP-tag, ACP-tag, Halo-tag, and an MCP-tag. In some embodiments, modifications are introduced with a Click Reaction, also known as Click Chemistry. The Click reaction may be copper dependent or copper independent.
[0252] In some embodiments, guide nucleic acids comprise an aptamer. The aptamer may serve as a linker between the effector protein and the fusion partner by interacting non-covalently with both. In some embodiments, the aptamer binds a fusion partner, wherein the fusion partner is a transcriptional activator. In some embodiments, the aptamer binds a fusion partner, wherein the fusion partner is a transcriptional inhibitor. In some embodiments, the aptamer binds a fusion partner, wherein the fusion partner comprises a base editor. In some embodiments, the aptamer binds the fusion partner directly. In some embodiments, the aptamer binds the fusion partner indirectly. Aptamers may bind the fusion partner indirectly through an aptamer binding protein. By way of non-limiting example, the aptamer binding protein may be MS2 and the aptamer sequence may be ACATGAGGATCACCCATGT (SEQ ID NO: 15,016); the aptamer binding protein may be PP7 and the aptamer sequence may be GGAGCAGACGATATGGCGTCGCTCC (SEQ ID NO: 15,017); or the aptamer binding protein may be BoxB and the aptamer sequence may be GCCCTGAAGAAGGGC (SEQ ID NO: 15,018).
[0253] In some embodiments, the fusion partner is located within effector protein. For example, the fusion partner may be a domain of a fusion partner protein that is internally integrated into the effector protein. In other words, the fusion partner may be located between the 5 and 3 ends of the effector protein without disrupting the ability of the fusion effector protein to recognize/bind a target nucleic acid. In some embodiments, the fusion partner replaces a portion of the effector protein. In some embodiments, the fusion partner replaces a domain of the effector protein. In some embodiments, the fusion partner does not replace a portion of the effector protein.
[0254] An effector protein disclosed herein or fusion effector protein may comprise a nuclear localization signal (NLS). In some cases, the NLS may comprise a sequence of KRPAATKKAGQAKKKK (SEQ ID NO: 15,019). In some cases, the NLS comprises or consists of a sequence of PKKKRKV (SEQ ID NO: 15,020). In some cases, the NLS comprises or consists of a sequence of LPPLERLTL (SEQ ID NO: 15,021). An effector protein may be codon optimized for expression in a specific cell, for example, a bacterial cell, a plant cell, a eukaryotic cell, an animal cell, a mammalian cell, or a human cell. In some embodiments, the effector protein is codon optimized for a human cell. The NLS may be located at a variety of locations, including, but not limited to 5 of the effector protein, 5 of the fusion partner, 3 of the effector protein, 3 of the fusion partner, between the effector protein and the fusion partner, within the fusion partner, within the effector protein.
Linkers for Peptides
[0255] In general, effector proteins and fusion partners of a fusion effector protein are connected by a linker. In some embodiments, a linker comprises a bond or molecule that links a first polypeptide to a second polypeptide. The linker may comprise or consist of a covalent bond. The linker may comprise or consist of a chemical group. In some embodiments, the linker comprises an amino acid. In some embodiments, a peptide linker comprises at least two amino acids linked by an amide bond. In general, the linker connects a terminus of the effector protein to a terminus of the fusion partner. In some embodiments, carboxy terminus of the effector protein is linked to the amino terminus of the fusion partner. In some embodiments, carboxy terminus of the fusion partner is linked to the amino terminus of the effector protein. In some embodiments, the effector protein and the fusion partner are directly linked by a covalent bond.
[0256] In some embodiments, linkers comprise one or more amino acids. In some embodiments, linker is a protein. In some embodiments, a terminus of the effector protein is linked to a terminus of the fusion partner through an amide bond. In some embodiments, a terminus of the effector protein is linked to a terminus of the fusion partner through a peptide bond. In some embodiments, linkers comprise an amino acid. In some embodiments, linkers comprise a peptide. In some embodiments, an effector protein is coupled to a fusion partner by a linker protein. In some embodiments, the linker may have any of a variety of amino acid sequences. In some embodiments, the linker may comprise a region of rigidity (e.g., beta sheet, alpha helix), a region of flexibility, or any combination thereof. In some embodiments, the linker comprises small amino acids, such as glycine and alanine, that impart high degrees of flexibility. The ordinarily skilled artisan will recognize that design of a peptide conjugated to any desired element may include linkers that are all or partially flexible, such that the linker may include a flexible linker as well as one or more portions that confer less flexible structure. Suitable linkers include proteins of 4 linked amino acids to 40 linked amino acids in length, or between 4 linked amino acids and 25 linked amino acids in length. In some embodiments, linked amino acids described herein comprise at least two amino acids linked by an amide bond.
[0257] Linkers may be produced by using synthetic, linker-encoding oligonucleotides to couple proteins, or may be encoded by a nucleic acid sequence encoding a fusion protein (e.g., an effector protein coupled to a fusion partner). In some embodiments, the linker is from 1 to 100 amino acids in length. In some embodiments, the linker is more 100 amino acids in length. In some embodiments, the linker is from 10 to 27 amino acids in length. In some embodiments, linker proteins include glycine polymers (G)n, glycine-serine polymers (including, for example, (GS)n, GSGGSn, GGSGGSn, and GGGSn, where n is an integer of at least one), glycine-alanine polymers, and alanine-serine polymers. In some embodiments, linkers may comprise amino acid sequences including, but not limited to, GGSG, GGSGG, GSGSG, GSGGG, GGGSG, and GSSSG. In some embodiments, the linker comprises one or more repeats a tri-peptide GGS. In some embodiments, the linker is an XTEN linker.
[0258] In some embodiments, linkers do not comprise an amino acid. In some embodiments, linkers do not comprise a peptide. In some embodiments, linkers comprise a nucleotide, a polynucleotide, a polymer, or a lipid. In some embodiments, linker may be a polyethylene glycol (PEG), polypropylene glycol (PPG), co-poly(ethylene/propylene) glycol, polyoxyethylene (POE), polyurethane, polyphosphazene, polysaccharides, dextran, polyvinyl alcohol, polyvinylpyrrolidones, polyvinyl ethyl ether, polyacrylamide, polyacrylate, polycyanoacrylates, lipid polymers, chitins, hyaluronic acid, heparin, an alkyl linker, or a combination thereof. In some embodiments, linkers comprise or consist of a nucleic acid. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises RNA. In some embodiments, the effector protein and the fusion partner each interact with the nucleic acid, the nucleic acid thereby linking the effector protein and the fusion partner. In some embodiments, the nucleic acid serves as a scaffold for both the effector protein and the fusion partner to interact with, thereby linking the effector protein and the fusion partner. Such nucleic acids include those described by Tadakuma et al., (2016), Progress in Molecular Biology and Translational Science, Volume 139, pp. 121-163, incorporated herein by reference.
Multimeric Complexes
[0259] Compositions, systems, and methods of the present disclosure may comprise a multimeric complex or uses thereof, wherein the multimeric complex comprises one or more effector proteins that non-covalently interact with one another. A multimeric complex may comprise enhanced activity relative to the activity of any one of its effector proteins alone. For example, a multimeric complex comprising two effector proteins (e.g., in dimeric form) may comprise greater nucleic acid binding affinity and/or nuclease activity than that of either of the effector proteins provided in monomeric form. In another example, a multimeric complex comprising an effector protein and an effector partner may comprise greater nucleic acid binding affinity and/or nuclease activity than that of either of the effector protein or effector partner provided in monomeric form.
[0260] The terms effector partner and partner polypeptide refer to a polypeptide that does not have 100% sequence identity with an effector protein described herein. In some instances, an effector partner described herein may be found in a homologous genome as an effector protein described herein.
[0261] A multimeric complex may have an affinity for a target sequence of a target nucleic acid and is capable of catalytic activity (e.g., cleaving, nicking, inserting or otherwise editing the nucleic acid) at or near the target sequence. A multimeric complex may have an affinity for a donor nucleic acid and is capable of catalytic activity (e.g., cleaving, nicking, editing or otherwise modifying the nucleic acid by creating cuts) at or near one or more ends of the donor nucleic acid. Multimeric complexes may be activated when complexed with a guide nucleic acid. Multimeric complexes may be activated when complexed with a target nucleic acid. Multimeric complexes may be activated when complexed with a guide nucleic acid, a target nucleic acid, and/or a donor nucleic acid. In some embodiments, the multimeric complex cleaves the target nucleic acid. In some embodiments, the multimeric complex nicks the target nucleic acid.
[0262] Various aspects of the present disclosure include compositions and methods comprising multiple effector proteins, and uses thereof, respectively. An effector protein comprising at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% sequence identity to any one of the sequences of TABLE 1 may be provided with a second effector protein. Two effector proteins may target different nucleic acid sequences. Two effector proteins may target different types of nucleic acids (e.g., a first effector protein may target double- and single-stranded nucleic acids, and a second effector protein may only target single-stranded nucleic acids). It is understood that when discussing the use of more than one effector protein in compositions, systems, and methods provided herein, the multimeric complex form is also described.
[0263] In some embodiments, multimeric complexes comprise at least one effector protein comprising an amino acid sequence with at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identity to any one of the sequences of TABLE 1. In some embodiments, the multimeric complex is a dimer comprising two effector proteins of identical amino acid sequences. In some embodiments, the multimeric complex comprises a first effector protein and a second effector protein, wherein the amino acid sequence of the first effector protein is at least 90%, at least 92%, at least 94%, at least 96%, at least 98% identical, or at least 99% identical to the amino acid sequence of the second effector protein.
[0264] In some embodiments, the multimeric complex is a heterodimeric complex comprising at least two effector proteins of different amino acid sequences. In some embodiments, the multimeric complex is a heterodimeric complex comprising a first effector protein and a second effector protein, wherein the amino acid sequence of the first effector protein is less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, or less than 10% identical to the amino acid sequence of the second effector protein.
[0265] In some embodiments, a multimeric complex comprises at least two effector proteins. In some embodiments, a multimeric complex comprises more than two effector proteins. In some embodiments, a multimeric complex comprises two, three or four effector proteins. In some embodiments, at least one effector protein of the multimeric complex comprises an amino acid sequence with at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identity to any one of the sequences of TABLE 1. In some embodiments, each effector protein of the multimeric complex independently comprises an amino acid sequence with at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identity to any one of the sequences of TABLE 1.
Synthesis, Isolation and Assaying
[0266] Effector proteins of the present disclosure may be synthesized, using any suitable method. In some embodiments, the effector proteins may be produced in vitro or by eukaryotic cells or by prokaryotic cells. In some embodiments, the effector proteins may be further processed by unfolding (e.g. heat denaturation, dithiothreitol reduction, etc.) and may be further refolded, using any suitable method.
[0267] Any suitable method of generating and assaying the effector proteins described herein may be used. Such methods include, but are not limited to, site-directed mutagenesis, random mutagenesis, combinatorial libraries, and other mutagenesis methods described herein (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, M D (1999); Gillman et al., Directed Evolution Library Creation: Methods and Protocols (Methods in Molecular Biology) Springer, 2nd ed (2014)). One non-limiting example of a method for preparing an effector protein is to express recombinant nucleic acids encoding the effector protein in a suitable microbial organism, such as a bacterial cell, a yeast cell, or other suitable cell, using methods well known in the art. Exemplary methods are also described in the Examples provided herein.
[0268] In some embodiments, an effector protein provided herein is an isolated effector protein. In some embodiments, the effector proteins may be isolated and purified for use in compositions, systems, and/or methods described herein. In some embodiments, methods described here may include the step of isolating effector proteins described herein. Any suitable method to provide isolated effector proteins described herein may be used in the present disclosure, for example, recombinant expression systems, precipitation, gel filtration, ion-exchange, reverse-phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al., Guide to Protein Purification: Methods in Enzymology, Vol. 182, (Academic Press, (1990)). Alternatively, the isolated polypeptides of the present disclosure can be obtained using well-known recombinant methods (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Ed., Cold Spring Harbor Laboratory, New York (2001); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, MD (1999)). The methods and conditions for biochemical purification of a polypeptide described herein can be chosen by those skilled in the art, and purification monitored, for example, by a functional assay.
[0269] In some embodiments, compositions, systems, and methods described herein may further comprise a purification tag that can be attached to an effector protein, or a nucleic acid encoding the purification tag that can be attached to a nucleic acid encoding the effector protein as described herein. In some embodiments, the purification tag may be an amino acid sequence which can attach or bind with high affinity to a separation substrate and assist in isolating the protein of interest from its environment, which may be its biological source, such as a cell lysate. Attachment of the purification tag may be at the N or C terminus of the effector protein. Furthermore, an amino acid sequence recognized by a protease or a nucleic acid encoding for an amino acid sequence recognized by a protease, such as TEV protease or the HRV3C protease may be inserted between the purification tag and the effector protein, such that biochemical cleavage of the sequence with the protease after initial purification liberates the purification tag. Purification and/or isolation may be performed through high performance liquid chromatography (HPLC), exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique. Non-limiting examples of purification tags are as described herein.
[0270] In some embodiments, effector proteins described herein are isolated from cell lysate. In some embodiments, the compositions described herein may comprise 20% or more by weight, 75% or more by weight, 95% or more by weight, or 99.5% or more by weight of an effector protein, related to the method of preparation of compositions described herein and its purification thereof, wherein percentages may be upon total protein content in relation to contaminants. Thus, in some embodiments, the effector protein is at least 80% pure, at least 85% pure, at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure (e.g., free of contaminants, non-engineered proteins or other macromolecules, etc.).
Protospacer Adjacent Motif (PAM) Sequences
[0271] Effector proteins of the present disclosure may cleave or nick a target nucleic acid within or near a protospacer adjacent motif (PAM) sequence of the target nucleic acid. In some embodiments, the target nucleic acid is a double stranded nucleic acid comprising a target strand and a non-target strand.
[0272] In some embodiments, cleavage occurs within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides of a 5 or 3 terminus of a PAM sequence. In some embodiments, effector proteins described herein recognize a PAM sequence. In some embodiments, recognizing a PAM sequence comprises interacting with a sequence adjacent to the PAM. In some embodiments, a target nucleic acid comprises a target sequence that is adjacent to a PAM sequence. In some embodiments, the effector protein does not require a PAM to bind and/or cleave a target nucleic acid.
[0273] In some embodiments, a target nucleic acid is a single stranded target nucleic acid comprising a target sequence. Accordingly, in some embodiments, the single stranded target nucleic acid comprises a PAM sequence described herein that is adjacent (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides) or directly adjacent to the target sequence. In some embodiments, an RNP cleaves the single stranded target nucleic acid.
[0274] In some embodiments, a target nucleic acid is a double stranded nucleic acid comprising a target strand and a non-target strand, wherein the target strand comprises a target sequence. In some embodiments, the PAM sequence is located on the target strand. In some embodiments, the PAM sequence is located on the non-target strand. In some embodiments, the PAM sequence described herein is adjacent (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides) to the target sequence on the target strand or the non-target strand. In some embodiments, such a PAM described herein is directly adjacent to the target sequence on the target strand or the non-target strand. In some embodiments, an RNP cleaves the target strand or the non-target strand. In some embodiments, the RNP cleaves both, the target strand and the non-target strand. In some embodiments, an RNP recognizes the PAM sequence, and hybridizes to a target sequence of the target nucleic acid. In some embodiments, the RNP cleaves the target nucleic acid, wherein the RNP has recognized the PAM sequence and is hybridized to the target sequence.
[0275] In some embodiments, an effector protein described herein, or a multimeric complex thereof, recognizes a PAM on a target nucleic acid. In some embodiments, multiple effector proteins of the multimeric complex recognize a PAM on a target nucleic acid. In some embodiments, at least two of the multiple effector proteins recognize the same PAM sequence. In some embodiments, at least two of the multiple effector proteins recognize different PAM sequences. In some embodiments, only one effector protein of the multimeric complex recognizes a PAM on a target nucleic acid.
[0276] An effector protein of the present disclosure, or a multimeric complex thereof, may cleave or nick a target nucleic acid within or near a protospacer adjacent motif (PAM) sequence of the target nucleic acid. In some embodiments, cleavage occurs within 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides of a 5 or 3 terminus of a PAM sequence.
[0277] In some embodiments, compositions, methods and systems described herein do not comprise a PAM sequence. In some embodiments, effector proteins do not recognize a PAM sequence. In some embodiments, compositions, methods and systems described herein comprise a protospacer-flanking site (PFS) sequence. A PFS sequence may be useful for the detection and/or modification of RNA.
V. Nucleic Acid Systems
Guide Nucleic Acids
[0278] The compositions, systems, and methods of the present disclosure may comprise a guide nucleic acid or a use thereof. Unless otherwise indicated, compositions, systems and methods comprising guide nucleic acids or uses thereof, as described herein and throughout, include DNA molecules, such as expression vectors, that encode a guide nucleic acid. Accordingly, compositions, systems, and methods of the present disclosure comprise a guide nucleic acid or a nucleotide sequence encoding the guide nucleic acid.
[0279] In some embodiments, the guide nucleic acid comprises a nucleotide sequence. Such nucleotide sequence may be described as a nucleotide sequence of either DNA or RNA, however, no matter the form the sequence is described, it is readily understood that such nucleotide sequences can be revised to be RNA or DNA, as needed, for describing a sequence within a guide nucleic acid itself or the sequence that encodes a guide nucleic acid. Similarly, disclosure of the nucleotide sequences described herein also discloses a complementary nucleotide sequence, a reverse nucleotide sequence, and the reverse complement nucleotide sequence, any one of which can be a nucleotide sequence for use in a guide nucleic acid. In some embodiments, a guide nucleic acid sequence(s) comprises one or more nucleotide alterations at one or more positions in any one of the sequences described herein. Alternative nucleotides can be any one or more of A, C, G, T or U, or a deletion, or an insertion.
[0280] A guide nucleic acid may comprise a sequence that is bound by an effector protein. In general, the guide nucleic acid comprises a CRISPR RNA (crRNA), at least a portion of which is complementary to a target sequence of a target nucleic acid. In some embodiments, the guide nucleic acid comprises a trans-activating CRISPR RNA (tracrRNA) that interacts with the effector protein. In some embodiments, the crRNA and the tracrRNA are covalently linked, also referred to herein as a single guide RNA (sgRNA). In some embodiments, the crRNA and tracrRNA are linked by a phosphodiester bond. In some embodiments, the crRNA and tracrRNA are linked by one or more linked nucleotides. In some embodiments, a crRNA and tracrRNA function as two separate, unlinked molecules. In some embodiments, the composition does not comprise a tracrRNA. In some embodiments, the crRNA comprises a sequence that is bound by an effector protein.
[0281] The terms, length and linked nucleosides, as used herein, refer to a nucleic acid (polynucleotide) or polypeptide, may be expressed as kilobases (kb) or base pairs (bp),. Thus, a length of 1 kb refers to a length of 1000 linked nucleosides, and a length of 500 bp refers to a length of 500 linked nucleosides. Similarly, a protein having a length of 500 linked amino acids may also be simply described as having a length of 500 amino acids.
[0282] Guide nucleic acids may comprise DNA, RNA, or a combination thereof (e.g., RNA with a thymine base). Guide nucleic acids may include a chemically modified nucleobase or phosphate backbone. Guide nucleic acids may be referred to herein as a guide RNA (gRNA). However, a guide RNA is not limited to ribonucleotides, but may comprise deoxyribonucleotides and other chemically modified nucleotides. A guide nucleic acid may comprise a naturally occurring guide nucleic acid. A guide nucleic acid may comprise a non-naturally occurring guide nucleic acid, including a guide nucleic acid that is designed to contain a chemical or biochemical modification. The sequence of a guide nucleic acid may comprise two or more heterologous sequences. Guide RNAs may be chemically synthesized or recombinantly produced.
[0283] Guide nucleic acids, when complexed with an effector protein, may bring the effector protein into proximity of a target nucleic acid. Sufficient conditions for hybridization of a guide nucleic acid to a target nucleic acid and/or for binding of a guide nucleic acid to an effector protein include in vivo physiological conditions of a desired cell type or in vitro conditions sufficient for assaying catalytic activity of a protein, polypeptide or peptide described herein, such as the nuclease activity of an effector protein.
[0284] The compositions, systems, and methods of the present disclosure may comprise a guide nucleic acid, a nucleic acid encoding the guide nucleic acid, or a use thereof. Unless otherwise indicated, compositions, systems and methods comprising guide nucleic acids or uses thereof, as described herein and throughout, include DNA molecules, such as expression vectors, that encode a guide nucleic acid. Guide nucleic acids are also referred to herein as guide RNA. A guide nucleic acid, as well as any components thereof (e.g., spacer sequence, repeat sequence, linker nucleotide sequence, etc.) may comprise one or more deoxyribonucleotides, ribonucleotides, biochemically or chemically modified nucleotides (e.g., one or more engineered modifications as described herein), or any combinations thereof. Such nucleotide sequences described herein may be described as a nucleotide sequence of either DNA or RNA, however, no matter the form the sequence is described, it is readily understood that such nucleotide sequences can be revised to be RNA or DNA, as needed, for describing a sequence within a guide nucleic acid itself or the sequence that encodes a guide nucleic acid, such as a nucleotide sequence described herein for a vector. Similarly, disclosure of the nucleotide sequences described herein also discloses the complementary nucleotide sequence, the reverse nucleotide sequence, and the reverse complement nucleotide sequence, any one of which can be a nucleotide sequence for use in a guide nucleic acid as described herein.
[0285] A guide nucleic acid may comprise a naturally occurring sequence. A guide nucleic acid may comprise a non-naturally occurring sequence, wherein the sequence of the guide nucleic acid, or any portion thereof, may be different from the sequence of a naturally occurring guide nucleic acid. A guide nucleic acid of the present disclosure comprises one or more of the following: a) a single nucleic acid molecule; b) a DNA base; c) an RNA base; d) a modified base; e) a modified sugar; f) a modified backbone; and the like. Modifications are described herein and throughout the present disclosure (e.g., in the section entitled Engineered Modifications). A guide nucleic acid may be chemically synthesized or recombinantly produced by any suitable methods. Guide nucleic acids and portions thereof may be found in or identified from a CRISPR array present in the genome of a host organism or cell.
[0286] In general, a guide nucleic acid comprises a first region that is not complementary to a target nucleic acid (FR) and a second region is complementary to the target nucleic acid (SR). In some embodiments, FR is located 5 to SR (FR-SR). In some embodiments, SR is located 5 to FR (SR-FR).
[0287] In some embodiments, the FR comprises one or more repeat sequences. In some embodiments, an effector protein binds to at least a portion of the FR. In some embodiments, the SR comprises a spacer sequence, wherein the spacer sequence can interact in a sequence-specific manner with (e.g., has complementarity with, or can hybridize to a target sequence in) a target nucleic acid.
[0288] The guide nucleic acid may also form complexes as described through herein. For example, a guide nucleic acid may hybridize to another nucleic acid, such as target nucleic acid, or a portion thereof. In another example, a guide nucleic acid may complex with an effector protein. In such embodiments, a guide nucleic acid-effector protein complex may be described herein as an RNP. In some embodiments, when in a complex, at least a portion of the complex may bind, recognize, and/or hybridize to a target nucleic acid. For example, when a guide nucleic acid and an effector protein are complexed to form an RNP, at least a portion of the guide nucleic acid hybridizes to a target sequence in a target nucleic acid. Those skilled in the art in reading the below specific examples of guide nucleic acids as used in RNPs described herein, will understand that in some embodiments, a RNP may hybridize to one or more target sequences in a target nucleic acid, thereby allowing the RNP to modify and/or recognize a target nucleic acid or sequence contained therein (e.g., PAM) or to modify and/or recognize non-target sequences depending on the guide nucleic acid, and in some embodiments, the effector protein, used.
[0289] In some embodiments, a guide nucleic acid may comprise or form intramolecular secondary structure (e.g., hairpins, stem-loops, etc.). In some embodiments, a guide nucleic acid comprises a stem-loop structure comprising a stem region and a loop region. In some embodiments, the stem region is 4 to 8 linked nucleotides in length. In some embodiments, the stem region is 5 to 6 linked nucleotides in length. In some embodiments, the stem region is 4 to 5 linked nucleotides in length. In some embodiments, the guide nucleic acid comprises a pseudoknot (e.g., a secondary structure comprising a stem, at least partially, hybridized to a second stem or half-stem secondary structure). An effector protein may recognize a guide nucleic acid comprising multiple stem regions. In some embodiments, the nucleotide sequences of the multiple stem regions are identical to one another. In some embodiments, the nucleotide sequences of at least one of the multiple stem regions is not identical to those of the others. In some embodiments, the guide nucleic acid comprises at least 2, at least 3, at least 4, or at least 5 stem regions.
[0290] In some embodiments, the compositions, systems, and methods of the present disclosure comprise two or more guide nucleic acids (e.g., 2, 3, 4, 5, 6, 7, 9, 10 or more guide nucleic acids), and/or uses thereof. Multiple guide nucleic acids may target an effector protein to different locations in the target nucleic acid by hybridizing to different target sequences. In some embodiments, a first guide nucleic acid may hybridize within a location of the target nucleic acid that is different from where a second guide nucleic acid may hybridize the target nucleic acid. In some embodiments, the first loci and the second loci of the target nucleic acid may be located at least 1, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 nucleotides apart. In some embodiments, the first loci and the second loci of the target nucleic acid may be located between 100 and 200, 200 and 300, 300 and 400, 400 and 500, 500 and 600, 600 and 700, 700 and 800, 800 and 900 or 900 and 1000 nucleotides apart.
[0291] In some embodiments, the first loci and/or the second loci of the target nucleic acid are located in an intron of a gene. In some embodiments, the first loci and/or the second loci of the target nucleic acid are located in an exon of a gene. In some embodiments, the first loci and/or the second loci of the target nucleic acid span an exon-intron junction of a gene. In some embodiments, the first portion and/or the second portion of the target nucleic acid are located on either side of an exon and cutting at both sites results in deletion of the exon. In some embodiments, composition, systems, and methods comprise a donor nucleic acid that may be inserted in replacement of a deleted or cleaved sequence of the target nucleic acid. In some embodiments, compositions, systems, and methods comprising multiple guide nucleic acids or uses thereof comprise multiple effector proteins, wherein the effector proteins may be identical, non-identical, or combinations thereof.
[0292] In some embodiments, a guide nucleic acid comprises about: 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 linked nucleotides. In general, a guide nucleic acid comprises at least: 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 linked nucleotides. In some embodiments, the guide nucleic acid has about 10 to about 60, about 20 to about 50, or about 30 to about 40 linked nucleotides.
[0293] In some embodiments, a guide nucleic acid comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides that are complementary to a eukaryotic sequence. Such a eukaryotic sequence is a nucleotide sequence that is present in a host eukaryotic cell. Such a nucleotide sequence is distinguished from nucleotide sequences present in other host cells, such as prokaryotic cells, or viruses. Said sequences present in a eukaryotic cell can be located in a gene, an exon, an intron, a non-coding (e.g., promoter or enhancer) region, a selectable marker, tag, signal, and the like. In some embodiments, a target sequence is a eukaryotic sequence.
[0294] In some embodiments, a length of a guide nucleic acid is about 30 to about 120 linked nucleotides. In some embodiments, the length of a guide nucleic acid is about 40 to about 100, about 40 to about 90, about 40 to about 80, about 40 to about 70, about 40 to about 60, about 40 to about 50, about 50 to about 90, about 50 to about 80, about 50 to about 70, or about 50 to about 60 linked nucleotides. In some embodiments, the length of a guide nucleic acid is about 40, about 45, about 50, about 55, about 60, about 65, about 70 or about 75 linked nucleotides. In some embodiments, the length of a guide nucleic acid is greater than about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70 or about 75 linked nucleotides. In some embodiments, the length of a guide nucleic acid is not greater than about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 105, about 110, about 115, about 120, or about 125 linked nucleotides. In some embodiments, a guide nucleic acid comprises at least 25 linked nucleosides. A guide nucleic acid may comprise 10 to 50 linked nucleosides. In some cases, the guide nucleic acid comprises or consists essentially of about 12 to about 80 linked nucleosides, about 12 to about 50, about 12 to about 45, about 12 to about 40, about 12 to about 35, about 12 to about 30, about 12 to about 25, from about 12 to about 20, about 12 to about 19, about 19 to about 20, about 19 to about 25, about 19 to about 30, about 19 to about 35, about 19 to about 40, about 19 to about 45, about 19 to about 50, about 19 to about 60, about 20 to about 25, about 20 to about 30, about 20 to about 35, about 20 to about 40, about 20 to about 45, about 20 to about 50, or about 20 to about 60 linked nucleosides. In some cases, the guide nucleic acid has about 10 to about 60, about 20 to about 50, or about 30 to about 40 linked nucleosides.
[0295] In some embodiments, guide nucleic acids comprise additional elements that contribute additional functionality (e.g., stability, heat resistance, etc.) to the guide nucleic acid. Such elements may be one or more nucleotide alterations, nucleotide sequences, intermolecular secondary structures, or intramolecular secondary structures (e.g., one or more hair pin regions, one or more bulges, etc.).
[0296] In some embodiments, guide nucleic acids comprise one or more linkers connecting different nucleotide sequences as described herein. A linker may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides. A linker may be any suitable linker, examples of which are described herein.
[0297] In some embodiments, guide nucleic acids comprise one or more nucleotide sequences as described herein. Such nucleotide sequences described herein may be described as a nucleotide sequence of either DNA or RNA, however, no matter the form the sequence is described, it is readily understood that such nucleotide sequences may be revised to be RNA or DNA, as needed, for describing a sequence within a guide nucleic acid itself or the sequence that encodes a guide nucleic acid, such as a nucleotide sequence described herein for a vector. Similarly, disclosure of the nucleotide sequences described herein also discloses the complementary nucleotide sequence, the reverse nucleotide sequence, and the reverse complement nucleotide sequence, any one of which may be a nucleotide sequence for use in a guide nucleic acid as described herein. In some embodiments, guide nucleic acid sequence(s) comprises one or more nucleotide alterations at one or more positions in any one of the sequences described herein. Alternative nucleotides may be any one or more of A, C, G, T or U, or a deletion, or an insertion.
Repeat Sequence
[0298] Guide nucleic acids described herein may comprise one or more repeat sequences. In some embodiments, a repeat sequence comprises a nucleotide sequence that is not complementary to a target sequence of a target nucleic acid. In some embodiments, a repeat sequence comprises a nucleotide sequence that may interact with an effector protein. In some embodiments, a repeat sequence is connected to another sequence of a guide nucleic acid that is capable of non-covalently interacting with an effector protein. In some embodiments, a repeat sequence includes a nucleotide sequence that is capable of forming a guide nucleic acid-effector protein complex (e.g., a RNP complex).
[0299] In some embodiments, the repeat sequence is between 10 and 50, 12 and 48, 14 and 46, 16 and 44, and 18 and 42 nucleotides in length.
[0300] In some embodiments, a repeat sequence is adjacent to a spacer sequence. In some embodiments, a repeat sequence is followed by a spacer sequence in the 5 to 3 direction. In some embodiments, a repeat sequence is preceded by a spacer sequence in the 5 to 3 direction. In some embodiments, a repeat sequence is linked to a spacer sequence. In some embodiments, a guide nucleic acid comprises a repeat sequence linked to a spacer sequence, which may be a direct link or by any suitable linker, examples of which are described herein.
[0301] In some embodiments, guide nucleic acids comprise more than one repeat sequence (e.g., two or more, three or more, or four or more repeat sequences). In some embodiments, a guide nucleic acid comprises more than one repeat sequence separated by another sequence of the guide nucleic acid. For example, in some embodiments, a guide nucleic acid comprises two repeat sequences, wherein the first repeat sequence is followed by a spacer sequence, and the spacer sequence is followed by a second repeat sequence in the 5 to 3 direction. In some embodiments, the more than one repeat sequences are identical. In some embodiments, the more than one repeat sequences are not identical.
[0302] In some embodiments, the repeat sequence comprises two sequences that are complementary to each other and hybridize to form a double stranded RNA duplex (dsRNA duplex). In some embodiments, the two sequences are not directly linked and hybridize to form a stem loop structure. In some embodiments, the dsRNA duplex comprises 5, 10, 15, 20 or 25 base pairs (bp). In some embodiments, not all nucleotides of the dsRNA duplex are paired, and therefore the duplex forming sequence may include a bulge. In some embodiments, the repeat sequence comprises a hairpin or stem-loop structure, optionally at the 5 portion of the repeat sequence. In some embodiments, a strand of the stem portion comprises a sequence and the other strand of the stem portion comprises a sequence that is, at least partially, complementary. In some embodiments, such sequences may have 65% to 100% complementarity (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementarity). In some embodiments, a guide nucleic acid comprises nucleotide sequence that when involved in hybridization events may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a bulge, a loop structure or hairpin structure, etc.).
Spacer Sequence
[0303] Guide nucleic acids described herein may comprise one or more spacer sequences. In some embodiments, a spacer sequence is capable of hybridizing to a target sequence of a target nucleic acid. In some embodiments, a spacer sequence comprises a nucleotide sequence that is, at least partially, hybridizable to an equal length of a sequence (e.g., a target sequence) of a target nucleic acid. Exemplary hybridization conditions are described herein. In some embodiments, the spacer sequence may function to direct an RNP complex comprising the guide nucleic acid to the target nucleic acid for detection and/or modification. The spacer sequence may function to direct a RNP to the target nucleic acid for detection and/or modification. A spacer sequence may be complementary to a target sequence that is adjacent to a PAM that is recognizable by an effector protein described herein.
[0304] In some embodiments, a spacer sequence comprises at least 5 to about 50 contiguous nucleotides that are complementary to a target sequence in a target nucleic acid. In some embodiments, a spacer sequence comprises at least 5 to about 50 linked nucleotides. In some embodiments, a spacer sequence comprises at least 5 to about 50, at least 5 to about 25, at least about 10 to at least about 25, or at least about 15 to about 25 linked nucleotides. In some embodiments, the spacer sequence comprises 15-28 linked nucleotides. In some embodiments, a spacer sequence comprises 15-26, 15-24, 15-22, 15-20, 15-18, 16-28, 16-26, 16-24, 16-22, 16-20, 16-18, 17-26, 17-24, 17-22, 17-20, 17-18, 18-26, 18-24, or 18-22 linked nucleotides. In some embodiments, the spacer sequence comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides. In some cases, the spacer sequence is 18-24 linked nucleosides in length. In some cases, the spacer sequence is at least 15 linked nucleosides in length. In some cases, the spacer sequence is at least 16, 18, 20, or 22 linked nucleosides in length. In some cases, the spacer sequence is at least 17 linked nucleosides in length. In some cases, the spacer sequence is at least 18 linked nucleosides in length. In some cases, the spacer sequence is at least 20 linked nucleosides in length. In some cases, the spacer sequence is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to a target sequence of the target nucleic acid. In some cases, the spacer sequence is 100% complementary to the target sequence of the target nucleic acid. In some cases, the spacer sequence comprises at least 15 contiguous nucleobases that are complementary to the target nucleic acid.
[0305] In some embodiments, a spacer sequence is adjacent to a repeat sequence. In some embodiments, a spacer sequence follows a repeat sequence in a 5 to 3 direction. In some embodiments, a spacer sequence precedes a repeat sequence in a 5 to 3 direction. In some embodiments, the spacer sequence(s) and the repeat sequence(s) of the guide nucleic acid are present within the same molecule. In some embodiments, the spacer(s) and repeat sequence(s) are linked directly to one another. In some embodiments, a linker is present between the spacer(s) and repeat sequences. Linkers may be any suitable linker. In some embodiments, the spacer sequence(s) and the repeat sequence(s) of the guide nucleic acid are present in separate molecules, which are joined to one another by base pairing interactions.
[0306] It is understood that the sequence of a spacer sequence need not be 100% complementary to that of a target sequence of a target nucleic acid to hybridize or hybridize specifically to the target sequence. The guide nucleic acid may comprise at least one uracil between nucleic acid residues 5 to 20 of the spacer sequence that is not complementary to the corresponding nucleoside of the target sequence. The guide nucleic acid may comprise at least one uracil between nucleic acid residues 5 to 9, 10 to 14, or 15 to 20 of the spacer sequence that is not complementary to the corresponding nucleoside of the target sequence. In some cases, the region of the target nucleic acid that is complementary to the spacer sequence comprises an epigenetic modification or a post-transcriptional modification. In some cases, the epigenetic modification comprises acetylation, methylation, or thiol modification.
[0307] In some embodiments, a spacer sequence comprises a nucleotide sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to a target sequence of a target nucleic acid. A spacer sequence is capable of hybridizing to an equal length portion of a target nucleic acid (e.g., a target sequence). In some embodiments, a target nucleic acid, such as DNA or RNA, may be a cancer gene or gene associated with a genetic disorder, or an amplicon thereof, as described herein. In some embodiments, a target nucleic acid is a gene selected from TABLE 3. In some embodiments, a spacer sequence comprises a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to a target sequence of a gene selected from TABLE 3. In some embodiments, a target nucleic acid is a nucleic acid associated with a disease or syndrome set forth in TABLE 4. In some embodiments, a spacer sequence comprises a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to a target sequence of a target nucleic acid associated with a disease or syndrome set forth in TABLE 4. In some embodiments, the spacer sequence comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides that are capable of hybridizing to the target sequence. In some embodiments, the spacer sequence comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides that are complementary to the target sequence.
[0308] It is understood that the spacer sequence of a spacer sequence need not be 100% complementary to that of a target sequence of a target nucleic acid to hybridize or hybridize specifically to the target sequence. For example, the spacer sequence may comprise at least one alteration, such as a substituted or modified nucleotide, that is not complementary to the corresponding nucleotide of the target sequence.
Linker for Nucleic Acids
[0309] In some embodiments, a guide nucleic acid for use with compositions, systems, and methods described herein comprises one or more linkers, or a nucleic acid encoding one or more linkers. In some embodiments, the guide nucleic acid comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten linkers. In some embodiments, the guide nucleic acid comprises one, two, three, four, five, six, seven, eight, nine, or ten linkers. In some embodiments, the guide nucleic acid comprises more than one linker. In some embodiments, at least two of the more than one linker are the same. In some embodiments, at least two of the more than one linker are not same.
[0310] In some embodiments, a linker comprises one to ten, one to seven, one to five, one to three, two to ten, two to eight, two to six, two to four, three to ten, three to seven, three to five, four to ten, four to eight, four to six, five to ten, five to seven, six to ten, six to eight, seven to ten, or eight to ten linked nucleotides. In some embodiments, the linker comprises one, two, three, four, five, six, seven, eight, nine, or ten linked nucleotides. In some embodiments, a linker comprises a nucleotide sequence of 5-GAAA-3.
[0311] In some embodiments, a guide nucleic acid comprises one or more linkers connecting one or more repeat sequences. In some embodiments, the guide nucleic acid comprises one or more linkers connecting one or more repeat sequences and one or more spacer sequences. In some embodiments, the guide nucleic acid comprises at least two repeat sequences connected by a linker.
tracrRNA
[0312] In some embodiments, the guide RNA comprises a tracrRNA. The tracrRNA may be linked to a crRNA to form a composite gRNA. In some cases, the crRNA and the tracrRNA are provided as a single nucleic acid (e.g., covalently linked). In some embodiments, compositions comprise a tracrRNA that is separate from, but forms a complex with a crRNA to form a gRNA system. In some embodiments, the crRNA and the tracrRNA are separate polynucleotides.
[0313] In general, a tracrRNA comprises a nucleotide sequence that is bound by an effector protein. A tracrRNA may comprise at least one secondary structure (e.g., hairpin loop) that facilitates the binding of an effector protein. A tracrRNA may include a repeat hybridization sequence and a hairpin region. The term repeat hybridization sequence refers to a sequence of nucleotides of a tracrRNA that is capable of hybridizing to a repeat sequence of a guide nucleic acid. The repeat hybridization sequence may hybridize to all or part of the repeat sequence of a crRNA. The repeat hybridization sequence may be positioned 3 of the hairpin region. The repeat hybridization sequence may be positioned 5 of the hairpin region. The hairpin region may include a first sequence, a second sequence that is reverse complementary to the first sequence, and a stem-loop linking the first sequence and the second sequence.
[0314] In some embodiments, tracrRNAs comprise a stem-loop structure comprising a stem region and a loop region. In some cases, the stem region is 4 to 8 linked nucleosides in length. In some cases, the stem region is 5 to 6 linked nucleosides in length. In some cases, the stem region is 4 to 5 linked nucleosides in length. In some cases, the tracrRNA comprises a pseudoknot (e.g., a secondary structure comprising a stem at least partially hybridized to a second stem or half-stem secondary structure). An effector protein may recognize a tracrRNA comprising multiple stem regions. In some embodiments, the amino acid sequences of the multiple stem regions are identical to one another. In some embodiments, the amino acid sequences of at least one of the multiple stem regions is not identical to those of the others. In some cases, the tracrRNA comprises at least 2, at least 3, at least 4, or at least 5 stem regions. In some embodiments, the length of a tracrRNA is about 50 to about 105, about 50 to about 95, about 50 to about 73, about 50 to about 71, about 50 to about 68, or about 50 to about 56 linked nucleosides. In some embodiments, the length of a tracrRNA is 56 to 105 linked nucleosides, from 56 to 105 linked nucleosides, 68 to 105 linked nucleosides, 71 to 105 linked nucleosides, 73 to 105 linked nucleosides, or 95 to 105 linked nucleosides. In some embodiments, the length of a tracrRNA is 40 to 60 nucleotides. In some embodiments, the length of a tracrRNA is 50, 56, 68, 71, 73, 95, or 105 linked nucleosides. In some embodiments, the length of a tracrRNA is 50 nucleotides.
[0315] An exemplary tracrRNA may comprise, from 5 to 3, a 5 region, a hairpin region, a repeat hybridization sequence, and a 3 region. In some cases, the 5 region may hybridize to the 3 region. In some embodiments, the 5 region does not hybridize to the 3 region. In some cases, the 3 region is covalently linked to the crRNA (e.g., through a phosphodiester bond). In some embodiments, a tracrRNA may comprise an unhybridized region at the 3 end of the tracrRNA. The unhybridized region may have a length of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, or about 20 linked nucleosides. In some embodiments, the length of the un-hybridized region is 0 to 20 linked nucleosides.
A Single Nucleic Acid System
[0316] In some embodiments, compositions, systems and methods described herein comprise a single nucleic acid system comprising a guide nucleic acid or a nucleotide sequence encoding the guide nucleic acid, and one or more effector proteins or a nucleotide sequence encoding the one or more effector proteins. The term, single nucleic acid system, as used herein, refers to a system that uses a guide nucleic acid complexed with one or more polypeptides described herein, wherein the complex is capable of interacting with a target nucleic acid in a sequence specific manner, and wherein the guide nucleic acid is capable of non-covalently interacting with the one or more polypeptides described herein, and wherein the guide nucleic acid is capable of hybridizing with a target sequence of the target nucleic acid. A single nucleic acid system lacks a duplex of a guide nucleic acid as hybridized to a second nucleic acid, wherein in such a duplex the second nucleic acid, and not the guide nucleic acid, is capable of interacting with the effector protein. In some embodiments, a first region (FR) of the guide nucleic acid non-covalently interacts with the one or more polypeptides described herein. In some embodiments, a second region (SR) of the guide nucleic acid hybridizes with a target sequence of the target nucleic acid. In the single nucleic acid system having a complex of the guide nucleic acid and the effector protein, the effector protein is not transactivated by the guide nucleic acid. In other words, activity of effector protein does not require binding to a second non-target nucleic acid molecule. An exemplary guide nucleic acid for a single nucleic acid system is a crRNA or a sgRNA.
crRNA
[0317] Guide nucleic acids and portions thereof may be found in or identified from a CRISPR array present in the genome of a host organism. A crRNA may be the product of processing of a longer precursor CRISPR RNA (pre-crRNA) transcribed from the CRISPR array by cleavage of the pre-crRNA within each direct repeat sequence to afford shorter, mature crRNAs. A crRNA may be generated by a variety of mechanisms, including the use of dedicated endonucleases (e.g., Cas6 or Cas5d in Type I and III systems), coupling of a host endonuclease (e.g., RNase III) with tracrRNA (Type II systems), or a ribonuclease activity endogenous to the effector protein itself (e.g., Cpf1 from Type V systems). A crRNA may also be specifically generated outside of processing of a pre-crRNA and individually contacted to an effector protein in vivo or in vitro.
[0318] In general, a crRNA comprises a spacer sequence that hybridizes to a target sequence of a target nucleic acid, and a repeat sequence that interacts with a tracrRNA or an effector protein. Typically, the repeat sequence is adjacent to the spacer sequence. For example, a guide RNA that interacts with an effector protein comprises a repeat sequence that is 5 of the spacer sequence.
[0319] In some embodiments, a guide nucleic acid comprises a crRNA. In some embodiments, the guide nucleic acid is the crRNA. In general, a crRNA comprises a first region (FR) and a second region (SR), wherein the FR of the crRNA comprises a repeat sequence, and the SR of the crRNA comprises a spacer sequence. In some embodiments, the repeat sequence and the spacer sequences are directly connected to each other (e.g., covalent bond (phosphodiester bond)). In some embodiments, the repeat sequence and the spacer sequence are connected by a linker.
[0320] In some embodiments, a crRNA is useful as a single nucleic acid system for compositions, methods, and systems described herein or as part of a single nucleic acid system for compositions, methods, and systems described herein. In some embodiments, a crRNA is useful as part of a single nucleic acid system for compositions, methods, and systems described herein. In such embodiments, a single nucleic acid system comprises a guide nucleic acid comprising a crRNA wherein, a repeat sequence of a crRNA is capable of connecting a crRNA to an effector protein. In some embodiments, a single nucleic acid system comprises a guide nucleic acid comprising a crRNA linked to another nucleotide sequence that is capable of being non-covalently bond by an effector protein.
[0321] A crRNA may include deoxyribonucleosides, ribonucleosides, chemically modified nucleosides, or any combination thereof. In some embodiments, a crRNA comprises about: 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 linked nucleotides. In some embodiments, a crRNA comprises at least: 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 linked nucleotides. In some embodiments, the length of the crRNA is about 20 to about 120 linked nucleotides. In some embodiments, the length of a crRNA is about 20 to about 100, about 30 to about 100, about 40 to about 100, about 40 to about 90, about 40 to about 80, about 40 to about 70, about 40 to about 60, about 40 to about 50, about 50 to about 90, about 50 to about 80, about 50 to about 70, or about 50 to about 60 linked nucleotides. In some embodiments, the length of a crRNA is about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70 or about 75 linked nucleotides.
[0322] In some cases, an effector protein cleaves a precursor RNA (pre-crRNA) to produce a guide RNA, also referred to as a mature guide RNA. An effector protein that cleaves pre-crRNA to produce a mature guide RNA is said to have pre-crRNA processing activity. In some cases, a repeat sequence of a guide RNA comprises mutations or truncations relative to respective regions in a corresponding pre-crRNA.
sgRNA
[0323] In some embodiments, a guide nucleic acid comprises a sgRNA. The terms single guide nucleic acid, single guide RNA and sgRNA, as used herein, in the context of a single nucleic acid system, refers to a guide nucleic acid, wherein the guide nucleic acid is a single polynucleotide chain having all the required sequence for a functional complex with an effector protein (e.g., being bound by an effector protein, including in some instances activating the effector protein, and hybridizing to a target nucleic acid, without the need for a second nucleic acid molecule). For example, an sgRNA can have two or more linked guide nucleic acid components
[0324] In some embodiments, a sgRNA comprises one or more of one or more of a crRNA, a repeat sequence, a spacer sequence, a linker, or combinations thereof. In some embodiments, a repeat sequence is 5 to a spacer sequence in an sgRNA. In some embodiments, a sgRNA comprises a linked repeat sequence and spacer sequence. In some embodiments, a repeat sequence and a spacer sequence are linked in an sgRNA directly (e.g., covalently linked, such as through a phosphodiester bond) In some embodiments, a repeat sequence and a spacer sequence are linked in an sgRNA by any suitable linker, examples of which are provided herein.
A Dual Nucleic Acid System
[0325] In some embodiments, compositions, systems and methods described herein comprise a dual nucleic acid system comprising a crRNA or a nucleotide sequence encoding the crRNA, a tracrRNA or a nucleotide sequence encoding the tracrRNA, and one or more effector protein or a nucleotide sequence encoding the one or more effector protein, wherein the crRNA and the tracrRNA are separate, unlinked molecules, wherein a repeat hybridization region of the tracrRNA is capable of hybridizing with an equal length portion of the crRNA to form a tracrRNA-crRNA duplex, wherein the equal length portion of the crRNA does not include a spacer sequence of the crRNA, and wherein the spacer sequence is capable of hybridizing to a target sequence of the target nucleic acid. In the dual nucleic acid system having a complex of the guide nucleic acid, tracrRNA, and the effector protein, the effector protein is transactivated by the tracrRNA. In other words, activity of effector protein requires binding to a tracrRNA molecule.
[0326] The terms, transactivating, trans-activating, trans-activated, transactivated and grammatical equivalents thereof, as used herein, in the context of a dual nucleic acid system refers to an outcome of the system, wherein a polypeptide is enabled to have a binding and/or nuclease activity on a target nucleic acid, by a tracrRNA or a tracrRNA-crRNA duplex.
[0327] In some embodiments, a repeat hybridization sequence is at the 3 end of a tracrRNA. In some embodiments, a repeat hybridization sequence may have a length of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, or about 20 linked nucleotides. In some embodiments, the length of the repeat hybridization sequence is 1 to 20 linked nucleotides.
[0328] A tracrRNA and/or tracrRNA-crRNA duplex may form a secondary structure that facilitates the binding of an effector protein to a tracrRNA or a tracrRNA-crRNA. In some embodiments, the secondary structure modifies activity of the effector protein on a target nucleic acid. In some embodiments, the secondary structure comprises a stem-loop structure comprising a stem region and a loop region. In some embodiments, the stem region is 4 to 8 linked nucleotides in length. In some embodiments, the stem region is 5 to 6 linked nucleotides in length. In some embodiments, the stem region is 4 to 5 linked nucleotides in length. In some embodiments, the secondary structure comprises a pseudoknot (e.g., a secondary structure comprising a stem at least partially hybridized to a second stem or half-stem secondary structure). An effector protein may recognize a secondary structure comprising multiple stem regions. In some embodiments, nucleotide sequences of the multiple stem regions are identical to one another. In some embodiments, the nucleotide sequences of at least one of the multiple stem regions is not identical to those of the others. In some embodiments, the secondary structure comprises at least two, at least three, at least four, or at least five stem regions. In some embodiments, the secondary structure comprises one or more loops. In some embodiments, the secondary structure comprises at least one, at least two, at least three, at least four, or at least five loops.
VI. Engineered Modifications
[0329] Polypeptides (e.g., effector proteins) and nucleic acids (e.g., engineered guide nucleic acids) can be further modified as described herein. Examples are modifications that do not alter the primary sequence of the polypeptides or nucleic acids, such as chemical derivatization of polypeptides (e.g., acylation, acetylation, carboxylation, amidation, etc.), or modifications that do alter the primary sequence of the polypeptide or nucleic acid. Also included are polypeptides that have a modified glycosylation pattern (e.g., those made by: modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; by exposing the polypeptide to enzymes which affect glycosylation, such as mammalian glycosylating or deglycosylating enzymes). Also embraced are polypeptides that have phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, or phosphothreonine).
[0330] The term engineered modification as used herein, refers to a structural change of one or more nucleic acid residues of a nucleotide sequence or one or more amino acid residue of an amino acid sequence, such as chemical modification of one or more nucleobases; or a chemical change to the phosphate backbone, a nucleotide, a nucleobase, or a nucleoside. Such modifications can be made to an effector protein amino acid sequence or guide nucleic acid nucleotide sequence, or any sequence disclosed herein (e.g., a nucleic acid encoding an effector protein or a nucleic acid that encodes a guide nucleic acid). Methods of modifying a nucleic acid or amino acid sequence are known. One of ordinary skill in the art will appreciate that the engineered modification(s) may be located at any position(s) of a nucleic acid such that the function of the nucleic acid, protein, composition or system is not substantially decreased. Nucleic acids provided herein can be prepared according to any available technique including, but not limited to chemical synthesis, enzymatic synthesis, which is generally termed in vitro-transcription, cloning, enzymatic, or chemical cleavage, etc. In some instances, the nucleic acids provided herein are not uniformly modified along the entire length of the molecule. Different nucleotide modifications and/or backbone structures can exist at various positions within the nucleic acid.
[0331] Modifications disclosed herein can also include modification of described polypeptides and/or guide nucleic acids through any suitable method, such as molecular biological techniques and/or synthetic chemistry, to improve their resistance to proteolytic degradation, to change the target sequence specificity, to optimize solubility properties, to alter protein activity (e.g., transcription modulatory activity, enzymatic activity, etc.) or to render them more suitable for their intended purpose (e.g., in vivo administration, in vitro methods, or ex vivo applications). Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g. D-amino acids or non-naturally occurring synthetic amino acids. D-amino acids may be substituted for some or all of the amino acid residues. Modifications can also include modifications with non-naturally occurring unnatural amino acids. The particular sequence and the manner of preparation will be determined by convenience, economics, purity required, and the like.
[0332] Modifications can further include the introduction of various groups to polypeptides and/or guide nucleic acids described herein. For example, groups can be introduced during synthesis or during expression of a polypeptide (e.g., an effector protein), which allow for linking to other molecules or to a surface. Thus, e.g., cysteines may be used to make thioethers, histidines for linking to a metal ion complex, carboxyl groups for forming amides or esters, amino groups for forming amides, and the like.
[0333] Modifications can further include changing of nucleic acids described herein (e.g., engineered guide nucleic acids) to provide the nucleic acid with a new or enhanced feature, such as improved stability. Such modifications of a nucleic acid include a base editing, a base modification, a backbone modification, a sugar modification, or combinations thereof. In some embodiments, the modifications can be of one or more nucleotides, nucleosides, or nucleobases in a nucleic acid.
[0334] In some embodiments, nucleic acids (e.g., nucleic acids encoding effector proteins, engineered guide nucleic acids, or nucleic acids encoding engineered guide nucleic acids) described herein comprise one or more modifications comprising: 2O-methyl modified nucleotides, 2 fluoro modified nucleotides; locked nucleic acid (LNA) modified nucleotides; peptide nucleic acid (PNA) modified nucleotides; nucleotides with phosphorothioate linkages; a 5 cap (e.g., a 7-methylguanylate cap (m7G)), phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3-alkylene phosphonates, 5-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3-amino phosphoramidate and aminoalkyl phosphoramidates, phosphorodiamidates, thionophosphor amidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3-5 linkages, 2-5 linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3 to 3, 5 to 5 or 2 to 2 linkage; phosphorothioate and/or heteroatom internucleoside linkages, such as CH.sub.2NHOCH.sub.2, CH.sub.2N(CH.sub.3)OCH.sub.2 (known as a methylene (methylimino) or MMI backbone), CH.sub.2ON(CH.sub.3)CH.sub.2, CH.sub.2N(CH.sub.3)N(CH.sub.3)CH.sub.2 and ON(CH.sub.3)CH.sub.2CH.sub.2 (wherein the native phosphodiester internucleotide linkage is represented as OP(?O)(OH)OCH.sub.2); morpholino linkages (formed in part from the sugar portion of a nucleoside); morpholino backbones; phosphorodiamidate or other non-phosphodiester internucleoside linkages; siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; other backbone modifications having mixed N, O, S and CH.sub.2 component parts; and combinations thereof.
VII. Vectors and Multiplexed Expression Vectors
[0335] Compositions, systems, and methods described herein comprise a vector or a use thereof. A vector can comprise a nucleic acid of interest. In some embodiments, the nucleic acid of interest comprises one or more components of a composition or system described herein. In some embodiments, the nucleic acid of interest comprises a nucleotide sequence that encodes one or more components of the composition or system described herein. In some embodiments, one or more components comprises a polypeptide(s), guide nucleic acid(s), target nucleic acid(s), and donor nucleic acid(s). In some embodiments, the component comprises a nucleic acid encoding an effector protein, a donor nucleic acid, and a guide nucleic acid or a nucleic acid encoding the guide nucleic acid. The vector may be part of a vector system, wherein a vector system comprises a library of vectors each encoding one or more component of a composition or system described herein. In some embodiments, components described herein (e.g., an effector protein, a guide nucleic acid, and/or a target nucleic acid) are encoded by the same vector. In some embodiments, components described herein (e.g., an effector protein, a guide nucleic acid, and/or a target nucleic acid) are each encoded by different vectors of the system.
[0336] In some embodiments, a vector comprises a nucleotide sequence encoding one or more effector proteins as described herein. In some embodiments, the one or more effector proteins comprise at least two effector proteins. In some embodiments, the at least two effector protein are the same. In some embodiments, the at least two effector proteins are different from each other. In some embodiments, the nucleotide sequence is operably linked to a promoter that is operable in a target cell, such as a eukaryotic cell. In some embodiments, the vector comprises the nucleotide sequence encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more effector proteins.
[0337] The terms promoter and promoter sequence refer to a DNA regulatory region capable of binding RNA polymerase and initiating transcription of a downstream (3 direction) coding or non-coding sequence. A transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase, can also be found in a promoter region. Eukaryotic promoters will often, but not always, contain TATA boxes and CAT boxes. Various promoters, including inducible promoters, may be used to drive expression by the various vectors of the present disclosure.
[0338] In some examples, the delivery vector may be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector) a viral vector, or any combination thereof. In some embodiments, the delivery vehicle may be a non-viral vector. In some embodiments, the delivery vehicle may be a plasmid. In some embodiments, the plasmid comprises DNA. In some embodiments, the plasmid comprises RNA. In some examples, the plasmid comprises circular double-stranded DNA. In some examples, the plasmid may be linear. In some examples, the plasmid comprises one or more genes of interest and one or more regulatory elements. The term regulatory element refers to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and/or regulate transcription of a non-coding sequence (e.g., a guide nucleic acid) or a coding sequence (e.g., effector proteins, fusion proteins, and the like) and/or regulate translation of an encoded polypeptide.
[0339] In some examples, the plasmid comprises a bacterial backbone containing an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the plasmid may be a minicircle plasmid. In some examples, the plasmid contains one or more genes that provide a selective marker to induce a target cell to retain the plasmid. In some examples, the plasmid may be formulated for delivery through injection by a needle carrying syringe. In some examples, the plasmid may be formulated for delivery via electroporation. In some examples, the plasmids may be engineered through synthetic or other suitable means known in the art. For example, in some cases, the genetic elements may be assembled by restriction digest of the desired genetic sequence from a donor plasmid or organism to produce ends of the DNA which may then be readily ligated to another genetic sequence. In some embodiments, the vector is a non-viral vector, and a physical method or a chemical method is employed for delivery into the somatic cell.
[0340] In some embodiments, a vector may encode one or more of any system components, including but not limited to effector proteins, guide nucleic acids, donor nucleic acids, and target nucleic acids as described herein. In some embodiments, a system component encoding sequence is operably linked to a promoter that is operable in a target cell, such as a eukaryotic cell. In some embodiments, a vector may encode 1, 2, 3, 4 or more of any system components. For example, a vector may encode two or more guide nucleic acids, wherein each guide nucleic acid comprises a different sequence. A vector may encode an effector protein and a guide nucleic acid. A vector may encode an effector protein, a guide nucleic acid, and a donor nucleic acid.
[0341] In some embodiments, a vector comprises one or more guide nucleic acids, or a nucleotide sequence encoding the one or more guide nucleic acids as described herein. In some embodiments, the one or more guide nucleic acids comprise at least two guide nucleic acids. In some embodiments, the at least two guide nucleic acids are the same. In some embodiments, the at least two guide nucleic acids are different from each other. In some embodiments, the guide nucleic acid or the nucleotide sequence encoding the guide nucleic acid is operably linked to a promoter that is operable in a target cell, such as a eukaryotic cell. In some embodiments, the vector comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more guide nucleic acids. In some embodiments, the vector comprises a nucleotide sequence encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more guide nucleic acids.
[0342] In some embodiments, a vector comprises one or more donor nucleic acids as described herein. In some embodiments, the one or more donor nucleic acids comprise at least two donor nucleic acids. In some embodiments, the at least two donor nucleic acids are the same. In some embodiments, the at least two donor nucleic acids are different from each other. In some embodiments, the vector comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more donor nucleic acids.
[0343] In some embodiments, a vector may comprise or encode one or more regulatory elements. Regulatory elements may refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and/or regulate transcription of a non-coding sequence or a coding sequence and/or regulate translation of an encoded polypeptide. In some embodiments, a vector may comprise or encode for one or more additional elements, such as, for example, replication origins, antibiotic resistance (or a nucleic acid encoding the same), a tag (or a nucleic acid encoding the same), selectable markers, and the like. In some embodiments, a vector comprises or encodes for one or more elements, such as, for example, ribosome binding sites, and RNA splice sites.
[0344] Vectors described herein can encode a promotera regulatory region on a nucleic acid, such as a DNA sequence, capable of initiating transcription of a downstream (3 direction) coding or non-coding sequence. A promoter can be linked at its 3 terminus to a nucleic acid, the expression or transcription of which is desired, and extends upstream (5 direction) to include bases or elements necessary to initiate transcription or induce expression, which could be measured at a detectable level. A promoter can comprise a nucleotide sequence, referred to herein as a promoter sequence. The promoter sequence can include a transcription initiation site, and one or more protein binding domains responsible for the binding of transcription machinery, such as RNA polymerase. When eukaryotic promoters are used, such promoters can contain TATA boxes and CAT boxes. Various promoters, including inducible promoters, may be used to drive expression, i.e., transcriptional activation, of the nucleic acid of interest. Accordingly, in some embodiments, the nucleic acid of interest can be operably linked to a promoter.
[0345] Promotors may be any suitable type of promoter envisioned for the compositions, systems, and methods described herein. Examples include constitutively active promoters (e.g., CMV promoter), inducible promoters (e.g., heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.), spatially restricted and/or temporally restricted promoters (e.g., a tissue specific promoter, a cell type specific promoter, etc.), etc. Suitable promoters include, but are not limited to: SV40 early promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter; adenovirus major late promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, a human U6 small nuclear promoter (U6), an enhanced U6 promoter, and a human H1 promoter (H1). By transcriptional activation, it is intended that transcription will be increased above basal levels in the target cell by 2 fold, 5 fold, 10 fold, 50 fold, by 100 fold, 500 fold, or by 1000 fold, or more. In addition, vectors used for providing a nucleic acid that, when transcribed, produces a guide nucleic acid and/or a nucleic acid that encodes an effector protein to a cell may include nucleic acid sequences that encode for selectable markers in the target cells, so as to identify cells that have taken up the guide nucleic acid and/or the effector protein.
[0346] In general, vectors provided herein comprise at least one promotor or a combination of promoters driving expression or transcription of one or more genome editing tools described herein. In some embodiments, the vector comprises a nucleotide sequence of a promoter. In some embodiments, the vector comprises two promoters. In some embodiments, the vector comprises three promoters. In some embodiments, a length of the promoter is less than about 500, less than about 400, less than about 300, or less than about 200 linked nucleotides. In some embodiments, a length of the promoter is at least 100, at least 200, at least 300, at least 400, or at least 500 linked nucleotides. Non-limiting examples of promoters include CMV, 7SK, EF1a, RPBSA, hPGK, EFS, SV40, PGK1, Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKIIa, GAL1-10, H1, TEF1, GDS, ADH1, CaMV35S, HSV TK, Ubi, U6, MNDU3, MSCV, MND, and CAG.
[0347] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the inducible promoter only drives expression of its corresponding coding sequence (e.g., polypeptide or guide nucleic acid) when a signal is present, e.g., a hormone, a small molecule, a peptide. Non-limiting examples of inducible promoters are the T7 RNA polymerase promoter, the T3 RNA polymerase promoter, the Isopropyl-beta-D-thiogalactopyranoside (IPTG)-regulated promoter, a lactose induced promoter, a heat shock promoter, a tetracycline-regulated promoter (tetracycline-inducible or tetracycline-repressible), a steroid regulated promoter, a metal-regulated promoter, and an estrogen receptor-regulated promoter. In some embodiments, the promoter is an activation-inducible promoter, such as a CD69 promoter. In some embodiments, the promoter for expressing effector protein is a ubiquitous promoter. In some embodiments, the ubiquitous promoter comprises MND or CAG promoter sequence.
[0348] In some embodiments, the promoters are prokaryotic promoters (e.g., drive expression of a gene in a prokaryotic cell). In some embodiments, the promoters are eukaryotic promoters, (e.g., drive expression of a gene in a eukaryotic cell). In some embodiments, the promoter is EF1a. In some embodiments, the promoter is ubiquitin. In some embodiments, vectors are bicistronic or polycistronic vector (e.g., having or involving two or more loci responsible for generating a protein) having an internal ribosome entry site (IRES) is for translation initiation in a cap-independent manner.
[0349] In some embodiments, a vector described herein is a nucleic acid expression vector. In some embodiments, a vector described herein is a recombinant expression vector. In some embodiments, a vector described herein is a messenger RNA.
[0350] In some embodiments, a vector described herein is a delivery vector. In some embodiments, the delivery vector is a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector) a viral vector, or any combination thereof. In some embodiments, the delivery vehicle is a non-viral vector. In some embodiments, the delivery vector is a plasmid. In some embodiments, the plasmid comprises DNA. In some embodiments, the plasmid comprises RNA. In some embodiments, the plasmid comprises circular double-stranded DNA. In some embodiments, the plasmid is linear. In some embodiments, the plasmid comprises one or more coding sequences of interest and one or more regulatory elements. In some embodiments, the plasmid comprises a bacterial backbone containing an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some embodiments, the plasmid is a minicircle plasmid. In some embodiments, the plasmid contains one or more genes that provide a selective marker to induce a target cell to retain the plasmid. In some examples, the plasmids are engineered through synthetic or other suitable means known in the art. For example, in some embodiments, the genetic elements are assembled by restriction digest of the desired genetic sequence from a donor plasmid or organism to produce ends of the DNA which is then be readily ligated to another genetic sequence.
[0351] In some embodiments, vectors comprise an enhancer. Enhancers are nucleotide sequences that have the effect of enhancing promoter activity. In some embodiments, enhancers augment transcription regardless of the orientation of their sequence. In some embodiments, enhancers activate transcription from a distance of several kilo basepairs. Furthermore, enhancers are located optionally upstream or downstream of a gene region to be transcribed, and/or located within the gene, to activate the transcription. Exemplary enhancers include, but are not limited to, WPRE; CMV enhancers; the R-U5 segment in LTR of HTLV-I.
[0352] In some embodiments, a vector is administered as part of a method of nucleic acid detection, editing, and/or treatment as described herein. In some embodiments, a vector is administered in a single vehicle, such as a single expression vector. In some embodiments, at least two of the three components, a nucleic acid encoding one or more effector proteins, one or more donor nucleic acids, and one or more guide nucleic acids or a nucleic acid encoding the one or more guide nucleic acid, are provided in the single expression vector. In some embodiments, components, such as a guide nucleic acid and an effector protein, are encoded by the same vector. In some embodiments, an effector protein (or a nucleic acid encoding same) and/or an engineered guide nucleic acid (or a nucleic acid that, when transcribed, produces same) are not co-administered with donor nucleic acid in a single vehicle. In some embodiments, an effector protein (or a nucleic acid encoding same), an engineered guide nucleic acid (or a nucleic acid that, when transcribed, produces same), and/or donor nucleic acid are administered in one or more or two or more vehicles, such as one or more, or two or more expression vectors.
[0353] In some embodiments, a vector may be part of a vector system. In some embodiments, the vector system comprises a library of vectors each encoding one or more components of a composition or system described herein. In some embodiments, a vector system is administered as part of a method of nucleic acid detection, editing, and/or treatment as described herein, wherein at least two vectors are co-administered. In some embodiments, the at least two vectors comprise different components. In some embodiments, the at least two vectors comprise the same component having different sequences. In some embodiments, at least one of the three components, a nucleic acid encoding one or more effector proteins, one or more donor nucleic acids, and one or more guide nucleic acids or a nucleic acid encoding the one or more guide nucleic acids, or a variant thereof is provided in a different vector. In some embodiments, the nucleic acid encoding the effector protein, and a guide nucleic acid or a nucleic acid encoding the guide nucleic acid are provided in different vectors. In some embodiments, the donor nucleic acid is encoded by a different vector than the vector encoding the effector protein and the guide nucleic acid.
Lipid Particles and Non-viral Vectors
[0354] In some embodiments, compositions and systems provided herein comprise a lipid particle. In some embodiments, a lipid particle is a lipid nanoparticle (LNP). In some embodiments, a lipid or a lipid nanoparticle can encapsulate an expression vector as described herein. LNPs are a non-viral delivery system for delivery of the composition and/or system components described herein. LNPs are particularly effective for delivery of nucleic acids. Beneficial properties of LNP include ease of manufacture, low cytotoxicity and immunogenicity, high efficiency of nucleic acid encapsulation and cell transfection, multi-dosing capabilities and flexibility of design (Kulkarni et al., (2018) Nucleic Acid Therapeutics, 28(3): 146-157). In some embodiments, compositions and methods comprise a lipid, polymer, nanoparticle, or a combination thereof, or use thereof, to introduce one or more effector proteins, one or more guide nucleic acids, one or more donor nucleic acids, or any combinations thereof to a cell. Non-limiting examples of lipids and polymers are cationic polymers, cationic lipids, ionizable lipids, or bio-responsive polymers. In some embodiments, the ionizable lipids exploits chemical-physical properties of the endosomal environment (e.g., pH) offering improved delivery of nucleic acids. In some embodiments, the ionizable lipids are neutral at physiological pH. In some embodiments, the ionizable lipids are protonated under acidic pH. In some embodiments, the bio-responsive polymer exploits chemical-physical properties of the endosomal environment (e.g., pH) to preferentially release the genetic material in the intracellular space.
[0355] In some embodiments, a LNP comprises an outer shell and an inner core. In some embodiments, the outer shell comprises lipids. In some embodiments, the lipids comprise modified lipids. In some embodiments, the modified lipids comprise pegylated lipids. In some embodiments, the lipids comprise one or more of cationic lipids, anionic lipids, ionizable lipids, and non-ionic lipids. In some embodiments, the LNP comprises one or more of N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3), 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1-palmitoyl-2-oleoylsn-glycero-3-phosphoethanolamine (POPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), cholesterol (Chol), 1,2-dimyristoyl-sn-glycerol, and methoxypolyethylene glycol (DMG-PEChooo), derivatives, analogs, or variants thereof. In some embodiments, the LNP has a negative net overall charge prior to complexation with one or more of a guide nucleic acid, a nucleic acid encoding the one or more guide nucleic acid, a nucleic acid encoding the effector protein, and/or a donor nucleic acid. In some embodiments, the inner core is a hydrophobic core. In some embodiments, the one or more of a guide nucleic acid, the nucleic acid encoding the one or more guide nucleic acid, the nucleic acid encoding the effector protein, and/or the donor nucleic acid forms a complex with one or more of the cationic lipids and the ionizable lipids. In some embodiments, the nucleic acid encoding the effector protein or the nucleic acid encoding the guide nucleic acid is self-replicating.
[0356] In some embodiments, a LNP comprises one or more of cationic lipids, ionizable lipids, and modified versions thereof. In some embodiments, the ionizable lipid comprises TT3 or a derivative thereof. Accordingly, in some embodiments, the LNP comprises one or more of TT3 and pegylated TT3. The publication WO2016187531 is hereby incorporated by reference in its entirety, which describes representative LNP formulations in Table 2 and Table 3, and representative methods of delivering LNP formulations in Example 7.
[0357] In some embodiments, a LNP comprises a lipid composition targeting to a specific organ. In some embodiments, the lipid composition comprises lipids having a specific alkyl chain length that controls accumulation of the LNP in the specific organ (e.g., liver or spleen). In some embodiments, the lipid composition comprises a biomimetic lipid that controls accumulation of the LNP in the specific organ (e.g., brain). In some embodiments, the lipid composition comprises lipid derivatives (e.g., cholesterol derivatives) that controls accumulation of the LNP in a specific cell (e.g., liver endothelial cells, Kupffer cells, hepatocytes).
Delivery of Viral Vectors
[0358] In some embodiments, a vector described herein comprises a viral vector. In some embodiments, the viral vector comprises a nucleic acid to be delivered into a host cell by a recombinantly produced virus or viral particle. In some embodiments, the vector is an adeno-associated viral vector. There are a variety of viral vectors that are associated with various types of viruses, including but not limited to retroviruses (e.g., lentiviruses and ?-retroviruses), adenoviruses, arenaviruses, alphaviruses, adeno-associated viruses (AAVs), baculoviruses, vaccinia viruses, herpes simplex viruses and poxviruses. In some embodiments, the vector is an adeno-associated viral (AAV) vector. In some embodiments, the viral vector is a recombinant viral vector. In some embodiments, the vector is a retroviral vector. In some embodiments, the retroviral vector is a lentiviral vector. In some embodiments, the retroviral vector comprises gamma-retroviral vector. A viral vector provided herein may be derived from or based on any such virus. For example, in some embodiments, the gamma-retroviral vector is derived from a Moloney Murine Leukemia Virus (MoMLV, MMLV, MuLV, or MLV) or a Murine Stem cell Virus (MSCV) genome. In some embodiments, the lentiviral vector is derived from the human immunodeficiency virus (HIV) genome. In some embodiments, the viral vector is a chimeric viral vector. In some embodiments, the chimeric viral vector comprises viral portions from two or more viruses. In some embodiments, the viral vector corresponds to a virus of a specific serotype.
[0359] In some embodiments, a viral vector is an adeno-associated viral vector (AAV vector). In some embodiments, a viral particle that delivers a viral vector described herein is an AAV. In some embodiments, the AAV comprises any AAV known in the art. In some embodiments, the viral vector corresponds to a virus of a specific AAV serotype. In some embodiments, the AAV serotype is selected from an AAV1 serotype, an AAV2 serotype, AAV3 serotype, an AAV4 serotype, AAV5 serotype, an AAV6 serotype, AAV7 serotype, an AAV8 serotype, an AAV9 serotype, an AAV10 serotype, an AAV11 serotype, an AAV12 serotype, an AAV-rh10 serotype, and any combination, derivative, or variant thereof. In some embodiments, the AAV vector is a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof. scAAV genomes are generally known in the art and contain both DNA strands which can anneal together to form double-stranded DNA.
[0360] In some embodiments, an AAV vector described herein is a chimeric AAV vector. In some embodiments, the chimeric AAV vector comprises an exogenous amino acid or an amino acid substitution, or capsid proteins from two or more serotypes. In some examples, a chimeric AAV vector may be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.
[0361] In some embodiments, AAV vector described herein comprises two inverted terminal repeats (ITRs). According, in some embodiments, the viral vector provided herein comprises two inverted terminal repeats of AAV. A nucleotide sequence between the ITRs of an AAV vector provided herein comprises a sequence encoding genome editing tools. In some embodiments, the genome editing tools comprise a nucleic acid encoding one or more effector proteins, a nucleic acid encoding one or more fusion proteins (e.g., a nuclear localization signal (NLS), polyA tail), one or more guide nucleic acids, a nucleic acid encoding the one or more guide nucleic acids, respective promoter(s), one or more donor nucleic acid, or any combinations thereof. In some embodiments, viral vectors provided herein comprise at least one promotor or a combination of promoters driving expression or transcription of one or more genome editing tools described herein. In some embodiments, a coding region of the AAV vector forms an intramolecular double-stranded DNA template thereby generating the AAV vector that is a self-complementary AAV (scAAV) vector. In some embodiments, the scAAV vector comprises the sequence encoding genome editing tools that has a length of about 2 kb to about 3 kb. In some embodiments, the AAV vector provided herein is a self-inactivating AAV vector. In some embodiments, the AAV vector provided herein comprises a modification, such as an insertion, deletion, chemical alteration, or synthetic modification, relative to a wild-type AAV vector.
Producing AAV Delivery Vectors
[0362] In some embodiments, methods of producing AAV delivery vectors herein comprise packaging a nucleic acid encoding an effector protein and a guide nucleic acid, or a combination thereof, into an AAV vector. In some embodiments, methods of producing the delivery vector comprises, (a) contacting a cell with at least one nucleic acid encoding: (i) a guide nucleic acid; (ii) a Replication (Rep) gene; and (iii) a Capsid (Cap) gene that encodes an AAV capsid protein; (b) expressing the AAV capsid protein in the cell; (c) assembling an AAV particle; and (d) packaging an effector encoding nucleic acid into the AAV particle, thereby generating an AAV delivery vector. In some embodiments, promoters, stuffer sequences, and any combination thereof may be packaged in the AAV vector. In some examples, the AAV vector may package 1, 2, 3, 4, or 5 guide nucleic acids or copies thereof. In some embodiments, the AAV vector comprises inverted terminal repeats, e.g., a 5 inverted terminal repeat and a 3 inverted terminal repeat. In some embodiments, the AAV vector comprises a mutated inverted terminal repeat that lacks a terminal resolution site.
[0363] In some embodiments, a hybrid AAV vector is produced by transcapsidation, e.g., packaging an inverted terminal repeat (ITR) from a first serotype into a capsid of a second serotype, wherein the first and second serotypes may be not the same. In some examples, the Rep gene and ITR from a first AAV serotype (e.g., AAV2) may be used in a capsid from a second AAV serotype (e.g., AAV9), wherein the first and second AAV serotypes may be not the same. As a non-limiting example, a hybrid AAV serotype comprising the AAV2 ITRs and AAV9 capsid protein may be indicated AAV2/9. In some examples, the hybrid AAV delivery vector comprises an AAV2/1, AAV2/2, AAV 2/4, AAV2/5, AAV2/8, or AAV2/9 vector.
Producing AAV Particles
[0364] In some embodiments, AAV particles described herein are recombinant AAV (rAAV). In some embodiments, rAAV particles are generated by transfecting AAV producing cells with an AAV-containing plasmid carrying the sequence encoding the genome editing tools, a plasmid that carries viral encoding regions, i.e., Rep and Cap gene regions; and a plasmid that provides the helper genes such as E1A, E1B, E2A, E4ORF6 and VA. In some embodiments, the AAV producing cells are mammalian cells. In some embodiments, host cells for rAAV viral particle production are mammalian cells. In some embodiments, a mammalian cell for rAAV viral particle production is a COS cell, a HEK293T cell, a HeLa cell, a KB cell, a variant thereof, or a combination thereof. In some embodiments, rAAV virus particles can be produced in the mammalian cell culture system by providing the rAAV plasmid to the mammalian cell. In some embodiments, producing rAAV virus particles in a mammalian cell comprises transfecting vectors that express the rep protein, the capsid protein, and the gene-of-interest expression construct flanked by the ITR sequence on the 5 and 3 ends. Methods of such processes are provided in, for example, Naso et al., BioDrugs, 2017 August; 31(4):317-334 and Benskey et al., (2019), Methods Mol Biol., 1937:3-26, each of which is incorporated by reference in their entireties.
[0365] In some embodiments, rAAV is produced in a non-mammalian cell. In some embodiments, rAAV is produced in an insect cell. In some embodiments, the insect cell for producing rAAV viral particles comprises a Sf9 cell. In some embodiments, production of rAAV virus particles in insect cells may comprise baculovirus. In some embodiments, production of rAAV virus particles in insect cells may comprise infecting the insect cells with three recombinant baculoviruses, one carrying the cap gene, one carrying the rep gene, and one carrying the gene-of-interest expression construct enclosed by an ITR on both the 5 and 3 end. In some embodiments, rAAV virus particles are produced by the One Bac system. In some embodiments, rAAV virus particles can be produced by the Two Bac system. In some embodiments, in the Two Bac system, the rep gene and the cap gene of the AAV is integrated into one baculovirus virus genome, and the ITR sequence and the gene-of-interest expression construct is integrated into another baculovirus virus genome. In some embodiments, in the One Bac system, an insect cell line that expresses both the rep protein and the capsid protein is established and infected with a baculovirus virus integrated with the ITR sequence and the gene-of-interest expression construct. Details of such processes are provided in, for example, Smith et. al., (1983), Mol. Cell. Biol., 3(12):2156-65; Urabe et al., (2002), Hum. Gene. Ther., 1; 13(16):1935-43; and Benskey et al., (2019), Methods Mol Biol., 1937:3-26, each of which is incorporated by reference in its entirety.
VIII. Target Nucleic Acids
[0366] Disclosed herein are compositions, systems and methods for detecting and/or editing a target nucleic acid. In some embodiments, the target nucleic acid is a double stranded nucleic acid. In some embodiments, the target nucleic acid is a single stranded nucleic acid. Alternatively, or in combination, the target nucleic acid is a double stranded nucleic acid and is prepared into single stranded nucleic acids before or upon contacting an RNP. In some embodiments, the single stranded nucleic acid comprises a RNA, wherein the RNA comprises a mRNA, arRNA, a tRNA, a non-coding RNA, a long non-coding RNA, a microRNA (miRNA), and a single-stranded RNA (ssRNA). In some embodiments, the target nucleic acid is complementary DNA (cDNA) synthesized from a single-stranded RNA template in a reaction catalyzed by a reverse transcriptase. Exemplary chemical methods include delivery of the recombinant polynucleotide via liposomes such as, cationic lipids or neutral lipids; dendrimers; nanoparticles; or cell-penetrating peptides.
[0367] In some embodiments, the target nucleic acid is an mRNA. In some embodiments, the target nucleic acid is from a virus, a parasite, or a bacterium described herein.
[0368] In some embodiments, a target nucleic acid comprising a target sequence comprises a PAM sequence. In some embodiments, the PAM sequence is 3 to the target sequence. In some embodiments, the PAM sequence is directly 3 to the target sequence. In some embodiments, the PAM sequence 5 to the target sequence. In some embodiments, the PAM sequence is directly 5 to the target sequence. In some embodiments, the target nucleic acid as described in the methods herein does not initially comprise a PAM sequence. However, any target nucleic acid of interest may be generated using the methods described herein to comprise a PAM sequence, and thus be a PAM target nucleic acid. A PAM target nucleic acid, as used herein, refers to a target nucleic acid that has been amplified to insert a PAM sequence that is recognized by an effector protein system.
[0369] In some embodiments, a target nucleic acid comprises 5 to 100, 5 to 90, 5 to 80, 5 to 70, 5 to 60, 5 to 50, 5 to 40, 5 to 30, 5 to 25, 5 to 20, 5 to 15, or 5 to 10 linked nucleotides. In some embodiments, the target nucleic acid comprises 10 to 90, 20 to 80, 30 to 70, or 40 to 60 linked nucleotides. In some embodiments, the target nucleic acid comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 60, 70, 80, 90, or 100 linked nucleotides. In some embodiments, the target nucleic acid comprises at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 linked nucleotides.
[0370] In some embodiments, compositions, systems, and methods described herein comprise a target nucleic acid may be responsible for a disease, contain a mutation (e.g., single strand polymorphism, point mutation, insertion, or deletion), be contained in an amplicon, or be uniquely identifiable from the surrounding nucleic acids (e.g., contain a unique sequence of nucleotides). In some embodiments, the target nucleic acid has undergone a modification (e.g., an editing) after contacting with an RNP. In some embodiments, the editing is a change in the sequence of the target nucleic acid. In some embodiments, the change comprises an insertion, deletion, or substitution of one or more nucleotides compared to the target nucleic acid that has not undergone any modification.
[0371] Nucleic acids, such as DNA and pre-mRNA, described herein can contain at least one intron and at least one exon, wherein as read in the 5 to the 3 direction of a nucleic acid strand, the 3 end of an intron can be adjacent to the 5 end of an exon, and wherein said intron and exon correspond for transcription purposes. If a nucleic acid strand contains more than one intron and exon, the 5 end of the second intron is adjacent to the 3 end of the first exon, and 5 end of the second exon is adjacent to the 3 end of the second intron. The junction between an intron and an exon can be referred to herein as a splice junction, wherein a 5 splice site (SS) can refer to the +1/+2 position at the 5 end of intron and a 3SS can refer to the last two positions at the 3 end of an intron. Alternatively, a 5 SS can refer to the 5 end of an exon and a 3SS can refer to the 3 end of an exon. In some embodiments, nucleic acids can contain one or more elements that act as a signal during transcription, splicing, and/or translation. In some embodiments, signaling elements include a 5SS, a 3SS, a premature stop codon, U1 and/or U2 binding sequences, and cis acting elements such as branch site (BS), polypyridine tract (PYT), exonic and intronic splicing enhancers (ESEs and ISEs) or silencers (ESSs and ISSs). In some embodiments, nucleic acids may also comprise a untranslated region (UTR), such as a 5 UTR or a 3 UTR. In some embodiments, the start of an exon or intron is referred to interchangeably herein as the 5 end of an exon or intron, respectively. Likewise, in some embodiments, the end of an exon or intron is referred to interchangeably herein as the 3 end of an exon or intron, respectively.
[0372] In some embodiments, at least a portion of at least one target sequence is within about 1, about 5 or more, about 10 or more, about 15 or more, about 20 or more, about 25 or more, about 30 or more, about 35 or more, about 40 or more, about 45 or more, about 50 or more, about 55 or more, about 60 or more, about 65 or more, about 70 or more, about 75 or more, about 80 or more, about 85 or more, about 90 or more, about 95 or more, about 100 or more, about 105 or more, about 110 or more, about 115 or more, about 120 or more, about 125 or more, about 130 or more, about 135 or more, about 140 or more, about 145 or more, or about 150 to about 300 nucleotides adjacent to: the 5 end of an exon; the 3 end of an exon; the 5 end of an intron; the 3 end of an intron; one or more signaling element comprising a 5SS, a 3SS, a premature stop codon, U1 binding sequence, U2 binding sequence, a BS, a PYT, ESE, an ISE, an ESS, an ISS; a 5 UTR; a 3 UTR; more than one of the foregoing, or any combination thereof. In some embodiments, the target nucleic acid comprises a target locus. In some embodiments, the target nucleic acid comprises more than one target loci. In some embodiments, the target nucleic acid comprises two target loci. Accordingly, in some embodiments, the target nucleic acid can comprise one or more target sequences.
[0373] In some embodiments, compositions, systems, and methods described herein comprise an edited target nucleic acid which can describe a target nucleic acid wherein the target nucleic acid has undergone a change, for example, after contact with an effector protein. In some embodiments, the editing is an alteration in the sequence of the target nucleic acid. In some embodiments, the edited target nucleic acid comprises an insertion, deletion, or replacement of one or more nucleotides compared to the unedited target nucleic acid. In some embodiments, the editing is a mutation.
Mutations
[0374] In some embodiments, target nucleic acids described herein comprise a mutation. In some embodiments, a composition, system or method described herein can be used to edit a target nucleic acid comprising a mutation such that the mutation is edited to be the wild-type nucleotide or nucleotide sequence. In some embodiments, a composition, system or method described herein can be used to detect a target nucleic acid comprising a mutation. A mutation may result in the insertion of at least one amino acid in a protein encoded by the target nucleic acid. A mutation may result in the deletion of at least one amino acid in a protein encoded by the target nucleic acid. A mutation may result in the substitution of at least one amino acid in a protein encoded by the target nucleic acid. A mutation that results in the deletion, insertion, or substitution of one or more amino acids of a protein encoded by the target nucleic acid may result in misfolding of a protein encoded by the target nucleic acid. A mutation may result in a premature stop codon, thereby resulting in a truncation of the encoded protein.
[0375] Non-limiting examples of mutations are insertion-deletion (indel), a point mutation, single nucleotide polymorphism (SNP), a chromosomal mutation, a copy number mutation or variation, and frameshift mutations. In some embodiments, an indel mutation is an insertion or deletion of one or more nucleotides. The term, indel refers to an insertion-deletion or indel mutation, which is a type of genetic mutation that results from the insertion and/or deletion of one or more nucleotide in a target nucleic acid. An indel can vary in length (e.g., 1 to 1,000 nucleotides in length) and be detected by any suitable method, including sequencing. In some embodiments, a point mutation comprises a substitution, insertion, or deletion. In some embodiments, a frameshift mutation occurs when the number of nucleotides in the insertion/deletion is not divisible by three, and it occurs in a protein coding region. In some embodiments, a chromosomal mutation can comprise an inversion, a deletion, a duplication, or a translocation of one or more nucleotides. In some embodiments, a copy number variation can comprise a gene amplification or an expanding trinucleotide repeat. In some embodiments, an SNP is associated with a phenotype of the sample or a phenotype of the organism from which the sample was taken. In some embodiments, an SNP is associated with altered phenotype from wild type phenotype. In some embodiments, the SNP is a synonymous substitution or a nonsynonymous substitution. In some embodiments, the nonsynonymous substitution is a missense substitution or a nonsense point mutation. In some embodiments, the synonymous substitution is a silent substitution.
[0376] In some embodiments, a target nucleic acid described herein comprises a mutation of one or more nucleotides. In some embodiments, the one or more nucleotides comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. In some embodiments, the mutation comprises a deletion, insertion, and/or substitution of about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, or about 1000 nucleotides. In some embodiments, the mutation comprises a deletion, insertion, and/or substitution of 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 50 to 55, 55 to 60, 60 to 65, 65 to 70, 70 to 75, 75 to 80, 80 to 85, 85 to 90, 90 to 95, 95 to 100, 100 to 200, 200 to 300, 300 to 400, 400 to 500, 500 to 600, 600 to 700, 700 to 800, 800 to 900, 900 to 1000, 1 to 50, 1 to 100, 25 to 50, 25 to 100, 50 to 100, 100 to 500, 100 to 1000, or 500 to 1000 nucleotides. The mutation may be located in a non-coding region or a coding region of a gene, wherein the gene is a target nucleic acid. A mutation may be in an open reading frame of a target nucleic acid. In some embodiments, guide nucleic acids described herein hybridize to a portion of the target nucleic acid comprising or adjacent to the mutation.
[0377] In some embodiments, target nucleic acids comprise a mutation, wherein the mutation is a SNP. In some embodiments, the single nucleotide mutation or SNP is associated with a phenotype of the sample or a phenotype of the organism from which the sample was taken. In some embodiments, the SNP is associated with altered phenotype from wild type phenotype. In some embodiments, a single nucleotide mutation, SNP, or deletion described herein is associated with a disease, such as a genetic disease. In some embodiments, the SNP is a synonymous substitution or a nonsynonymous substitution. In some embodiments, the nonsynonymous substitution is a missense substitution or a nonsense point mutation. In some embodiments, the synonymous substitution is a silent substitution. In some embodiments, the mutation is a deletion of one or more nucleotides. In some embodiments, the single nucleotide mutation, SNP, or deletion is associated with a disease such as a genetic disorder. In some embodiments, the mutation, such as a single nucleotide mutation, a SNP, or a deletion, may be encoded in the sequence of a target nucleic acid from the germline of an organism or may be encoded in a target nucleic acid from a diseased cell.
[0378] In some embodiments, the mutation is associated with a disease, such as a genetic disorder. In some embodiments, the mutation may be encoded in the sequence of a target nucleic acid from the germline of an organism or may be encoded in a target nucleic acid from a diseased cell. In some embodiments, a target nucleic acid described herein comprises a mutation associated with a disease. In some examples, a mutation associated with a disease refers to a mutation whose presence in a subject indicates that the subject is susceptible to or suffers from, a disease, disorder, condition, or syndrome. In some examples, a mutation associated with a disease refers to a mutation which causes, contributes to the development of, or indicates the existence of the disease, disorder, condition, or syndrome. A mutation associated with a disease may also refer to any mutation which generates transcription or translation products at an abnormal level, or in an abnormal form, in cells affected by a disease relative to a control without the disease. In some examples, a mutation associated with a disease refers to a mutation whose presence in a subject indicates that the subject is susceptible to, or suffers from, a disease, disorder, or pathological state. In some embodiments, a mutation associated with a disease, comprises the co-occurrence of a mutation and the phenotype of a disease. The mutation may occur in a gene, wherein transcription or translation products from the gene occur at a significantly abnormal level or in an abnormal form in a cell or subject harboring the mutation as compared to a non-disease control subject not having the mutation. In some embodiments, a target nucleic acid described herein comprises a mutation associated with a disease, wherein the target nucleic acid is any one of the target nucleic acids set forth in TABLE 3. In some embodiments, a target nucleic acid described herein comprises a mutation associated with a disease, wherein the disease is any one of the diseases set forth in TABLE 4.
Detection and Identification of Target Nucleic Acid
[0379] In some embodiments, a target nucleic acid is in a cell. In some embodiments, the cell is a single-cell eukaryotic organism; a plant cell an algal cell; a fungal cell; an animal cell; a cell of an invertebrate animal; a cell of a vertebrate animal such as fish, amphibian, reptile, bird, and mammal; or a cell of a mammal such as a human, a non-human primate, an ungulate, a feline, a bovine, an ovine, and a caprine. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell, a human cell, or a plant cell. In some embodiments, the cell is a human cell. In some embodiments, the human cell is a: muscle cell, liver cell, lung cell, cardiac cell, visceral cell, cardiac muscle cell, smooth muscle cell, cardiomyocyte, nodal cardiac muscle cell, smooth muscle cell, visceral muscle cell, skeletal muscle cell, myocyte, red (or slow) skeletal muscle cell, white (fast) skeletal muscle cell, intermediate skeletal muscle, muscle satellite cell, muscle stem cell, myoblast, muscle progenitor cell, induced pluripotent stem cell (iPS), or a cell derived from an iPS cell, modified to have its gene edited and differentiated into myoblasts, muscle progenitor cells, muscle satellite cells, muscle stem cells, skeletal muscle cells, cardiac muscle cells or smooth muscle cells.
[0380] In some embodiments, an effector protein-guide nucleic acid complex may comprise high selectivity for a target sequence. In some embodiments, an RNP comprise a selectivity of at least 200:1, 100:1, 50:1, 20:1, 10:1, or 5:1 for a target nucleic acid over a single nucleotide variant of the target nucleic acid. In some embodiments, an RNP may comprise a selectivity of at least 5:1 for a target nucleic acid over a single nucleotide variant of the target nucleic acid.
[0381] By leveraging such effector protein selectivity, some methods described herein may detect a target nucleic acid present in the sample in various concentrations or amounts as a target nucleic acid population. In some embodiments, the method detects at least 2 target nucleic acid populations. In some embodiments, the method detects at least 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 target nucleic acid populations. In some embodiments, the method detects 3 to 50, 5 to 40, or 10 to 25 target nucleic acid populations. In some embodiments, the method detects at least 2 individual target nucleic acids. In some embodiments, the method detects at least 3, 5, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 individual target nucleic acids. In some embodiments, the method detects 1 to 10,000, 100 to 8000, 400 to 6000, 500 to 5000, 1000 to 4000, or 2000 to 3000 individual target nucleic acids. In some embodiments, the method detects target nucleic acid present at least at one copy per 10 non-target nucleic acids, 10.sup.2 non-target nucleic acids, 10.sup.3 non-target nucleic acids, 10.sup.4 non-target nucleic acids, 105 non-target nucleic acids, 10.sup.6 non-target nucleic acids, 10.sup.7 non-target nucleic acids, 10.sup.8 non-target nucleic acids, 10.sup.9 non-target nucleic acids, or 10.sup.10 non-target nucleic acids.
[0382] In some embodiments, compositions described herein exhibit indiscriminate trans-cleavage of ssRNA, enabling their use for detection of RNA in samples. In some embodiments, target ssRNA are generated from many nucleic acid templates (RNA) in order to achieve cleavage of the FQ reporter in the DETECTR platform. Certain effector proteins may be activated by ssRNA, upon which they may exhibit trans-cleavage of ssRNA and may, thereby, be used to cleave ssRNA FQ reporter molecules in the DETECTR system. These effector proteins may target ssRNA present in the sample or ssRNA generated and/or amplified from any number of nucleic acid templates (RNA). Described herein are reagents comprising a single stranded reporter nucleic acid comprising a detection moiety, wherein the reporter nucleic acid (e.g., the ssDNA-FQ reporter described above) is capable of being cleaved by the Effector protein, upon generation and amplification of ssRNA from a nucleic acid template using the methods disclosed herein, thereby generating a first detectable signal.
[0383] In some embodiments, a target nucleic acid is an amplified nucleic acid of interest. In some embodiments, the nucleic acid of interest is any nucleic acid disclosed herein or from any sample as disclosed herein. In some embodiments, the nucleic acid of interest is an RNA that is reverse transcribed before amplification. In some embodiments, the nucleic acid of interest is amplified then the amplicons is transcribed into RNA.
[0384] In some embodiments, target nucleic acids may activate an effector protein to initiate sequence-independent cleavage of a nucleic acid-based reporter (e.g., a reporter comprising an RNA sequence, or a reporter comprising DNA and RNA). For example, an effector protein of the present disclosure is activated by a target nucleic acid to cleave reporters having an RNA (also referred to herein as an RNA reporter). Alternatively, an effector protein of the present disclosure is activated by a target nucleic acid to cleave reporters having an RNA. Alternatively, an effector protein of the present disclosure is activated by a target RNA to cleave reporters having an RNA (also referred to herein as a RNA reporter). The RNA reporter may comprise a single-stranded RNA labelled with a detection moiety or may be any RNA reporter as disclosed herein.
[0385] Further description of editing or detecting a target nucleic acid in a gene of interest can be found in more detail in Kim et al., Enhancement of target specificity of CRISPR-Cas 12a by using a chimeric DNA-RNA guide, Nucleic Acids Res. 2020 Sep. 4; 48(15):8601-8616; Wang et al., Specificity profiling of CRISPR system reveals greatly enhanced off-target gene editing, Scientific Reports volume 10, Article number: 2269 (2020); Tuladhar et al., CRISPR-Cas9-based mutagenesis frequently provokes on-target mRNA misregulation, Nature Communications volume 10, Article number: 4056 (2019); Dong et al., Genome-Wide Off-Target Analysis in CRISPR-Cas9 Modified Mice and Their Offspring, G3, Volume 9, Issue 11, 1 Nov. 2019, Pages 3645-3651; Winter et al., Genome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus ?-hemolysin-mediated toxicity, Scientific Reports volume 6, Article number: 24242 (2016); and Ma et al., A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death, Cell Rep. 2015 Jul. 28; 12(4):673-83, which are hereby incorporated by reference in their entirety.
Certain Samples
[0386] Various sample types comprising a target nucleic acid of interest are consistent with the present disclosure. These samples may comprise a target nucleic acid for detection. In some embodiments, the detection of the target nucleic indicates an ailment, such as a disease, cancer, or genetic disorder, or genetic information, such as for phenotyping, genotyping, or determining ancestry and are compatible with the reagents and support mediums as described herein. Generally, a sample from an individual or an animal or an environmental sample may be obtained to test for presence of a disease, cancer, genetic disorder, or any mutation of interest.
[0387] In some embodiments, a sample comprises a target nucleic acid from 0.05% to 20% of total nucleic acids in the sample. In some embodiments, the target nucleic acid is 0.1% to 10% of the total nucleic acids in the sample. In some embodiments, the target nucleic acid is 0.1% to 5% of the total nucleic acids in the sample. In some embodiments, the target nucleic acid is 0.1% to 1% of the total nucleic acids in the sample. In some embodiments, the target nucleic acid is in any amount less than 100% of the total nucleic acids in the sample. In some embodiments, the target nucleic acid is 100% of the total nucleic acids in the sample. In some embodiments, the sample comprises a portion of the target nucleic acid and at least one nucleic acid comprising less than 100% sequence identity to the portion of the target nucleic acid but no less than 50% sequence identity to the portion of the target nucleic acid. For example, the portion of the target nucleic acid comprises a mutation as compared to at least one nucleic acid comprising less than 100% sequence identity to the portion of the target nucleic acid but no less than 50% sequence identity to the portion of the target nucleic acid. In some embodiments, the portion of the target nucleic acid comprises a single nucleotide mutation as compared to at least one nucleic acid comprising less than 100% sequence identity to the portion of the target nucleic acid but no less than 50% sequence identity to the portion of the target nucleic acid.
[0388] In some embodiments, a sample comprises target nucleic acid populations at different concentrations or amounts. In some embodiments, the sample has at least 2 target nucleic acid populations. In some embodiments, the sample has at least 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 target nucleic acid populations. In some embodiments, the sample has 3 to 50, 5 to 40, or 10 to 25 target nucleic acid populations.
[0389] In some embodiments, a sample has at least 2 individual target nucleic acids. In some embodiments, the sample has at least 3, 5, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 individual target nucleic acids.
[0390] In some embodiments, the sample comprises 1 to 10,000, 100 to 8000, 400 to 6000, 500 to 5000, 1000 to 4000, or 2000 to 3000 individual target nucleic acids.
[0391] In some embodiments, a sample comprises one copy of target nucleic acid per 10 non-target nucleic acids, 10.sup.2 non-target nucleic acids, 10.sup.3 non-target nucleic acids, 10.sup.4 non-target nucleic acids, 10.sup.5 non-target nucleic acids, 10.sup.6 non-target nucleic acids, 10.sup.7 non-target nucleic acids, 10.sup.8 non-target nucleic acids, 10.sup.9 non-target nucleic acids, or 10.sup.10 non-target nucleic acids.
[0392] In some embodiments, samples comprise a target nucleic acid at a concentration of less than 1 nM, less than 2 nM, less than 3 nM, less than 4 nM, less than 5 nM, less than 6 nM, less than 7 nM, less than 8 nM, less than 9 nM, less than 10 nM, less than 20 nM, less than 30 nM, less than 40 nM, less than 50 nM, less than 60 nM, less than 70 nM, less than 80 nM, less than 90 nM, less than 100 nM, less than 200 nM, less than 300 nM, less than 400 nM, less than 500 nM, less than 600 nM, less than 700 nM, less than 800 nM, less than 900 nM, less than 1 ?M, less than 2 ?M, less than 3 ?M, less than 4 ?M, less than 5 ?M, less than 6 ?M, less than 7 ?M, less than 8 ?M, less than 9 ?M, less than 10 ?M, less than 100 ?M, or less than 1 mM. In some embodiments, the sample comprises a target nucleic acid at a concentration of 1 nM to 2 nM, 2 nM to 3 nM, 3 nM to 4 nM, 4 nM to 5 nM, 5 nM to 6 nM, 6 nM to 7 nM, 7 nM to 8 nM, 8 nM to 9 nM, 9 nM to 10 nM, 10 nM to 20 nM, 20 nM to 30 nM, 30 nM to 40 nM, 40 nM to 50 nM, 50 nM to 60 nM, 60 nM to 70 nM, 70 nM to 80 nM, 80 nM to 90 nM, 90 nM to 100 nM, 100 nM to 200 nM, 200 nM to 300 nM, 300 nM to 400 nM, 400 nM to 500 nM, 500 nM to 600 nM, 600 nM to 700 nM, 700 nM to 800 nM, 800 nM to 900 nM, 900 nM to 1 ?M, 1 ?M to 2 ?M, 2 ?M to 3 ?M, 3 ?M to 4 ?M, 4 ?M to 5 ?M, 5 ?M to 6 ?M, 6 ?M to 7 ?M, 7 ?M to 8 ?M, 8 ?M to 9 ?M, 9 ?M to 10 ?M, 10 UM to 100 ?M, 100 ?M to 1 mM, 1 nM to 10 nM, 1 nM to 100 nM, 1 nM to 1 ?M, 1 nM to 10 ?M, 1 nM to 10 ?M, 1 nM to 1 mM, 10 nM to 100 nM, 10 nM to 1 ?M, 10 nM to 10 ?M, 10 nM to 100 ?M, 10 nM to 1 mM, 100 nM to 1 ?M, 100 nM to 10 UM, 100 nM to 100 ?M, 100 nM to 1 mM, 1 ?M to 10 ?M, 1 ?M to 100 ?M, 1 ?M to 1 mM, 1 ?M to 100 ?M, 10 ?M to 1 mM, or 100 ?M to 1 mM. In some embodiments, the sample comprises a target nucleic acid at a concentration of 20 nM to 200 ?M, 50 nM to 100 ?M, 200 nM to 50 ?M, 500 nM to 20 ?M, or 2 ?M to 10 ?M. In some embodiments, the target nucleic acid is not present in the sample.
[0393] In some embodiments, samples comprise fewer than 10 copies, fewer than 100 copies, fewer than 1000 copies, fewer than 10,000 copies, fewer than 100,000 copies, or fewer than 1,000,000 copies of a target nucleic acid. In some embodiments, the sample comprises 10 copies to 100 copies, 100 copies to 1000 copies, 1000 copies to 10,000 copies, 10,000 copies to 100,000 copies, 100,000 copies to 1,000,000 copies, 10 copies to 1000 copies, 10 copies to 10,000 copies, 10 copies to 100,000 copies, 10 copies to 1,000,000 copies, 100 copies to 10,000 copies, 100 copies to 100,000 copies, 100 copies to 1,000,000 copies, 1,000 copies to 100,000 copies, or 1,000 copies to 1,000,000 copies of a target nucleic acid. In some embodiments, the sample comprises 10 copies to 500,000 copies, 200 copies to 200,000 copies, 500 copies to 100,000 copies, 1000 copies to 50,000 copies, 2000 copies to 20,000 copies, 3000 copies to 10,000 copies, or 4000 copies to 8000 copies. In some embodiments, the target nucleic acid is not present in the sample.
[0394] In some embodiments, the sample is a biological sample, an environmental sample, or a combination thereof. Non-limiting examples of biological samples are blood, serum, plasma, saliva, urine, mucosal sample, peritoneal sample, cerebrospinal fluid, gastric secretions, nasal secretions, sputum, pharyngeal exudates, urethral or vaginal secretions, an exudate, an effusion, and a tissue sample (e.g., a biopsy sample). A tissue sample from a subject may be dissociated or liquified prior to application to detection system of the present disclosure. Non-limiting examples of environmental samples are soil, air, or water. In some embodiments, an environmental sample is taken as a swab from a surface of interest or taken directly from the surface of interest.
[0395] In some embodiments, the sample is a raw (unprocessed, unedited, unmodified) sample. Raw samples may be applied to a system for detecting or editing a target nucleic acid, such as those described herein. In some embodiments, the sample is diluted with a buffer or a fluid or concentrated prior to its application to the system or be applied neat to the detection system. Sometimes, the sample contains no more 20 ?l of buffer or fluid. The sample, in some embodiments, is contained in no more than 1, 5, 10, 15, 20, 25, 30, 35 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 200, 300, 400, 500 ?l, or any of value 1 ?l to 500 ?l, preferably 10 ?L to 200 ?L, or more preferably 50 ?L to 100 ?L of buffer or fluid. Sometimes, the sample is contained in more than 500 ?l.
[0396] In some embodiments, the sample is taken from a single-cell eukaryotic organism; a plant or a plant cell; an algal cell; a fungal cell; an animal cell, tissue, or organ; a cell, tissue, or organ from an invertebrate animal; a cell, tissue, fluid, or organ from a vertebrate animal such as fish, amphibian, reptile, bird, and mammal; a cell, tissue, fluid, or organ from a mammal such as a human, a non-human primate, an ungulate, a feline, a bovine, an ovine, and a caprine. In some embodiments, the sample is taken from nematodes, protozoans, helminths, or malarial parasites. In some embodiments, the sample comprises nucleic acids from a cell lysate from a eukaryotic cell, a mammalian cell, a human cell, a prokaryotic cell, or a plant cell. In some embodiments, the sample comprises nucleic acids expressed from a cell.
[0397] In some embodiments, samples are used for diagnosing a disease. In some embodiments the disease is cancer. The sample used for cancer testing may comprise at least one target nucleic acid that may hybridize to a guide nucleic acid of the reagents described herein. The target nucleic acid, in some embodiments, comprises a portion of a gene comprising a mutation associated with a disease, such as cancer, a gene whose overexpression is associated with cancer, a tumor suppressor gene, an oncogene, a checkpoint inhibitor gene, a gene associated with cellular growth, a gene associated with cellular metabolism, or a gene associated with cell cycle. Sometimes, the target nucleic acid encodes a cancer biomarker. In some embodiments, the assay may be used to detect hotspots in target nucleic acids that may be predictive of a cancer. In some embodiments, the target nucleic acid comprises a portion of a nucleic acid that is associated with a cancer. In some embodiments, the target nucleic acid is a portion of a nucleic acid from a genomic locus, any DNA amplicon of, a reverse transcribed mRNA, or a cDNA from a locus of at least one of a gene set forth in TABLE 3. Any region of the aforementioned gene loci may be probed for a mutation or deletion using the compositions and methods disclosed herein. For example, in the EGFR gene locus, the compositions and methods for detection disclosed herein may be used to detect a single nucleotide polymorphism or a deletion.
[0398] In some embodiments, samples are used to diagnose a genetic disorder, also referred to as genetic disorder testing. The sample used for genetic disorder testing may comprise at least one target nucleic acid that may hybridize to a guide nucleic acid of the reagents described herein. The target nucleic acid, in some embodiments, is from a gene with a mutation associated with a genetic disorder, from a gene whose overexpression is associated with a genetic disorder, from a gene associated with abnormal cellular growth resulting in a genetic disorder, or from a gene associated with abnormal cellular metabolism resulting in a genetic disorder. In some embodiments, the target nucleic acid is a nucleic acid from a genomic locus, a transcribed mRNA, or a reverse transcribed mRNA, a DNA amplicon of or a cDNA from a locus of at least one of a gene set forth in TABLE 3.
[0399] A sample used for phenotyping testing may comprise at least one target nucleic acid that may hybridize to a guide nucleic acid of the reagents described herein. The target nucleic acid, in some embodiments, is a nucleic acid encoding a sequence associated with a phenotypic trait. A sample used for genotyping testing may comprise at least one target nucleic acid that may hybridize to a guide nucleic acid of the reagents described herein. A target nucleic acid, in some embodiments, is a nucleic acid encoding a sequence associated with a genotype of interest. A sample used for ancestral testing may comprise at least one target nucleic acid that may hybridize to a guide nucleic acid of the reagents described herein. A target nucleic acid, in some embodiments, is a nucleic acid encoding a sequence associated with a geographic region of origin or ethnic group. A sample may be used for identifying a disease status. For example, a sample is any sample described herein, and is obtained from a subject for use in identifying a disease status of a subject. In some embodiments, the disease is cancer. In some embodiments, the disease is a genetic disorder. In some embodiments, a method comprises obtaining a serum sample from a subject; and identifying a disease status of the subject.
Certain Target Nucleic Acids
[0400] Disclosed herein are compositions, systems and methods for modifying and detecting target nucleic acids. In some embodiments, the target nucleic acid is a double stranded nucleic acid. In some embodiments, the target nucleic acid is a single stranded nucleic acid. In some embodiments, the target nucleic acid is a double stranded nucleic acid that is prepared into single stranded nucleic acids before or upon contacting a reagent or sample. In some embodiments, the target nucleic acid comprises DNA. In some embodiments, the target nucleic acid comprises RNA. The target nucleic acids include but are not limited to mRNA, rRNA, tRNA, non-coding RNA, long non-coding RNA, and microRNA (miRNA). In some cases, the target nucleic acid is single-stranded RNA (ssRNA) or mRNA.
[0401] In some embodiments, target nucleic acids comprise a mutation. The mutation may be a mutation of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. The mutation may result in the insertion of at least one amino acid in a polypeptide encoded by the target nucleic acid. The mutation may result in the deletion of at least one amino acid in a polypeptide encoded by the target nucleic acid. The mutation may result in the substitution of at least one amino acid in a polypeptide encoded by the target nucleic acid. The mutation may result in misfolding of the polypeptide. The mutation may result in a premature stop codon. The mutation may result in a truncation of the protein.
[0402] In some embodiments, at least a portion of a guide nucleic acid of a composition described herein hybridizes to a region of the target nucleic acid comprising the mutation. In some embodiments, at least a portion of a guide nucleic acid of a composition described herein hybridizes to a region of the target nucleic acid that is within 10 nucleotides, within 50 nucleotides, within 100 nucleotides, or within 200 nucleotides of the mutation. The mutation may be located in a non-coding region or a coding region of a gene.
[0403] In some embodiments, the mutation is an autosomal dominant mutation. In some embodiments, the mutation is a dominant negative mutation. In some embodiments, the mutation is a loss of function mutation. In some embodiments, the mutation is a single nucleotide polymorphism (SNP). In some embodiments, the SNP is associated with a phenotype of the sample or a phenotype of the organism from which the sample was taken. The SNP, in some cases, is associated with altered phenotype from wild type phenotype. The SNP may be a synonymous substitution or a nonsynonymous substitution. The nonsynonymous substitution may be a missense substitution, or a nonsense point mutation. The synonymous substitution may be a silent substitution. The mutation may be a deletion of one or more nucleotides. Often, the single nucleotide mutation, SNP, or deletion is associated with a disease such as cancer or a genetic disorder. The mutation, such as a single nucleotide mutation, a SNP, or a deletion, may be encoded in the sequence of a target nucleic acid from the germline of an organism or may be encoded in a target nucleic acid from a diseased cell, such as a cancer cell.
[0404] In some embodiments, the target nucleic acid comprises a mutation associated with a disease. In some examples, a mutation associated with a disease refers to a mutation which causes the disease, contributes to the development of the disease, or indicates the existence of the disease. In some embodiments, the mutation causes the disease.
[0405] Non-limiting examples of diseases associated with genetic mutations are cystic fibrosis, Duchenne muscular dystrophy, ?-thalassemia, hemophilia, sickle cell anemia, amyotrophic lateral sclerosis (ALS), severe combined immunodeficiency, Huntington's disease, Alzheimer's Disease, alpha-1 antitrypsin deficiency, myotonic dystrophy Type 1, and Usher syndrome. The disease may comprise, at least in part, a cancer, an inherited disorder, an ophthalmological disorder, a neurological disorder, a blood disorder, a metabolic disorder, or a combination thereof.
[0406] The target nucleic acid, in some cases, comprises a portion of a gene comprising a mutation associated with cancer, a gene whose overexpression is associated with cancer, a tumor suppressor gene, an oncogene, a checkpoint inhibitor gene, a gene associated with cellular growth, a gene associated with cellular metabolism, or a gene associated with cell cycle. Sometimes, the target nucleic acid encodes a cancer biomarker, such as a prostate cancer biomarker or non-small cell lung cancer. In some cases, the assay may be used to detect hotspots in target nucleic acids that may be predictive of lung cancer. In some cases, the target nucleic acid comprises a portion of a nucleic acid that is associated with a blood fever. In some cases, the target nucleic acid is a portion of a nucleic acid from a genomic locus, any DNA amplicon of, a reverse transcribed mRNA, or a cDNA from a locus of at least one of: ALK, APC, ATM, AXIN2, BAP1, BARD1, BLM, BMPR1A, BRCA1, BRCA2, BRIP1, CASR, CDC73, CDH1, CDK4, CDKN1B, CDKN1C, CDKN2A, CEBPA, CHEK2, CTNNA1, DICER1, DIS3L2, EGFR, EPCAM, FH, FLCN, GATA2, GPC3, GREM1, HOXB13, HRAS, MAX, MEN1, MET, MITF, MLH1, MSH2, MSH3, MSH6, MUTYH, NBN, NF1, NF2, NTHL1, PALB2, PDGFRA, PHOX2B, PMS2, POLD1, POLE, POT1, PRKAR1A, PTCH1, PTEN, RAD50, RAD51C, RAD51D, RB1, RECQL4, RET, RUNX1, SDHA, SDHAF2, SDHB, SDHC, SDHD, SMAD4, SMARCA4, SMARCB1, SMARCE1, STK11, SUFU, TERC, TERT, TMEM127, TP53, TSC1, TSC2, VHL, WRN, and WT1. In some cases, the target nucleic acid comprises a portion of a nucleic acid from a genomic locus, any DNA amplicon of, a reverse transcribed mRNA, or a cDNA from a locus of at least one of: TRAC, B2M, PD1, PCSK9, DNMT1, HPRT1, RPL32P3, CCR5, FANCF, GRIN2B, EMX1, AAVS1, ALKBH5, CLTA, CDK11, CTNNB1, AXIN1, LRP6, TBK1, BAP1, TLE3, PPM1A, BCL2L2, SUFU, RICTOR, VPS35, TOP1, SIRT1, PTEN, MMD, PAQR8, H2AX, POU5F1, OCT4, SYS1, ARFRP1, TSPAN14, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J1, and HRD1.
[0407] In some cases, the target nucleic acid is a portion of a nucleic acid from a genomic locus, any DNA amplicon of, a reverse transcribed mRNA, or a cDNA from a locus of at least one of: CFTR, FMR1, SMN1, ABCB11, ABCC8, ABCD1, ACAD9, ACADM, ACADVL, ACAT1, ACOX1, ACSF3, ADA, ADAMTS2, ADGRG1, AGA, AGL, AGPS, AGXT, AIRE, ALDH3A2, ALDOB, ALG6, ALMS1, ALPL, AMT, AQP2, ARG1, ARSA, ARSB, ASL, ASNS, ASPA, ASS1, ATM, ATP6V1B1, ATP7A, ATP7B, ATRX, BBS1, BBS10, BBS12, BBS2, BCKDHA, BCKDHB, BCS1L, BLM, BSND, CAPN3, CBS, CDH23, CEP290, CERKL, CHM, CHRNE, CIITA, CLN3, CLN5, CLN6, CLN8, CLRN1, CNGB3, COL27A1, COL4A3, COL4A4, COL4A5, COL7A1, CPS1, CPT1A, CPT2, CRB1, CTNS, CTSK, CYBA, CYBB, CYP11B1, CYP11B2, CYP17A1, CYP19A1, CYP27A1, DBT, DCLRE1C, DHCR7, DHDDS, DLD, DMD, DNAH5, DNAI1, DNAI2, DYSF, EDA, EIF2B5, EMD, ERCC6, ERCC8, ESCO2, ETFA, ETFDH, ETHE1, EVC, EVC2, EYS, F9, FAH, FAM161A, FANCA, FANCC, FANCG, FH, FKRP, FKTN, G6PC, GAA, GALC, GALK1, GALT, GAMT, GBA, GBE1, GCDH, GFM1, GJB1, GJB2, GLA, GLB1, GLDC, GLE1, GNE, GNPTAB, GNPTG, GNS, GRHPR, HADHA, HAX1, HBA1, HBA2, HBB, HEXA, HEXB, HGSNAT, HLCS, HMGCL, HOGA1, HPS1, HPS3, HSD17B4, HSD3B2, HYAL1, HYLS1, IDS, IDUA, IKBKAP, IL2RG, IVD, KCNJ11, LAMA2, LAMA3, LAMB3, LAMC2, LCA5, LDLR, LDLRAP1, LHX3, LIFR, LIPA, LOXHD1, LPL, LRPPRC, MAN2B1, MCOLN1, MED17, MESP2, MFSD8, MKS1, MLC1, MMAA, MMAB, MMACHC, MMADHC, MPI, MPL, MPV17, MTHFR, MTM1, MTRR, MTTP, MUT, MYO7A, NAGLU, NAGS, NBN, NDRG1, NDUFAF5, NDUFS6, NEB, NPC1, NPC2, NPHS1, NPHS2, NR2E3, NTRK1, OAT, OPA3, OTC, PAH, PC, PCCA, PCCB, PCDH15, PDHA1, PDHB, PEX1, PEX10, PEX12, PEX2, PEX6, PEX7, PFKM, PHGDH, PKHD1, PMM2, POMGNT1, PPT1, PROP1, PRPS1, PSAP, PTS, PUS1, PYGM, RAB23, RAG2, RAPSN, RARS2, RDH12, RMRP, RPE65, RPGRIP1L, RS1, RTEL1, SACS, SAMHD1, SEPSECS, SGCA, SGCB, SGCG, SGSH, SLC12A3, SLC12A6, SLC17A5, SLC22A5, SLC25A13, SLC25A15, SLC26A2, SLC26A4, SLC35A3, SLC37A4, SLC39A4, SLC4A11, SLC6A8, SLC7A7, SMARCAL1, SMPD1, STAR, SUMF1, TAT, TCIRG1, TECPR2, TFR2, TGM1, TH, TMEM216, TPP1, TRMU, TSFM, TTPA, TYMP, USHIC, USH2A, VPS13A, VPS13B, VPS45, VRK1, VSX2, WNT10A, XPA, XPC, and ZFYVE26.
[0408] The target nucleic acid may be from any organism, including, but not limited to, a bacterium, a virus, a parasite, a protozoon, a fungus, a mammal, a plant, and an insect. As another non-limiting example, the target nucleic acid may be responsible for a disease, contain a mutation (e.g., single strand polymorphism, point mutation, insertion, or deletion), be contained in an amplicon, or be uniquely identifiable from the surrounding nucleic acids (e.g., contain a unique sequence of nucleotides).
[0409] In some embodiments, the target nucleic acid is selected from those listed in TABLE 3.
TABLE-US-00003 TABLE 3 EXEMPLARY TARGETS Exemplary targets AAVS1, ABCA4, ABCB11, ABCC8, ABCD1, ABCG5, ABCG8, ACAD9, ACADM, ACADVL, ACAT1, ACOX1, ACSF3, ACTA1, ADA, ADAMTS2, ADGRG1, AGA, AGL, AGPS, AGXT, AHI1, AIRE, ALDH3A2, ALDOB, ALG6, ALK, ALKBH5, ALMS1, ALPL, AMRC9, AMT, ANAPC10, ANAPC11, ANGPTL3, ANGPTLA, APC, Apo(a), APOCIII, APOE?4, APOL1, APP, AQP2, AR, ARFRP1, ARG1, ARH, ARL13B, ARL6, ARSA, ARSB, ASL, ASNS, ASPA, ASS1, ATM, ATP6V1B1, ATP7A, ATP7B, ATRX, ATXN1, ATXN10, ATXN2, ATXN3, ATXN7, ATXN8OS, AXIN1, AXIN2, B2M, BACE-1, BAK1, BAP1, BARD1, BAX2, BBS1, BBS10, BBS12, BBS2, BCKDHA, BCKDHB, BCL2L2, BCS1L, BEST1, Betaglobin gene, BLM, BMPR1A, BRAF, BRAFV600E, BRCA1, BRCA2, BRIP1, BSND, C9orf72, CA4, CACNA1A, CAH1, CAPN3, CASR, CBS, CCNB1 CC2D2A, CCR5, CD1, CD2, CD3, CD3D, CD3Z, CD4, CD5, CD6, CD7, CD8A, CD8B, CD9, CD14, CD18, CD19, CD21, CD22, CD23, CD27, CD28, CD30, CD33, CD34, CD36, CD38, CD40, CD40L, CD44, CD46, CD47, CD48, CD52, CD55, CD57, CD58, CD59, CD68, CD69, CD72, CD73, CD74, CD79A, CD80, CD81, CD83, CD84, CD86, CD90, CD93, CD96, CD99, CD100, CD123, CD160, CD163, CD164, CD164L2, CD166, CD200, CD204, CD207, CD209, CD226, CD244, CD247, CD274, CD276, CD300, CD320, CDC73, CDH1, CDH23, CDK11, CDK4, CDKN1A, CDKN1B, CDKN1C, CDKN2A, CDKN2B, CEBPA, CELA3B, CEP290, CERKL, CFB, CFTR, CHCHD10, CHEK2, CHM, CHRNE, CIDEB, CIITA, CLN3, CLN5, CLN6, CLN8, CLRN1, CLTA, CMT1A, CNBP, CNGB1, CNGB3, COL1A1, COL1A2, COL27A1, COL4A3, COL4A4, COL4A5, COL6A1, COL6A2, COL6A3, COL7A1, CPSI, CPTIA, CPT2, CRB1, CREBBP, CRX, CRYAA, CTNNA1, CTNNB1, CTNND2, CTNS, CTSK, CXCL12, CYBA, CYBB, CYP11B1, CYP11B2, CYP17A1, CYP19A1, CYP21A2, CYP27A1, DBT, DCC, DCLRE1C, DERL2, DFNA36, DFNB31, DGAT2, DHCR7, DHDDS, DICER1, DIS3L2, DLD, DMD, DMPK, DNAH5, DNAI1, DNAI2, DNM2, DNMT1, DPC4, DYSF, EDA, EDN3, EDNRB, EGFR, EIF2B5, EMC2, EMC3, EMD, EMX1, EN1, EPCAM, ERCC6, ERCC8, ESCO2, ETFA, ETFDH, ETHE1, EVC, EVC2, EYS, F5, F9, FXI, FAH, FAM161A, FANCA, FANCB, FANCC, FANCD1, FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ, FANCL, FANCM, FANCN, FANCP, FANCS, FBN1, FGF14, FGFR2, FGFR3, FGA, FGB, FGG, FH, FHL1, FIX, FKRP, FKTN, FLCN, FMR1, FOXP3, FSCN2, FSHD1, FUS, FUT8, FVIII, FXII, FXN, G6PC, GAA, GALC, GALK1, GALT, GAMT, GATA2, GATA-4, GBA, GBEI, GCDH, GCGR, GDNF, GFAP, GFMI, GHR, GJB1, GJB2, GLA, GLB1, GLDC, GLE1, GNE, GNPTAB, GNPTG, GNS, GPAM, GPC3, GPR98, GREM1, GRHPR, GRIN2B, H2AFX, H2AX, HADHA, HAX1, HBA1, HBA2, HBB, HBV cccDNA, HER2, HEXA, HEXB, HFE, HGSNAT, HLCS, HMGCL, HAO1, HOGA1, HOXB13, HPRPF3, HPRT1, HPS1, HPS3, HRAS, HRD1, HSD3B2, HSD17B4, HSD17B13, HTT, HUSI, HYALI, HYLSI, IDS, IDUA, IFITM5, IKBKAP, IL2RG, IL7R, IMPDH1, INPP5E, IRF4, ITGB2, ITPRI, IVD, JAGI, JAKI, JAK3, KCNC3, KCND3, KCNJ11, KLKB1, KLHL7, KRAS, LAMA1, LAMA2, LAMA3, LAMB3, LAMC2, LCA5, LDHA, LDLR, LDLRAP1, LHX3, LIFR, LIPA, LMNA, LMOD3, LOR, LOXHD1, LPA, LPL, LRAT, LRP6, LRPPRC, LRRK2, MADR2, MAN2B1, MAPT, MARCI, MAX, MCM6, MCOLNI, MECP2, MED17, MEFV, MENI, MERTK, MESP2, MET, METex14, MFN2, MFSD8, MIA3, MITF, MKL2, MKS1, MLC1, MLH1, MLH3, MMAA, MMAB, MMACHC, MMADHC, MMD, MPI, MPL, MPV17, MSH2, MSH3, MSH6, MTHFD1L, MTHFR, MTM1, MTRR, MTTP, MUT, MUTYH, MYC, MYH7, MYO7A, NAGLU, NAGS, NBN, NDRG1, NDUFAF5, NDUFS6, NEB, NF1, NF2, NKX2-5, NOG, NOTCH1, NOTCH2, NPC1, NPC2, NPHP1, NPHS1, NPHS2, NRAS, NR2E3, NTHL1, NTRK, NTRK1, OAT, OCT4, OFD1, OPA3, OTC, PAH, PALB2, PAQR8, PAX3, PC, PCCA, PCCB, PCDH15, PCSK9, PD1, PDCD1, PDE6B, PDGFRA, PDHA1, PDHB, PEX1, PEX10, PEX12, PEX13, PEX14, PEX16, PEX19, PEX2, PEX26, PEX3, PEX5, PEX6, PEX7, PFKM, PHGDH, PHOX2B, PKD1, PKD2, PKHDI, PKK, PLEKHG4, PMM2, PMP22, PMS1, PMS2, PNPLA3, POLD1, POLE, POMGNT1, POT1, POU5F1, PPM1A, PPP2R2B, PPT1, PRCD, PRKAG2, PRKAR1A, PRKCG, PRNP, PROM1, PROP1, PRPF31, PRPF8, PRPH2, PRPS1, PSAP, PSD3, PSD95, PSEN1, PSEN2, PSRC1, PTCH1, PTEN, PTS, PUS1, PYGM, RAB23, RAD50, RAD51C, RAD51D, RAG1, RAG2, RAPSN, RARS2, RB1, RDH12, RECQL4, RET, RHO, RICTOR, RMRP, ROS1, RP1, RP2, RPE65, RPGR, RPGRIP1L, RPL32P3, RS1, RTCA, RTEL1, RUNX1, SACS, SAMHD1, SCN1A, SCN2A, SDHA, SDHAF2, SDHB, SDHC, SDHD, SEL1L, SEPSEC5, SERPINA1, SERPINC1, SERPING1, SGCA, SGCB, SGCG, SGSH, SIRT1, SLC12A3, SLC12A6, SLC17A5, SLC22A5, SLC25A13, SLC25A15, SLC26A2, SLC26A4, SLC35A3, SLC35B4, SLC37A4, SLC39A4, SLC4A11, SLC6A8, SLC7A7, SMAD3, SMAD4, SMARCA4, SMARCAL1, SMARCB1, SMARCE1, SMN1, SMPD1, SNAI2, SNCA, SNRNP200, SOD1, SOX10, SPARA7, SPTBN2, STAR, STAT3, STK11, SUFU, SUMF1, SYNE1, SYNE2, SYS1, TARDBP, TAT, TBK1, TBP, TCIRG1, TCTN3, TECPR2, TERC, TERT, TFR2, TGFBR2, TGM1, TH, TLE3, TMEM127, TMEM138, TMEM216, TMEM43, TMEM67, TMPRSS6, TOP1, TOPORS, TP53, TPM2, TNNT1, TNN3, TNNI2, TPP1, TRAC, TRMU, TSC1, TSC2, TSFM, TSPAN14, TTBK2, TTC8, TTPA, TTR, TULP1, TYMP, UBE2G2, UBE2J1, UBE3A, USH1C, USH1G, USH2A, VEGF, VHL, VPS13A, VPS13B, VPS35, VPS45, VRK1, VSX2, VWF, WAS, WDR19, WDR48, WNT10A, WRN, WS2B, WS2C, WT1, XPA, XPC, XPF, XRCC3, YAP1, ZAC1, ZEB1, ZFYVE26, and ZNF423
IX. Compositions
[0410] Disclosed herein are compositions comprising one or more effector proteins described herein or nucleic acids encoding the one or more effector proteins, one or more guide nucleic acids described herein or nucleic acids encoding the one or more guide nucleic acids described herein, or combinations thereof. In some embodiments, a repeat sequence of the one or more guide nucleic acids are capable of interacting with the one or more of the effector proteins. In some embodiments, spacer sequences of the one or more guide nucleic acids hybridizes with a target sequence of a target nucleic acid. In some embodiments, the compositions comprise one or more donor nucleic acids described herein. In some embodiments, the compositions are capable of editing a target nucleic acid in a cell or a subject. In some embodiments, the compositions are capable of editing a target nucleic acid or the expression thereof in a cell, in a tissue, in an organ, in vitro, in vivo, or ex vivo. In some embodiments, the compositions are capable of editing a target nucleic acid in a sample comprising the target nucleic.
[0411] In some embodiments, compositions described herein comprise plasmids described herein, viral vectors described herein, non-viral vectors described herein, or combinations thereof. In some embodiments, compositions described herein comprise the viral vectors. In some embodiments, compositions described herein comprise an AAV. In some embodiments, compositions described herein comprise liposomes (e.g., cationic lipids or neutral lipids), dendrimers, lipid nanoparticle (LNP), or cell-penetrating peptides. In some embodiments, compositions described herein comprise an LNP.
Pharmaceutical Compositions
[0412] In some embodiments, compositions described herein are pharmaceutical compositions. In some embodiments, the pharmaceutical compositions comprise compositions described herein and a pharmaceutically acceptable carrier or diluent. Pharmaceutically acceptable excipient, carrier or diluent refers to any substance formulated alongside the active ingredient of a pharmaceutical composition that allows the active ingredient to retain biological activity and is non-reactive with the subject's immune system. Such a substance can be included for the purpose of long-term stabilization, bulking up solid formulations that contain potent active ingredients in small amounts, or to confer a therapeutic enhancement on the active ingredient in the final dosage form, such as facilitating absorption, reducing viscosity, or enhancing solubility. The selection of appropriate substance can depend upon the route of administration and the dosage form, as well as the active ingredient and other factors. Compositions having such substances can be formulated by suitable methods (see, e.g., Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990; and Remington, The Science and Practice of Pharmacy 21st Ed. Mack Publishing, 2005).
[0413] Non-limiting examples of pharmaceutically acceptable carriers and diluents suitable for the pharmaceutical compositions disclosed herein include buffers (e.g., neutral buffered saline, phosphate buffered saline); carbohydrates (e.g., glucose, mannose, sucrose, dextran, mannitol); polypeptides or amino acids (e.g., glycine); antioxidants; chelating agents (e.g., EDTA, glutathione); adjuvants (e.g., aluminum hydroxide); surfactants (Polysorbate 80, Polysorbate 20, or Pluronic F68); glycerol; sorbitol; mannitol; polyethyleneglycol; and preservatives. In some embodiments, the vector is formulated for delivery through injection by a needle carrying syringe. In some embodiments, the composition is formulated for delivery by electroporation. In some embodiments, the composition is formulated for delivery by chemical method. In some embodiments, the pharmaceutical compositions comprise a virus vector or a non-viral vector.
[0414] Pharmaceutical compositions described herein comprise a salt. In some embodiments, the salt is a sodium salt. In some embodiments, the salt is a potassium salt. In some embodiments, the salt is a magnesium salt. In some embodiments, the salt is NaCl. In some embodiments, the salt is KNO.sub.3. In some embodiments, the salt is Mg.sup.2+SO.sub.4.sup.2?.
[0415] Pharmaceutical compositions described herein are in the form of a solution (e.g., a liquid). In some embodiments, the solution is formulated for injection, e.g., intravenous or subcutaneous injection. In some embodiments, the pH of the solution is about 7, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, about 8, about 8.1, about 8.2, about 8.3, about 8.4, about 8.5, about 8.6, about 8.7, about 8.8, about 8.9, or about 9. In some embodiments, the pH is 7 to 7.5, 7.5 to 8, 8 to 8.5, 8.5 to 9, or 7 to 8.5. In some cases, the pH of the solution is less than 7. In some cases, the pH is greater than 7.
X. Systems
[0416] Disclosed herein, in some aspects, are systems for detecting a target nucleic acid, comprising any one of the effector proteins described herein. In some embodiments, systems comprise a guide nucleic acid. Systems may be used to detect a target nucleic acid. In some embodiments, systems comprise an effector protein described herein, a reagent, support medium, or a combination thereof. In some embodiments, systems comprise a fusion protein described herein. In some embodiments, effector proteins comprise an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the amino acid sequences selected from SEQ ID NOS: 1-10,484 or 15,022-24,165. In some embodiments, the amino acid sequence of the effector protein is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any one of the amino acid sequences selected from SEQ ID NOS: 1-10,484 or 15,022-24,165. In some embodiments, systems comprise an effector protein that is at least 90% identical to an effector protein sequence provide in TABLE 1, and a guide nucleic acid that is at least 90% identical to a corresponding guide nucleic from TABLE 1, wherein corresponding means the effector protein sequence and guide nucleic acid sequence are selected from the same column number (e.g., A1 and B1) and same row.
[0417] Systems may be used for detecting the presence of a target nucleic acid associated with or causative of a disease, such as cancer, a genetic disorder, or an infection. In some embodiments, systems are useful for phenotyping, genotyping, or determining ancestry. Unless specified otherwise, systems include kits and may be referred to as kits. Unless specified otherwise, systems include devices and may also be referred to as devices. Systems described herein may be provided in the form of a companion diagnostic assay or device, a point-of-care assay or device, or an over-the-counter diagnostic assay/device.
[0418] Reagents and effector proteins of various systems may be provided in a reagent chamber or on a support medium. Alternatively, the reagent and/or effector protein may be contacted with the reagent chamber or the support medium by the individual using the system. An exemplary reagent chamber is a test well or container. The opening of the reagent chamber may be large enough to accommodate the support medium. Optionally, the system comprises a buffer and a dropper. The buffer may be provided in a dropper bottle for ease of dispensing. The dropper may be disposable and transfer a fixed volume. The dropper may be used to place a sample into the reagent chamber or on the support medium.
[0419] Disclosed herein are systems for detecting and/or editing target nucleic acid. In some embodiments, systems comprise components comprising one or more of: compositions described herein; a solution or buffer; a reagent; a support medium; other components or appurtenances as described herein; or combinations thereof.
System Solutions
[0420] In general, system components comprise a solution in which the activity of an effector protein occurs. Often, the solution comprises or consists essentially of a buffer. The solution or buffer may comprise a buffering agent, a salt, a crowding agent, a detergent, a reducing agent, a competitor, or a combination thereof. Often the buffer is the primary component or the basis for the solution in which the activity occurs. Thus, concentrations for components of buffers described herein (e.g., buffering agents, salts, crowding agents, detergents, reducing agents, and competitors) are the same or essentially the same as the concentration of these components in the solution in which the activity occurs. In some embodiments, a buffer is required for cell lysis activity or viral lysis activity.
[0421] In some embodiments, systems comprise a buffer, wherein the buffer comprise at least one buffering agent. Exemplary buffering agents include HEPES, TRIS, MES, ADA, PIPES, ACES, MOPSO, BIS-TRIS propane, BES, MOPS, TES, DISO, Trizma, TRICINE, GLY-GLY, HEPPS, BICINE, TAPS, A MPD, A MPSO, CHES, CAPSO, AMP, CAPS, phosphate, citrate, acetate, imidazole, or any combination thereof. In some embodiments, the concentration of the buffering agent in the buffer is 1 mM to 200 mM. A buffer compatible with an effector protein may comprise a buffering agent at a concentration of 10 mM to 30 mM. A buffer compatible with an effector protein may comprise a buffering agent at a concentration of about 20 mM. A buffering agent may provide a pH for the buffer or the solution in which the activity of the effector protein occurs. The pH may be 3 to 4, 3.5 to 4.5, 4 to 5, 4.5 to 5.5, 5 to 6, 5.5 to 6.5, 6 to 7, 6.5 to 7.5, 7 to 8, 7.5 to 8.5, 8 to 9, 8.5 to 9.5, 9 to 10, or 9.5 to 10.5.
[0422] In some embodiments, systems comprise a solution, wherein the solution comprises at least one salt. In some embodiments, the at least one salt is selected from potassium acetate, magnesium acetate, sodium chloride, potassium chloride, magnesium chloride, calcium chloride, and any combination thereof. In some embodiments, the concentration of the at least one salt in the solution is 5 mM to 100 mM, 5 mM to 10 mM, 1 mM to 60 mM, or 1 mM to 10 mM. In some embodiments, the concentration of the at least one salt is about 105 mM. In some embodiments, the concentration of the at least one salt is about 55 mM. In some embodiments, the concentration of the at least one salt is about 7 mM. In some embodiments, the solution comprises potassium acetate and magnesium acetate. In some embodiments, the solution comprises sodium chloride and magnesium chloride. In some embodiments, the solution comprises potassium chloride and magnesium chloride. In some embodiments, the salt is a magnesium salt and the concentration of magnesium in the solution is at least 5 mM, 7 mM, at least 9 mM, at least 11 mM, at least 13 mM, or at least 15 mM. In some embodiments, the concentration of magnesium is less than 20 mM, less than 18 mM, or less than 16 mM.
[0423] In some embodiments, systems comprise a solution, wherein the solution comprises at least one crowding agent. A crowding agent may reduce the volume of solvent available for other molecules in the solution, thereby increasing the effective concentrations of said molecules. Exemplary crowding agents include glycerol and bovine serum albumin. In some embodiments, the crowding agent is glycerol. In some embodiments, the concentration of the crowding agent in the solution is 0.01% (v/v) to 10% (v/v). In some embodiments, the concentration of the crowding agent in the solution is 0.5% (v/v) to 10% (v/v).
[0424] In some embodiments, systems comprise a solution, wherein the solution comprises at least one detergent. Exemplary detergents include Tween, Triton-X, and IGEPAL. A solution may comprise Tween, Triton-X, or any combination thereof. A solution may comprise Triton-X. A solution may comprise IGEPAL CA-630. In some embodiments, the concentration of the detergent in the solution is 2% (v/v) or less. In some embodiments, the concentration of the detergent in the solution is 1% (v/v) or less. In some embodiments, the concentration of the detergent in the solution is 0.00001% (v/v) to 0.01% (v/v). In some embodiments, the concentration of the detergent in the solution is about 0.01% (v/v).
[0425] In some embodiments, systems comprise a solution, wherein the solution comprises at least one reducing agent. Exemplary reducing agents comprise dithiothreitol (DTT), B-mercaptoethanol (BME), or tris(2-carboxyethyl) phosphine (TCEP). In some embodiments, the reducing agent is DTT. In some embodiments, the concentration of the reducing agent in the solution is 0.01 mM to 100 mM. In some embodiments, the concentration of the reducing agent in the solution is 0.1 mM to 10 mM. In some embodiments, the concentration of the reducing agent in the solution is 0.5 mM to 2 mM. In some embodiments, the concentration of the reducing agent in the solution is 0.01 mM to 100 mM. In some embodiments, the concentration of the reducing agent in the solution is 0.1 mM to 10 mM. In some embodiments, the concentration of the reducing agent in the solution is about 1 mM.
[0426] In some embodiments, systems comprise a solution, wherein the solution comprises a competitor. In general, competitors compete with the target nucleic acid or the reporter nucleic acid for cleavage by the effector protein or a dimer thereof. Exemplary competitors include heparin, and imidazole, and salmon sperm DNA. In some embodiments, the concentration of the competitor in the solution is 1 ?g/mL to 100 ?g/mL. In some embodiments, the concentration of the competitor in the solution is 40 ?g/mL to 60 ?g/mL.
[0427] In some embodiments, systems comprise a solution, wherein the solution comprises a co-factor. In some embodiments, the co-factor allows an effector protein or a multimeric complex thereof to perform a function, including pre-crRNA processing and/or target nucleic acid cleavage. The suitability of a cofactor for an effector protein or a multimeric complex thereof may be assessed, such as by methods based on those described by Sundaresan et al. (Cell Rep. 2017 Dec. 26; 21(13): 3728-3739). In some embodiments, an effector or a multimeric complex thereof forms a complex with a co-factor. In some embodiments, the co-factor is a divalent metal ion. In some embodiments, the divalent metal ion is selected from Mg.sup.2+, Mn.sup.2+, Zn.sup.2+, Ca.sup.2+, Cu.sup.2+. In some embodiments, the divalent metal ion is Mg.sup.2+. In some embodiments, the co-factor is Mg.sup.2+.
Reporters
[0428] In some embodiments, systems disclosed herein comprise a reporter. By way of non-limiting and illustrative example, a reporter may comprise a single stranded nucleic acid and a detection moiety (e.g., a labeled single stranded RNA reporter), wherein the nucleic acid is capable of being cleaved by an effector protein (e.g., a CRISPR/Cas protein as disclosed herein) or a multimeric complex thereof, releasing the detection moiety, and generating a detectable signal. As used herein, reporter is used interchangeably with reporter nucleic acid or reporter molecule. The effector proteins disclosed herein, activated upon hybridization of a guide nucleic acid to a target nucleic acid, may cleave the reporter. Cleaving the reporter may be referred to herein as cleaving the reporter nucleic acid, the reporter molecule, or the nucleic acid of the reporter. Reporters may comprise RNA. Reporters may comprise DNA. Reporters may be double-stranded. Reporters may be single-stranded.
[0429] In some embodiments, reporters comprise a protein capable of generating a signal. A signal may be a calorimetric, potentiometric, amperometric, optical (e.g., fluorescent, colorimetric, etc.), or piezo-electric signal. In some embodiments, the reporter comprises a detection moiety. Suitable detectable labels and/or moieties that may provide a signal include, but are not limited to, an enzyme, a radioisotope, a member of a specific binding pair; a fluorophore; a fluorescent protein; a quantum dot; and the like.
[0430] In some embodiments, the reporter comprises a detection moiety and a quenching moiety. In some embodiments, the reporter comprises a cleavage site, wherein the detection moiety is located at a first site on the reporter and the quenching moiety is located at a second site on the reporter, wherein the first site and the second site are separated by the cleavage site. Sometimes the quenching moiety is a fluorescence quenching moiety. In some embodiments, the quenching moiety is 5 to the cleavage site and the detection moiety is 3 to the cleavage site. In some embodiments, the detection moiety is 5 to the cleavage site and the quenching moiety is 3 to the cleavage site. Sometimes the quenching moiety is at the 5 terminus of the nucleic acid of a reporter. Sometimes the detection moiety is at the 3 terminus of the nucleic acid of a reporter. In some embodiments, the detection moiety is at the 5 terminus of the nucleic acid of a reporter. In some embodiments, the quenching moiety is at the 3 terminus of the nucleic acid of a reporter.
[0431] Suitable fluorescent proteins include, but are not limited to, green fluorescent protein (GFP) or variants thereof, blue fluorescent variant of GFP (BFP), cyan fluorescent variant of GFP (CFP), yellow fluorescent variant of GFP (YFP), enhanced GFP (EGFP), enhanced CFP (ECFP), enhanced YFP (EYFP), GFPS65T, Emerald, Topaz (TYFP), Venus, Citrine, mCitrine, GFPuv, destabilised EGFP (dEGFP), destabilised ECFP (dECFP), destabilised EYFP (dEYFP), mCFPm, Cerulean, T-Sapphire, CyPet, YPet, mKO, HcRed, t-HcRed, DsRed, DsRed2, DsRed-monomer, J-Red, dimer2, t-dimer2(12), mRFP1, pocilloporin, Renilla GFP, Monster GFP, paGFP, Kaede protein and kindling protein, Phycobiliproteins and Phycobiliprotein conjugates including B-Phycoerythrin, R-Phycoerythrin and Allophycocyanin. Suitable enzymes include, but are not limited to, horseradish peroxidase (HRP), alkaline phosphatase (AP), beta-galactosidase (GAL), glucose-6-phosphate dehydrogenase, beta-N-acetylglucosaminidase, ?-glucuronidase, invertase, Xanthine Oxidase, firefly luciferase, and glucose oxidase (GO).
[0432] In some embodiments, the detection moiety comprises an invertase. The substrate of the invertase may be sucrose. A DNS reagent may be included in the system to produce a colorimetric change when the invertase converts sucrose to glucose. In some embodiments, the reporter nucleic acid and invertase are conjugated using a heterobifunctional linker by sulfo-SMCC chemistry.
[0433] Suitable fluorophores may provide a detectable fluorescence signal in the same range as 6-Fluorescein (Integrated DNA Technologies), IRDye 700 (Integrated DNA Technologies), TYE 665 (Integrated DNA Technologies), Alex Fluor 594 (Integrated DNA Technologies), or ATTO TM 633 (NHS Ester) (Integrated DNA Technologies). Non-limiting examples of fluorophores are fluorescein amidite, 6-Fluorescein, IRDye 700, TYE 665, Alex Fluor 594, or ATTO TM 633 (NHS Ester). The fluorophore may be an infrared fluorophore. The fluorophore may emit fluorescence in the range of 500 nm and 720 nm. In some embodiments, the fluorophore emits fluorescence at a wavelength of 700 nm or higher. In other embodiments, the fluorophore emits fluorescence at about 665 nm. In some embodiments, the fluorophore emits fluorescence in the range of 500 nm to 520 nm, 500 nm to 540 nm, 500 nm to 590 nm, 590 nm to 600 nm, 600 nm to 610 nm, 610 nm to 620 nm, 620 nm to 630 nm, 630 nm to 640 nm, 640 nm to 650 nm, 650 nm to 660 nm, 660 nm to 670 nm, 670 nm to 680 nm, 690 nm to 690 nm, 690 nm to 700 nm, 700 nm to 710 nm, 710 nm to 720 nm, or 720 nm to 730 nm. In some embodiments, the fluorophore emits fluorescence in the range 450 nm to 750 nm, 500 nm to 650 nm, or 550 to 650 nm.
[0434] Systems may comprise a quenching moiety. A quenching moiety may be chosen based on its ability to quench the detection moiety. A quenching moiety may be a non-fluorescent fluorescence quencher. A quenching moiety may quench a detection moiety that emits fluorescence in the range of 500 nm and 720 nm. A quenching moiety may quench a detection moiety that emits fluorescence in the range of 500 nm and 720 nm. In some embodiments, the quenching moiety quenches a detection moiety that emits fluorescence at a wavelength of 700 nm or higher. In other embodiments, the quenching moiety quenches a detection moiety that emits fluorescence at about 660 nm or about 670 nm. In some embodiments, the quenching moiety quenches a detection moiety that emits fluorescence in the range of 500 to 520, 500 to 540, 500 to 590, 590 to 600, 600 to 610, 610 to 620, 620 to 630, 630 to 640, 640 to 650, 650 to 660, 660 to 670, 670 to 680, 690 to 690, 690 to 700, 700 to 710, 710 to 720, or 720 to 730 nm. In some embodiments, the quenching moiety quenches a detection moiety that emits fluorescence in the range 450 nm to 750 nm, 500 nm to 650 nm, or 550 to 650 nm. A quenching moiety may quench fluorescein amidite, 6-Fluorescein, IRDye 700, TYE 665, Alex Fluor 594, or ATTO TM 633 (NHS Ester). A quenching moiety may be Iowa Black RQ, Iowa Black FQ or IRDye QC-1 Quencher. A quenching moiety may quench fluorescein amidite, 6-Fluorescein (Integrated DNA Technologies), IRDye 700 (Integrated DNA Technologies), TYE 665 (Integrated DNA Technologies), Alex Fluor 594 (Integrated DNA Technologies), or ATTO TM 633 (NHS Ester) (Integrated DNA Technologies). A quenching moiety may be Iowa Black RQ (Integrated DNA Technologies), Iowa Black FQ (Integrated DNA Technologies) or IRDye QC-1 Quencher (LiCor). Any of the quenching moieties described herein may be from any commercially available source, may be an alternative with a similar function, a generic, or a non-tradename of the quenching moieties listed.
[0435] The generation of the detectable signal from the release of the detection moiety may indicate that cleavage by the effector protein has occurred and that the sample contains the target nucleic acid. In some embodiments, the detection moiety comprises a fluorescent dye. Sometimes the detection moiety comprises a fluorescence resonance energy transfer (FRET) pair. In some embodiments, the detection moiety comprises an infrared (IR) dye. In some embodiments, the detection moiety comprises an ultraviolet (UV) dye. Alternatively, or in combination, the detection moiety comprises a protein. Sometimes the detection moiety comprises a biotin. Sometimes the detection moiety comprises at least one of avidin or streptavidin. In some embodiments, the detection moiety comprises a polysaccharide, a polymer, or a nanoparticle. In some embodiments, the detection moiety comprises a gold nanoparticle or a latex nanoparticle.
[0436] A detection moiety may be any moiety capable of generating a calorimetric, potentiometric, amperometric, optical (e.g., fluorescent, colorimetric, etc.), or piezo-electric signal. A nucleic acid of a reporter, sometimes, is protein-nucleic acid that is capable of generating a calorimetric, potentiometric, amperometric, optical (e.g., fluorescent, colorimetric, etc.), or piezo-electric signal upon cleavage of the nucleic acid. Often a calorimetric signal is heat produced after cleavage of the nucleic acids of a reporter. Sometimes, a calorimetric signal is heat absorbed after cleavage of the nucleic acids of a reporter. A potentiometric signal, for example, is electrical potential produced after cleavage of the nucleic acids of a reporter. An amperometric signal may be movement of electrons produced after the cleavage of nucleic acid of a reporter. Often, the signal is an optical signal, such as a colorimetric signal or a fluorescence signal. An optical signal is, for example, a light output produced after the cleavage of the nucleic acids of a reporter. Sometimes, an optical signal is a change in light absorbance between before and after the cleavage of nucleic acids of a reporter. Often, a piezo-electric signal is a change in mass between before and after the cleavage of the nucleic acid of a reporter.
[0437] The detectable signal may be a colorimetric signal or a signal visible by eye. In some embodiments, the detectable signal may be fluorescent, electrical, chemical, electrochemical, or magnetic. In some embodiments, the first detection signal may be generated by interaction of the detection moiety to the capture molecule in the detection region, where the first detection signal indicates that the sample contained the target nucleic acid. Sometimes systems are capable of detecting more than one type of target nucleic acid, wherein the system comprises more than one type of guide nucleic acid and more than one type of reporter nucleic acid. In some embodiments, the detectable signal may be generated directly by the cleavage event. Alternatively, or in combination, the detectable signal may be generated indirectly by the signal event. Sometimes the detectable signal is not a fluorescent signal. In some embodiments, the detectable signal may be a colorimetric or color-based signal. In some embodiments, the detected target nucleic acid may be identified based on its spatial location on the detection region of the support medium. In some embodiments, the second detectable signal may be generated in a spatially distinct location than the first generated signal.
[0438] In some embodiments, the reporter nucleic acid is a single-stranded nucleic acid sequence comprising ribonucleotides. The nucleic acid of a reporter may be a single-stranded nucleic acid sequence comprising at least one ribonucleotide. In some embodiments, the nucleic acid of a reporter is a single-stranded nucleic acid comprising at least one ribonucleotide residue at an internal position that functions as a cleavage site. In some embodiments, the nucleic acid of a reporter comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 ribonucleotide residues at an internal position. In some embodiments, the nucleic acid of a reporter comprises from 2 to 10, from 3 to 9, from 4 to 8, or from 5 to 7 ribonucleotide residues at an internal position. Sometimes the ribonucleotide residues are continuous. Alternatively, the ribonucleotide residues are interspersed in between non-ribonucleotide residues. In some embodiments, the nucleic acid of a reporter has only ribonucleotide residues. In some embodiments, the nucleic acid of a reporter has only DNA residues. In some embodiments, the nucleic acid comprises nucleotides resistant to cleavage by the effector protein described herein. In some embodiments, the nucleic acid of a reporter comprises synthetic nucleotides. In some embodiments, the nucleic acid of a reporter comprises at least one ribonucleotide residue and at least one non-ribonucleotide residue.
[0439] In some embodiments, the nucleic acid of a reporter comprises at least one uracil ribonucleotide. In some embodiments, the nucleic acid of a reporter comprises at least two uracil ribonucleotides. Sometimes the nucleic acid of a reporter has only uracil ribonucleotides. In some embodiments, the nucleic acid of a reporter comprises at least one adenine ribonucleotide. In some embodiments, the nucleic acid of a reporter comprises at least two adenine ribonucleotides. In some embodiments, the nucleic acid of a reporter has only adenine ribonucleotides. In some embodiments, the nucleic acid of a reporter comprises at least one cytosine ribonucleotide. In some embodiments, the nucleic acid of a reporter comprises at least two cytosine ribonucleotides. In some embodiments, the nucleic acid of a reporter comprises at least one guanine ribonucleotide. In some embodiments, the nucleic acid of a reporter comprises at least two guanine ribonucleotides. In some embodiments, a nucleic acid of a reporter comprises a single unmodified ribonucleotide. In some embodiments, a nucleic acid of a reporter comprises only unmodified DNAs.
[0440] In some embodiments, the nucleic acid of a reporter is 5 to 20, 5 to 15, 5 to 10, 7 to 20, 7 to 15, or 7 to 10 nucleotides in length. In some embodiments, the nucleic acid of a reporter is 3 to 20, 4 to 10, 5 to 10, or 5 to 8 nucleotides in length. In some embodiments, the nucleic acid of a reporter is 5 to 12 nucleotides in length. In some embodiments, the reporter nucleic acid is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 nucleotides in length. In some embodiments, the reporter nucleic acid is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
[0441] In some embodiments, systems comprise a plurality of reporters. The plurality of reporters may comprise a plurality of signals. In some embodiments, systems comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 30, at least 40, or at least 50 reporters. In some embodiments, there are 2 to 50, 3 to 40, 4 to 30, 5 to 20, or 6 to 10 different reporters.
[0442] Herein, detection of reporter cleavage to determine the presence of a target nucleic acid may be referred to as DETECTR. In some embodiments described herein is a method of assaying for a target nucleic acid in a sample comprising contacting the target nucleic acid with an effector protein, a non-naturally occurring guide nucleic acid that hybridizes to a segment of the target nucleic acid, and a reporter nucleic acid, and assaying for a change in a signal, wherein the change in the signal is produced by cleavage of the reporter nucleic acid.
[0443] In the presence of a large amount of non-target nucleic acids, an activity of an effector protein (e.g., an effector protein as disclosed herein) may be inhibited. This is because the activated effector proteins collaterally cleave any nucleic acids. If total nucleic acids are present in large amounts, they may outcompete reporters for the effector proteins. In some embodiments, systems comprise an excess of reporter(s), such that when the system is operated and a solution of the system comprising the reporter is combined with a sample comprising a target nucleic acid, the concentration of the reporter in the combined solution-sample is greater than the concentration of the target nucleic acid. In some embodiments, the sample comprises amplified target nucleic acid. In some embodiments, the sample comprises an unamplified target nucleic acid. In some embodiments, the concentration of the reporter is greater than the concentration of target nucleic acids and non-target nucleic acids. The non-target nucleic acids may be from the original sample, either lysed or unlysed. The non-target nucleic acids may comprise byproducts of amplification. In some embodiments, systems comprise a reporter wherein the concentration of the reporter in a solution is 1.5 fold, at least 2 fold, at least 3 fold, at least 4 fold, at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, at least 10 fold, at least 11 fold, at least 12 fold, at least 13 fold, at least 14 fold, at least 15 fold, at least 16 fold, at least 17 fold, at least 18 fold, at least 19 fold, at least 20 fold, at least 30 fold, at least 40 fold, at least 50 fold, at least 60 fold, at least 70 fold, at least 80 fold, at least 90 fold, at least 100 fold excess of total nucleic acids. In some embodiments, systems comprise a reporter wherein the concentration of the reporter in a solution is 1.5 fold to 100 fold, 2 fold to 10 fold, 10 fold to 20 fold, 20 fold to 30 fold, 30 fold to 40 fold, 40 fold to 50 fold, 50 fold to 60 fold, 60 fold to 70 fold, 70 fold to 80 fold, 80 fold to 90 fold, 90 fold to 100 fold, 1.5 fold to 10 fold, 1.5 fold to 20 fold, 10 fold to 40 fold, 20 fold to 60 fold, or 10 fold to 80 fold excess of total nucleic acids.
Amplification Reagents/Components
[0444] In some embodiments, systems described herein comprise a reagent or component for amplifying a nucleic acid. Non-limiting examples of reagents for amplifying a nucleic acid include polymerases, primers, and nucleotides. In some embodiments, systems comprise reagents for nucleic acid amplification of a target nucleic acid in a sample. Nucleic acid amplification of the target nucleic acid may improve at least one of sensitivity, specificity, or accuracy of the assay in detecting the target nucleic acid. In some embodiments, nucleic acid amplification is isothermal nucleic acid amplification, providing for the use of the system or system in remote regions or low resource settings without specialized equipment for amplification. In some embodiments, amplification of the target nucleic acid increases the concentration of the target nucleic acid in the sample relative to the concentration of nucleic acids that do not correspond to the target nucleic acid.
[0445] The reagents for nucleic acid amplification may comprise a recombinase, an oligonucleotide primer, a single-stranded DNA binding (SSB) protein, a polymerase, or a combination thereof that is suitable for an amplification reaction. Non-limiting examples of amplification reactions are transcription mediated amplification (TMA), helicase dependent amplification (HDA), or circular helicase dependent amplification (cHDA), strand displacement amplification (SDA), recombinase polymerase amplification (RPA), loop mediated amplification (LAMP), exponential amplification reaction (EXPAR), rolling circle amplification (RCA), ligase chain reaction (LCR), simple method amplifying RNA targets (SMART), single primer isothermal amplification (SPIA), multiple displacement amplification (MDA), nucleic acid sequence based amplification (NASBA), hinge-initiated primer-dependent amplification of nucleic acids (HIP), nicking enzyme amplification reaction (NEAR), and improved multiple displacement amplification (IMDA).
[0446] In some embodiments, systems described herein comprise a PCR tube, a PCR well or a PCR plate. In some embodiments, the wells of the PCR plate may be pre-aliquoted with the reagent for amplifying a nucleic acid, as well as a guide nucleic acid, an effector protein, a multimeric complex, or any combination thereof.
[0447] In some embodiments, systems comprise a PCR plate; a guide nucleic acid targeting a target sequence; an effector protein capable of being activated when complexed with the guide nucleic acid and the target sequence; and a single stranded reporter nucleic acid comprising a detection moiety, wherein the reporter nucleic acid is capable of being cleaved by the activated nuclease, thereby generating a detectable signal.
[0448] In some embodiments, systems described herein comprise a support medium; a guide nucleic acid targeting a target sequence; and an effector protein capable of being activated when complexed with the guide nucleic acid and the target sequence. In some embodiments, nucleic acid amplification is performed in a nucleic acid amplification region on the support medium. Alternatively, or in combination, the nucleic acid amplification is performed in a reagent chamber, and the resulting sample is applied to the support medium.
[0449] In some embodiments, a system described herein for editing a target nucleic acid comprises a PCR plate; a guide nucleic acid targeting a target sequence; and an effector protein capable of being activated when complexed with the guide nucleic acid and the target sequence. In some embodiments, the wells of the PCR plate may be pre-aliquoted with the guide nucleic acid targeting a target sequence, and an effector protein capable of being activated when complexed with the guide nucleic acid and the target sequence. A user may thus add the biological sample of interest to a well of the pre-aliquoted PCR plate.
[0450] In some embodiments, wells of the PCR plate may be pre-aliquoted with a guide nucleic acid targeting a target sequence, an effector protein capable of being activated when complexed with the guide nucleic acid and the target sequence, and at least one population of a single stranded reporter nucleic acid comprising a detection moiety. In some embodiments, the reporter nucleic acid is capable of being cleaved by the activated nuclease, thereby generating a detectable signal. A user may thus add the biological sample of interest to a well of the pre-aliquoted PCR plate and measure for the detectable signal with a fluorescent light reader or a visible light reader.
[0451] In some embodiments, amplification reaction of nucleic acid as described herein is performed for no greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or 60 minutes, or any value 1 to 60 minutes. In some embodiments, the amplification reaction is performed for 1 to 60, 5 to 55, 10 to 50, 15 to 45, 20 to 40, or 25 to 35 minutes. In some embodiments, the amplification reaction is performed at a temperature of around 20-45? C. In some embodiments, the amplification reaction is performed at a temperature no greater than 20? C., 25? C., 30? C., 35? C., 37? C., 40? C., 45? C., or any value 20? C. to 45? C. In some embodiments, the amplification reaction is performed at a temperature of at least 20? C., 25? C., 30? C., 35? C., 37? C., 40? C., or 45? C., or any value 20? C. to 45? C.
[0452] In some embodiments, the amplification reaction is performed at a temperature of 20? C. to 45? C., 25? C. to 40? C., 30? C. to 40? C., or 35? C. to 40? C.
[0453] In some embodiments, systems comprise primers for amplifying a target nucleic acid to produce an amplification product comprising the target nucleic acid and a PAM. In some embodiments, at least one of the primers may comprise the PAM that is incorporated into the amplification product during amplification. The compositions for amplification of target nucleic acids and methods of use thereof, as described herein, are compatible with any of the methods disclosed herein including methods of assaying for at least one base difference (e.g., assaying for a SNP or a base mutation) in a target nucleic acid, methods of assaying for a target nucleic acid that lacks a PAM by amplifying the target nucleic acid to introduce a PAM, and compositions used in introducing a PAM by amplification into the target nucleic acid.
Additional System Components
[0454] In some embodiments, systems include a package, carrier, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein. Suitable containers include, for example, test wells, bottles, vials, and test tubes. In some embodiments, the containers are formed from a variety of materials such as glass, plastic, or polymers. In some embodiments, the system or systems described herein contain packaging materials. Examples of packaging materials include, but are not limited to, pouches, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for intended mode of use.
[0455] In some embodiments, systems described herein include labels listing contents and/or instructions for use, or package inserts with instructions for use. In some embodiments, the systems include a set of instructions and/or a label is on or associated with the container. In some embodiments, the label is on a container when letters, numbers or other characters forming the label are attached, molded, or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container (e.g., as a package insert). In some embodiments, the label is used to indicate that the contents are to be used for a specific therapeutic application. In some embodiments, the label indicates directions for use of the contents, such as in the methods described herein. In some embodiments, after packaging the formed product and wrapping or boxing to maintain a sterile barrier, the product is terminally sterilized by heat sterilization, gas sterilization, gamma irradiation, or by electron beam sterilization. Alternatively, in some embodiments, the product is prepared and packaged by aseptic processing.
[0456] In some embodiments, systems comprise a solid support. An RNP or effector protein may be attached to a solid support. The solid support may be an electrode or a bead. The bead may be a magnetic bead. Upon cleavage, the RNP is liberated from the solid support and interacts with other mixtures. For example, upon cleavage of the nucleic acid of the RNP, the effector protein of the RNP flows through a chamber into a mixture comprising a substrate. When the effector protein meets the substrate, a reaction occurs, such as a colorimetric reaction, which is then detected. As another example, the protein is an enzyme substrate, and upon cleavage of the nucleic acid of the enzyme substrate-nucleic acid, the enzyme flows through a chamber into a mixture comprising the enzyme. When the enzyme substrate meets the enzyme, a reaction occurs, such as a calorimetric reaction, which is then detected.
Certain System Conditions
[0457] In some embodiments, systems and methods are employed under certain conditions that enhance an activity of the effector protein relative to alternative conditions, as measured by a detectable signal released from cleavage of a reporter in the presence of the target nucleic acid. In some embodiments, the reporter nucleic acid is a homopolymeric reporter nucleic acid comprising 5 to 20 consecutive adenines, 5 to 20 consecutive thymines, 5 to 20 consecutive cytosines, or 5 to 20 consecutive guanines. In some embodiments, the reporter is an RNA-FQ reporter.
[0458] In some embodiments, effector proteins disclosed herein recognize, bind, or are activated by, different target nucleic acids having different sequences, but are active toward the same reporter nucleic acid, allowing for facile multiplexing in a single assay having a single ssRNA-FQ reporter.
[0459] In some embodiments, systems and methods are employed under certain conditions that enhance cis-cleavage activity of the effector protein.
[0460] Certain conditions that may enhance the activity of an effector protein include a certain salt presence or salt concentration of the solution in which the activity occurs. For example, cis-cleavage activity of an effector protein may be inhibited or halted by a high salt concentration. The salt may be a sodium salt, a potassium salt, or a magnesium salt. In some embodiments, the salt is NaCl. In some embodiments, the salt is KNO.sub.3. In some embodiments, the salt concentration is less than 150 mM, less than 125 mM, less than 100 mM, less than 75 mM, less than 50 mM, or less than 25 mM.
[0461] Certain conditions that may enhance the activity of an effector protein include the pH of a solution in which the activity. In some embodiments, the pH is about 7, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, about 8, about 8.1, about 8.2, about 8.3, about 8.4, about 8.5, about 8.6, about 8.7, about 8.8, about 8.9, or about 9. In some embodiments, the pH is 7 to 7.5, 7.5 to 8, 8 to 8.5, 8.5 to 9, or 7 to 8.5. In some embodiments, the pH is less than 7. In some embodiments, the pH is greater than 7.
[0462] Certain conditions that may enhance the activity of an effector protein includes the temperature at which the activity is performed. In some embodiments, the temperature is about 25? C. to about 50? C. In some embodiments, the temperature is about 20? C. to about 40? C., about 30? C. to about 50? C., or about 40? C. to about 60? C. In some embodiments, the temperature is about 25? C., about 30? C., about 35? C., about 40? C., about 45? C., or about 50? C.
XI. Methods and Formulations for Introducing System Components and Compositions into a Target Cell
[0463] A guide nucleic acid (or a nucleic acid comprising a nucleotide sequence encoding same) and/or an effector protein described herein may be introduced into a host cell by any of a variety of well-known methods. As a non-limiting example, a guide nucleic acid and/or effector protein may be combined with a lipid. As another non-limiting example, a guide nucleic acid and/or effector protein may be combined with a particle or formulated into a particle.
Methods for Introducing System Components and Compositions to a Host
[0464] Described herein are methods of introducing various components described herein to a host. A host may be any suitable host, such as a host cell. When described herein, a host cell may be an in vivo or in vitro eukaryotic cell, a prokaryotic cell (e.g., bacterial or archaeal cell), or a cell from a multicellular organism (e.g., a cell line) cultured as a unicellular entity, which eukaryotic or prokaryotic cells may be, or have been, used as recipients for methods of introduction described herein, and include the progeny of the original cell which has been transformed by the methods of introduction described herein. It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation. A host cell may be a recombinant host cell or a genetically modified host cell, if a heterologous nucleic acid, e.g., an expression vector, has been introduced into the cell.
[0465] Methods of introducing a nucleic acid and/or protein into a host cell are known in the art, and any convenient method may be used to introduce a subject nucleic acid (e.g., an expression construct/vector) into a target cell (e.g., a human cell, and the like). Suitable methods include, e.g., viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle-mediated nucleic acid delivery (see, e.g., Panyam et al. Adv Drug Deliv Rev. 2012 Sep. 13. pii: S0169-409X(12)00283-9. doi: 10.1016/j.addr.2012.09.023), and the like. In some embodiments, the nucleic acid and/or protein are introduced into a disease cell comprised in a pharmaceutical composition comprising the guide nucleic acid and/or effector protein and a pharmaceutically acceptable excipient.
[0466] In some embodiments, molecules of interest, such as nucleic acids of interest, are introduced to a host. In some embodiments, polypeptides, such as an effector protein are introduced to a host. In some embodiments, vectors, such as lipid particles and/or viral vectors may be introduced to a host. Introduction may be for contact with a host or for assimilation into the host, for example, introduction into a host cell.
[0467] In some embodiments, described herein are methods of introducing one or more nucleic acids, such as a nucleic acid encoding an effector protein, a nucleic acid that, when transcribed, produces an engineered guide nucleic acid, and/or a donor nucleic acid, or combinations thereof, into a host cell. Any suitable method may be used to introduce a nucleic acid into a cell. Suitable methods include, for example, viral infection, transfection, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like. Further methods are described throughout.
[0468] Introducing one or more nucleic acids into a host cell may occur in any culture media and under any culture conditions that promote the survival of the cells. Introducing one or more nucleic acids into a host cell may be carried out in vivo or ex vivo. Introducing one or more nucleic acids into a host cell may be carried out in vitro.
[0469] In some embodiments, an effector protein may be provided as RNA. The RNA may be provided by direct chemical synthesis or may be transcribed in vitro from a DNA (e.g., encoding the effector protein). Once synthesized, the RNA may be introduced into a cell by way of any suitable technique for introducing nucleic acids into cells (e.g., microinjection, electroporation, transfection, etc.). In some embodiments, introduction of one or more nucleic acid may be through the use of a vector and/or a vector system, accordingly, in some embodiments, compositions and system described herein comprise a vector and/or a vector system.
[0470] Vectors may be introduced directly to a host. In some embodiments, host cells may be contacted with one or more vectors as described herein, and in some embodiments, said vectors are taken up by the cells. Methods for contacting cells with vectors include but are not limited to electroporation, calcium chloride transfection, microinjection, lipofection, micro-injection, contact with the cell or particle that comprises a molecule of interest, or a package of cells or particles that comprise molecules of interest.
[0471] Components described herein may also be introduced directly to a host. For example, an engineered guide nucleic acid may be introduced to a host, specifically introduced into a host cell. Methods of introducing nucleic acids, such as RNA into cells include, but are not limited to direct injection, transfection, or any other method used for the introduction of nucleic acids.
[0472] Polypeptides (e.g., effector proteins) described herein may also be introduced directly to a host. In some embodiments, polypeptides described herein may be modified to promote introduction to a host. For example, polypeptides described herein may be modified to increase the solubility of the polypeptide. Such a polypeptide may optionally be fused to a polypeptide domain that increases solubility. The domain may be linked to the polypeptide through a defined protease cleavage site, such as TEV sequence which is cleaved by TEV protease. The linker may also include one or more flexible sequences, e.g. from 1 to 10 glycine residues. In some embodiments, the cleavage of the polypeptide is performed in a buffer that maintains solubility of the product, e.g. in the presence of from 0.5 to 2 M urea, in the presence of polypeptides and/or polynucleotides that increase solubility, and the like. Domains of interest include endosomolytic domains, e.g. influenza HA domain; and other polypeptides that aid in production, e.g. IF2 domain, GST domain, GRPE domain, and the like. In another example, the polypeptide may be modified to improve stability. For example, the polypeptides may be PEGylated, where the polyethyleneoxy group provides for enhanced lifetime in the blood stream. Polypeptides may also be modified to promote uptake by a host, such as a host cell. For example, a polypeptide described herein may be fused to a polypeptide permeant domain to promote uptake by a host cell. Any suitable permeant domains may be used in the non-integrating polypeptides of the present disclosure, including peptides, peptidomimetics, and non-peptide carriers. Examples include penetratin, a permeant peptide may be derived from the third alpha helix of Drosophila melanogaster transcription factor Antennapaedia; the HIV-1 tat basic region amino acid sequence, e.g., amino acids 49-57 of a naturally-occurring tat protein; and poly-arginine motifs, for example, the region of amino acids 34-56 of HIV-1 rev protein, nonaarginine, octa-arginine, and the like. The site at which the fusion is made may be selected in order to optimize the biological activity, secretion or binding characteristics of the polypeptide. The optimal site may be determined by suitable methods.
Formulations for Introducing System Components and Compositions to a Host
[0473] Described herein are formulations of introducing compositions or components of a system described herein to a host. In some embodiments, such formulations, systems and compositions described herein comprise an effector protein and a carrier (e.g., excipient, diluent, vehicle, or filling agent). In some aspects of the present disclosure, the effector protein is provided in a pharmaceutical composition comprising the effector protein and any pharmaceutically acceptable excipient, carrier, or diluent.
XII. Methods of Modifying a Nucleic Acid
[0474] Provided herein are compositions, methods, and systems for modifying (e.g., editing) target nucleic acids. In general, modifying refers to changing the physical composition of a target nucleic acid. However, compositions, methods, and systems disclosed herein may also be capable of modifying target nucleic acids, such as making epigenetic modifications of target nucleic acids, which does not change the nucleotide sequence of the target nucleic acids per se. Effector proteins, compositions and systems described herein may be used for modifying a target nucleic acid, which includes editing a target nucleic acid sequence. Modifying a target nucleic acid may comprise one or more of: cleaving the target nucleic acid, deleting one or more nucleotides of the target nucleic acid, inserting one or more nucleotides into the target nucleic acid, mutating one or more nucleotides of the target nucleic acid, or otherwise changing one or more nucleotides of the target nucleic acid. Modifying a target nucleic acid may comprise one or more of: methylating, demethylating, deaminating, or oxidizing one or more nucleotides of the target nucleic acid.
[0475] Compositions, methods, and systems described herein may modify a coding portion of a gene, a non-coding portion of a gene, or a combination thereof. Modifying at least one gene using the compositions, methods or systems described herein may reduce or increase expression of one or more genes. In some embodiments, the compositions, methods or systems reduce expression of one or more genes by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%. In some embodiments, the compositions, methods or systems remove all expression of a gene, also referred to as genetic knock out. In some embodiments, the compositions, methods or systems increase expression of one or more genes by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.
[0476] In some embodiments, the compositions, methods or systems comprise a nucleic acid expression vector, or use thereof, to introduce an effector protein, guide nucleic acid, donor template or any combination thereof to a cell. In some embodiments, the nucleic acid expression vector is a viral vector. Viral vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, and herpes simplex viruses. In some embodiments, the viral vector is a replication-defective viral vector, comprising an insertion of a therapeutic gene inserted in genes essential to the lytic cycle, preventing the virus from replicating and exerting cytotoxic effects. In some embodiments, the viral vector is an adeno associated viral (AAV) vector. In some embodiments, the nucleic acid expression vector is a non-viral vector. In some embodiments, compositions and methods comprise a lipid, polymer, nanoparticle, or a combination thereof, or use thereof, to introduce a Cas protein, guide nucleic acid, donor template or any combination thereof to a cell. Non-limiting examples of lipids and polymers are cationic polymers, cationic lipids, or bio-responsive polymers. In some embodiments, the bio-responsive polymer exploits chemical-physical properties of the endosomal environment (e.g., pH) to preferentially release the genetic material in the intracellular space.
[0477] Methods of modifying may comprise contacting a target nucleic acid with one or more components, compositions or systems described herein. In some embodiments, a method of modifying comprises contacting a target nucleic acid with at least one of: a) one or more effector proteins, or one or more nucleic acids encoding one or more effector proteins; or b) one or more guide nucleic acids, or one or more nucleic acids encoding one or more guide nucleic acids. In some embodiments, a method of modifying comprises contacting a target nucleic acid with a system described herein wherein the system comprises components comprising at least one of: a) one or more effector proteins, or one or more nucleic acids encoding one or more effector proteins; or b) one or more guide nucleic acids, or one or more nucleic acids encoding one or more guide nucleic acids. In some embodiments, a method of modifying comprises contacting a target nucleic acid with a composition described herein comprising at least one of: a) one or more effector proteins, or one or more nucleic acids encoding one or more effector proteins; or b) one or more guide nucleic acids, or one or more nucleic acids encoding one or more guide nucleic acids; in a composition.
[0478] Editing a target nucleic acid sequence may introduce a mutation (e.g., point mutations, deletions) in a target nucleic acid relative to a corresponding wildtype nucleotide sequence. Editing may remove or correct a disease-causing mutation in a nucleic acid sequence to produce a corresponding wildtype nucleotide sequence. Editing a target nucleic acid sequence may remove/correct point mutations, deletions, null mutations, or tissue-specific mutations in a target nucleic acid. Editing a target nucleic acid sequence may be used to generate gene knock-out, gene knock-in, gene editing, gene tagging, or a combination thereof. Methods of the disclosure may be targeted to any locus in a genome of a cell.
[0479] Modifying may comprise single stranded cleavage, double stranded cleavage, donor nucleic acid insertion, epigenetic modification (e.g., methylation, demethylation, acetylation, or deacetylation), or a combination thereof. In some embodiments, cleavage (single-stranded or double-stranded) is site-specific, meaning cleavage occurs at a specific site in the target nucleic acid, often within the region of the target nucleic acid that hybridizes with the guide nucleic acid spacer sequence. In some embodiments, the effector proteins introduce a single-stranded break in a target nucleic acid to produce a cleaved nucleic acid. In some embodiments, the effector protein is capable of introducing a break in a single stranded RNA (ssRNA). The effector protein may be coupled to a guide nucleic acid that targets a particular region of interest in the ssRNA. In some embodiments, the target nucleic acid, and the resulting cleaved nucleic acid is contacted with a nucleic acid for homologous recombination (e.g., homology directed repair (HDR)) or non-homologous end joining (NHEJ). In some embodiments, a double-stranded break in the target nucleic acid may be repaired (e.g., by NHEJ or HDR) without insertion of a donor template, such that the repair results in an indel in the target nucleic acid at or near the site of the double-stranded break. In some embodiments, an indel, sometimes referred to as an insertion-deletion or indel mutation, is a type of genetic mutation that results from the insertion and/or deletion of one or more nucleotide in a target nucleic acid. An indel may vary in length (e.g., 1 to 1,000 nucleotides in length) and be detected using methods well known in the art, including sequencing. If the number of nucleotides in the insertion/deletion is not divisible by three, and it occurs in a protein coding region, it is also a frameshift mutation. Indel percentage is the percentage of sequencing reads that show at least one nucleotide has been mutation that results from the insertion and/or deletion of nucleotides regardless of the size of insertion or deletion, or number of nucleotides mutated. For example, if there is at least one nucleotide deletion detected in a given target nucleic acid, it counts towards the percent indel value. As another example, if one copy of the target nucleic acid has one nucleotide deleted, and another copy of the target nucleic acid has 10 nucleotides deleted, they are counted the same. This number reflects the percentage of target nucleic acids that are edited by a given effector protein.
[0480] In some embodiments, methods of modifying described herein cleave a target nucleic acid at one or more locations to generate a cleaved target nucleic acid. In some embodiments, the cleaved target nucleic acid undergoes recombination (e.g., NHEJ or HDR). In some embodiments, cleavage in the target nucleic acid may be repaired (e.g., by NHEJ or HDR) without insertion of a donor nucleic acid, such that the repair results in an indel in the target nucleic acid at or near the site of the cleavage site. In some embodiments, cleavage in the target nucleic acid may be repaired (e.g., by NHEJ or HDR) with insertion of a donor nucleic acid, such that the repair results in an indel in the target nucleic acid at or near the site of the cleavage site.
[0481] In some embodiments, wherein the compositions, systems, and methods of the present disclosure comprise an additional guide nucleic acid or a use thereof, and such dual-guided compositions, systems, and methods described herein may modify the target nucleic acid in two locations. In some embodiments, dual-guided modifying may comprise cleavage of the target nucleic acid in the two locations targeted by the guide nucleic acids. In some embodiments, upon removal of the sequence between the guide nucleic acids, the wild-type reading frame is restored. A wild-type reading frame may be a reading frame that produces at least a partially, or fully, functional protein. A non-wild-type reading frame may be a reading frame that produces a non-functional or partially non-functional protein. The term functional protein refers to protein that retains at least some if not all activity relative to the wildtype protein. A functional protein can also include a protein having enhanced activity relative to the wildtype protein. Assays are known and available for detecting and quantifying protein activity, e.g., colorimetric and fluorescent assays. In some instances, a functional protein is a wildtype protein. In some instances, a functional protein is a functional portion of a wildtype protein.
[0482] Accordingly, in some embodiments, compositions, systems, and methods described herein may edit 1 to 1,000 nucleotides or any integer in between, in a target nucleic acid. In some embodiments, 1 to 1,000, 2 to 900, 3 to 800, 4 to 700, 5 to 600, 6 to 500, 7 to 400, 8 to 300, 9 to 200, or 10 to 100 nucleotides, or any integer in between, may be edited by the compositions, systems, and methods described herein. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides may be edited by the compositions, systems, and methods described herein. In some embodiments, 10, 20, 30, 40, 50, 60, 70, 80 90, 100 or more nucleotides, or any integer in between, may be edited by the compositions, systems, and methods described herein. In some embodiments, 100, 200, 300, 400, 500, 600, 700, 800, 900 or more nucleotides, or any integer in between, may be edited by the compositions, systems, and methods described herein.
[0483] Methods may comprise use of two or more effector proteins. An illustrative method for introducing a break in a target nucleic acid comprises contacting the target nucleic acid with: (a) a first engineered guide nucleic acid comprising a region that binds to a first effector protein described herein; and (b) a second engineered guide nucleic acid comprising a region that binds to a second effector protein described herein, wherein the first engineered guide nucleic acid comprises an additional region that hybridizes to the target nucleic acid and wherein the second engineered guide nucleic acid comprises an additional region that hybridizes to the target nucleic acid. In some embodiments, the first and second effector protein are identical. In some embodiments, the first and second effector protein are not identical.
[0484] In some embodiments, editing a target nucleic acid comprises genome editing. Genome editing may comprise editing a genome, chromosome, plasmid, or other genetic material of a cell or organism. In some embodiments, the genome, chromosome, plasmid, or other genetic material of the cell or organism is modified in vivo. In some embodiments, the genome, chromosome, plasmid, or other genetic material of the cell or organism is modified in a cell. In some embodiments, the genome, chromosome, plasmid, or other genetic material of the cell or organism is modified in vitro. For example, a plasmid may be edited in vitro using a composition described herein and introduced into a cell or organism.
[0485] In some embodiments, editing a target nucleic acid may comprise deleting a sequence from a target nucleic acid. For example, a mutated sequence or a sequence associated with a disease may be removed from a target nucleic acid. In some embodiments, editing a target nucleic acid may comprise replacing a sequence in a target nucleic acid with a second sequence. For example, a mutated sequence or a sequence associated with a disease may be replaced with a second sequence lacking the mutation or that is not associated with the disease. In some embodiments, editing a target nucleic acid may comprise introducing a sequence into a target nucleic acid. For example, a beneficial sequence or a sequence that may reduce or eliminate a disease may be inserted into the target nucleic acid.
[0486] In some embodiments, methods comprise inserting a donor nucleic acid into a cleaved target nucleic acid. The donor nucleic acid may be inserted at a specified (e.g., effector protein targeted) point within the target nucleic acid. In some embodiments, the cleaved target nucleic acid is cleaved at a single location. In such embodiments, the methods comprise contacting a target nucleic acid with an effector protein described herein, thereby introducing a single-stranded break in the target nucleic acid; and contacting the target nucleic acid with a donor nucleic acid for homologous recombination, optionally by HDR or NHEJ, thereby introducing a new sequence into the target nucleic acid (e.g., at a cleavage site). In some embodiments, the cleaved target nucleic acid is cleaved at two locations. In such embodiments, the methods comprise contacting a target nucleic acid with an effector protein described herein, thereby introducing a single-stranded break in the target nucleic acid; contacting the target nucleic acid with a second effector protein described herein, to generate a second cleavage site in the target nucleic acid, ligating the regions flanking the first and second cleavage site, optionally through NHEJ or single-strand annealing, thereby resulting in the excision of a portion of the target nucleic acid between the first and second cleavage sites from the target nucleic acid; and contacting the target nucleic acid with a donor nucleic acid for homologous recombination, optionally by HDR or NHEJ, thereby introducing a new sequence into the target nucleic acid (e.g., in between two cleavage sites).
[0487] In some embodiments, methods comprise editing a target nucleic acid with two or more effector proteins. Editing a target nucleic acid may comprise introducing a two or more single-stranded breaks in a target nucleic acid. In some embodiments, a break may be introduced by contacting a target nucleic acid with an effector protein and a guide nucleic acid. The guide nucleic acid may bind to the effector protein and hybridize to a region of the target nucleic acid, thereby recruiting the effector protein to the region of the target nucleic acid. Binding of the effector protein to the guide nucleic acid and the region of the target nucleic acid may activate the effector protein, and the effector protein may introduce a break (e.g., a single stranded break) in the region of the target nucleic acid. In some embodiments, editing a target nucleic acid may comprise introducing a first break in a first region of the target nucleic acid and a second break in a second region of the target nucleic acid. For example, editing a target nucleic acid may comprise contacting a target nucleic acid with a first guide nucleic acid that binds to a first effector protein and hybridizes to a first region of the target nucleic acid and a second guide nucleic acid that binds to a second programmable nickase and hybridizes to a second region of the target nucleic acid. The first effector protein may introduce a first break in a first strand at the first region of the target nucleic acid, and the second effector protein may introduce a second break in a second strand at the second region of the target nucleic acid. In some embodiments, a segment of the target nucleic acid between the first break and the second break may be removed, thereby editing the target nucleic acid. In some embodiments, a segment of the target nucleic acid between the first break and the second break may be replaced (e.g., with donor nucleic acid), thereby editing the target nucleic acid.
[0488] Methods, systems and compositions described herein may edit a target nucleic acid wherein such editing may effect one or more indels. In some embodiments, where compositions, systems, and/or methods described herein effect one or more indels, the impact on the transcription and/or translation of the target nucleic acid may be predicted depending on: 1) the amount of indels generated; and 2) the location of the indel on the target nucleic acid. For example, as described herein, in some embodiments, if the amount of indels is not divisible by three, and the indels occur within or along a protein coding region, then the edit or mutation may be a frameshift mutation. In some embodiments, if the amount of indels is divisible by three, then a frameshift mutation may not be effected, but a splicing disruption mutation and/or sequence skip mutation may be effected, such as an exon skip mutation. In some embodiments, if the amount of indels is not evenly divisible by three, then a frameshift mutation may be effected.
[0489] Methods, systems and compositions described herein may edit a target nucleic acid wherein such editing may be measured by indel activity. Indel activity measures the amount of change in a target nucleic acid (e.g., nucleotide deletion(s) and/or insertion(s)) compared to a target nucleic acid that has not been contacted by a polypeptide described in compositions, systems, and methods described herein. For example, indel activity may be detected by next generation sequencing of one or more target loci of a target nucleic acid where indel percentage is calculated as the fraction of sequencing reads containing insertions or deletions relative to an unedited reference sequence. In some embodiments, methods, systems, and compositions comprising an effector protein and guide nucleic acid described herein may exhibit about 0.0001% to about 65% or more indel activity upon contact to a target nucleic acid compared to a target nucleic acid non-contacted with compositions, systems, or by methods described herein. For example, methods, systems, and compositions comprising an effector protein and guide nucleic acid described herein may exhibit about 0.0001%, about 0.001%, about 0.01%, about 0.1%, about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65% or more indel activity.
[0490] In some embodiments, editing of a target nucleic acid as described herein effects one or more mutations comprising splicing disruption mutations, frameshift mutations (e.g., 1+ or 2+frameshift mutation), sequence deletion, sequence skipping, sequence reframing, sequence knock-in, or any combination thereof. In some embodiments, the splicing disruption can be an editing that disrupts a splicing of a target nucleic acid or a splicing of a sequence that is transcribed from a target nucleic acid relative to a target nucleic acid without the splicing disruption. In some embodiments, the frameshift mutation can be an editing that alters the reading frame of a target nucleic acid relative to a target nucleic acid without the frameshift mutation. In some embodiments, the frameshift mutation can be a +2 frameshift mutation, wherein a reading frame is edited by 2 bases. In some embodiments, the frameshift mutation can be a +1 frameshift mutation, wherein a reading frame is edited by 1 base. In some embodiments, the frameshift mutation is an editing that alters the number of bases in a target nucleic acid so that it is not divisible by three. In some embodiments, the frameshift mutation can be an editing that is not a splicing disruption. In some embodiments a sequence as described in reference to the sequence deletion, sequence skipping, sequence reframing, and sequence knock-in can be a DNA sequence, a RNA sequence, an edited DNA or RNA sequence, a mutated sequence, a wild-type sequence, a coding sequence, a non-coding sequence, an exonic sequence (exon), an intronic sequence (intron), or any combination thereof. In some embodiments, the sequence deletion is an editing where one or more sequences in a target nucleic acid are deleted relative to a target nucleic acid without the sequence deletion. In some embodiments, the sequence deletion can result in or effect a splicing disruption or a frameshift mutation. In some embodiments, the sequence deletion result in or effect a splicing disruption. In some embodiments, the sequence skipping is an editing where one or more sequences in a target nucleic acid are skipped upon transcription or translation of the target nucleic acid relative to a target nucleic acid without the sequence skipping. In some embodiments, the sequence skipping can result in or effect a splicing disruption or a frameshift mutation. In some embodiments, the sequence skipping can result in or effect a splicing disruption. In some embodiments, the sequence reframing is an editing where one or more bases in a target are edited so that the reading frame of the sequence is reframed relative to a target nucleic acid without the sequence reframing. In some embodiments, the sequence reframing can result in or effect a splicing disruption or a frameshift mutation. In some embodiments, the sequence reframing can result in or effect a frameshift mutation. In some embodiments, the sequence knock-in is an editing where one or more sequences is inserted into a target nucleic acid relative to a target nucleic acid without the sequence knock-in. In some embodiments, the sequence knock-in can result in or effect a splicing disruption or a frameshift mutation. In some embodiments, the sequence knock-in can result in or effect a splicing disruption.
[0491] In some embodiments, editing of a target nucleic acid can be locus specific, wherein compositions, systems, and methods described herein can edit a target nucleic acid at one or more specific loci to effect one or more specific mutations comprising splicing disruption mutations, frameshift mutations, sequence deletion, sequence skipping, sequence reframing, sequence knock-in, or any combination thereof. For example, editing of a specific locus can affect any one of a splicing disruption, frameshift (e.g., 1+ or 2+ frameshift), sequence deletion, sequence skipping, sequence reframing, sequence knock-in, or any combination thereof. In some embodiments, editing of a target nucleic acid can be locus specific, modification specific, or both. In some embodiments, editing of a target nucleic acid can be locus specific, modification specific, or both, wherein compositions, systems, and methods described herein comprise an effector protein described herein and a guide nucleic acid described herein.
[0492] Methods of editing a target nucleic acid or modulating the expression of a target nucleic acid may be performed in vivo. Methods of editing a target nucleic acid or modulating the expression of a target nucleic acid may be performed in vitro. For example, a plasmid may be edited in vitro using a composition described herein and introduced into a cell or organism. Methods of editing a target nucleic acid or modulating the expression of a target nucleic acid may be performed ex vivo. For example, methods may comprise obtaining a cell from a subject, editing a target nucleic acid in the cell with methods described herein, and returning the cell to the subject.
[0493] In some embodiments, methods of modifying described herein comprise contacting a target nucleic acid with one or more components, compositions or systems described herein. In some embodiments, the one or more components, compositions or systems described herein comprise at least one of: a) one or more effector proteins, or one or more nucleic acids encoding one or more effector proteins; and b) one or more guide nucleic acids, or one or more nucleic acids encoding one or more guide nucleic acids. In some embodiments, the one or more effector proteins introduce a single-stranded break or a double-stranded break in the target nucleic acid.
[0494] In some embodiments, methods of modifying described herein comprise using one or more guide nucleic acids or uses thereof, wherein the methods modify a target nucleic acid at a single location. In some embodiments, the methods comprise contacting an RNP comprising an effector protein and a guide nucleic acid to the target nucleic acid. In some embodiments, the methods introduce a mutation (e.g., point mutations, deletions) in the target nucleic acid relative to a corresponding wildtype nucleotide sequence. In some embodiments, the methods remove or correct a disease-causing mutation in a nucleic acid sequence to produce a corresponding wildtype nucleotide sequence. In some embodiments, the methods remove/correct point mutations, deletions, null mutations, or tissue-specific mutations in a target nucleic acid. In some embodiments, the methods introduce a single stranded cleavage, a nick, a deletion of one or two nucleotides, an insertion of one or two nucleotides, a substitution of one or two nucleotides, an epigenetic modification (e.g., methylation, demethylation, acetylation, or deacetylation), or a combination thereof to the target nucleic acid. In some embodiments, the methods comprise using an effector protein and two guide nucleic acids, wherein two RNPs cleave the target nucleic acid at the same location, wherein a first RNP comprises the effector protein and a first guide nucleic acid, and wherein a second RNP comprises the effector protein and a second guide nucleic acid. In some embodiments, methods comprising using two effector protein and two guide nucleic acids, wherein both RNPs cleave the target nucleic acid at the same location, wherein a first RNP comprises a first effector protein and a first target nucleic acid, and wherein a second RNP comprises a second effector protein and a second target nucleic acid.
[0495] In some embodiments, methods of modifying described herein comprise using one or more guide nucleic acids or uses thereof, wherein the methods modify a target nucleic acid at two different locations. In some embodiments, the methods introduce two cleavage sites in the target nucleic acid, wherein a first cleavage site and a second cleavage site comprise one or more nucleotides therebetween. In some embodiments, the methods cause deletion of the one or more nucleotides. In some embodiments, the deletion restores a wild-type reading frame. In some embodiments, the wild-type reading frame produces at least a partially functional protein. In some embodiments, the deletion causes a non-wild-type reading frame. In some embodiments, a non-wild-type reading frame produces a partially functional protein or non-functional protein. In some embodiments, the at least partially functional protein has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 180%, at least 200%, at least 300%, at least 400% activity compared to a corresponding wildtype protein. In some embodiments, the methods comprise using an effector protein and two guide nucleic acids, wherein two RNPs cleave the target nucleic acid at different locations, wherein a first RNP comprises the effector protein and a first guide nucleic acid, and wherein a second RNP comprises the effector protein and a second guide nucleic acid. In some embodiments, methods comprising using two effector protein and two guide nucleic acids, wherein both RNPs cleave the target nucleic acid at the same location, wherein a first RNP comprises a first effector protein and a first target nucleic acid, and wherein a second RNP comprises a second effector protein and a second target nucleic acid.
[0496] In some embodiments, methods of editing described herein comprise inserting a donor nucleic acid into a cleaved target nucleic acid. In some embodiments, the cleaved target nucleic acid formed by introducing a single-stranded break into a target nucleic acid. The donor nucleic acid may be inserted at a specified (e.g., effector protein targeted) point within the target nucleic acid. In some embodiments, the cleaved target nucleic acid is cleaved at a single location. In such embodiments, the methods comprise contacting a target nucleic acid with an effector protein described herein, thereby introducing a single-stranded break in the target nucleic acid; and contacting the target nucleic acid with a donor nucleic acid for homologous recombination, optionally by HDR or NHEJ, thereby introducing a new sequence into the target nucleic acid (e.g., at a cleavage site). In some embodiments, the cleaved target nucleic acid is cleaved at two locations. In such embodiments, the methods comprise contacting a target nucleic acid with an effector protein described herein, thereby introducing a single-stranded break in the target nucleic acid; contacting the target nucleic acid with a second effector protein described herein, to generate a second cleavage site in the target nucleic acid, ligating the regions flanking the first and second cleavage site, optionally through NHEJ or single-strand annealing, thereby resulting in the excision of a portion of the target nucleic acid between the first and second cleavage sites from the target nucleic acid; and contacting the target nucleic acid with a donor nucleic acid for homologous recombination, optionally by HDR or NHEJ, thereby introducing a new sequence into the target nucleic acid (e.g., in between two cleavage sites).
[0497] Provided herein are methods of modifying target nucleic acids or the expression thereof. In some embodiments, methods comprise editing a target nucleic acid. In general, editing refers to modifying the nucleobase sequence of a target nucleic acid. Also provided herein are methods of modulating the expression of a target nucleic acid. Fusion effector proteins and systems described herein may be used for such methods. Methods of editing a target nucleic acid may comprise one or more of cleaving the target nucleic acid, deleting one or more nucleotides of the target nucleic acid, inserting one or more nucleotides into the target nucleic acid, modifying one or more nucleotides of the target nucleic acid. Methods of modulating expression of target nucleic acids may comprise modifying the target nucleic acid or a protein associated with the target nucleic acid, e.g., a histone.
[0498] In some embodiments, methods of modifying a target nucleic acid comprise contacting a target nucleic acid with a composition described herein. In some embodiments, methods comprise contacting a target nucleic acid with an effector protein described herein. In some embodiments, methods comprise contacting a target nucleic acid with a fusion effector protein described herein. The effector protein may be an effector protein described herein, including catalytically inactive effector proteins. The effector protein may comprise an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165. In some embodiments, the amino acid sequence of the effector protein is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100% identical to a sequence selected from SEQ ID NOS: 1-10,484 or 15,022-24,165. In some embodiments, methods comprise contacting a target nucleic acid with an effector protein that is at least 90% identical to an effector protein sequence provide in TABLE 1, and a guide nucleic acid that is at least 90% identical to a corresponding guide nucleic from TABLE 1, wherein corresponding means the effector protein sequence and guide nucleic acid sequence are selected from the same column number (e.g., A1 and B1) and same row.
[0499] In some embodiments, methods comprise contacting a target nucleic acid with a donor nucleic acid. In some embodiments, composition described herein comprise a donor nucleic acid. Methods may comprise contacting a target nucleic acid, including but not limited to a cell comprising the target nucleic acid, with such compositions. In some embodiments, the donor nucleic acid is inserted at a site that has been cleaved by a composition disclosed herein. In some embodiments, the donor nucleic acid comprises a sequence that serves as a template in the process of homologous recombination. The sequence may carry one or more nucleobase modifications that are to be introduced into the target nucleic acid. By using this donor nucleic acid as a template, the genetic information, including the modification(s), is copied into the target nucleic acid by way of homologous recombination. In reference to a viral vector, the term donor nucleic acid refers to a sequence of nucleotides that will be or has been introduced into a cell following transfection of the viral vector. The donor nucleic acid may be introduced into the cell by any mechanism of the transfecting viral vector, including, but not limited to, integration into the genome of the cell or introduction of an episomal plasmid or viral genome.
[0500] In some embodiments, methods comprise base editing. In some embodiments, base editing comprises contacting a target nucleic acid with a fusion effector protein comprising an effector protein fused to a base editing enzyme, such as a deaminase, thereby changing a nucleobase of the target nucleic acid to an alternative nucleobase. In some embodiments, the nucleobase of the target nucleic acid is adenine (A) and the method comprises changing A to guanine (G). In some embodiments, the nucleobase of the target nucleic acid is cytosine (C) and the method comprises changing C to thymine (T). In some embodiments, the nucleobase of the target nucleic acid is C and the method comprises changing C to G. In some embodiments, the nucleobase of the target nucleic acid is A and the method comprises changing A to G.
[0501] In some embodiments, methods introduce a nucleobase change in a target nucleic acid relative to a corresponding wildtype or mutant nucleobase sequence. In some embodiments, methods remove or correct a disease-causing mutation in a nucleic acid sequence, e.g., to produce a corresponding wildtype nucleobase sequence. In some embodiments, methods remove/correct point mutations, deletions, null mutations, or tissue-specific mutations in a target nucleic acid. In some embodiments, methods generate gene knock-out, gene knock-in, gene editing, gene tagging, or a combination thereof. Methods of the disclosure may be targeted to a locus in a genome of a cell.
[0502] In some embodiments, methods of editing a target nucleic acid or modulating the expression of a target nucleic acid are performed in vivo. In some embodiments, methods of editing a target nucleic acid or modulating the expression of a target nucleic acid are performed in vitro. For example, a plasmid may be modified in vitro using a composition described herein and introduced into a cell or organism. In some embodiments, methods of editing a target nucleic acid or modulating the expression of a target nucleic acid are performed ex vivo. For example, methods may comprise obtaining a cell from a subject, modifying a target nucleic acid in the cell with methods and compositions described herein, and returning the cell to the subject. Methods of editing performed ex vivo may be particularly advantageous to produce CAR T-cells. In some embodiments, methods comprise editing a target nucleic acid or modulating the expression of the target nucleic acid in a cell or a subject. The cell may be a dividing cell. The cell may be a terminally differentiated cell. In some embodiments, the target nucleic acid is a gene.
[0503] Methods of editing a target nucleic acid or modulating the expression of a target nucleic acid described herein may be employed to generate a genetically modified cell. The cell may be a prokaryotic cell. The cell may be an archaeal cell. The cell may be a eukaryotic cell. The cell may be a mammalian cell. The cell may be a human cell. The cell may be a T cell. The cell may be a hematopoietic stem cell. The cell may be a bone marrow derived cell, a white blood cell, a blood cell progenitor, or a combination thereof. Generating a genetically modified cell may comprise contacting a target cell with an effector protein or a fusion effector protein described herein and a guide nucleic acid. Contacting may comprise electroporation, acoustic poration, optoporation, viral vector-based delivery, iTOP, nanoparticle delivery (e.g., lipid or gold nanoparticle delivery), cell-penetrating peptide (CPP) delivery, DNA nanostructure delivery, or any combination thereof. In some cases, the nanoparticle delivery comprises lipid nanoparticle delivery or gold nanoparticle delivery. In some cases, the nanoparticle delivery comprises lipid nanoparticle delivery. In some cases, the nanoparticle delivery comprises gold nanoparticle delivery.
[0504] Methods may comprise cell line engineering. Generally, cell line engineering comprises modifying a pre-existing cell (e.g., naturally-occurring or engineered) or pre-existing cell line to produce a novel cell line or modified cell line. In some embodiments, modifying the pre-existing cell or cell line comprises contacting the pre-existing cell or cell line with an effector protein or fusion effector protein described herein and a guide nucleic acid. The resulting modified cell line may be useful for production of a protein of interest. Non-limiting examples of cell lines includes: 132-d5 human fetal fibroblasts, 10.1 mouse fibroblasts, 293-T, 3T3, 3T3 Swiss, 3T3-L1, 721, 9L, A-549, A10, A172, A20, A253, A2780, A2780ADR, A2780cis, A375, A431, ALC, ARH-77, B16, B35, BALB/3T3 mouse embryo fibroblast, BC-3, BCP-1 cells, BEAS-2B, BHK-21, BR 293, BS-C-1 monkey kidney epithelial, Bcl-1, bEnd.3, BxPC3, C3H-10T1/2, C6/36, C8161, CCRF-CEM, CHO, CHO Dhfr-/-, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T, CIR, CML T1, CMT, COR-L23, COR-L23/5010, COR-L23/CPR, COR-L23/R23, COS, COS-1, COS-6, COS-7, COS-M6A, COV-434, CT26, CTLL-2, CV1, CaCo2, Cal-27, Calu1, D17, DH82, DLD2, DU145, DuCaP, EL4, EM2, EM3, EMT6/AR1, EMT6/AR10.0, FM3, H1299, H69, HASMC, HB54, HB55, HB56, HCA2, HEK-293, HEKa, HEKn, HL-60, HMEC, HT-29, HUVEC, HeLa, HeLa B, HeLa T4, HeLa-S3, Hep G2, Hepa1c1c7, Huh1, Huh4, Huh7, IC21, J45.01, J82, JY cells, Jurkat, Jurkat, K562 cells, KCL22, KG1, KYO1, Ku812, LNCap, LRMB, MC-38, MCF-10A, MCF-7, MDA-MB-231, MDA-MB-435, MDA-MB-468, MDCK II, MDCK II, MEF, mIMCD-3C8161, MOLT, MONO-MAC 6, MOR/0.2R, MRC5, MTD-1A, Ma-Mel 1-48, MiaPaCell, MyEnd, NALM-1, NCI-H69/CPR, NCI-H69/LX10, NCI-H69/LX20, NCI-H69/LX4, NHDF, NIH-3T3, NRK, NRK-52E, NW-145, OPCN/OPCT cell lines, P388D1, PC-3, PNT-1A/PNT 2, Panc1, Peer, RIN-5F, RMA/RMAS, RPTE, Rat6, Raw264.7, RenCa, SEM-K2, SK-UT, SKOV3, SW480, SW620, Saos-2 cells, Sf-9, SkBr3, T-47D, T2, T24, T84, TF1, THP1 cell line, TIB55, U373, U87, U937, VCaP, Vero cells, WEHI-231, WM39, WT-49, X63, YAC-1, and YAR.
Donor Nucleic Acids
[0505] In some embodiments, a donor nucleic acid comprises a nucleic acid that is incorporated into a target nucleic acid or genome. In some embodiments, a donor nucleic acid comprises a sequence that is derived from a plant, bacteria, fungi, virus, or an animal. In some embodiments, the animal is a non-human animal, such as, by way of non-limiting example, a mouse, rat, hamster, rabbit, pig, bovine, deer, sheep, goat, chicken, cat, dog, ferret, a bird, non-human primate (e.g., marmoset, rhesus monkey). In some embodiments, the non-human animal is a domesticated mammal or an agricultural mammal. In some embodiments, the animal is a human. In some embodiments, the sequence comprises a human wild-type (WT) gene or a portion thereof. In some embodiments, the human WT gene or the portion thereof comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, or 100% identical to an equal length portion of the WT sequence of any one of the genes recited in TABLE 3. In some embodiments, the donor nucleic acid is incorporated into an insertion site of a target nucleic acid.
[0506] In some embodiments, a donor nucleic acid of any suitable size is integrated into a target nucleic acid or a genome. In some embodiments, the donor nucleic acid integrated into the target nucleic acid or the genome is less than 3, about 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 kilobases in length. In some embodiments, the donor nucleic acid is more than 500 kilobases (kb) in length.
[0507] In some embodiments, a viral vector comprising a donor nucleic acid introduces the donor nucleic acid into a cell following transfection. In some embodiments, the donor nucleic acid is introduced into the cell by any mechanism of the transfecting viral vector, including, but not limited to, integration into the genome of the cell or introduction of an episomal plasmid or viral genome.
[0508] In some embodiments, an effector protein as described herein facilitates insertion of a donor nucleic acid at a site of cleavage or between two cleavage sites by cleaving (hydrolysis of a phosphodiester bond) of a nucleic acid resulting in a nick or double strand break-nuclease activity.
[0509] In some embodiments, a donor nucleic acid serves as a template in the process of homologous recombination, which may carry an alteration that is to be or has been introduced into a target nucleic acid. By using the donor nucleic acid as a template, the genetic information, including the alteration, is copied into the target nucleic acid by way of homologous recombination.
Genetically Modified Cells and Organisms
[0510] Methods of editing described herein may be employed to generate a genetically modified cell. In some embodiments, the cell is a eukaryotic cell (e.g., a mammalian cell) or a prokaryotic cell (e.g., an archaeal cell). In some embodiments, the cell is derived from a multicellular organism and cultured as a unicellular entity. In some embodiments, the cell comprises a heritable genetic modification, such that progeny cells derived therefrom comprise the heritable genetic mutation. In some embodiments, the cell is progeny of a genetically modified cell comprising a genetic modification of the genetically modified parent cell. In some embodiments, the genetically modified cell comprises a deletion, insertion, mutation, or non-native sequence relative to a wild-type version of the cell or the organism from which the cell was derived.
[0511] Methods of editing described herein may be performed in a cell. In some embodiments, the cell is in vitro. In some embodiments, the cell is in vivo. In some embodiments, the cell is ex vivo. In some embodiments, the cell is an isolated cell. In some embodiments, the cell is inside of an organism. In some embodiments, the cell is an organism. In some embodiments, the cell is in a cell culture. In some embodiments, the cell is one of a collection of cells. In some embodiments, the cell is a mammalian cell or derived there from. In some embodiments, the cell is a rodent cell or derived there from. In some embodiments, the cell is a human cell or derived there from. In some embodiments, the cell is a eukaryotic cell or derived there from. In some embodiments, the cell is a progenitor cell or derived there from. In some embodiments, the cell is a pluripotent stem cell or derived there from. In some embodiments, the cell is an animal cell or derived there from. In some embodiments, the cell is an invertebrate cell or derived there from. In some embodiments, the cell is a vertebrate cell or derived there from. In some embodiments, the cell is from a specific organ or tissue. In some embodiments, the cell is a hepatocyte. In some embodiments, the tissue is a subject's blood, bone marrow, or cord blood. In some embodiments, the tissue is a heterologous donor blood, cord blood, or bone marrow. In some embodiments, the tissue is an allogenic blood, cord blood, or bone marrow. In some embodiments, the tissue may be muscle. In some embodiments, the muscle may be a skeletal muscle. In some embodiments, skeletal muscles include the following: abductor digiti minimi (foot), abductor digiti minimi (hand), abductor hallucis, abductor pollicis brevis, abductor pollicis longus, adductor brevis, adductor hallucis, adductor longus, adductor magnus, adductor pollicis, anconeus, articularis cubiti, articularis genu, aryepiglotticus, auricularis, biceps brachii, biceps femoris, brachialis, brachioradialis, buccinator, bulbospongiosus, constrictor of pharynx-inferior, constrictor of pharynx-middle, constrictor of pharynx-superior, coracobrachialis, corrugator supercilii, cremaster, cricothyroid, dartos, deep transverse perinei, deltoid, depressor anguli oris, depressor labii inferioris, diaphragm, digastric, digastric (anterior view), erector spinaespinalis, erector spinaeiliocostalis, erector spinaelongissimus, extensor carpi radialis brevis, extensor carpi radialis longus, extensor carpi ulnaris, extensor digiti minimi (hand), extensor digitorum (hand), extensor digitorum brevis (foot), extensor digitorum longus (foot), extensor hallucis brevis, extensor hallucis longus, extensor indicis, extensor pollicis brevis, extensor pollicis longus, external oblique abdominis, flexor carpi radialis, flexor carpi ulnaris, flexor digiti minimi brevis (foot), flexor digiti minimi brevis (hand), flexor digitorum brevis, flexor digitorum longus (foot), flexor digitorum profundus, flexor digitorum superficialis, flexor hallucis brevis, flexor hallucis longus, flexor pollicis brevis, flexor pollicis longus, frontalis, gastrocnemius, gemellus inferior, gemellus superior, genioglossus, geniohyoid, gluteus maximus, gluteus medius, gluteus minimus, gracilis, hyoglossus, iliacus, inferior oblique, inferior rectus, infraspinatus, intercostals external, intercostals innermost, intercostals internal, internal oblique abdominis, interossei-dorsal of hand, interossei-dorsal of foot, interossei-palmar of hand, interosseiplantar of foot, interspinales, intertransversarii, intrinsic muscles of tongue, ishiocavernosus, lateral cricoarytenoid, lateral pterygoid, lateral rectus, latissimus dorsi, levator anguli oris, levator ani-coccygeus, levator ani-iliococcygeus, levator ani-pubococcygeus, levator ani-puborectalis, levator ani-pubovaginalis, levator labii superioris, levator labii superioris, alaeque nasi, levator palpebrae superioris, levator scapulae, levator veli palatini, levatores costarum, longus capitis, longus colli, lumbricals of foot, lumbricals of hand, masseter, medial pterygoid, medial rectus, mentalis, m. uvulae, mylohyoid, nasalis, oblique arytenoid, obliquus capitis inferior, obliquus capitis superior, obturator externus, obturator internus (A), obturator internus (B), omohyoid, opponens digiti minimi (hand), opponens pollicis, orbicularis oculi, orbicularis oris, palatoglossus, palatopharyngeus, palmaris brevis, palmaris longus, pectineus, pectoralis major, pectoralis minor, peroneus brevis, peroneus longus, peroneus tertius, piriformis (A), piriformis (B), plantaris, platysma, popliteus, posterior cricoarytenoid, procerus, pronator quadratus, pronator teres, psoas major, psoas minor, pyramidalis, quadratus femoris, quadratus lumborum, quadratus plantae, rectus abdominis, rectus capitus anterior, rectus capitus lateralis, rectus capitus posterior major, rectus capitus posterior minor, rectus femoris, rhomboid major, rhomboid minor, risorius, salpingopharyngeus, sartorius, scalenus anterior, scalenus medius, scalenus minimus, scalenus posterior, semimembranosus, semitendinosus, serratus anterior, serratus posterior inferior, serratus posterior superior, soleus, sphincter ani, sphincter urethrae, splenius capitis, splenius cervicis, stapedius, sternocleidomastoideohyoid, sternothyroid, styloglossus, stylohyoid, stylohyoid (anterior view), stylopharyngeus, subclavius, subcostalis, subscapularis, superficial transverse perinei, superior oblique, superior rectus, supinator, supraspinatus, temporalis, temporoparietalis, tensor fasciae lata, tensor tympani, tensor veli palatini, teres major, teres minor, thyro-arytenoid & vocalis, thyro-epiglotticus, thyrohyoid, tibialis anterior, tibialis posterior, transverse arytenoid, transversospinalis-multifidus, transversospinalis-rotatores, transversospinalis-semispinalis, transversus abdominis, transversus thoracis, trapezius, triceps, vastus intermedius, vastus lateralis, vastus medialis, zygomaticus major, or zygomaticus minor. In some embodiments, the cell is a myocyte. In some embodiments, the cell is a muscle cell. In some embodiments, the muscle cell is a skeletal muscle cell. In some embodiments, the skeletal muscle cell is a red (slow) skeletal muscle cell, a white (fast) skeletal muscle cell or an intermediate skeletal muscle cell.
[0512] Methods of editing described herein may comprise contacting cells with compositions or systems described herein. In some embodiments, the contacting comprises
[0513] Methods of editing described herein may be performed in a subject. In some embodiments, the methods comprise administering compositions described herein to the subject. In some embodiments, the subject is a human. In some embodiments, the subject is a mammal (e.g., rat, mouse, cow, dog, pig, sheep, horse). In some embodiments, the subject is a vertebrate or an invertebrate. In some embodiments, the subject is a laboratory animal. In some embodiments, the subject is a patient. In some embodiments, the subject is at risk of developing, suffering from, or displaying symptoms of a disease. In some embodiments, the subject may have a mutation associated with a gene described herein. In some embodiments, the subject may display symptoms associated with a mutation of a gene described herein.
[0514] In some aspects, disclosed herein are modified cells or populations of modified cells, wherein the modified cell comprises an effector protein described herein, a nucleic acid encoding an effector protein described herein, or a combination thereof. In some embodiments, the modified cell comprises a fusion effector protein described herein, a nucleic acid encoding an effector protein described herein, or a combination thereof. In some embodiments, the modified cell is a modified prokaryotic cell. In some embodiments, the modified cell is a modified eukaryotic cell. A modified cell may be a modified fungal cell. In some embodiments, the modified cell is a modified vertebrate cell. In some embodiments, the modified cell is a modified invertebrate cell. In some embodiments, the modified cell is a modified mammalian cell. In some embodiments, the modified cell is a modified human cell. In some embodiments, the modified cell is in a subject. A modified cell may be in vitro. A modified cell may be in vivo. A modified cell may be ex vivo. A modified cell may be a cell in a cell culture. A modified cell may be a cell obtained from a biological fluid, organ or tissue of a subject and modified with a composition and/or method described herein. Non-limiting examples of biological fluids are blood, plasma, serum, and cerebrospinal fluid. Non-limiting examples of tissues and organs are bone marrow, adipose tissue, skeletal muscle, smooth muscle, spleen, thymus, brain, lymph node, adrenal gland, prostate gland, intestine, colon, liver, kidney, pancreas, heart, lung, bladder, ovary, uterus, breast, and testes. Non-limiting examples of cells that may be obtained from a subject are hepatocytes, epithelial cells, endothelial cells, neurons, cardiomyocytes, muscle cells and adipocytes. Non-limiting examples of cells that may be modified with compositions and methods described herein include immune cells, such as CAR T-cells, T-cells, B-cells, NK cells, granulocytes, basophils, eosinophils, neutrophils, mast cells, monocytes, macrophages, dendritic cells, microglia, Kuppfer cells, antigen-presenting cells (APC), or adaptive cells.
[0515] Non-limiting examples of cells that may be engineered or modified with compositions and methods described herein include stem cells, such as human stem cells, animal stem cells, stem cells that are not derived from human embryonic stem cells, embryonic stem cells, mesenchymal stem cells, pluripotent stem cells, induced pluripotent stem cells (iPS), somatic stem cells, adult stem cells, hematopoietic stem cells, tissue-specific stem cells. A cell may be a pluripotent cell.
[0516] Non-limiting examples of cells that may be engineered or modified with compositions and methods described herein include include plant cells, such as parenchyma, sclerenchyma, collenchyma, xylem, phloem, germline (e.g., pollen). Cells from lycophytes, ferns, gymnosperms, angiosperms, bryophytes, charophytes, chlorophytes, rhodophytes, or glaucophytes.
XIII. Methods of Detecting a Target Nucleic Acid
[0517] Provided herein are methods of detecting target nucleic acids. In some embodiments, the methods comprise detecting a target nucleic acid with compositions or systems described herein. In some embodiments, the methods of detecting a target nucleic acid comprising: a) contacting the target nucleic acid with a composition comprising an effector protein as described herein, a guide nucleic acid as described herein, and a reporter nucleic acid that is cleaved in the presence of the effector protein, the guide nucleic acid, and the target nucleic acid; and b) detecting a signal produced by cleavage of the reporter nucleic acid, thereby detecting the target nucleic acid in the sample. In some embodiments, the methods result in cis cleavage of the reporter nucleic acid. In some embodiments, the reporter nucleic acid is a single stranded nucleic acid. In some embodiments, the reporter comprises a detection moiety. In some embodiments, the reporter nucleic acid is capable of being cleaved by the effector protein. In some embodiments, a cleaved reporter nucleic acid generates a first detectable signal. In some embodiments, the first detectable signal is a change in color. In some embodiments, the change is color is measured indicating presence of the target nucleic acid. In some embodiments, the first detectable signal is measured on a support medium.
[0518] In some embodiments, methods of detecting comprise contacting a target nucleic acid, a cell comprising the target nucleic acid, or a sample comprising a target nucleic acid with an effector protein that comprises an amino acid sequence that is at least is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOS: 1-10,484 or 15,022-24, 165. In some embodiments, the amino acid sequence of the effector protein is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOS: 1-10,484 or 15,022-24,165.
[0519] In some embodiments, the methods comprise contacting the sample to a composition as described herein; and assaying for a signal indicating cleavage of at least some protein-nucleic acids of a population of protein-nucleic acids, wherein the signal indicates a presence of the target nucleic acid in the sample and wherein absence of the signal indicates an absence of the target nucleic acid in the sample.
[0520] In some embodiments, methods comprise contacting the sample comprising the target nucleic acid with a guide nucleic acid targeting a target nucleic acid segment, an effector protein capable of being activated when complexed with the guide nucleic acid and the target nucleic acid segment, a single stranded nucleic acid of a reporter comprising a detection moiety, wherein the nucleic acid of a reporter is capable of being cleaved by the activated effector protein, thereby generating a first detectable signal, cleaving the single stranded nucleic acid of a reporter using the effector protein that cleaves as measured by a change in color, and measuring the first detectable signal on the support medium.
[0521] Methods may comprise contacting a sample or a cell with a composition described herein at a temperature of at least about 25? C., at least about 30? C., at least about 35? C., at least about 40? C., at least about 50? C., or at least about 65? C. In some embodiments, the temperature is not greater than 80? C. In some embodiments, the temperature is about 25? C., about 30? C., about 35? C., about 40? C., about 45? C., about 50? C., about 55? C., about 60? C., about 65? C., or about 70? C. In some embodiments, the temperature is about 25? C. to about 45? C., about 35? C. to about 55? C., or about 55? C. to about 65? C.
[0522] In some embodiments, methods of detecting a target nucleic acid are by a cleavage assay. In some embodiments, the target nucleic acid is a single-stranded target nucleic acid. In some embodiments, the cleavage assay comprises: a) contacting the target nucleic acid with a composition comprising an effector protein as described; and b) cleaving the target nucleic acid. In some embodiments, the cleavage assay comprises an assay designed to visualize, quantitate or identify cleavage of a nucleic acid. In some embodiments, the method is an in vitro trans-cleavage assay. In some embodiments, a cleavage activity is a trans-cleavage activity. In some embodiments, the method is an in vitro cis-cleavage assay. In some embodiments, a cleavage activity is a cis-cleavage activity. In some embodiments, the cleavage assay follows a procedure comprising: (i) providing a composition comprising an equimolar amounts of an effector protein as described herein, and a guide nucleic acid described herein, under conditions to form an RNP complex; (ii) adding a plasmid comprising a target nucleic acid, wherein the target nucleic acid is a linear dsDNA, wherein the target nucleic acid comprises a target sequence and a PAM (iii) incubating the mixture under conditions to enable cleavage of the plasmid; (iv) quenching the reaction with EDTA and a protease; and (v) analyzing the reaction products (e.g., viewing the cleaved and uncleaved linear dsDNA with gel electrophoresis).
[0523] In some embodiments, methods are not capable of detecting target nucleic acids that are present in a sample or solution at a concentration less than or equal to 10 nM. The term threshold of detection is used herein to describe the minimal amount of target nucleic acid that must be present in the sample in order for detection to occur. For example, in some embodiments, when a threshold of detection is 10 nM, then a signal can be detected when a target nucleic acid is present in the sample at a concentration of 10 nM or more. In such embodiments, the methods are not capable of detecting target nucleic acids that are present in a sample at a concentration less than 10 nM. In some embodiments, the threshold is less than or equal to 5 nM, 1 nM, 0.5 nM, 0.1 nM, 0.05 nM, 0.01 nM, 0.005 nM, 0.001 nM, 0.0005 nM, 0.0001 nM, 0.00005 nM, 0.00001 nM, 10 pM, 1 pM, 500 fM, 250 fM, 100 fM, 50 fM, 10 fM, 5 fM, 1 fM, 500 attomole (aM), 100 aM, 50 aM, 10 aM, or 1 aM. In some embodiments, the threshold is in a range of from 1 aM to 1 nM, 1 aM to 500 pM, 1 aM to 200 pM, 1 aM to 100 pM, 1 aM to 10 PM, 1 aM to 1 pM, 1 aM to 500 fM, 1 aM to 100 fM, 1 aM to 1 fM, 1 aM to 500 aM, 1 aM to 100 aM, 1 aM to 50 aM, 1 aM to 10 aM, 10 aM to 1 nM, 10 aM to 500 pM, 10 aM to 200 pM, 10 aM to 100 pM, 10 aM to pM, 10 aM to 1 pM, 10 aM to 500 fM, 10 aM to 100 fM, 10 aM to 1 fM, 10 aM to 500 aM, 10 aM to 100 aM, 10 aM to 50 aM, 100 aM to 1 nM, 100 aM to 500 pM, 100 pM to 200 pM, 100 aM to 100 pM, 100 aM to 10 pM, 100 aM to 1 pM, 100 aM to 500 fM, 100 aM to 100 fM, 100 aM to 1 fM, 100 aM to 500 aM, 500 aM to 1 nM, 500 aM to 500 pM, 500 aM to 200 pM, 500 aM to 100 pM, 500 aM to 10 pM, 500 aM to 1 pM, 500 aM to 500 fM, 500 aM to 100 fM, 500 aM to 1 fM, 1 fM to 1 nM, 1 fM to 500 pM, 1 fM to 200 pM, 1 fM to 100 pM, 1 fM to 10 pM, 1 fM to 1 pM, 10 fM to 1 nM, 10 fM to 500 pM, 10 fM to 200 pM, 10 fM to 100 pM, 10 fM to 10 pM, 10 fM to 1 pM, 500 fM to 1 nM, 500 fM to 500 pM, 500 fM to 200 pM, 500 fM to 100 pM, 500 fM to 10 pM, 500 fM to 1 pM, 800 fM to 1 nM, 800 fM to 500 pM, 800 fM to 200 pM, 800 fM to 100 pM, 800 fM to 10 pM, 800 fM to 1 pM, 1 pM to 1 nM, 1 pM to 500 pM, 1 pM to 200 pM, 1 pM to 100 pM, or 1 pM to 10 pM. In some embodiments, the threshold of detection in a range of from 800 fM to 100 pM, 1 pM to 10 pM, 10 fM to 500 fM, 10 fM to 50 fM, 50 fM to 100 fM, 100 fM to 250 fM, or 250 fM to 500 fM. In some embodiments, the threshold is in a range of from 2 aM to 100 pM, from 20 aM to 50 pM, from 50 aM to 20 pM, from 200 aM to 5 PM, or from 500 aM to 2 pM.
[0524] In some embodiments, a minimum concentration at which the methods detect a target nucleic acid a sample is in a range of from 1 aM to 1 nM, 10 aM to 1 nM, 100 aM to 1 nM, 500 aM to 1 nM, 1 fM to 1 nM, 1 fM to 500 pM, 1 fM to 200 pM, 1 fM to 100 pM, 1 fM to 10 pM, 1 fM to 1 pM, 10 fM to 1 nM, 10 fM to 500 pM, 10 fM to 200 pM, 10 fM to 100 pM, 10 fM to 10 pM, 10 fM to 1 pM, 500 fM to 1 nM, 500 fM to 500 pM, 500 fM to 200 pM, 500 fM to 100 pM, 500 fM to 10 pM, 500 fM to 1 pM, 800 fM to 1 nM, 800 fM to 500 pM, 800 fM to 200 pM, 800 fM to 100 pM, 800 fM to 10 pM, 800 fM to 1 pM, 1 pM to 1 nM, 1 pM to 500 pM, from 1 pM to 200 pM, 1 pM to 100 pM, or 1 pM to 10 pM. In some embodiments, a minimum concentration at which the methods detect in a sample is in a range of from 2 aM to 100 pM, from 20 aM to 50 pM, from 50 aM to 20 pM, from 200 aM to 5 PM, or from 500 aM to 2 pM. In some embodiments, a minimum concentration at which the methods detect a single stranded target nucleic acid in a sample is in a range of from 1 aM to 100 pM. In some embodiments, a minimum concentration at which the methods detect a target nucleic acid in a sample is in a range of from 1 fM to 100 pM. In some embodiments, a minimum concentration at which the methods detect a single stranded target nucleic acid in a sample is in a range of from 10 fM to 100 pM.
[0525] In some embodiments, a minimum concentration at which the methods detect a single stranded target nucleic acid in a sample is in a range of from 800 fM to 100 pM. In some embodiments, a minimum concentration at which the methods detect a single stranded target nucleic acid in a sample is in a range of from 1 pM to 10 pM. In some embodiments, the devices, systems, fluidic devices, kits, and methods described herein detect a single stranded target nucleic acid in a sample comprising a plurality of nucleic acids such as a plurality of non-target nucleic acids, where the target single-stranded nucleic acid is present at a concentration as low as 1 aM, 10 aM, 100 aM, 500 aM, 1 fM, 10 fM, 500 fM, 800 fM, 1 pM, 10 pM, 100 pM, or 1 pM.
[0526] In some embodiments, a minimum concentration at which the methods detect a target nucleic acid at a concentration of about 10 nM, about 20 nM, about 30 nM, about 40 nM, about 50 nM, about 60 nM, about 70 nM, about 80 nM, about 90 nM, about 100 nM, about 200 nM, about 300 nM, about 400 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1 ?M, about 10 ?M, or about 100 ?M. In some embodiments, a minimum concentration at which the methods detect a target nucleic acid at a concentration of from 10 nM to 20 nM, from 20 nM to 30 nM, from 30 nM to 40 nM, from 40 nM to 50 nM, from 50 nM to 60 nM, from 60 nM to 70 nM, from 70 nM to 80 nM, from 80 nM to 90 nM, from 90 nM to 100 nM, from 100 nM to 200 nM, from 200 nM to 300 nM, from 300 nM to 400 nM, from 400 nM to 500 nM, from 500 nM to 600 nM, from 600 nM to 700 nM, from 700 nM to 800 nM, from 800 nM to 900 nM, from 900 nM to 1 pM, from 1 ?M to 10 ?M, from 10 ?M to 100 pM, from 10 nM to 100 nM, from 10 nM to 1 ?M, from 10 nM to 10 UM, from 10 nM to 100 ?M, from 100 nM to 1 ?M, from 100 nM to 10 pM, from 100 nM to 100 ?M, or from 1 ?M to 100 ?M. In some embodiments, a minimum concentration at which the methods detect a target nucleic acid at a concentration of from 20 nM to 5 ?M, from 50 nM to 20 ?M, or from 200 nM to 5 ?M.
[0527] In some embodiments, methods detect a target nucleic acid in less than 60 minutes. In some embodiments, methods detect a target nucleic acid in less than about 120 minutes, less than about 110 minutes, less than about 100 minutes, less than about 90 minutes, less than about 80 minutes, less than about 70 minutes, less than about 60 minutes, less than about 55 minutes, less than about 50 minutes, less than about 45 minutes, less than about 40 minutes, less than about 35 minutes, less than about 30 minutes, less than about 25 minutes, less than about 20 minutes, less than about 15 minutes, less than about 10 minutes, less than about 5 minutes, less than about 4 minutes, less than about 3 minutes, less than about 2 minutes, or less than about 1 minute.
[0528] In some embodiments, methods require at least about 120 minutes, at least about 110 minutes, at least about 100 minutes, at least about 90 minutes, at least about 80 minutes, at least about 70 minutes, at least about 60 minutes, at least about 55 minutes, at least about 50 minutes, at least about 45 minutes, at least about 40 minutes, at least about 35 minutes, at least about 30 minutes, at least about 25 minutes, at least about 20 minutes, at least about 15 minutes, at least about 10 minutes, or at least about 5 minutes to detect a target nucleic acid. In some embodiments, the sample is contacted with the reagents for from 5 minutes to 120 minutes, from 5 minutes to 100 minutes, from 10 minutes to 90 minutes, from 15 minutes to 45 minutes, or from 20 minutes to 35 minutes.
[0529] In some embodiments, methods of detecting are performed in less than 10 hours, less than 9 hours, less than 8 hours, less than 7 hours, less than 6 hours, less than 5 hours, less than 4 hours, less than 3 hours, less than 2 hours, less than 1 hour, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, less than 10 minutes, less than 9 minutes, less than 8 minutes, less than 7 minutes, less than 6 minutes, or less than 5 minutes. In some embodiments, methods of detecting are performed in about 5 minutes to about 10 hours, about 10 minutes to about 8 hours, about 15 minutes to about 6 hours, about 20 minutes to about 5 hours, about 30 minutes to about 2 hours, or about 45 minutes to about 1 hour.
[0530] In some embodiments, methods comprise detection of a detectable signal. In some embodiments, the detection occurs within 5 minutes of contacting a sample and/or a target nucleic acid with a composition described herein. In some embodiments, the detection occurs within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, or 120 minutes of contacting the target nucleic acid. In some embodiments, the detection occurs within 1 to 120, 5 to 100, 10 to 90, 15 to 80, 20 to 60, or 30 to 45 minutes of contacting the target nucleic acid.
Amplification
[0531] In some embodiments, methods of detecting comprise amplifying a target nucleic acid for detection using any of the compositions or systems described herein. Amplifying may comprise changing the temperature of the amplification reaction, also known as thermal amplification (e.g., PCR). Amplifying may be performed at essentially one temperature, also known as isothermal amplification. Amplifying may improve at least one of sensitivity, specificity, or accuracy of the detection of the target nucleic acid.
[0532] In some embodiments, amplifying comprises subjecting a target nucleic acid to an amplification reaction selected from transcription mediated amplification (TMA), helicase dependent amplification (HDA), or circular helicase dependent amplification (cHDA), strand displacement amplification (SDA), recombinase polymerase amplification (RPA), loop mediated amplification (LAMP), exponential amplification reaction (EXPAR), rolling circle amplification (RCA), ligase chain reaction (LCR), simple method amplifying RNA targets (SMART), single primer isothermal amplification (SPIA), multiple displacement amplification (MDA), nucleic acid sequence based amplification (NASBA), hinge-initiated primer-dependent amplification of nucleic acids (HIP), nicking enzyme amplification reaction (NEAR), and improved multiple displacement amplification (IMDA).
[0533] In some embodiments, amplification of the target nucleic acid comprises modifying the sequence of the target nucleic acid. For example, in some embodiments, the methods are used for inserting a PAM sequence into a target nucleic acid that lacks a PAM sequence. In some embodiments, the methods are used for increasing the homogeneity of a target nucleic acid in a sample. For example, in some embodiments, the methods are used for removing a nucleic acid variation that is not of interest in the target nucleic acid.
[0534] In some embodiments, methods of amplifying a nucleic acid takes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or 60 minutes. In some embodiments, the methods performed at a temperature of around 20-45? C. In some embodiments, the methods are performed at a temperature of less than about 20? C., less than about 25? C., less than about 30? C., less than about 35? C., less than about 37? C., less than about 40? C., or less than about 45? C. In some embodiments, the methods are performed at a temperature of at least about 20? C., at least about 25? C., at least about 30? C., at least about 35? C., at least about 37? C., at least about 40? C., or at least about 45? C.
XIV. Methods of Treating a Disorder
[0535] Described herein are methods for treating a disease in a subject by editing a target nucleic acid associated with a gene or expression of a gene related to the disease. In some embodiments, the methods comprise methods of editing nucleic acid described herein.
[0536] In some embodiments, methods for treating a disease in a subject comprises administration of a composition(s) or component(s) of a system described herein. In some embodiments, the composition(s) or component(s) of the system comprises use of a recombinant nucleic acid (DNA or RNA), administered for the purpose to edit a nucleic acid. In some embodiments, the composition or component of the system comprises use of a vector to introduce a functional gene or transgene. In some embodiments, vectors comprise nonviral vectors, including cationic polymers, cationic lipids, or bio-responsive polymers. In some embodiments, the bio-responsive polymer exploits chemical-physical properties of the endosomal environment (e.g., pH) to preferentially release the genetic material in the intracellular space. In some embodiments, vectors comprise viral vectors, including retroviruses, adenoviruses, adeno-associated viruses, and herpes simplex viruses. In some embodiments, the vector comprises a replication-defective viral vector, comprising an insertion of a therapeutic gene inserted in genes essential to the lytic cycle, preventing the virus from replicating and exerting cytotoxic effects. Methods of gene therapy that are applicable to the compositions and systems described herein are described in more detail in Ingusci et al., Gene Therapy Tools for Brain Diseases, Front. Pharmacol. 10:724 (2019), which is hereby incorporated by reference in its entirety.
[0537] In some embodiments, treating, preventing, or inhibiting disease or disorder in a subject may comprise contacting a target nucleic acid associated with a particular ailment with a composition described herein. In some aspects, the methods of treating, preventing, or inhibiting a disease or disorder may involve removing, editing, modifying, replacing, transposing, or affecting the regulation of a genomic sequence of a patient in need thereof. In some embodiments, the methods of treating, preventing, or inhibiting a disease or disorder may involve modulating gene expression.
[0538] Described herein are compositions and methods for treating a disease in a subject by editing a target nucleic acid associated with a gene or expression of a gene related to the disease. In some embodiments, methods comprise administering a composition or cell described herein to a subject. By way of non-limiting example, the disease may be a cancer, an ophthalmological disorder, a neurological disorder, a neurodegenerative disease, a blood disorder, or a metabolic disorder, or a combination thereof. The disease may be an inherited disorder, also referred to as a genetic disorder. The disease may be the result of an infection or associated with an infection.
[0539] The compositions and methods described herein may be used to treat, prevent, or inhibit a disease or syndrome in a subject. In some embodiments, the disease is a genetic disease. The term genetic disease refers to a disease, disorder, condition, or syndrome associated with or caused by one or more mutations in the DNA of an organism having genetic disease. In some embodiments, the disease is a liver disease, a lung disease, an eye disease, or a muscle disease. Exemplary diseases and syndromes include but are not limited to the diseases and syndromes listed in TABLE 4.
TABLE-US-00004 TABLE 4 EXEMPLARY DISEASES Exemplary Diseases and Syndromes 11-hydroxylase deficiency; 17,20-desmolase deficiency; 17-hydroxylase deficiency; 3- hydroxyisobutyrate aciduria; 3-hydroxysteroid dehydrogenase deficiency; 46,XY gonadal dysgenesis; AAA syndrome; ABCA3 deficiency; ABCC8-associated hyperinsulinism; aceruloplasminemia; acromegaly; achondrogenesis type 2; acral peeling skin syndrome; acrodermatitis enteropathica; adrenocortical micronodular hyperplasia; adrenoleukodystrophies; adrenomyeloneuropathies; Aicardi- Goutieres syndrome; Alagille disease (also called Alagille Syndrome); Alexander Disease; Alpers syndrome; alpha-1 antitrypsin deficiency (AATD); alpha-mannosidosis; Alstrom syndrome; Alzheimer's disease; amebic dysentery; amelogenesis imperfecta; amish type microcephaly; amyotrophic lateral sclerosis (ALS); anaplastic large cell lymphoma; anauxetic dysplasia; androgen insensitivity syndrome; angiopathic thrombosis; antiphospholipid syndrome; Antley-Bixler syndrome; APECED; Apert syndrome; aplasia of lacrimal and salivary glands; arginase-1 deficiency; argininosuccinic aciduria; argininemia; arrhythmogenic right ventricular dysplasia; Arts syndrome; ARVD2; arylsulfatase deficiency type metachromatic leukodystrophy; ataxia telangiectasia; atherosclerotic cardiovascular disease; autoimmune lymphoproliferative syndrome; autoimmune polyglandular syndrome type 1; autosomal dominant anhidrotic ectodermal dysplasia; autosomal dominant deafness; autosomal dominant polycystic kidney disease; autosomal recessive microtia; autosomal recessive renal glucosuria; autosomal visceral heterotaxy; babesiosis; balantidial dysentery; Bardet-Biedl syndrome; Bartter syndrome; basal cell nevus syndrome; Batten disease; benign recurrent intrahepatic cholestasis; beta-mannosidosis; ?-thalassemia; Bethlem myopathy; Blackfan-Diamond anemia; bleeding disorder (coagulation); blepharophimosis; Byler disease; C syndrome; CADASIL; calcific aortic stenosis; calcification of joints and arteries; carbamoyl phosphate synthetase I deficiency; cardiofaciocutaneous syndrome; Carney triad; carnitine palmitoyltransferase deficiencies; cartilage-hair hypoplasia; cblC type of combined methylmalonic aciduria; CD18 deficiency; CD3Z-associated primary T-cell immunodeficiency; CD40L deficiency; CDAGS syndrome; CDG1A; CDG1B; CDG1M; CDG2C; CEDNIK syndrome; central core disease; centronuclear myopathy; cerebral capillary malformation; cerebrooculofacioskeletal syndrome type 4; cerebrooculogacioskeletal syndrome; cerebrotendinous xanthomatosis; Chaga's Disease; Charcot Marie Tooth Disesase; cherubism; CHILD syndrome; chronic granulomatous disease; chronic recurrent multifocal osteomyelitis; cirrhosis; citrin deficiency; citrullinemia type I; citrullinemia type II; classic hemochromatosis; CNPPB syndrome; cobalamin C disease; Cockayne syndrome; coenzyme Q10 deficiency; Coffin-Lowry syndrome; Cohen syndrome; combined deficiency of coagulation factors V; common variable immune deficiency 3; complement hyperactivation; complete androgen insentivity; cone rod dystrophies; conformational diseases; congenital adrenal hyperplasia; congenital bile adid synthesis defect type 1; congenital bile adid synthesis defect type 2; congenital defect in bile acid synthesis type; congenital erythropoietic porphyria; congenital generalized osteosclerosis; Congenital muscular dystrophy; Cornelia de Lange syndrome; coronary heart disease; Cousin syndrome; Cowden disease; COX deficiency; Cri du chat syndrome; Crigler-Najjar disease; Crigler-Najjar syndrome type 1; Crisponi syndrome; Crouzon syndrome; Currarino syndrome; Curth-Macklin type ichthyosis hystrix; cutis laxa; cystic fibrosis; cystinosis; d-2-hydroxyglutaric aciduria; DDP syndrome; Dejerine-Sottas disease; Denys-Drash syndrome; Dercum disease; desmin cardiomyopathy; desmin myopathy; DGUOK-associated mitochondrial DNA depletion; diabetes Type I; diabetes Type II; disorders of glutamate metabolism; distal spinal muscular atrophy type 5; DNA repair diseases; dominant optic atrophy; Doyne honeycomb retinal dystrophy; Dravet Syndrome; Duchenne muscular dystrophy; dyskeratosis congenita; Ehlers-Danlos syndrome type 4; Ehlers-Danlos syndromes; Elejalde disease; Ellis-van Creveld disease; Emery-Dreifuss muscular dystrophies; encephalomyopathic mtDNA depletion syndrome; encephalitis; enzymatic diseases; EPCAM-associated congenital tufting enteropathy; epidermolysis bullosa with pyloric atresia; epilepsy; fabry disease; facioscapulohumeral muscular dystrophy; Factor V Leiden thrombophilia; Faisalabad histiocytosis; familial atypical mycobacteriosis; familial capillary malformation-arteriovenous; Familial Creutzfeld-Jakob disease; familial esophageal achalasia; familial glomuvenous malformation; familial hemophagocytic lymphohistiocytosis; familial mediterranean fever; familial megacalyces; familial schwannomatosis; familial spina bifida; familial splenic asplenia/hypoplasia; familial thrombotic thrombocytopeni purpura; Fanconi disease (Fanconi anemia); Feingold syndrome; FENIB; fibrodysplasia ossificans progressiva; FKTN; Fragile X syndrome; Francois-Neetens fleck corneal dystrophy; Frasier syndrome; Friedreich's ataxia; FTDP-17; Fuchs corneal dystrophy; fucosidosis; G6PD deficiency; galactosialidosis; Galloway syndrome; Gardner syndrome; Gaucher disease; Gitelman syndrome; GLUT1 deficiency; GM2-Gangliosidoses (e.g., Tay Sachs Disease, Sandhoff Disease) glycogen storage disease type 1b; glycogen storage disease type 2; glycogen storage disease type 3; glycogen storage disease type 4; glycogen storage disease type 9a; glycogen storage diseases; GM1- gangliosidosis; Greenberg syndrome; Greig cephalopolysyndactyly syndrome; hair genetic diseases; hairy cell leukemia; HANAC syndrome; harlequin type ichtyosis congenita; HDR syndrome; hearing loss; hemochromatosis type 3; hemochromatosis type 4; hemolytic anemia; hemolytic uremic syndrome; hemophilia A; hemophilia B; hereditary angioedema type 3; hereditary angioedemas; hereditary hemorrhagic telangiectasia; hereditary hypofibrinogenemia; hereditary intraosseous vascular malformation; hereditary leiomyomatosis and renal cell cancer; hereditary neuralgic amyotrophy; hereditary sensory and autonomic neuropathy type; Hermansky-Pudlak disease; HHH syndrome; HHT2; hidrotic ectodermal dysplasia type 1; hidrotic ectodermal dysplasias; histiocytic sarcoma; HNF4A-associated hyperinsulinism; HNPCC; homozygous familial hypercholesterolemia; human immunodeficiency with microcephaly; Human monkeypox (MPX); human papilloma virus (HPV) infection; Huntington's disease; hyper-IgD syndrome; hyperinsulinism-hyperammonemia syndrome; hypercholesterolemia; hypertrophy of the retinal pigment epithelium; hypochondrogenesis; hypohidrotic ectodermal dysplasia; ICF syndrome; idiopathic congenital intestinal pseudo-obstruction; immunodeficiency 13; immunodeficiency 17; immunodeficiency 25; immunodeficiency with hyper- IgM type 1; immunodeficiency with hyper-IgM type 3; immunodeficiency with hyper-IgM type 4; immunodeficiency with hyper-IgM type 5; immunoglobulin alpha deficiency; inborn errors of thyroid metabolism; infantile myofibromatosis; infantile visceral myopathy; infantile X-linked spinal muscular atrophy; intrahepatic cholestasis of pregnancy; IPEX syndrome; IRAK4 deficiency; isolated congenital asplenia; Jeune syndrome; Johanson-Blizzard syndrome; Joubert syndrome; JP-HHT syndrome; juvenile hemochromatosis; juvenile hyalin fibromatosis; juvenile nephronophthisis; Kabuki mask syndrome; Kallmann syndromes; Kartagener syndrome; KCNJ11-associated hyperinsulinism; Kearns- Sayre syndrome; Kostmann disease; Kozlowski type of spondylometaphyseal dysplasia; Krabbe disease; LADD syndrome; late infantile-onset neuronal ceroid lipofuscinosis; LCK deficiency; LDHCP syndrome; Leber Congenital Amaurosis Teyp 10; Legius syndrome; Leigh syndrome; lethal congenital contracture syndrome 2; lethal congenital contracture syndromes; lethal contractural syndrome type 3; lethal neonatal CPT deficiency type 2; lethal osteosclerotic bone dysplasia; leukocyte adhesion deficiency; Li Fraumeni syndrome; LIG4 syndrome; Limb Girdle Muscular Dystrophies; lipodystrophy; lissencephaly type 1; lissencephaly type 3; Loeys-Dietz syndrome; low phospholipid- associated cholelithiasis; Lynch Syndrome; lysinuric protein intolerance; a lysosomal storage disease (e.g., Hunter syndrome, Hurler syndrome); macular dystrophy; Maffucci syndrome; Majeed syndrome; mannose-binding protein deficiency; mantle cell lymphoma; Marfan disease; Marshall syndrome; MASA syndrome; mastocytosis; MCAD deficiency; McCune-Albright syndrome; MCKD2; Meckel syndrome; MECP2 Duplication Syndrome; Meesmann corneal dystrophy; megacystis-microcolon- intestinal hypoperistalsis; megaloblastic anemia type 1; MEHMO; MELAS; Melnick-Needles syndrome; MEN2s; meningitis; Menkes disease; metachromatic leukodystrophies; methymalonic acidemia due to transcobalamin receptor defect; methylmalonic acidurias; methylvalonic aciduria; microcoria-congenital nephrosis syndrome; microvillous atrophy; migraine; mitochondrial neurogastrointestinal encephalomyopathy; monilethrix; monosomy X; mosaic trisomy 9 syndrome; Mowat-Wilson syndrome; mucolipidosis type 2; mucolipidosis type Ma; mucolipidosis type IV; mucopolysaccharidoses; mucopolysaccharidosis type 3A; mucopolysaccharidosis type 3C; mucopolysaccharidosis type 4B; multiminicore disease; multiple acyl-CoA dehydrogenation deficiency; multiple cutaneous and mucosal venous malformations; multiple endocrine neoplasia type 1; multiple sulfatase deficiency; mycosis fungoides; myotonic dystrophy; NAIC; nail-patella syndrome; nemaline myopathies; neonatal diabetes mellitus; neonatal surfactant deficiency; nephronophtisis; Netherton disease; neurofibromatoses; neurofibromatosis type 1; Niemann-Pick disease type A; Niemann-Pick disease type B; Niemann-Pick disease type C; NKX2E; non-alcoholic fatty liver disease (NAFLD); non-alcoholic steatohepatitis (NASH); Noonan syndrome; North American Indian childhood cirrhosis; NROB1 duplication-associated DSD; ocular genetic diseases; oculo-auricular syndrome; OLEDAID; oligomeganephronia; oligomeganephronic renal hypolasia; Ollier disease; Opitz-Kaveggia syndrome; orofaciodigital syndrome type 1; orofaciodigital syndrome type 2; osseous Paget disease; osteogenesis imperfecta; otopalatodigital syndrome type 2; OXPHOS diseases; palmoplantar hyperkeratosis; panlobar nephroblastomatosis; Parkes-Weber syndrome; Parkinson's disease; partial deletion of 21q22.2-q22.3; Pearson syndrome; Pelizaeus-Merzbacher disease; Pendred syndrome; pentalogy of Cantrell; peroxisomal acyl-CoA-oxidase deficiency; Peutz- Jeghers syndrome; Pfeiffer syndrome; Pierson syndrome; pigmented nodular adrenocortical disease; pipecolic acidemia; Pitt-Hopkins syndrome; plasmalogens deficiency; platelet glycoprotein IV deficiency; pleuropulmonary blastoma and cystic nephroma; polycystic kidney disease; polycystic ovarian disease; polycystic lipomembranous osteodysplasia; Pompe disease; including infantile onset Pompe disease (IOPD) and late onset Pompe disease (LOPD); porphyrias; PRKAG2 cardiac syndrome; premature ovarian failure; primary erythermalgia; primary hemochromatoses; primary hyperoxaluria; progressive familial intrahepatic cholestasis; propionic acidemia; protein-losing enteropathy; pyruvate decarboxylase deficiency; RAPADILINO syndrome; renal cystinosis; retinitis pigmentosa; Rett Syndrome; rhabdoid tumor predisposition syndrome; Rieger syndrome; ring chromosome 4; Roberts syndrome; Robinow-Sorauf syndrome; Rothmund-Thomson syndrome; severe combined immunodeficiency disorder (SCID); Saethre-Chotzen syndrome; Sandhoff disease; SC phocomelia syndrome; SCAS; Schinzel phocomelia syndrome; severe hypertriglyceridemia; short rib-polydactyly syndrome type 1; short rib-polydactyly syndrome type 4; short-rib polydactyly syndrome type 2; short- rib polydactyly syndrome type 3; Shwachman disease; Shwachman-Diamond disease; sickle cell anemia; Silver-Russell syndrome; Simpson-Golabi-Behmel syndrome; Smith-Lemli-Opitz syndrome; SPG7-associated hereditary spastic paraplegia; spherocytosis; spinocerebellar ataxia; spinal muscular atrophy; split-hand/foot malformation with long bone deficiencies; spondylocostal dysostosis; sporadic visceral myopathy with inclusion bodies; storage diseases; Stargardt macular dystrophy; STRA6-associated syndrome; stroke; Tay-Sachs disease; thanatophoric dysplasia; thrombophilia due to antithrombin III deficiency; thyroid metabolism diseases; Tourette syndrome; transcarbamylase deficiency; transthyretin-associated amyloidosis; trisomy 13; trisomy 22; trisomy 2p syndrome; tuberous sclerosis; tufting enteropathy; Ullrich Congenital Muscular Dystrophy; urea cycle diseases; Usher Syndrome; Van Den Ende-Gupta syndrome; Van der Woude syndrome; variegated mosaic aneuploidy syndrome; VLCAD deficiency; von Hippel-Lindau disease; von Willebrand disease; Waardenburg syndrome; WAGR syndrome; Walker-Warburg syndrome; Werner syndrome; Wilson disease; Wiskott-Aldrich Syndrome; Wolcott-Rallison syndrome; Wolfram syndrome; X-linked agammaglobulinemia; X-linked chronic idiopathic intestinal pseudo-obstruction; X-linked cleft palate with ankyloglossia; X-linked dominant chondrodysplasia punctata; X-linked ectodermal dysplasia; X- linked Emery-Dreifuss muscular dystrophy; X-linked lissencephaly; X-linked lymphoproliferative disease; X-linked visceral heterotaxy; xanthinuria type 1; xanthinuria type 2; xeroderma pigmentosum; XPV; and Zellweger disease.
[0540] In some embodiments, compositions and methods edit at least one gene associated with a disease described herein or the expression thereof. In some embodiments, the disease is Alzheimer's disease and the gene is selected from APP, BACE-1, PSD95, MAPT, PSEN1, PSEN2, and APOE&4. In some embodiments, the disease is Parkinson's disease and the gene is selected from SNCA, GDNF, and LRRK2. In some embodiments, the disease comprises Centronuclear myopathy and the gene is DNM2. In some embodiments, the disease is Huntington's disease and the gene is HTT. In some embodiments, the disease is Alpha-1 antitrypsin deficiency (AATD) and the gene is SERPINA1. In some embodiments, the disease is amyotrophic lateral sclerosis (ALS) and the gene is selected from SOD1, FUS, C9ORF72, ATXN2, TARDBP, and CHCHD10. In some embodiments, the disease comprises Alexander Disease and the gene is GFAP. In some embodiments, the disease comprises anaplastic large cell lymphoma and the gene is CD30. In some embodiments, the disease comprises Angelman Syndrome and the gene is UBE3A. In some embodiments, the disease comprises calcific aortic stenosis and the gene is Apo(a). In some embodiments, the disease comprises CD3Z-associated primary T-cell immunodeficiency and the gene is CD3Z or CD247. In some embodiments, the disease comprises CD18 deficiency and the gene is ITGB2. In some embodiments, the disease comprises CD40L deficiency and the gene is CD40L. In some embodiments, the disease is congenital adrenal hyperplasia and the gene is CAH1. In some embodiments, the disease comprises CNS trauma and the gene is VEGF. In some embodiments, the disease comprises coronary heart disease and the gene is selected from FGA, FGB, and FGG. In some embodiments, the disease comprises MECP2 Duplication syndrome and Rett syndrome and the gene is MECP2. In some embodiments, the disease comprises a bleeding disorder (coagulation) and the gene is FXI. In some embodiments, the disease comprises fragile X syndrome and the gene is FMR1. In some embodiments, the disease comprises Fuchs corneal dystrophy and the gene is selected from ZEB1, SLC4A11, and LOXHD1. In some embodiments, the disease comprises GM2-Gangliosidoses (e.g., Tay Sachs Disease, Sandhoff disease) and the gene is selected from HEXA and HEXB. In some embodiments, the disease comprises Hearing loss disorders and the gene is DFNA36. In some embodiments, the disease is Pompe disease, including infantile onset Pompe disease (IOPD) and late onset Pompe disease (LOPD) and the gene is GAA. In some embodiments, the disease is Retinitis pigmentosa and the gene is selected from PDE6B, RHO, RP1, RP2, RPGR, PRPH2, IMPDH1, PRPF31, CRB1, PRPF8, TULP1, CA4, HPRPF3, ABCA4, EYS, CERKL, FSCN2, TOPORS, SNRNP200, PRCD, NR2E3, MERTK, USH2A, PROM1, KLHL7, CNGB1, TTC8, ARL6, DHDDS, BEST1, LRAT, SPARA7, CRX, CLRN1, RPE65, and WDR19. In some embodiments, the disease comprises Leber Congenital Amaurosis Type 10 and the gene is CEP290. In some embodiments, the disease is cardiovascular disease and/or lipodystrophies and the gene is selected from ABCG5, ABCG8, AGT, ANGPTL3, APOCHII, APOA1, APOL1, ARH, CDKN2B, CFB, CXCL12, FXI, FXII, GATA-4, MIA3, MKL2, MTHFD1L, MYH7, NKX2-5, NOTCH1, PKK, PCSK9, PSRC1, SMAD3, and TTR. In some embodiments, the disease is cardiovascular disease and/or lipodystrophies and the gene is ANGPTL3. In some embodiments, the disease is cardiovascular disease and/or lipodystrophies and the gene is PCSK9. In some embodiments, the disease is cardiovascular disease and/or lipodystrophies and the gene is TTR. In some embodiments, the disease is severe hypertriglyceridemia (SHTG) and the gene is APOCIII or ANGPTL4. In some embodiments, the disease comprises acromegaly and the gene is GHR. In some embodiments, the disease comprises acute myeloid leukemia and the gene is CD22. In some embodiments, the disease is diabetes and the gene is GCGR. In some embodiments, the disease is NAFLD/NASH and the gene is selected from HSD17B13, PSD3, GPAM, CIDEB, DGAT2 and PNPLA3. In some embodiments, the disease is NASH/cirrhosis and the gene is MARCI. In some embodiments, the disease is cancer and the gene is selected from STAT3, YAP1, FOXP3, AR (Prostate cancer), and IRF4 (multiple myeloma). In some embodiments, the disease is cystic fibrosis and the gene is CFTR. In some embodiments, the disease is Duchenne muscular dystrophy and the gene is DMD. In some embodiments, the disease is ornithine transcarbamylase deficiency (OTCD) and the gene is OTC. In some embodiments, the disease is congenital adrenal hyperplasia (CAH) and the gene is CYP21A2. In some embodiments, the disease is atherosclerotic cardiovascular disease (ASCVD) and the gene is LPA. In some embodiments, the disease is hepatitis B virus infection (CHB) and the gene is HBV covalently closed circular DNA (cccDNA). In some embodiments, the disease is citrullinemia type I and the gene is ASS1. In some embodiments, the disease is citrullinemia type I and the gene is SLC25A13. In some embodiments, the disease is citrullinemia type I and the gene is ASS1. In some embodiments, the disease is arginase-1 deficiency and the gene is ARG1. In some embodiments, the disease is carbamoyl phosphate synthetase I deficiency and the gene is CPS1. In some embodiments, the disease is argininosuccinic aciduria and the gene is ASL. In some embodiments, the disease comprises angioedema and the gene is PKK. In some embodiments, the disease comprises thalassemia and the gene is TMPRSS6. In some embodiments, the disease comprises achondroplasia and the gene is FGFR3. In some embodiments, the disease comprises Cri du chat syndrome and the gene is selected from CTNND2. In some embodiments, the disease comprises sickle cell anemia and the gene is Beta globin gene. In some embodiments, the disease comprises Alagille Syndrome and the gene is selected from JAG1 and NOTCH2. In some embodiments, the disease comprises Charcot-Marie-Tooth disease and the gene is selected from PMP22 and MFN2. In some embodiments, the disease comprises Crouzon syndrome and the gene is selected from FGFR2, FGFR3, and FGFR3. In some embodiments, the disease comprises Dravet Syndrome and the gene is selected from SCN1A and SCN2A. In some embodiments, the disease comprises Emery-Dreifuss syndrome and the gene is selected from EMD. LMNA, SYNE1, SYNE2, FHL1, and TMEM43. In some embodiments, the disease comprises Factor V Leiden thrombophilia and the gene is F5. In some embodiments, the disease is fabry disease and the gene is GLA. In some embodiments, the disease is facioscapulohumeral muscular dystrophy and the gene is FSHD1. In some embodiments, the disease comprises Fanconi anemia and the gene is selected from FANCA, FANCB, FANCC, FANCD1, FANCD2, FANCE, FANCF. FANCG, FANCI, FANCJ, FANCL, FANCM, FANCN, FANCP, FANCS, RAD51C, and XPF. In some embodiments, the disease comprises Familial Creutzfeld-Jakob disease and the gene is PRNP. In some embodiments, the disease comprises Familial Mediterranean Fever and the gene is MEFV. In some embodiments, the disease comprises Friedreich's ataxia and the gene is FXN. In some embodiments, the disease comprises Gaucher disease and the gene is GBA. In some embodiments, the disease comprises human papilloma virus (HPV) infection and the gene is HPV E7. In some embodiments, the disease comprises hemochromatosis and the gene is HFE, optionally comprising a C282Y mutation. In some embodiments, the disease comprises Hemophilia A and the gene is FVIII. In some embodiments, the disease is hereditary angioedema and the gene is SERPING1 or KLKB1. In some embodiments, the disease comprises histiocytosis and the gene is CD1. In some embodiments, the disease comprises immunodeficiency 17 and the gene is CD3D. In some embodiments, the disease comprises immunodeficiency 13 and the gene is CD4. In some embodiments, the disease comprises Common Variable Immunodeficiency and the gene is selected from CD19 and CD81. In some embodiments, the disease comprises Joubert syndrome and the gene is selected from INPP5E, TMEM216, AHI1, NPHP1, CEP290, TMEM67, RPGRIP1L, ARL13B, CC2D2A, OFD1, TMEM138, TCTN3, ZNF423, and AMRC9. In some embodiments, the disease comprises leukocyte adhesion deficiency and the gene is CD18. In some embodiments, the disease comprises Li-Fraumeni syndrome and the gene is TP53. In some embodiments, the disease comprises lymphoproliferative syndrome and the gene is CD27. In some embodiments, the disease comprises Lynch syndrome and the gene is selected from MSH2. MLH1. MSH6, PMS2, PMS1, TGFBR2, and MLH3. In some embodiments, the disease comprises mantle cell lymphoma and the gene is CD5. In some embodiments, the disease comprises Marfan syndrome and the gene is FBN1. In some embodiments, the disease comprises mastocytosis and the gene is CD2. In some embodiments, the disease comprises methylmalonic acidemia and the gene is selected from MMAA, MMAB, and MUT. In some embodiments, the disease is mycosis fungoides and the gene is CD7. In some embodiments, the disease is myotonic dystrophy and the gene is selected from CNBP and DMPK. In some embodiments, the disease comprises neurofibromatosis and the gene is selected from NF1, and NF2. In some embodiments, the disease comprises osteogenesis imperfecta and the gene is selected from COL1A1, COL1A2, and IFITM5. In some embodiments, the disease is non-small cell lung cancer and the gene is selected from KRAS, EGFR, ALK, METex14, BRAF V600E. ROS1, RET, and NTRK. In some embodiments, the disease comprises Peutz-Jeghers syndrome and the gene is STK11. In some embodiments, the disease comprises polycystic kidney disease and the gene is selected from PKD1 and PKD2. In some embodiments, the disease comprises Severe Combined Immune Deficiency and the gene is selected from IL7R, RAG1, and JAK3. In some embodiments, the disease comprises PRKAG2 cardiac syndrome and the gene is PRKAG2. In some embodiments, the disease comprises spinocerebellar ataxia and the gene is selected from ATXN1, ATXN2, ATXN3, PLEKHG4, SPTBN2, CACNA1A, ATXN7, ATXN8OS, ATXN10, TTBK2, PPP2R2B, KCNC3, PRKCG, ITPR1, TBP, KCND3, and FGF14. In some embodiments, the disease is thrombophilia due to antithrombin III deficiency and the gene is SERPINC1. In some embodiments the disease is spinal muscular atrophy and the gene is SMN1. In some embodiments, the disease comprises Usher Syndrome and the gene is selected from MYO7A, USHIC. CDH23, PCDH15, USH1G, USH2A, GPR98, DFNB31, and CLRN1. In some embodiments, the disease comprises von Willebrand disease and the gene is VWF. In some embodiments, the disease comprises Waardenburg syndrome and the gene is selected from PAX3, MITF, WS2B, WS2C, SNAI2, EDNRB, EDN3, and SOX10. In some embodiments, the disease comprises Wiskott-Aldrich Syndrome and the gene is WAS. In some embodiments, the disease comprises von Hippel-Lindau disease and the gene is VHL. In some embodiments, the disease comprises Wilson disease and the gene is ATP7B. In some embodiments, the disease comprises Zellweger syndrome and the gene is selected from PEX1, PEX2, PEX3, PEX5, PEX6, PEX10, PEX12, PEX13, PEX14, PEX16, PEX19, and PEX26. In some embodiments, the disease comprises infantile myofibromatosis and the gene is CD34. In some embodiments, the disease comprises platelet glycoprotein IV deficiency and the gene is CD36. In some embodiments, the disease comprises immunodeficiency with hyper-IgM type 3 and the gene is CD40. In some embodiments, the disease comprises hemolytic uremic syndrome and the gene is CD46. In some embodiments, the disease comprises complement hyperactivation, angiopathic thrombosis, or protein-losing enteropathy and the gene is CD55. In some embodiments, the disease comprises hemolytic anemia and the gene is CD59. In some embodiments, the disease comprises calcification of joints and arteries and the gene is CD73. In some embodiments, the disease comprises immunoglobulin alpha deficiency and the gene is CD79A. In some embodiments, the disease comprises C syndrome and the gene is CD96. In some embodiments, the disease comprises hairy cell leukemia and the gene is CD123. In some embodiments, the disease comprises histiocytic sarcoma and the gene is CD163. In some embodiments, the disease comprises autosomal dominant deafness and the gene is CD164. In some embodiments, the disease comprises immunodeficiency 25 and the gene is CD247. In some embodiments, the disease comprises methymalonic acidemia due to transcobalamin receptor defect and the gene is CD320.
Cancer
[0541] In some embodiments, compositions, systems or methods described herein edit at least one gene associated with a cancer or the expression thereof. Non-limiting examples of cancers include: acute lymphoblastic leukemia; acute lymphoblastic lymphoma; acute lymphocytic leukemia; acute myelogenous leukemia; acute myeloid leukemia (adult/childhood); adrenocortical carcinoma; anal cancer; appendix cancer; astrocytoma; atypical teratoid/rhabdoid tumor; basal-cell carcinoma; bile duct cancer; bladder cancer; bone osteosarcoma; brain cancer; brain tumor; brainstem glioma; breast cancer; bronchial adenoma, carcinoid, or tumor; Burkitt lymphoma; carcinomacervical cancer; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloid leukemia; colon cancer; colorectal cancer; emphysema; endometrial cancer; esophageal cancer; Ewing sarcoma; gallbladder cancer; gastric (stomach) cancer; gastrointestinal tumor; gliomahairy cell leukemia; head and neck cancer; liver cancer; Hodgkin's lymphoma; hypopharyngeal cancer; Kaposi Sarcoma; kidney cancer lip and oral cavity cancer; liposarcoma; lung cancer, non-small cell lung cancer; Waldenstr?m; melanoma; mesotheliomamyelogenous leukemia; myeloid leukemia; myeloma; nasopharyngeal carcinoma; neuroblastoma; non-Hodgkin's lymphoma; ovarian cancer; pancreatic cancer; pineal cancer; pituitary tumor; prostate cancer; rectal cancer; renal cell carcinomaretinoblastoma; spinal cord tumor; squamous cell carcinoma; squamous neck cancer; T-cell lymphoma, cutaneous (Mycosis Fungoides and S?zary syndrome); testicular cancer; throat cancer; thyroid cancer; urethral cancer; uterine cancervaginal cancer; and Wilms Tumor. In some embodiments, the cancer is a solid cancer (i.e., a tumor). In some embodiments, the cancer is selected from a blood cell cancer, a leukemia, and a lymphoma. The cancer can be a leukemia, such as, by way of non-limiting example, acute myeloid (or myelogenous) leukemia (AML), chronic myeloid (or myelogenous) leukemia (CML), acute lymphocytic (or lymphoblastic) leukemia (ALL), and chronic lymphocytic leukemia (CLL). In some embodiments, the cancer is any one of colon cancer, rectal cancer, renal-cell carcinoma, liver cancer, bladder cancer, cancer of the kidney or ureter, lung cancer, non-small cell lung cancer, cancer of the small intestine, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, brain cancer (e.g., glioblastoma), cancer of the head or neck, melanoma, uterine cancer, ovarian cancer, breast cancer, testicular cancer, cervical cancer, stomach cancer, Hodgkin's Disease, non-Hodgkin's lymphoma, and thyroid cancer.
[0542] In some embodiments, compositions, systems or methods described herein edit at least one mutation in a target nucleic acid, wherein the at least one mutation is associated with cancer or causative of cancer. In some embodiments, the target nucleic acid comprises a gene associated with cancer, a gene whose overexpression is associated with cancer, a tumor suppressor gene, an oncogene, a checkpoint inhibitor gene, a gene associated with cellular growth, a gene associated with cellular metabolism, a gene associated with cell cycle, combinations thereof, or portions thereof. Non-limiting examples of genes comprising a mutation associated with cancer are ABL, ACE, AF4/HRX, AKT-2, ALK, ALK/NPM, AML1, AML1/MTG8, APC, ATM, AXIN2, AXL, BAP1, BARD1, BCL-2, BCL-3, BCL-6, BCR/ABL, BLM, BMPR1A, BRCA1, BRCA2, BRIP1, c-MYC, CASR, CCR5, CDC73, CDH1, CDK4, CDKN1B, CDKN1C, CDKN2A, CEBPA, CHEK2, CREBBP, CTNNA1, DBL, DEK/CAN, DICER1, DIS3L2, E2A/PBX1, EGFR, ENL/HRX, EPCAM, ERG/TLS, ERBB, ERBB-2, ETS-1, EWS/FLI-1, FH, FKRP, FLCN, FMS, FOS, FPS, GATA2, GCG, GLI, GPC3, GPGSP, GREM1, HER2/neu, HOX11, HOXB13, HRAS, HST, IL-3, INT-2, JAKI, JUN, KIT, KS3, K-SAM, LBC, LCK, LMO1, LMO2, L-MYC, LYL-1, LYT-10, LYT-10/Cal, MAS, MAX, MDM-2, MEN1, MET, MITF, MLH1, MLL, MOS, MSH1, MSH2, MSH3, MSH6, MTG8/AML1, MUTYH, MYB, MYH11/CBFB, NBN, NEU, NF1, NF2, N-MYC, NTHL1, OST, PALB2, PAX-5, PBX1/E2A, PCDC1, PDGFRA, PHOX2B, PIM-1, PMS2, POLD1, POLE, POT1, PPARG, PRAD-1, PRKAR1A, PTCH1, PTEN, RAD50, RAD51C, RAD51D, RAF, RAR/PML, RAS-H, RAS-K, RAS-N, RB1, RECQL4, REL/NRG, RET, RHOM1, RHOM2, ROS, RUNX1, SDHA, SDHAF, SDHAF2, SDHB, SDHC, SDHD, SET/CAN, SIS, SKI, SMAD4, SMARCA4, SMARCB1, SMARCE1, SRC, STK11, SUFU, TAL1, TAL2, TAN-1, TIAM1, TERC, TERT, TIMP3, TMEM127, TNF, TP53, TRAC, TSC1, TSC2, TRK, VHL, WRN, and WT1, Non-limiting examples of oncogenes are KRAS, NRAS, BRAF, MYC, CTNNB1, and EGFR, In some embodiments, the oncogene is a gene that encodes a cyclin dependent kinase (CDK). Non-limiting examples of CDKs are Cdk1, Cdk4, Cdk5, Cdk7, Cdk8, Cdk9, Cdk11 and CDK20. Non-limiting examples of tumor suppressor genes are TP53, RB1, and PTEN.
Infections
[0543] In some embodiments, compositions, systems or methods described herein treats an infection in a subject. In some embodiments, the infections are caused by a pathogen (e.g., bacteria, viruses, fungi, and parasites). In some embodiments, compositions, systems or methods described herein modifies a target nucleic acid associated with the pathogen or parasite causing the infection. In some embodiments, the target nucleic acid may be in the pathogen or parasite itself or in a cell, tissue or organ of the subject that the pathogen or parasite infects. In some embodiments, the methods described herein include treating an infection caused by one or more bacterial pathogens. Non-limiting examples of bacterial pathogens include Acholeplasma laidlawii, Brucella abortus, Chlamydia psittaci, Chlamydia trachomatis, Cryptococcus neoformans, Escherichia coli, Legionella pneumophila, Lyme disease spirochetes, methicillin-resistant Staphylococcus aureus, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma arginini, Mycoplasma arthritidis, Mycoplasma genitalium, Mycoplasma hyorhinis, Mycoplasma orale, Mycoplasma pneumoniae, Mycoplasma salivarium, Neisseria gonorrhoeae, Neisseria meningitidis, Pneumococcus, Pseudomonas aeruginosa, sexually transmitted infection, Streptococcus agalactiae, Streptococcus pyogenes, and Treponema pallidum.
[0544] In some embodiments, compositions, systems or methods described herein treats an infection caused by one or more viral pathogens. Non-limiting examples of viral pathogens include adenovirus, blue tongue virus, chikungunya, coronavirus (e.g., SARS-COV-2), cytomegalovirus, Dengue virus, Ebola, Epstein-Barr virus, feline leukemia virus, Hemophilus influenzae B, Hepatitis virus A, Hepatitis virus B, Hepatitis virus C, herpes simplex virus I, herpes simplex virus II, human papillomavirus (HPV) including HPV16 and HPV18, human serum parvo-like virus, human T-cell leukemia viruses, immunodeficiency virus (e.g., HIV), influenza virus, lymphocytic choriomeningitis virus, measles virus, mouse mammary tumor virus, mumps virus, murine leukemia virus, polio virus, rabies virus, Reovirus, respiratory syncytial virus (RSV), rubella virus, Sendai virus, simian virus 40, Sindbis virus, varicella-zoster virus, vesicular stomatitis virus, wart virus, West Nile virus, yellow fever virus, or any combination thereof.
[0545] In some embodiments, compositions, systems or methods described herein treats an infection caused by one or more parasites. Non-limiting examples of parasites include helminths, annelids, platyhelminthes, nematodes, and thorny-headed worms. In some embodiments, parasitic pathogens comprise, without limitation, Babesia bovis, Echinococcus granulosus, Eimeria tenella, Leishmania tropica, Mesocestoides corti, Onchocerca volvulus, Plasmodium falciparum, Plasmodium vivax, Schistosoma japonicum, Schistosoma mansoni, Schistosoma spp., Taenia hydatigena, Taenia ovis, Taenia saginata, Theileria parva, Toxoplasma gondii, Toxoplasma spp., Trichinella spiralis, Trichomonas vaginalis, Trypanosoma brucei, Trypanosoma cruzi, Trypanosoma rangeli, Trypanosoma rhodesiense, Balantidium coli, Entamoeba histolytica, Giardia spp., Isospora spp., Trichomonas spp., or any combination thereof.
EXAMPLES
[0546] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.
Example 1. PAM Screening for Effector Proteins
[0547] Effector proteins and guide RNA combinations described herein are screened by an in vitro enrichment (IVE) assay to determine PAM recognition by each effector protein-guide RNA complex. Briefly, effector proteins are complexed with corresponding guide RNAs for 15 minutes at 37? C. The complexes are added to an IVE reaction mix. PAM screening reactions use 10 ?l of RNP in 100 ?l reactions with 1,000 ng of a 5 PAM library in 1? Cutsmart buffer and are carried out for 15 minutes at 25? C., 45 minutes at 37? C., and 15 minutes at 45? C. Reactions are terminated with 1 ?l of proteinase K and 5 ?l of 500 mM EDTA for 30 minutes at 37? C. Next generation sequencing is performed on cut sequences to identify enriched PAMs.
Example 2. Effector Proteins Edit Genomic DNA in Mammalian Cells
[0548] Effector proteins are tested for their ability to produce indels in a mammalian cell line (e.g., HEK293T cells). Briefly, a plasmid encoding the effector proteins and a guide RNA are delivered by lipofection to the mammalian cells. This is performed with a variety of guide RNAs targeting several loci adjacent to biochemically determined PAM sequences. Indels in the loci are detected by next generation sequencing of PCR amplicons at the targeted loci and indel percentage is calculated as the fraction of sequencing reads containing insertions or deletions relative to an unedited reference sequence. No plasmid and Cas9 are included as negative and positive controls, respectively.
Example 3. Base Editing
[0549] A nucleic acid vector encoding a fusion protein is constructed for base editing. The fusion protein comprises a catalytically inactive variant of an effector protein fused to a deaminase. The fusion protein and at least one guide nucleic acid is tested for its ability to edit a target sequence in eukaryotic cells. Cells are transfected with the nucleic acid vector and guide nucleic acid. After sufficient incubation, DNA is extracted from the transfected cells. Target sequences are PCR amplified and sequenced by NGS and MiSeq. The presence of base modifications are analyzed from sequencing data. Results are recorded as a change in % base call relative to the negative control.
Example 4. Activation of Gene Expression with Cas Effector Fusion Polypeptide
[0550] A single stranded reporter nucleic acid encoding a fluorescent protein (e.g., enhanced green fluorescent protein (EGFP)) and a eukaryotic promoter is generated with a target sequence that is known to be recognized by complexes of effector proteins disclosed herein and corresponding guide nucleic acids. A nucleic acid vector encoding the Cas effector fused to a transcriptional activator; a guide nucleic acid; and the single stranded reporter nucleic acid encoding EGFP are introduced to eukaryotic cells via lipofection and EGFP expression is quantified by flow cytometry. Relative amounts of RNA, indicative of relative gene expression, are quantified with RT-qPCR.
Example 5. Reduction of Gene Expression with with Cas Effector Fusion Polypeptide
[0551] A single stranded reporter nucleic acid encoding a fluorescent protein (e.g., enhanced green fluorescent protein (EGFP)) and a pSV40 promoter that drives constitutive expression of EGFP is generated with a target sequence that is known to be recognized by complexes of effector proteins disclosed herein and corresponding guide nucleic acids. A nucleic acid vector encoding the Cas effector fused to a transcriptional repressor; a guide nucleic acid; and the single stranded reporter nucleic acid encoding EGFP are introduced to eukaryotic cells via lipofection and EGFP expression is quantified by flow cytometry. Relative amounts of RNA, indicative of relative gene expression, are quantified with RT-qPCR.
Example 6. Generating a Catalytically Inactive Variant of a CRISPR Cas Effector Protein
[0552] Extensive work has been done to evaluate the overall domain structure of the CRISPR Cas enzymes in the last decade. These data can be an effective reference when trying to identify a catalytic residue of a Cas nuclease. By selecting the residue of a Cas nuclease of interest that aligns at the same relative location as the catalytic residue of a known nuclease when the Cas nuclease and known nuclease are aligned for maximal sequence identity, one can identify the catalytic residue of the Cas nuclease.
[0553] Sequence or structural analogs of a Cas nuclease provide an additional or supplemental way to predict the catalytic residues of the novel Cas nuclease relative to the previous description in this Example. Catalytic residues are usually highly conserved and can be identified in this manner.
[0554] Alternatively, or additionally to the description already provided in this Example, computational software may be used to predict the structure of a Cas nuclease.