Recombinant Escherichia Coli for Expressing Synthesis Pathway of Asiaticoside and Application Thereof

20240301461 ยท 2024-09-12

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure discloses recombinant Escherichia coli for expressing a synthesis pathway of asiaticoside and application thereof, and belongs to the field of bioengineering. Rhamnosyltransferase with an amino acid sequence shown in any one of SEQ ID NO: 25 to SEQ ID NO: 29, glucosyltransferase with an amino acid sequence shown in any one of SEQ ID NO: 10 to SEQ ID NO: 17 and UGT73AH1 reported in a document are transferred into E. coli BL21 (DE3)?pgi to realize co-expression. Fermentation results show that all 5 rhamnosyltransferases screened in the present disclosure can achieve effects, and a unique new peak appears at 0.596 min, which is consistent with a characteristic ion flow of an asiaticoside standard product. According to the present disclosure, barriers of the prior art are broken through, a new biosynthesis method for asiaticoside is provided, and industrialization of biosynthesis of asiaticoside becomes possible.

    Claims

    1. Recombinant Escherichia coli, wherein an E. coli is used as a host and the recombinant E. coli overexpresses glucosyltransferase with the amino acid sequence set forth in any one of SEQ ID NO: 10 to SEQ ID NO: 17 and glycosyltransferase UGT73AH1.

    2. The recombinant E. coli according to claim 1, wherein the recombinant E. coli is obtained by knocking out a gene pgi for encoding a glucose phosphate isomerase protein on a genome.

    3. The recombinant E. coli according to claim 2, wherein the gene pgi for encoding the glucose phosphate isomerase protein has the nucleotide sequence set forth in SEQ ID NO: 18.

    4. The recombinant E. coli according to claim 2, wherein the glycosyltransferase UGT73AH1 is derived from Centella asiatica (L.) Urban.

    5. The recombinant E. coli according to claim 1, wherein E. coli BL21 (DE3) is used as a host.

    6. The recombinant E. coli according to claim 1, wherein the recombinant E. coli overexpresses rhamnosyltransferase with an amino acid sequence set forth in any one of SEQ ID NO: 25 to SEQ ID NO: 29.

    7. The recombinant E. coli according to claim 6, wherein E. coli BL21 (DE3) is used as a host.

    8. A method for producing asiaticodiglycoside, comprising inoculating a seed liquid of the recombinant E. coli according to claim 1 into a fermentation culture medium, performing shaking culture until an OD.sub.600 value is 0.6-0.8, adding isopropyl thiogalactoside, adding asiatic acid with a final concentration of 150-250 mg/L after 4-8 hours, and then performing shaking culture continuously for 40-60 hour; or with glucosyltransferase with the amino acid sequence shown in any one of SEQ ID NO: 10 to SEQ ID NO: 17 and glycosyltransferase UGT73AH1 derived from Centella asiatica (L.) Urban as a catalyst, carrying out a reaction in a reaction solution containing uridine diphosphate glucose (UDPG) as a glycosyl donor with a final concentration of 0.8-1.2 g/L and asiatic acid as a substrate with a concentration of 150-250 mg/L at 35-38? C. for 4-10 hours.

    9. The method according to claim 8, wherein the fermentation culture medium comprises 15-25 g/L of glucose, 4-6 g/L of glycerol, 14-18 g/L of K.sub.2HPO.sub.4.Math.3H.sub.2O, 1-3 g/L of KH.sub.2PO.sub.4, 20-30 g/L of yeast powder and 10-15 g/L of peptone.

    10. A method for synthesizing asiaticoside, comprising producing asiaticoside by fermentation with the recombinant E. coli according to claim 6 as an original strain and asiatic acid as a substrate.

    11. The method according to claim 10, wherein the method comprises inoculating a seed liquid of the recombinant E. coli according into a fermentation culture medium, performing shaking culture until an OD.sub.600 value is 0.6-0.8, adding isopropyl thiogalactoside, adding asiatic acid with a final concentration of 150-250 mg/L after 4-8 hours, and then performing shaking culture continuously for 40-60 hours.

    Description

    BRIEF DESCRIPTION OF FIGURES

    [0042] FIG. 1 shows SDS-PAGE electrophoresis results of recombinant E. coli UGT73 in expression, where FIG. A shows a supernatant, and FIG. B shows a precipitate.

    [0043] FIG. 2A shows a liquid phase of recombinant E. coli UGT73 and UGT73AH1 in shake flask fermentation; FIG. 2B shows a liquid phase of a UGTs glycosylation product fermented by recombinant E. coli UGT73AH1 in shake flask fermentation.

    [0044] FIG. 3A shows mass spectrograms on positive ion fragments of recombinant E. coli UGT73 and UGT73AH1 in shake flask fermentation; FIG. 3B shows mass spectrograms on negative ion fragments of recombinant E. coli UGT73 and UGT73AH1 in shake flask fermentation.

    [0045] FIG. 4A shows mass spectrograms on positive ion fragments of crude enzyme solutions of recombinant E. coli UGT73 and UGT73AH1 in a reaction; FIG. 4B shows mass spectrograms on negative ion fragments of crude enzyme solutions of recombinant E. coli UGT73 and UGT73AH1 in a reaction.

    [0046] FIG. 5 shows SDS-PAGE electrophoresis results of recombinant E. coli RRT in expression.

    [0047] FIG. 6A-D shows liquid phase results of recombinant E. coli RRT and VvRHM in shake flask fermentation.

    [0048] FIG. 7 shows mass spectrometry results of recombinant E. coli RRT and VvRHM in shake flask fermentation.

    DETAILED DESCRIPTION

    (One) Culture Media

    [0049] A seed culture medium (LB) includes: 10 g/L of peptone, 5 g/L of a yeast extract and 5 g/L of sodium chloride; and 2% (mass fraction) of agar powder was added into a solid culture medium.

    [0050] A fermentation culture medium (TB) includes: 20 g/L of glucose, 5 g/L glycerol, 16.4 g/L of K.sub.2HPO.sub.4.Math.3H.sub.2O, 2.31 g/L of KH.sub.2PO.sub.4, 24 g/L of yeast powder and 12 g/L of peptone. 20 g/L of the glucose was sterilized separately and mixed uniformly before inoculation.

    (Two) PCR Reaction System and Amplification Conditions

    [0051] 1 ?L (10 ?M) of a forward primer, 1 ?L (10 ?M) of a reverse primer, 20 ng of template DNA and 25 ?L of 2?Phanta Max Master Mix were used, and double distilled water was added to 50 ?L. Amplification conditions were as follows: pre-denaturation at 95? C. for 3 min, followed by 30 cycles (at 95? C. for 15 s, at 55? C. for 15 s and at 72? C. for 15 s) and continuous extension at 72? C. for 10 min.

    (Three) Preparation of E. coli Competent Cells

    [0052] E. coli BL21 (DE3) was subjected to gene editing by using a CRISPR/Cas9 system to construct E. coli BL21 (DE3)?pgi. A plasmid pTarget used for knockout was constructed by a PCR mediated point mutation technology, and a template plasmid pTarget were stored in a laboratory. Primers P21pgi-F and P21pgi-R were used for constructing a plasmid pTarget-pgi, and PPGI-UPARM-F/R and PPGI-downARM-F/R were used for constructing homologous arms used for knockout. Specific operation methods are referred to the document: Li Q, Sun B, Chen J, et al. A modified pCas/pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli [J]. Acta Biochimica et Biophysica Sinica: English version, 2021, 53(5):8.

    TABLE-US-00001 P21pgi-F: (SEQIDNO:64) AGTTGCTGGCGCTGATTGGCATCGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCT; P21pgi-R: (SEQIDNO:65) AAACGATGCCAATCAGCGCCAGCACTAGTATTATACCTAGGACTGAGCT AG; 21-PGI-UPARM-F: (SEQIDNO:66) cctcgtgtcaggggatccattttc; 21-PGI-UPARM-R: (SEQIDNO:67) tgatccggcaaacaaaccaccgctggtagccacggcgcggttttcagtg c; 21-PGI-DOWNARM-F: (SEQIDNO:68) gctaccagcggtggtttgtttgccggatcattgagcaggaatatcgtga tcagg; 21-PGIDOWNARM-R: (SEQIDNO:69) tttacccaaaaacatttcgggcg;

    [0053] BL21 (DE3)?pgi in a glycerol tube was streaked on a corresponding LB plate and cultured overnight at 37? C. (for about 12 h). After 12 h, flat, round and vigorously growing bacteria were selected, inoculated into a 50 mL shake flask containing 5 mL of an LB culture medium and cultured at 220 rpm at 37? C. for about 8-10 h. The bacteria were inoculated into a 250 mL conical flask containing 50 mL of LB at an inoculation amount of 1% and cultured at 220 rpm at 37? C. for about 2 h until an OD.sub.600 value was 0.6-0.8. A bacterial solution was transferred to a 50 mL centrifuge tube, placed on ice for about 10-15 min and centrifuged at 4,000 rpm at 4? C. for 5 min to remove a supernatant. 5 mL of a solution A was added for resuspension, and centrifugation was performed at 4,000 rpm at 4? C. for 5 min to remove a supernatant. Then, 5 mL of a solution B was added to resuspend the bacteria, and a resulting product was packaged in 100 ?L/part and store at ?80? C.

    (Four) Transformation of E. coli

    [0054] E. coli competent cells were thawed on ice. 10 ?L of a recombinant product was added into 100 ?L of the competent cells and subjected to standing on ice for 30 min. A resulting mixture was subjected to heat shock in a water bath pot at 42? C. for 45 s, followed by standing on ice for 2 min. 1 mL of an LB culture medium was added, and incubation was performed at 220 rpm at 37? C. for 60 min. Then, centrifugation was performed at 4,000 rpm for 2 min to remove 900 ?L of a supernatant. The bacteria were resuspended with the remaining culture medium and then coated on a corresponding resistant plate.

    [0055] (Five) Identification of asiaticodiglycoside: After completion of fermentation, 2 mL of a fermentation solution was taken, added into an equal volume of methanol, violently shaken and uniformly mixed, followed by centrifugation at 14,000 r/min for 10 min. A supernatant was taken and filtered with a 0.22 ?m organic phase filter membrane, and a product was identified by UPLC-IT-TOF/MS of Shimadzu.

    [0056] (Six) Determination of asiaticodiglycoside by high performance liquid chromatography (HPLC): A Thermo Fisher C18 chromatographic column (4.6 mm?250 mm, 5 m) was used for chromatographic separation; the temperature of a column oven was set to 40? C.; the injection volume was 10 ?L; mobile phases were as follows: phase A: ultrapure water (0.1% of trifluoroacetic acid was added), and phase B: acetonitrile (0.1% of trifluoroacetic acid was added); the total flow rate was 1 mL/min; isocratic elution was used as an elution method, and the ratio of the phase A to the phase B was 70:30; and the wavelength of a detector was 210 nm.

    [0057] (Seven) Extraction of asiaticoside: After completion of fermentation, 2 ml of a fermentation solution was taken, added into an equal volume of methanol, violently shaken and uniformly mixed, followed by centrifugation at 14,000 r/min for 10 min. A supernatant was taken and filtered with a 0.22 ?m organic phase filter membrane, and a product was detected by UPLC-IT-TOF/MS of Shimadzu.

    [0058] (Eight) Determination of asiaticoside by HPLC: A Thermo Fisher C18 chromatographic column (4.6 mm?250 mm, 5 m) was used for chromatographic separation; the temperature of a column oven was set to 40? C.; the injection volume was 10 ?L; mobile phases were as follows: phase A: ultrapure water (0.1% of trifluoroacetic acid was added), and phase B: acetonitrile (0.1% of trifluoroacetic acid was added); the total flow rate was 1 mL/min; isocratic elution was used as an elution method, and the ratio of the phase A to the phase B was 70:30; and the wavelength of a detector was 210 nm.

    Example 1 Screening of Glucosyltransferases with Potential Functions

    [0059] Through BLAST comparison between data of a transcriptome of Centella asiatica and glucosyltransferases with a C-28 site that have known functions and are derived from 17 different sources in documents, results show that 5 isoenzymes are basically homologous to 12 genes with an E value of 0.

    [0060] Through comparison between sequences of the 12 genes, it can be seen that evm.model.CM025782.1.1646 [mRNA] and reported CaUGT73AH1 have differences in only one amino acid, evm.model.CM025782.1.1645 [mRNA] and evm.model.CM025782.1.1643 [mRNA] have an exactly same protein sequence, and evm.model.CM025782.1.1647 [mRNA] and CaUGT73AH1 have an exactly same protein sequence. In addition, all known glucosyltransferases with C28-COOH reported at present belong to the UGT73 family. According to KEGG analysis results is combination with BLAST comparison results, the enzymes were renumbered, as shown in Table 1 below.

    TABLE-US-00002 TABLE 1 Glycosyltransferases with high similarity Functional annotation Functional Transcriptome gene ID Number of KEGG annotation of GO evm.model.CM025782.1.1649 UGT73C1 K13496 UGT73C; UDP- GO:0008194(UDP- [mRNA] glucosyltransferase 73C glycosyltransferase [EC:2.4.1.-] activity) evm.model.CM025782.1.1644 UGT73C4 [mRNA] evm.model.CM025782.1.1643 UGT73C5 [mRNA] evm.model.CM025783.1.1337 UGT73C7 [mRNA] evm.model.CM025783.1.1336 UGT73C8 [mRNA] evm.model.CM025783.1.1338 UGT73C9 [mRNA] evm.model.CM025783.1.1335 UGT73C10 ND [mRNA] evm.model.CM025781.1.1405 UGT73C11 ND [mRNA]

    Example 2 Gene Amplification of Glycosyltransferase and Construction of Recombinant E. coli for Expressing Glucosyltransferase

    [0061] With cDNA obtained by reverse transcription of Centella asiatica as a template, priming pairs (Table 2) used for amplifying the glucosyltransferases screened in Example 1 were designed and subjected to amplification by PCR, respectively by selecting a Primer Star MasterMix high-fidelity pfu enzyme (Takara) under the following conditions: pre-denaturation at 95? C. for 3 min; at an amplification stage, 30 cycles at 95? C. for 15 s, at 60? C. for 15 s and at 72? C. for 1 min; and extension at 72? C. for 5 min. PCR products were purified to obtain target fragments UGT73C1 to UGT73C11, a vector pETDuet-1 was subjected to amplification by PCR with primers pETDuet-F and pETDuet-R, and a product was purified. The purified fragments UGT73C1 to UGT73C11 were recombined with the vector pETDuet-1 skeleton by a Gibson assembly method to obtain recombinant vectors, respectively, and the recombinant vectors were transferred into E. coli JM109. The recombinant vectors obtained were sent to Shanghai Biotech for sequencing to obtain correctly sequenced recombinant plasmids pETDuet-1-UGT73C1, pETDuet-1-UGT73C4, pETDuet-1-UGT73C5, pETDuet-1-UGT73C7, pETDuet-1-UGT73C8, pETDuet-1-UGT73C9, pETDuet-1-UGT73C10 and pETDuet-1-UGT73C11. Then, the plasmids were transferred into E. coli BL21 (DE3)?pgi to obtain recombinant E. coli BL21 (DE3)?pgi/pETDuet-1-UGT73C1 to BL21 (DE3)?pgi/pETDuet-1-UGT73C11, respectively.

    [0062] A primer pair (UGT73AH1-F/UGT73AH1-R, Table 2) used for amplifying UGT73AH1 derived from Centella asiatica (L.) Urban was designed. With a synthetic sequence as a template, the primer pair was subjected to amplification by PCR by selecting a Primer Star MasterMix high-fidelity pfu enzyme (Takara) under the following conditions: pre-denaturation at 95? C. for 3 min; at an amplification stage, 30 cycles at 95? C. for 15 s, at 56? C. for 15 s and at 72? C. for 1 min; and extension at 72? C. for 5 min. A PCR product was purified, a vector pET28a was subjected to amplification by PCR with 28a-F and 28a-R, and a product was purified. A purified fragment UGT73AH1 and the vector pET28a skeleton were recombined by a Gibson assembly method to obtain a recombinant vector, and the recombinant vector was transferred into E. coli JM109. The obtained vector was sequenced to obtain a correctly sequenced recombinant plasmid pET28a-UGT73AH1, and then the plasmid was transferred into E. coli BL21 (DE3)?pgi to obtain recombinant E. coli BL21 (DE3)?pgi/pET28a-UGT73AH1.

    [0063] The recombinant plasmids pETDuet-1-UGT73C1 to pETDuet-1-UGT73C11 were transferred into the recombinant E. coli BL21 (DE3)?pgi/pET28a-UGT73AH1, respectively to obtain a series of recombinant bacteria BL21 (DE3)?pgi/pETDuet-1-UGT73C1/pET28a-UGT73AH1 to BL21 (DE3)?pgi/pETDuet-1-UGT73C11/pET28a-UGT73AH1 containing UGT73AH1 and the glycosyltransferases screened in Example 1.

    TABLE-US-00003 Primersusedforconstructingexpressionvectorsofglucosyltransferases Primer Sequence(5-3) UGT73C1-F TAAGAAGGAGATATACCATGACCAGCAGTCAGCTGAAAG SEQIDNO:30 UGT73C1-R CTGTTCGACTTAAGCATTACTTATTCAGCAGCGGACCCACA SEQIDNO:31 UGT73C4-F TAAGAAGGAGATATACCATGGATGATCTCTCTTCTCTAAAACTGGGTGTTAAATT SEQIDNO:32 TTTTCAAGC UGT73C4-R CTGTTCGACTTAAGCATTACTTTCCCTTAACAAACGGCGGACTTCCAC SEQIDNO:33 UGT73C5-F TTAAGAAGGAGATATACCATGGCTACCAATATTGAGCAGCAGCAGC SEQIDNO:34 UGT73C5-R TTAAGAAGGAGATATACCATGGCTACCAATATTGAGCAGCAGCAGC SEQIDNO:35 UGT73C7-F TTAAGAAGGAGATATACCATGGATTCACAATTTCAGCAGCTTCACTTTGTTATGA SEQIDNO:36 TACCC UGT73C7-R CTGTTCGACTTAAGCATTAGCTTAATGCTAACCTATCCTTTACTTGTTCAATGAT SEQIDNO:37 GTCTTG UGT73C8-F TAAGAAGGAGATATACCATGGGTTCAGAATCTCAAGTGCAGCTTCAC SEQIDNO:38 UGT73C8-R GTTCGACTTAAGCATCACTTCCTTTCTTTCAAAATGTCTTGGATTAGTAACGTC SEQIDNO:39 UGT73C9-F TAAGAAGGAGATATACCATGGCCAACTTAGCTCAAAACCTTCATTTTGTCTTGC SEQIDNO:40 UGT73C9-R TTCTGTTCGACTTAAGCATCATTTACTTGTCCCATGGGCCATAATTTCTTGAATT SEQIDNO:41 AGGTG UGT73C10-F TAAGAAGGAGATATACCATGTCCCGAATCAGCGGTC SEQIDNO:42 UGT73C10-R TGTTCGACTTAAGCATCAAACATTTTCTTGATTGTTCAATTTCCGG SEQIDNO:43 UGT73C11-F TAAGAAGGAGATATACCATGGGAACTATTGCAAACGGAGAAATTGCCC SEQIDNO:44 UGT73C11-R GTTCGACTTAAGCATCAACAAGTGGTAATTGATCTAATTTCTGAAATGAATTCGT SEQIDNO:45 CG UGT73AH1-F AAGAAGGAGATATACAATGGATTCTCAATTTCAACAATTGCATTTTG SEQIDNO:46 UGT73AH1-R CAGCAGCCTAGGTTAATttaAGACAAAGCTAATCTATCTTTAACTTGTTCAATTA SEQIDNO:47 TATCTTG 28a-R GTTGAAATTGAGAATCCATggtatatctccttcttaaagttaaacaaaattattt SEQIDNO:48 ctagaggg 28a-F GATAGATTAGCTTTGTCTtaagaattcgagctccgtcgacaag SEQIDNO:49 pETDuet-R GTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG SEQIDNO:50 pETDuet-F TGCTTAAGTCGAACAGAAAGTAATCGTATTG SEQIDNO:51

    Example 3 Induced Expression of Glucosyltransferase

    [0064] With a strain BL21 (DE3)?pgi/pETDuet-1 transformed with an empty vector pETDuet-1 as a control, the series of recombinant E. coli constructed in Example 2 were subjected to streak culture on an LB plate containing ampicillin with a concentration of 50 ?g/mL at 37? C. for 12 h, respectively. Single bacterial colonies were selected, transferred into 5 mL of an LB liquid culture medium containing ampicillin with a concentration of 50 ?g/mL and subjected to shaking culture at 220 rpm at 37? C. for 12 h. The single bacterial colonies were transferred into 25 mL of a TB liquid culture medium containing ampicillin with a concentration of 50 ?g/mL at an inoculation amount of 1% by volume and subjected to shaking culture at 220 rpm at 37? C. until an OD.sub.600 value was 0.6-0.8. Isopropyl thiogalactoside (IPTG) was added to a final concentration of 0.5 ?mol/L and subjected to shaking culture continuously at 220 rpm at 16? C. for 20 h.

    [0065] 1 mL of a bacterial solution was sucked to determine the final OD.sub.600 value. 1 mL of the bacterial solution was centrifuged at 5,000?g for 1 min to collect bacteria, and the bacteria were resuspended with 1 mL of a 0.1 M PBS buffer solution with a pH value of 7.4, centrifuged at 5,000?g for 1 min and then washed to remove the residual culture medium. The bacteria were resuspended with a 0.1 M PBS buffer solution with a pH value of 7.4 to control the OD.sub.600 value of a final resuspended bacterial solution at 5. The bacteria were crushed with an ultrasonic crusher. After completion of crushing, a crushed solution was collected and centrifuged at 12,000?g for 2 min, and a supernatant, namely, a crude enzyme solution of glucosyltransferase, was collected. SDS-PAGE results are shown in FIG. 1.

    Example 4 Production of Asiaticodiglycoside by Induced Fermentation of Recombinant E. coli

    [0066] With a strain BL21 (DE3)?pgi/pETDuet-1/pET28a transformed with an empty vector as a control, the series of recombinant E. coli BL21 (DE3)?pgi/pETDuet-1-UGT73C1/pET28a-UGT73AH1 to BL21 (DE3)?pgi/pETDuet-1-UGT73C11/pET28a-UGT73AH1 constructed in Example 2 were subjected to streak culture on an LB plate containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL at 37? C. for 12 h, respectively. Single bacterial colonies were selected, transferred into 5 mL of an LB liquid culture medium containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL and subjected to shaking culture at 220 rpm at 37? C. for 12 h. The single bacterial colonies were transferred into 25 mL of a TB liquid culture medium containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL at an inoculation amount of 1% by volume and subjected to shaking culture at 220 rpm at 37? C. until an OD.sub.600 value was 0.6-0.8. Isopropyl thiogalactoside (IPTG) was added to a final concentration of 0.5 ?mol/L, asiatic acid was added as a substrate after 6 h to reach a final concentration of 200 mg/L, shaking culture was performed continuously at 220 rpm at 30? C. for 48 h, and samples were collected and detected at 24 h.

    [0067] After completion of fermentation, 2 mL of a fermentation solution was taken, added into an equal volume of methanol, violently shaken and uniformly mixed, followed by centrifugation at 14,000 r/min for 10 min. A supernatant was taken and filtered with a 0.22 ?m organic phase filter membrane, and a product was detected by UPLC-IT-TOF/MS of Shimadzu. As can be seen from mass spectrograms in FIG. 2A, FIG. 2B, FIG. 3A and FIG. 3B, when UGT73AH1, UGT73C7 and UGT73C8 are transferred into the strain BL21 (DE3)?pgi at the same time, a new peak different from that of the blank control appears at 7.92 min, and mass spectrum data same as that of asiaticodiglycoside are obtained, determining that asiaticodiglycoside is produced.

    Example 5 Production of Asiaticodiglycoside by a Reaction of a Crude Enzyme Solution

    [0068] With a strain BL21 (DE3)?pgi/pETDuet-1/pET28a transformed with an empty vector as a control, the series of recombinant E. coli BL21 (DE3)?pgi/pETDuet-1-UGT73C1/pET28a-UGT73AH1 to BL21 (DE3)?pgi/pETDuet-1-UGT73C11/pET28a-UGT73AH1 constructed in Example 2 were subjected to streak culture on an LB plate containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL at 37? C. for 12 h, respectively. Single bacterial colonies were selected, transferred into 5 mL of an LB liquid culture medium containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL and subjected to shaking culture at 220 rpm at 37? C. for 12 h. The single bacterial colonies were transferred into 25 mL of a TB liquid culture medium containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL at an inoculation amount of 1% and subjected to shaking culture at 220 rpm at 37? C. until an OD.sub.600 value was 0.6-0.8. Isopropyl thiogalactoside (IPTG) was added into a culture to reach a final concentration of 0.5 ?mol/L, and shaking culture was performed continuously at 220 rpm at 16? C. for 20 h.

    [0069] After completion of culture, 1 mL of the culture was sucked to determine the final OD.sub.600 value. 1 mL of a bacterial solution was centrifuged at 5,000?g for 1 min to collect bacteria. The bacteria were resuspended with 1 mL of a 0.1 M PBS buffer solution with a pH value of 7.4, centrifuged at 5,000?g for 1 min and then washed to remove the residual culture medium. The bacteria were resuspended with a 0.1 M PBS buffer solution with a pH value of 7.4 to control the OD.sub.600 value of a final resuspended bacterial solution at 5. The bacteria were crushed with an ultrasonic crusher. After completion of crushing, a crushed solution was collected and centrifuged at 12,000?g for 2 min, and a supernatant, namely, a crude enzyme solution of glucosyltransferase, was collected.

    [0070] The volume of the total enzyme reaction system was 500 ?l, the volume of the crude enzyme solution was 100 ?l, the final concentration of the added UDPG was 1 g/L, the final concentration of asiatic acid added as a substrate was 200 mg/L, and the system was supplemented with a PBS buffer solution to 500 ?l to carry out a reaction at 37? C. for 6 h. After completion of fermentation, an equal volume of methanol was added, violently shaken and uniformly mixed, followed by centrifugation at 14,000 r/min for 10 min. A supernatant was taken and filtered with a 0.22 ?m organic phase filter membrane, and a product was detected by UPLC-IT-TOF/MS of Shimadzu. As can be seen from mass spectrograms in FIG. 4A and FIG. 4B, when UGT73AH1, UGT73C7 and UGT73C8 are transferred into the strain BL21 (DE3)?pgi at the same time, a new peak different from that of the blank control appears at 7.92 min, and mass spectrum data same as that of asiaticodiglycoside are obtained, determining that asiaticodiglycoside is produced.

    Example 6 Screening of Rhamnosyltransferases with Potential Functions

    [0071] Through BLAST comparison between data of a transcriptome of Centella asiatica and rhamnosyltransferases that have known functions and are derived from 50 different sources in documents, results show that 5 isoenzymes are basically homologous to genes of the rhamnosyltransferases that have known functions in documents, and the E value is 0. Meanwhile, according to KEGG enrichment analysis, 5 rhamnosyltransferases in the transcriptome of Centella asiatica can be annotated.

    TABLE-US-00004 TABLE 3 Rhamnosyltransferases with high similarity Functional Functional annotation of annotation Transcriptome gene ID Number KEGG of GO evm.model.CM025780.1.1337[mRNA] RRT1 K23280 RRT; ND evm.model.CM025784.1.1860[mRNA] RRT2 rhamnogalacturonan I evm.model.CM025781.1.322 [mRNA] RRT3 rhamnosyltransferase evm.model.CM025784.1.718[mRNA] RRT4 [EC:2.4.1.351] evm.model.CM025785.1.2450[mRNA] RRT5

    Example 7 Gene Amplification of Glycosyltransferase and Construction of Recombinant E. coli for Expressing Rhamnosyltransferase

    [0072] With cDNA obtained by reverse transcription of Centella asiatica as a template, priming pairs (Table 4) used for amplifying sequences of the rhamnosyltransferases screened in Example 6 were designed and subjected to amplification by PCR, respectively by selecting a Primer Star MasterMix high-fidelity pfu enzyme (Takara) under the following conditions: pre-denaturation at 95? C. for 3 min; at an amplification stage, 30 cycles at 95? C. for 15 s, at 60? C. for 15 s and at 72? C. for 1 min; and extension at 72? C. for 5 min. PCR products were purified to obtain target fragments RRT1 to RRT5, meanwhile, a vector pRSFDuet-1 was subjected to amplification by PCR with a primer pair VvRHM-F and VvRHM-R, and a product was purified. The purified fragments RRT1 to RRT5 were recombined with the vector pRSFDuet-1 skeleton by a Gibson assembly method to obtain recombinant vectors, respectively, and the recombinant vectors were transferred into E. coli JM109. The vectors obtained were sent to Shanghai Biotech for sequencing to obtain correctly sequenced recombinant plasmids pRSFDuet-1-RRT1 to pRSFDuet-1-RRT5. Then, the plasmids were transferred into E. coli BL21 (DE3)?pgi to obtain recombinant E. coli BL21 (DE3)?pgi/pRSFDuet-1-RRT1 to BL21 (DE3)?pgi/pRSFDuet-1-RRT5, respectively.

    [0073] With a synthetic sequence as a template, a primer pair (Table 4) used for amplifying rhamnose isomerase VvRHM derived from Vitis vinifera was designed and subjected to amplification by PCR by selecting a Primer Star MasterMix high-fidelity pfu enzyme (Takara) under the following conditions: pre-denaturation at 95? C. for 3 min; at an amplification stage, 30 cycles at 95? C. for 15 s, at 56? C. for 15 s and at 72? C. for 1 min; and extension at 72? C. for 5 min. A PCR product was purified, a vector pRSFDuet-1 was subjected to amplification by PCR, and a product was purified. A purified fragment VvRHM and the vector pRSFDuet-1 skeleton were recombined by a Gibson assembly method to obtain a recombinant vector, and the recombinant vector was transferred into E. coli JM109. The obtained vector was sequenced by Shanghai Biotech, correctly compared and then transferred into E. coli BL21 (DE3)?pgi to obtain recombinant E. coli BL21 (DE3)?pgi/pRSFDuet-1-VvRHM.

    TABLE-US-00005 TABLE4 Primersusedforconstructingexpressionvectorsofglucosyltransferases Primer Sequence(5-3) RRT1-F TAATAAGGAGATATACCATGGAGGTTAGATCCGAGAGTGTACAGTTG SEQIDNO:52 AGG RRT1-R GATTACTTTCTGTTCGATCATCTCGAAGTTTCTGTTGAATTGACGGTAC SEQIDNO:53 CTAATACG RRT2-F TAATAAGGAGATATACCATGTGTGAATTAGATGAGAACAGGGAAGAG SEQIDNO:54 AGGGAGA RRT2-R GATTACTTTCTGTTCGATCATGTAATTCTTAATGGTTCAACCAAGGGTT SEQIDNO:55 GCAAACACTC RRT3-F ATAAGGAGATATACCATGGAGTTTAGATCTGAGAATGCACAGAATAG SEQIDNO:56 GTGTGATAAACTG RRT3-R CGATTACTTTCTGTTCGATTACCGGAACTTCTCAGTTAAATTGCCCGGG SEQIDNO:57 RRT4-F TAATAAGGAGATATACCATGGGGTGGAAGACATTAGGAGGTGAGAGT SEQIDNO:58 AG RRT4-R TACTTTCTGTTCGATCAGATGATGCTTAGAAGTTCTTCAGATGAAACTT SEQIDNO:59 CTGAAAATCGC RRT5-F AATAAGGAGATATACCATGAAAAGTGTGAGAGTGGAGGGGAGAGGG SEQIDNO:60 RRT5-R GATTACTTTCTGTTCGATCATTCAAGTGTATATTGTTCAACCAAGGGCT SEQIDNO:61 GAAAACAC VvRHM-F tttaactttaataaggagatataccATGGCGACCCATACCCCG SEQIDNO:62 VvRHM- CATggtatatctccttTTACTCGAGCGCTTTCACTTCGG SEQIDNO:63 R

    Example 8 Induced Expression of Rhamosyltranserase

    [0074] With a strain BL21 (DE3)?pgi/pRSFDuet-1 transformed with an empty vector pRSFDuet-1 as a control, the series of recombinant E. coli constructed in Example 7 were subjected to streak culture on an LB plate containing kanamycin with a concentration of 50 ?g/mL at 37? C. for 12 h, respectively. Single bacterial colonies were selected, transferred into 5 mL of an LB liquid culture medium containing kanamycin with a concentration of 50 ?g/mL and subjected to shaking culture at 220 rpm at 37? C. for 12 h. The single bacterial colonies were transferred into 25 mL of a TB liquid culture medium containing kanamycin with a concentration of 50 ?g/mL at an inoculation amount of 1% by volume and subjected to shaking culture at 220 rpm at 37? C. until an OD.sub.600 value was 0.6-0.8. Isopropyl thiogalactoside (IPTG) was added to a final concentration of 0.5 ?mol/L and subjected to shaking culture continuously at 220 rpm at 16? C. for 20 h.

    [0075] After completion of culture, 1 mL of a bacterial solution was sucked to determine the final OD.sub.600 value. 1 mL of the bacterial solution was centrifuged at 5,000?g for 1 min to collect bacteria, and the bacteria were resuspended with 1 mL of a 0.1 M PBS buffer solution with a pH value of 7.4, centrifuged at 5,000?g for 1 min and then washed to remove the residual culture medium. The bacteria were resuspended with a 0.1 M PBS buffer solution with a pH value of 7.4 to control the OD.sub.600 value of a final resuspended bacterial solution at 5. The bacteria were crushed with an ultrasonic crusher. After completion of crushing, a crushed solution was collected and centrifuged at 12,000?g for 2 min, and a supernatant, namely, a crude enzyme solution of rhamnosyltransferase, was collected. SDS-PAGE results are shown in FIG. 5.

    Example 9 Production of Asiaticoside by Induced Fermentation of Recombinant E. coli

    (1) Construction of Recombinant E. coli for Producing Asiaticoside

    [0076] Glucosyltransferase UGT73C7 with an amino acid sequence shown in SEQ ID NO: 13 was linked between XbaI and EcoRI restriction enzyme cutting sites of a vector pETDuet-1, glucosyltransferase UGT73AH1 with an amino acid sequence shown in SEQ ID NO: 19 was linked between NdeI and XhoI restriction enzyme cutting sites of the vector pETDuet-1 to construct a recombinant vector, and the recombinant vector was transferred into E. coli JM109. The obtained vector was sequenced by Shanghai Biotech to obtain a correctly sequenced recombinant plasmid pETDuet-1-UGT73AH1-UGT73C7.

    [0077] Glucosyltransferase UGT73C8 with an amino acid sequence shown in SEQ ID NO: 14 was linked between XbaI and EcoRI restriction enzyme cutting sites of a vector pETDuet-1, glucosyltransferase UGT73AH1 with an amino acid sequence shown in SEQ ID NO: 19 was linked between NdeI and XhoI restriction enzyme cutting sites of the vector pETDuet-1 to construct a recombinant vector, and the recombinant vector was transferred into E. coli JM109. The obtained vector was sequenced by Shanghai Biotech to obtain a correctly sequenced recombinant plasmid pETDuet-1-UGT73AH1-UGT73C8.

    [0078] The recombinant plasmid pETDuet-1-UGT73AH1-UGT73C7 or pETDuet-1-UGT73AH1-UGT73C8 was transferred into the series of recombinant E. coli constructed in Example 7 to obtain recombinant E. coli BL21 (DE3)?pgi/pRSFDuet-1-RRT1/pETDuet-1-UGT73AH1-UGT73C7 to BL21 (DE3)?pgi/pRSFDuet-1-RRT5/pETDuet-1-UGT73AH1-UGT73C7, BL21 (DE3)?pgi/pRSFDuet-1-RRT1/pETDuet-1-UGT73AH1-UGT73C8 to BL21 (DE3)?pgi/pRSFDuet-1-RRT5/pETDuet-1-UGT73AH1-UGT73C8, BL21 (DE3)?pgi/pRSFDuet-1-VvRHM-RRT/pETDuet-1-UGT73AH1-UGT73C7, and BL21 (DE3)?pgi/pRSFDuet-1-VvRHM-RRT/pETDuet-1-UGT73AH1-UGT73C8.

    (2) Production of Asiaticoside by Shake Flask Fermentation

    [0079] With a strain BL21 (DE3)?pgi/pRSFDuet-1/pETDuet-1 transformed with empty vectors pRSFDuet-1 and pETDuet-1 as a control, the series of recombinant E. coli constructed in step (1) were subjected to streak culture on an LB plate containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL at 37? C. for 12 h, respectively. Single bacterial colonies were selected, transferred into 5 mL of an LB liquid culture medium containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL and subjected to shaking culture at 220 rpm at 37? C. for 12 h. The single bacterial colonies were transferred into 25 mL of a TB liquid culture medium containing kanamycin with a concentration of 50 ?g/mL and ampicillin with a concentration of 50 ?g/mL at an inoculation amount of 1% by volume and subjected to shaking culture at 220 rpm at 37? C. until an OD.sub.600 value was 0.6-0.8. IPTG was added to a final concentration of 0.5 ?mol/L, asiatic acid was added as a substrate after 6 h to reach a final concentration of 200 mg/L, shaking culture was performed continuously at 220 rpm at 30? C. for 48 h, and samples were collected and detected at 24 h.

    [0080] After completion of fermentation, 2 ml of a fermentation solution was taken, added into an equal volume of methanol, violently shaken and uniformly mixed, followed by centrifugation at 14,000 r/min for 10 min. A supernatant was taken and filtered with a 0.22 ?m organic phase filter membrane, and a product was detected by UPLC-IT-TOF/MS of Shimadzu. As can be seen from mass spectrograms in FIGS. 6A-D and FIG. 7, the UGT73AH1 and the glucosyltransferase (UGT73C7 or UGT73C8) undergo co-expression with the 5 rhamnosyltransferases screened in Example 6 to prepare asiaticoside by fermentation, respectively, and a unique new peak appears at 0.596 min, which is consistent with a characteristic ion flow of an asiaticoside standard product, determining that the substance is asiaticoside.

    [0081] Although the present disclosure has been disclosed as above through exemplary examples, the examples are not intended to limit the present disclosure. For any person familiar with the art, various changes and modifications can be made without departing from the spirit and scope of the present disclosure. Therefore, the protection scope of the present disclosure should be as defined in the claims.