Method for preparing functional hepatic progenitor cells or hepatic cells, or functional small intestinal epithelial progenitor cells or small intestinal epithelial cells

12110507 ยท 2024-10-08

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a method for preparing functional hepatic (progenitor) cells or functional small intestinal epithelial (progenitor) cells, comprising the step of culturing an isolated cell population comprising hepatic (progenitor) cells or small intestinal epithelial (progenitor) cells in the presence of an antibiotic. Also, provided is a substantially homogeneous isolated cell population comprising functional hepatic progenitor cells, wherein an expression level of CYP3A4 in the functional hepatic progenitor cells is increased by at least 5 times the expression level thereof in a HepaRG? cell line.

Claims

1. A method for preparing functional hepatic progenitor cells or functional hepatic cells, or functional small intestinal epithelial progenitor cells or functional small intestinal epithelial cells, the method comprising the step of culturing an isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells in the presence of 0.1 to 100 ?g/ml puromycin and 5 to 15 mg/ml ammonia, wherein the hepatic progenitor cells or hepatic cells, or the small intestinal epithelial progenitor cells or small intestinal epithelial cells do not comprise an exogenous resistance gene for the antibiotic.

2. The method according to claim 1, wherein the isolated cell population is a primary culture derived from a hepatic tissue or a small intestinal epithelial tissue.

3. The method according to claim 1, wherein the isolated cell population is differentiated from stem cells.

4. The method according to claim 3, wherein the stem cells are embryonic stem (ES) cells.

5. The method according to claim 3, wherein the stem cells are induced pluripotent stem (iPS) cells.

6. The method according to claim 5, wherein the iPS cells are derived from a healthy individual.

7. The method according to claim 5, wherein the iPS cells are derived from a drug-induced liver injury patient or a drug-induced small intestinal injury patient.

8. The method according to claim 1, wherein the culture step is performed in the presence of a hepatic differentiation inducing factor.

9. The method according to claim 8, wherein the hepatic differentiation inducing factor is selected from the group consisting of a cytokine, a cell growth factor, a ROCK inhibitor, a MAPK inhibitor, an ALK inhibitor and an extracellular matrix.

10. A stable functional hepatic progenitor cell line or a stable functional hepatic cell line obtained by a method according to claim 1, wherein an expression level of CYP3A4 in the functional hepatic progenitor cells is increased by at least 5 times the expression level thereof in a HepaRG cell line, an immortalized mature hepatic cell line, or a hepatic cell line obtained by inducing differentiation without selection based on puromycin.

11. A stable functional small intestinal epithelial progenitor cell line or a stable functional small intestinal epithelial cell line obtained by a method according to claim 1, wherein an expression level of CYP3A4 in the functional hepatic progenitor cells is increased by at least 5 times the expression level thereof in a HepaRG cell line, an immortalized mature hepatic cell line, or a hepatic cell line obtained by inducing differentiation without selection based on puromycin.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a diagram showing a phase-contrast micrograph of fulminant hepatitis patient-derived iPS cells (iPSC-K cells).

(2) FIGS. 2a-2b are diagrams showing phase-contrast micrographs (a) before puromycin treatment and (b) after puromycin treatment as to hepatic progenitor cells differentiated from iPSC-K cells.

(3) FIG. 3 is a diagram showing micrographs (hematoxylin-eosin staining) of cells differentiated from HepaSM cells.

(4) FIG. 4 is a diagram showing micrographs (right: bright field, left: immunostaining (CYP3A4)) of cells differentiated from HepaSM cells.

(5) FIG. 5 is a diagram showing a fluorescence micrograph in which the expression of hepatic cell markers in cells differentiated from HepaSM cells was confirmed by immunocytochemistry.

(6) FIGS. 6a-6c are graphs showing results of a qRT-PCR analysis to investigate the expression of hepatic cell markers in cells differentiated from HepaSM cells.

(7) FIGS. 7a-7e are graphs showing results of a qRT-PCR analysis to investigate the expression of hepatic cell markers in hepatic cells differentiated from HepaSM cells (puromycin (+)), HepaRG? cells (RG), immortalized mature hepatic cells (MN), and hepatic cells obtained by inducing the differentiation without selection based on puromycin (YK).

(8) FIGS. 8a-8e are graphs showing results of a qRT-PCR analysis to investigate the expression hepatic cell markers when hepatic cells differentiated from HepaSM cells were or were not treated with rifampicin.

(9) FIGS. 9a-9b are diagrams showing micrographs in which the expression of proliferating cell markers in hepatic cells differentiated from HepaSM cells was confirmed by immunocytochemistry.

(10) FIGS. 10a-10e are diagrams showing phase-contrast micrographs after treatment with each antibiotic of hepatic progenitor cells differentiated from iPSC-K cells.

(11) FIGS. 11a-11f are diagrams showing phase-contrast micrographs after treatment with each antibiotic of hepatic progenitor cells differentiated from SEES5 cells.

(12) FIGS. 12a-12b are diagrams showing phase-contrast micrographs after puromycin treatment and after ammonia treatment of hepatic progenitor cells differentiated from iPSC-O cells or SEES5 cells.

(13) FIGS. 13a-13d are graphs showing results of a qRT-PCR analysis to investigate the expression of metabolizing enzymes in cells obtained by puromycin treatment and ammonia treatment as to hepatic progenitor cells differentiated from iPSC-O cells.

(14) FIGS. 14a-14b are diagrams showing phase-contrast micrographs before puromycin treatment as to gut organoid differentiated from Edom-iPS cells.

(15) FIGS. 15a-15b are diagrams showing phase-contrast micrographs after puromycin treatment as to gut organoid differentiated from Edom-iPS cells.

DESCRIPTION OF EMBODIMENTS

(16) Hereinafter, the present invention will be described in detail. However, the present invention is not limited by the embodiments described in the present specification.

(17) According to the first embodiment, the present invention provides a method for preparing functional hepatic progenitor cells or functional hepatic cells, or functional small intestinal epithelial progenitor cells or functional small intestinal epithelial cells, the method comprising the step of culturing an isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells in the presence of an antibiotic.

(18) In the present embodiment, the functional hepatic progenitor cells mean cells having the ability to differentiate into hepatic cells having the same or similar ability to metabolize drugs as that of hepatic cells in the living body. In the present embodiment, the functional hepatic cells means hepatic cells having the same or similar ability to metabolize drugs as that of hepatic cells in the living body. In the present embodiment, the functional small intestinal epithelial progenitor cells mean cells having the ability to differentiate into small intestinal epithelial cells having the same or similar ability to metabolize drugs as that of small intestinal epithelial cells in the living body. In the present embodiment, the functional small intestinal epithelial cells mean small intestinal epithelial cells having the same or similar ability to metabolize drugs as that of small intestinal epithelial cells in the living body. In this context, the phrase having the ability to metabolize drugs for cells mean that the cells express a drug metabolizing enzyme cytochrome P450, specifically, at least one cytochrome P450 selected from the group consisting of CYP3A4, CYP1A2 and CYP2B6, in an amount sufficient for exhibiting drug metabolizing activity. The hepatic cells can include both mature hepatic cells and immature hepatic cells.

(19) In the present embodiment, the isolated cell population means a population consisting of a plurality of cells isolated from an in vivo environment (e.g., a tissue) and cultured in vitro.

(20) The isolated cell population according to the present embodiment can be a primary culture derived from a hepatic tissue or a small intestinal epithelial tissue. The hepatic tissue or the small intestinal epithelial tissue that can be used in the present embodiment may be derived from a freely chosen vertebrate and is preferably derived from a mammal such as a mouse, a rat, a rabbit, sheep, a pig, cattle, a goat, a monkey, or a human, particularly preferably derived from a human. The hepatic tissue or the small intestinal epithelial tissue may be either a fetal tissue or an adult tissue. A method for preparing the primary culture from the hepatic tissue has been sufficiently established, and the primary culture from the hepatic tissue can be prepared according to a method known in the art (Cole, K. E. et al., Cancer Res., 1986; 46 (3):1290-6; and Adams R. S. et al., Proc. Natl. Acad. Sci. USA., 1992; 89 (19): 8981-5). The primary culture from the small intestinal epithelial tissue can also be prepared according to a method known in the art (Wang et al., Nature, 2015; 522: 173-178).

(21) The isolated cell population according to the present embodiment can be differentiated from stem cells. In the present embodiment, the stem cells mean cells having the ability to self-renew and the ability to differentiate. The stem cells are classified, according to their ability to differentiate, into pluripotent stem cells, multipotent stem cells, unipotent stem cells, and the like. Any of stem cells can be used in the method of the present embodiment as long as the stem cells that can be used in the present embodiment has the ability to differentiate into at least hepatic cells or small intestinal epithelial cells. Even stem cells that originally differentiate into fat cells, skeletal muscle cells, osteoblasts, or the like and differentiate into neither hepatic cells nor small intestinal epithelial cells can be used in the method of the present embodiment as long as the stem cells are capable of acquiring the ability to differentiate into hepatic cells or small intestinal epithelial cells by procedures of differentiation as mentioned later.

(22) The stem cells that can be used in the method of the present embodiment can be derived from a freely chosen vertebrate and is preferably derived from a mammal such as a mouse, a rat, a rabbit, sheep, a pig, cattle, a goat, a monkey, or a human, particularly preferably derived from a human. The stem cells that can be used in the present embodiment may be prepared from blastocyst, a fetal tissue, an adult tissue or umbilical cord blood. The tissue for preparing the stem cells is not particularly limited, and the stem cells can be prepared from, for example, bone marrow, muscle, the brain, the pancreas, the liver, or the kidney. The stem cells that can be used in the present embodiment can be embryonic stem (ES) cells, somatic stem cells, or induced pluripotent stem (iPS) cells and are preferably ES cells or iPS cells. The iPS cells may be derived from a healthy individual or may be derived from a drug-induced liver injury patient or a drug-induced small intestinal injury patient.

(23) A method for preparing the ES cells and the iPS cells has been sufficiently established, and these cells can be prepared according to a method known in the art (Takahashi, K. et al., Cell 2007; 131 (5): 861-72, doi:10.1016/j.cell.2007.11.019). Alternatively, an already established ES cell line or iPS cell line may be obtained from, for example, RIKEN BRC or ATCC (American Type Culture Collection).

(24) Various culture conditions for inducing the stem cells to differentiate into hepatic (progenitor) cells or small intestinal epithelial (progenitor) cells are known. The isolated cell population comprising hepatic (progenitor) cells or small intestinal epithelial (progenitor) cells having the desired degree of differentiation or maturity can be prepared by appropriately selecting the conditions. The stem cells can be differentiated into hepatic (progenitor) cells or small intestinal epithelial (progenitor) cells, for example, by forming embryoid bodies from the stem cells. Culture conditions for forming the embryoid bodies have been sufficiently established, and the embryoid bodies can be formed, for example, by suspension-culturing the stem cells for 1 day to 2 weeks in a medium containing no differentiation inhibiting factor. Alternatively, the stem cells can be differentiated (induced to differentiate) into hepatic (progenitor) cells, for example, by culturing the stem cells in a differentiation induction medium supplemented with a liquid factor such as activin A, FGF, or BMP. Also, the stem cells can be differentiated (induced to differentiate) into small intestinal epithelial (progenitor) cells, for example, by culturing the stem cells in a differentiation induction medium supplemented with a liquid factor such as heregulin ?1, IGF, or bFGF. Without the use of the liquid factor, the stem cells may be placed on a base material with a patterned cell adhesion region and non-cell-adhesion region and thereby differentiated into gut organoid (JP 2017-184749 A).

(25) A kit for inducing the stem cells to differentiate into hepatic (progenitor) cells is commercially available, and such a commercially available product may be used. Preferred examples of the commercially available product include Cellartis? iPS Cell to Hepatocyte Differentiation System (Cellartis, Y30055).

(26) In the method of the present embodiment, an isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells is cultured in the presence of an antibiotic. In this context, in the present embodiment, the antibiotic means a general cytotoxic compound that inhibits the survival and proliferation of cells. In the method of the present embodiment, the isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells is cultured in the presence of an antibiotic so that cells that cannot metabolize the antibiotic are killed while only functional hepatic progenitor cells or functional hepatic cells, or functional small intestinal epithelial progenitor cells or functional small intestinal epithelial cells, which can metabolize the antibiotic, can be selected.

(27) Any antibiotic other than a cell wall synthesis inhibitor can be used as the antibiotic according to the present embodiment. For example, a cell membrane function inhibitor, a protein synthesis inhibitor, a nucleic acid synthesis inhibitor, or a folic acid synthesis inhibitor can be used. One antibiotic selected therefrom can be used alone, or two or more thereof can be used in combination. Preferably, an antibiotic that is generally used for selecting a stable transformant carrying an exogenous gene (so-called antibiotic for selection) can be used as the antibiotic according to the present embodiment. Examples of the antibiotic for selection include, but are not limited to, puromycin, blasticidin S, G418 (also known as Geneticin?), hygromycin, and bleomycin family-derived antibiotics such as bleomycin, phleomycin, and phleomycin D1 (also known as Zeocin?). The antibiotic that can be used in the method of the present embodiment is preferably puromycin.

(28) In the method of the present embodiment, the isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells is cultured for a certain period in a medium supplemented with the antibiotic. The concentration of the antibiotic differs depending on the type of the cells and/or the type of the antibiotic and can be in the range of, for example, 0.1 to 5000 ?g/ml. The culture period differs depending on the type of the antibiotic, and the culture can be performed, for example, over 1 to 10 days. In the case of using, for example, puromycin, as the antibiotic, culture for 1 to 10 days at an antibiotic concentration of 0.1 to 100 ?g/ml is preferred, and culture for 1 to 5 days at an antibiotic concentration of 0.5 to 50 ?g/ml is particularly preferred. For example, a concentration of 20 to 100 ?g/ml of phleomycin for use as the antibiotic, a concentration of 20 to 2000 ?g/ml of hygromycin used, a concentration of 1 to 100 ?g/ml of blasticidin S used, a concentration of 20 to 2000 ?g/ml of phleomycin D1 used, or a concentration of 50 to 5000 ?g/ml of G418 used is preferred in culture for 1 to 10 days.

(29) Examples of the medium that can be used in the method of the present embodiment include basal media such as DMEM and RPMI1640. One medium selected therefrom can be used alone, or two or more types thereof can be used as a mixture. In the method of the present embodiment, the isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells is preferably placed in a concentration range of 1?10.sup.6 to 1?10.sup.8 cells/ml.

(30) For preparing the functional hepatic progenitor cells or the functional hepatic cells by the method of the present embodiment, it is preferred to appropriately add a hepatic differentiation inducing factor to the medium. One member selected from the group consisting of a cytokine, a cell growth factor, a ROCK inhibitor, a MAPK inhibitor, an ALK inhibitor and an extracellular matrix can be used alone as the hepatic differentiation inducing factor, or two or more thereof can be used in combination. For example, oncostatin M (approximately 2 to 200 ng/ml), hepatocyte growth factor (HGF) (approximately 5 to 500 ng/ml), Wnt (approximately 10 to 1000 ng/ml), epithelial cell growth factor (EGF) (approximately 10 to 1000 ng/ml), R-spondin 1 (approximately 10 to 1000 ng/ml), insulin-transferrin-sodium selenite (ITS) (approximately 50 to 5000 ng/ml), nicotinamide (approximately 1 to 100 mM), or hydrocortisone (approximately 40 to 4000 ng/ml) can be used as the cytokine and the cell growth factor, though the cytokine and the cell growth factor are not limited thereto. For example, Y-27632 (approximately 1 to 100 ?mol/ml) can be used as the ROCK inhibitor. For example, SB202190 (approximately 0.5 to 50 ?M) can be used as the MAPK inhibitor. For example, A81-01 (approximately 10 to 1000 ng/ml) can be used as the ALK inhibitor.

(31) In the case of preparing the functional small intestinal epithelial progenitor cells or the functional small intestinal epithelial cells by the method of the present embodiment, it is preferred to appropriately add a small intestinal epithelial differentiation inducing factor to the medium. One member selected from the group consisting of a cytokine, a cell growth factor, a ROCK inhibitor, a MAPK inhibitor, an ALK inhibitor and an extracellular matrix can be used alone as the small intestinal epithelial differentiation inducing factor, or two or more thereof can be used in combination. For example, oncostatin M (approximately 2 to 200 ng/ml), Wnt (approximately 10 to 1000 ng/ml), epithelial cell growth factor (EGF) (approximately 10 to 1000 ng/ml), R-spondin 1 (approximately 10 to 1000 ng/ml), insulin-transferrin-sodium selenite (ITS) (approximately 50 to 5000 ng/ml), nicotinamide (approximately 1 to 100 mM), or hydrocortisone (approximately 40 to 4000 ng/ml) can be used as the cytokine and the cell growth factor, though the cytokine and the cell growth factor are not limited thereto. For example, Y-27632 (approximately 1 to 100 ?mol/ml) can be used as the ROCK inhibitor. For example, SB202190 (approximately 0.5 to 50 ?M) can be used as the MAPK inhibitor. For example, A81-01 (approximately 10 to 1000 ng/ml) can be used as the ALK inhibitor.

(32) The culture in the method of the present embodiment may be performed by an adhesion culture method or may be performed by a suspension culture method and is preferably performed by an adhesion culture method. The adhesion culture can preferably employ a plate or the like coated with an extracellular matrix such as laminin, collagen, gelatin, fibronectin, or Matrigel, or with feeder cells such as mouse embryonic fibroblasts (MEFs). The culture conditions in the method of the present embodiment can be appropriately set depending on the type of the stem cells used. For example, mammal-derived stem cells are preferably cultured under conditions of 37? C. and 5% CO.sub.2.

(33) The method of the present embodiment may further comprise the step of culturing the isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells in the presence of ammonia. Specifically, the isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells can be cultured for a certain period in a medium supplemented with antibiotic. The concentration of ammonia can be in the range of, for example, 5 to 15 mg/ml. The culture period can be, for example, over 1 to 10 days, preferably over 1 to 5 days.

(34) In the method of the present embodiment, the step of culturing an isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells in the presence of an antibiotic, and the step of culturing the isolated cell population in the presence of ammonia can be performed sequentially or simultaneously. For example, the isolated cell population may be cultured for a certain period in the presence of an antibiotic and then, after replacement of the medium with a medium supplemented with ammonia, cultured for a certain period; the isolated cell population may be cultured for a certain period in the presence of ammonia and then, after replacement of the medium with a medium supplemented with the antibiotic, cultured for a certain period; or the isolated cell population may be cultured for a certain period in a medium supplemented with both the antibiotic and ammonia.

(35) According to the method of the present embodiment, functional hepatic cells or functional small intestinal epithelial cells, or their progenitor cells having sufficient ability to metabolize drugs can be prepared by merely culturing an isolated cell population comprising hepatic progenitor cells or hepatic cells, or small intestinal epithelial progenitor cells or small intestinal epithelial cells in the presence of an antibiotic.

(36) According to the second embodiment, the present invention provides functional hepatic progenitor cells or functional hepatic cells, or functional small intestinal epithelial progenitor cells or functional small intestinal epithelial cells obtained by the method disclosed above.

(37) The functional hepatic progenitor cells, the functional hepatic cells, the functional small intestinal epithelial progenitor cells and the functional small intestinal epithelial cells according to the present embodiment are as defined in the first embodiment. Thus, whether the cells obtained by the above method are functional hepatic progenitor cells or functional hepatic cells, or functional small intestinal epithelial progenitor cells or functional small intestinal epithelial cells can be confirmed based on the expression of at least one cytochrome P450 selected from the group consisting of CYP3A4, CYP1A2 and CYP2B6 and can be particularly preferably confirmed based on significant expression of CYP3A4.

(38) According to the third embodiment, the present invention provides a substantially homogeneous isolated cell population comprising functional hepatic progenitor cells, wherein an expression level of CYP3A4 in the functional hepatic progenitor cells is increased by at least 5 times the expression level thereof in a HepaRG? cell line.

(39) The functional hepatic progenitor cells and the isolated cell population according to the present embodiment are as defined in the first embodiment.

(40) In the present embodiment, the phrase substantially homogeneous for the isolated cell population means that the isolated cell population is in a state comprising the cells of interest at a proportion of at least 90%. Thus, the isolated cell population of the present embodiment comprises the functional hepatic progenitor cells at a proportion of at least 90%, preferably 95% or more, particularly preferably 99% or more. Hereinafter, the substantially homogeneous isolated cell population comprising functional hepatic progenitor cells is referred to as a functional hepatic progenitor cell population in the present specification.

(41) Whether the hepatic progenitor cells included in the functional hepatic progenitor cell population of the present embodiment are functional hepatic progenitor cells can be determined on the basis of significant expression of CYP3A4. The expression level of CYP3A4 in the functional hepatic progenitor cell population of the present embodiment is increased by at least 5 times, preferably 20 or more times, particularly preferably 100 or more times the expression level thereof in a HepaRG? cell line. The expression levels of CYP3A4 and markers described below can be quantitatively analyzed by a known approach such as quantitative RT-PCR or Western blot.

(42) The functional hepatic progenitor cells in the functional hepatic progenitor cell population of the present embodiment preferably express, in addition to CYP3A4, at least one member selected from the group consisting of a hepatic progenitor cell/immature hepatic cell marker ?-fetoprotein, an immature hepatic cell/mature hepatic cell marker albumin, CYP1A2 and CYP2B6 at a higher level than that of the HepaRG? cell line. In addition, the functional hepatic progenitor cells in the functional hepatic progenitor cell population of the present embodiment preferably express ornithine transcarbamylase (OTC), an enzyme constituting the urea circuit which metabolizes ammonia, and/or carbamyl phosphate synthetase 1 (CPS1) at a higher level than that of the HepaRG? cell line. More preferably, the functional hepatic progenitor cells comprised in the functional hepatic progenitor cell population of the present embodiment can be further positive to any one or both of hepatic progenitor cell/immature hepatic cell markers CD44 and EpCAM (CD326).

(43) The functional hepatic progenitor cell population of the present embodiment can be prepared by the method according to the first embodiment. In order to further increase the proportion of the functional hepatic progenitor cells comprised in the functional hepatic progenitor cell population of the present embodiment, cells expressing a cell surface marker for hepatic progenitor cells/immature hepatic cells may be separated from a cell population obtained by the method according to the first embodiment. Preferred examples of the cell surface marker for hepatic progenitor cells/immature hepatic cells include CD44, EpCAM (CD326), carboxypeptidase M (CPM), CD133, and CD13. The separation of the marker-positive cells can be performed by a known approach such as fluorescence activated cell sorting (FACS) or magnetic cell separation (MACS).

(44) The functional hepatic progenitor cell population of the present embodiment may be optionally immortalized. In this context, the term immortalized for cells means that the cells maintain a state capable of proliferating even after repetition of a certain number of divisions, i.e., the cells have infinite proliferative capacity. A method for immortalizing cells has already been established, and a known approach can be adopted. The cells can be immortalized, for example, by transferring an immortalizing gene such as telomerase reverse transcriptase (TERT) gene to the cells through a retrovirus vector.

(45) The functional hepatic progenitor cells thus obtained were designated as HepaSM and HepaNS and deposited under deposition Nos. BP-02591 and BP-02592 with an international depository authority National Institute of Technology and Evaluation (NITE) Patent Microorganisms Depositary (formerly International Patent Organism Depositary of the National Institute of Advanced Industrial Science and Technology) (deposition date: Dec. 6, 2017, receipt No. AP-02591 and AP-02592).

(46) The functional hepatic progenitor cells and the functional hepatic cells according to the second embodiment, and the functional hepatic progenitor cell population according to the third embodiment are useful in the treatment of liver diseases or in drug metabolism toxicity tests.

(47) According to the fourth embodiment, the present invention provides a method for treating a subject having hepatic dysfunction, the method comprising the step of administering the functional hepatic progenitor cell population to the subject.

(48) In the present embodiment, the treating includes not only full cure of hepatic dysfunction in the subject but remission of symptoms of hepatic dysfunction, alleviation of conditions of hepatic dysfunction, or delay or arrest of progression of the pathological condition.

(49) The subject according to the present embodiment can be a freely chosen vertebrate and is preferably a mammal such as a mouse, a rat, a rabbit, sheep, a pig, cattle, a goat, a monkey, or a human, particularly preferably a human. The subject can be of a freely chosen age, including infant, child, young, adult and aged subjects.

(50) Examples of the hepatic dysfunction according to the present embodiment include, but are not limited to, hepatitis, liver cirrhosis, liver cancer, inborn error of metabolism, acute liver failure (fulminant hepatitis), and chronic liver failure.

(51) The method of the present embodiment can be performed by administering the functional hepatic progenitor cell population to the subject having hepatic dysfunction. In this context, the functional hepatic progenitor cell population to be administered can be allogeneic, isogeneic or self-derived to the subject. In the present embodiment, the functional hepatic progenitor cell population may be genetically modified. For example, a normal gene corresponding to an abnormal gene causative of the disease can be transferred to a functional hepatic progenitor cell population differentiated from iPS cells prepared from a patient with inborn error of metabolism, and the resulting functional hepatic progenitor cell population can be administered to the patient.

(52) In the present embodiment, the functional hepatic progenitor cell population can be administered by an appropriate method, for example, injection, implantation, or transplantation. Preferably, the functional hepatic progenitor cell population can be injected into the portal vein of the subject. In the case of the injection of the functional hepatic progenitor cell population into the portal vein, a cell suspension (1?10.sup.6 cells/ml) prepared using, for example, phosphate buffered saline, can be injected into the portal vein at a rate of approximately 2 ml/min. In this context, the dose of the functional hepatic progenitor cell population can differ depending on the age and body weight of the subject, the severity of hepatic dysfunction, etc. and can be, for example, 1?10.sup.5 to 1?10.sup.10 cells/kg (body weight), preferably 1?10.sup.6 to 1?10.sup.8 cells/kg (body weight). The dose may be administered in one portion or may be administered in a plurality of portions.

(53) According to the fifth embodiment, the present invention provides a pharmaceutical composition for treating hepatic dysfunction, comprising the functional hepatic progenitor cell population.

(54) The hepatic dysfunction and the treating according to the present embodiment are as defined in the fourth embodiment.

(55) The pharmaceutical composition of the present embodiment contains the functional hepatic progenitor cell population as an active ingredient. The pharmaceutical composition of the present embodiment may consist of the active ingredient or may further comprise optional components such as a known pharmaceutically acceptable carrier, a buffer, and other components (e.g., a hepatocyte growth factor). The pharmaceutical composition of the present embodiment can be prepared, for example, as an injection dosage form, using a carrier, such as phosphate buffered saline, which can maintain the survival of the cells serving as the active ingredient. The administration method and dose of the pharmaceutical composition of the present embodiment can be as described in the fourth embodiment.

(56) The method according to the fourth embodiment and the pharmaceutical composition according to the fifth embodiment are useful in the causal treatment of hepatic dysfunction.

(57) According to the sixth embodiment, the present invention provides a method for evaluating the toxicity of a test compound, comprising the steps of: (1) contacting functional hepatic cells differentiated from the functional hepatic progenitor cell population or the deposited functional hepatic progenitor cells with the test compound; and (2) analyzing a degree of injury to the functional hepatic cells.

(58) The toxicity evaluation method of the present embodiment employs functional hepatic cells differentiated from the functional hepatic progenitor cell population or the deposited functional hepatic progenitor cells. Culture conditions for inducing the hepatic progenitor cells to differentiate into hepatic cells are known as described in the first embodiment, and functional hepatic cells having the desired degree of differentiation or maturity can be obtained under appropriate culture conditions.

(59) In the toxicity evaluation method of the present embodiment, the test compound is contacted with the functional hepatic cells. Examples of the test compound include, but are not particularly limited to, synthetic compounds such as drugs, and natural compounds such as cell extracts. These test compounds may be novel or may be known.

(60) The contact between the functional hepatic cells and the test compound can be performed, for example, by adding the test compound to a culture medium for the functional hepatic cells or a buffer solution such as phosphate buffered saline or a Tris-HCl buffer solution and incubating therein the cells for a certain time. The concentration of the test compound to be added differs depending on the type of the compound and can be appropriately selected within the range of, for example, 20 nM to 500 ?M. The incubation time can be preferably 24 to 48 hours.

(61) Subsequently, the degree of injury to the functional hepatic cells is analyzed. The degree of injury to the functional hepatic cells can be analyzed, for example, by measuring the survival rate of the functional hepatic cells or the amount of a liver injury marker such as aspartate transaminase (AST) emigrating from the cells. When the survival rate of the cells is significantly decreased as compared with before the contact with the test compound or when the amount of the liver injury marker emigrating from the cells is significantly increased as compared with before this contact, the test compound can be evaluated as having hepatotoxicity and not being promising as a drug. On the other hand, when the survival rate of the cells is equivalent to or higher than that before the contact with the test compound or when the amount of the liver injury marker emigrating from the cells is equivalent to or less than that before this contact, the test compound can be evaluated as having no hepatotoxicity and being promising as a drug.

(62) The method of the present embodiment is useful in screening for a candidate compound of a drug.

Examples

(63) Hereinafter, the present invention will be further described with reference to Examples. However, these Examples do not limit the present invention by any means.

(64) <1. Preparation of iPS Cells Derived from Fulminant Hepatitis Patients>

(65) iPS cells were prepared from fibroblasts of a fulminant hepatitis patient by the following procedures; the skin obtained by biopsy from the fulminant hepatitis patient (male, 7 months old) was cultured to obtain fibroblasts. To the obtained fibroblasts, human genes of Oct3/4, Sox2, Klf4 and c-Myc were transferred using a Sendai virus vector. Then, the cells were cultured for 2 weeks to confirm the appearance of a dome-like colony. The colony thus appearing was isolated, transferred onto MEF feeder cells, and subcultured in hiPSC medium (having the composition described below).

(66) Table 1. Composition of hiPSC Medium

(67) TABLE-US-00001 TABLE 1 KnockOut Thermo Fisher 10829-018 380 ml DMEM Scientific Knockout SR Thermo Fisher 10828-028 100 ml Scientific GlutaMAX Gibco 35050-061 5 ml Pen Strep Gibco 15140-122 5 ml MEM NEAA Gibco 11140-050 5 ml Sodium Pyruvate Gibco 11360-070 5 ml 2-Mercaptoethanol Gibco 21985-023 500 ?l bFGF Invitrogen PHG0023 500 ?l

(68) The results are shown in FIG. 1. The formation of a flat colony with a clear contour by subculture was confirmed, as in human ES cells or already established iPS cells, showing that iPS cells derived from the fulminant hepatitis patient were obtained. Hereinafter, the iPS cells are referred to as iPSC-K cells.

(69) iPS cells were also prepared from fibroblasts of another fulminant hepatitis patient by the same procedures as described above. Hereinafter, the iPS cells are referred to as iPSC-O cells.

(70) <2. Preparation of Functional Hepatic Progenitor Cells>

(71) (2-1. Formation of Embryoid Bodies (EBs))

(72) The iPSC-K cells were cultured until becoming approximately 80% confluent. The medium was removed, and the cells were washed with PBS. Then, StemPro Accutase (Thermo Fisher Scientific Inc.) was added thereto, and the cells were incubated under conditions of 37? C., and 5% CO.sub.2 for 10 to 20 minutes. The colony was dissociated by gentle tapping of the dish and then suspended by the addition of hiPSC medium. The obtained cell suspension was transferred to a dish coated with gelatin, and incubated under conditions of 15 minutes, 37? C., and 5% CO.sub.2 to remove the feeder cells. The supernatant was centrifuged, and the recovered iPSC-K cells were suspended in EB medium (having the composition described below). The iPSC-K cells were placed at a concentration of 1?10.sup.6 cells/well in a 96-well plate for suspension culture (Thermo Fisher Scientific Inc., 174929) and cultured for 10 days under conditions of 37? C. and 5% CO.sub.2 to form embryoid bodies (hereinafter, referred to as EBs).

(73) Table 2. Composition of EB Medium

(74) TABLE-US-00002 TABLE 2 KnockOut Thermo Fisher 10829-018 380 ml DMEM Scientific Knockout SR Thermo Fisher 10828-028 100 ml Scientific GlutaMAX Gibco 35050-061 5 ml Pen Strep Gibco 15140-122 5 ml MEM NEAA Gibco 11140-050 5 ml Sodium Pyruvate Gibco 11360-070 5 ml 2-Mercaptoethanol Gibco 21985-023 250 ?l
(2-2. Induction of EBs to Differentiate into Functional Hepatic Progenitor Cells)

(75) The EBs were recovered and suspended in XF32 medium (Uchida, H. et al., JCI Insight, 2017; 2 (1): e86492, doi:10.1172/jci.insight.86492). The EBs were placed at a concentration of 20 EBs/well in a 24-well plate coated with collagen, and differentiated into hepatic progenitor cells by adhesion culture at 37? C. for 35 days in 5% CO.sub.2. Then, the cells were further cultured for 2 days using modified SCM-6F8 medium (Wang, X. et al., Nature, 2015; 522 (7555): 173-8, doi:10.1038/nature14484, Epub 2015 Jun. 3) supplemented with 3 ?g/ml puromycin (Wako Pure Chemical Industries, Ltd., #160-23151).

(76) Table 3. Composition of XF32 Medium

(77) TABLE-US-00003 TABLE 3 KnockOut Thermo 10829-018 405 ml DMEM Fisher Scientific CTS KnockOut Themo 10828-013 75 ml SR XenoFree Fisher Scientific GlutaMAX Gibco 35050-061 5 ml Pen Strep Gibco 15140-122 5 ml MEM NEAA Gibco 11140-050 5 ml Sodium Gibco 11360-070 5 ml Pyruvate bFGF Invitrogen PHG0023 1 ml (10 ng/ml) IGF Sigma I1271 100 ?l (10 ?g/100 ?l) Heleglin ? Wako 080-09001 50 ?l (5 ?g/50 ?l) L-ascorvic acid Sigma A4544 500 ?l (50 ?g/ml)

(78) The results are shown in FIGS. 2a-2b. Cells obtained by the adhesion culture of EBs (FIG. 2(a)) were cultured in the presence of puromycin to obtain a colony of the cells (FIG. 2(b)). Functional hepatic progenitor cells obtained by the growth culture of this colony selected with puromycin were designated as HepaNS and deposited under deposition No. BP-02592 with an international depository authority National Institute of Technology and Evaluation (NITE) Patent Microorganisms Depositary (deposition date: Dec. 6, 2017, receipt No. AP-02592).

(79) (2-3. Immortalization of Functional Hepatic Progenitor Cells)

(80) Subsequently, the functional hepatic progenitor cells thus obtained were immortalized by the transfer of human telomerase reverse transcriptase (TERT) gene, mutant human CDK4 (CDK4R24C) gene, and human cyclin D1 gene. The transfer of these genes was performed according to the procedures described in PLoS One, 2012; 7 (1): e29677, doi:10.1371/journal.pone.0029677, Epub 2012 Jan. 19 using lentivirus vectors CSII-CMV-hTERT, CSII-TRE-Tight-hCDK4R24C, and CSII-TRE-Tight-cyclin D1. The obtained immortalized functional hepatic progenitor cells were designated as HepaSM and deposited under deposition No. BP-02591 with an international depository authority National Institute of Technology and Evaluation (NITE) Patent Microorganisms Depositary (deposition date: Dec. 6, 2017, receipt No. AP-02591).

(81) The HepaSM cells were cultured for 7 days under conditions of 37? C. and 5% CO.sub.2 using modified SCM-6F8 medium and thereby induced to differentiate into hepatic cells. The obtained hepatic cells were analyzed as described below.

(82) <3. Analysis of Hepatic Cells Differentiated from Functional Hepatic Progenitor Cells>

(83) The cells differentiated from the HepaSM cells were subjected to hematoxylin-eosin staining and immunostaining with hepatic cell markers. The immunostaining with hepatic cell markers was performed by the following procedures: the medium was removed, and a 4% paraformaldehyde solution was added to the cells, which were then fixed at 4? C. for 10 minutes. After removal of the solution, a 0.1% Triton-X (Nacalai Tesque, Inc.) solution was added to the cells, which were then permeabilized at room temperature for 10 minutes. After removal of the solution, Protein Block Serum-Free Ready-to-use (Dako, X0909) was added thereto, followed by blocking treatment at room temperature for 30 minutes. An anti-CYP3A4 antibody (C-17) (Santa Cruz Biotechnology, Inc., sc-27639) (diluted 1/1000), an anti-albumin antibody (Cedarlane, CLFAG2140) (diluted 1/50), or an anti-?-fetoprotein (AFP) antibody (R&D Systems, Inc., MAB1368) (diluted 1/100) was used as a primary antibody and reacted with the cells overnight at 4? C. Rabbit anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Thermo Fisher Scientific Inc., A11078), GFP Tag Polyclonal Antibody, Alexa Fluor 488 (Thermo Fisher Scientific Inc., A21311), or Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 (Thermo Fisher Scientific Inc., A21123) (all diluted 1/1000) was used as a secondary antibody and reacted with the cells at room temperature for 30 minutes.

(84) The results are shown in FIGS. 3 to 5. As a result of hematoxylin-eosin staining, the cells differentiated from the HepaSM cells were confirmed to exhibit the morphology of hepatic cells (FIG. 3). As a result of immunostaining, the cells differentiated from the HepaSM cells were confirmed to express hepatic cell markers CYP3A4, albumin (ALB) and ?-fetoprotein (AFP) (FIGS. 4 and 5). These results showed that the HepaSM cells are hepatic progenitor cells.

(85) Subsequently, the expression levels of CYP3A4, albumin and ?-fetoprotein in the hepatic cells differentiated from the HepaSM cells were analyzed by quantitative RT-PCR (qRT-PCR). Total RNA was extracted from the hepatic cells differentiated from the HepaSM cells using RNeasy Micro Kit (Qiagen N.V., 74004) according to the protocol included in the kit. 1 ?g of the total RNA was reverse-transcribed using SuperScript III First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific Inc.) according to the protocol included in the kit to prepare cDNA. The obtained cDNA was preserved at ?20? C.

(86) qRT-PCR was performed with the obtained cDNA as a template using the primer set described below. The qRT-PCR reaction was performed using Platinum SYBR Green qPCR SuperMix-UDG (Thermo Fisher Scientific Inc.) according to the protocol included in the kit. The PCR reaction conditions were as follows: 50? C. for 2 minutes?1 cycle, 95? C. for 2 minutes?1 cycle, (95? C. for 15 seconds and 60? C. for 30 seconds)?40 cycles, 95? C. for 15 seconds?1 cycle, 60? C. for 15 seconds?1 cycle, 95? C. for 15 seconds?1 cycle, and 50? C. for 2 minutes?1 cycle. Measurement was performed using Quant Studio 12K Flex (Applied Biosystems). The Ct value of each gene was calculated by automatic analysis using analytical software installed in the apparatus, and corrected with the expression level of internal standard ubiquitin gene. Undifferentiated iPSC-K cells subcultured over an equivalent period without induction of differentiation and selection in the presence of puromycin were used as a control.

(87) Table 4. Primer Set (1) Used in qRT-PCR

(88) TABLE-US-00004 TABLE4 ForwardandReverse Gene primers(5.fwdarw.3) SEQNO. AFP AGCTTGGTGGTGGATGAAAC 1 CCCTCTTCAGCAAAGCAGAC 2 ALB TGGCACAATGAAGTGGGTAA 3 CTGAGCAAAGGCAATCAACA 4 CYP1A2 CAATCAGGIGGTGGTGTCAG 5 GCTCCTGGACTGTTTTCTGC 6 CYP2B6 TCCTTTCTGAGGTTCCGAGA 7 TCCCGAAGTCCCTCATAGTG 8 CYP3A4 CAAGACCCCTTTGTGGAAAA 9 CGAGGCGACTTTCTTTCATC 10 UBIQUITIN GGAGCCGAGTGACACCATTG 11 CAGGGTACGACCATCTTCCAG 12

(89) The results are shown in FIGS. 6a-6c. Elevation in all the expression levels of ?-fetoprotein (AFP), albumin (ALB) and CYP3A4 was confirmed in the hepatic cells differentiated from the HepaSM cells (puromycin (+)). These results showed that the HepaSM cells can differentiate into hepatic cells expressing CYP3A4 at a high level, i.e., are functional hepatic progenitor cells.

(90) Subsequently, the expression levels of hepatic cell markers in the hepatic cells differentiated from the HepaSM cells were compared with the expression levels of: the hepatic cell markers in HepaRG? cells (obtained from Life Technologies Corp.); hepatic cells obtained by inducing differentiation by the same procedures as in the section 2-2 except that puromycin was not added; and immortalized mature hepatic cells. The expression levels of ?-fetoprotein (AFP), albumin (ALB), CYP1A2, CYP2B6 and CYP3A4 in each line of the hepatic cells were quantified by qRT-PCR by the same procedures as described above. The immortalized mature hepatic cells were prepared by isolating and primary culturing hepatic cells according to the procedures described in Alexandrova, K., et al.; Large-Scale Isolation of Human Hepatocytes for Therapeutic Application, Cell Transplantation, 2005; 14 (10): 845-853, and immortalizing the cells by the same procedures as described above.

(91) The results are shown in FIGS. 7a-7e. The hepatic cells differentiated from the HepaSM cells (in the drawing, represented by puromycin (+)) were confirmed to express ?-fetoprotein (AFP), CYP1A2, CYP2B6 and CYP3A4. The hepatic cells differentiated from the HepaSM cells were confirmed to particularly express CYP3A4 at a much higher level than that of the HepaRG? cells (in the drawing, represented by RG), the immortalized mature hepatic cells (in the drawing, represented by MN) or the hepatic cells obtained by inducing differentiation without selection based on puromycin (in the drawing, represented by YK). These results showed that the HepaSM cells are stable functional hepatic progenitor cells.

(92) As a result of quantifying the expression levels of hepatic cell markers in the same way as above in hepatic cells differentiated from the HepaNS cells, these hepatic cells were confirmed to express CYP3A4 at a marked high level, as in the hepatic cells differentiated from the HepaSM cells (data not shown). These results showed that the HepaNS cells are also stable functional hepatic progenitor cells.

(93) <4. Induction of Drug Metabolizing Enzyme in Functional Hepatic Progenitor Cells>

(94) The hepatic cells differentiated from the HepaSM cells were subjected to a drug metabolizing enzyme induction test based on the expression of cytochromes P450 (Khuu, D. N. et al.; In Vitro Differentiated Adult Human Liver Progenitor Cells Display Mature Hepatic Metabolic Functions: A Potential Tool for In Vitro Pharmacotoxicological Testing, Cell Transplantation, 2011; 20 (2): 287-302). Rifampicin (solvent: DMSO) was added at 20 ?M in terms of a final concentration to modified SCM-6F8 medium, and the cells were cultured therein for 2 days. Then, the expression levels of CYP1A2, CYP2B6 and CYP3A4 were quantified by qRT-PCR by the same procedures as in the section 3. Cells prepared in the same way as above using a medium supplemented with the same amount of DMSO instead of rifampicin (in the drawing, represented by RFP(?)) were used as a control.

(95) The results are shown in FIGS. 8a-8e. The rifampicin treatment markedly increased the expression levels of all the cytochromes P450 (CYP1A2, CYP2B6 and CYP3A4) in the hepatic cells differentiated from the HepaSM cells (in the drawing, represented by RFP (+)). Particularly, the induction of much higher expression of CYP3A4 was confirmed in the hepatic cells differentiated from the HepaSM cells than in the HepaRG? cells (in the drawing, represented by RG), the immortalized mature hepatic cells (in the drawing, represented by MN) or the hepatic cells obtained by inducing differentiation without selection based on puromycin (in the drawing, represented by YK). These results showed that the hepatic cells differentiated from the HepaSM cells can be used in a drug toxicity test through in vitro enzyme induction conforming to Drug Interaction Studies-Study Design, Data Analysis, Implications for Dosing, and Labeling Recommendations, 2012 provided by FDA.

(96) As a result of conducting the drug metabolizing enzyme induction test in the same way as above on the hepatic cells differentiated from the HepaNS cells, the induction of markedly high expression of CYP3A4 was confirmed, as in the hepatic cells differentiated from the HepaSM cells (data not shown). These results showed that the hepatic cells differentiated from the HepaNS cells can also be used in the drug toxicity test through in vitro enzyme induction conforming to Drug Interaction Studies-Study Design, Data Analysis, Implications for Dosing, and Labeling Recommendations, 2012 provided by FDA.

(97) <5. Evaluation of Proliferative Capability of Hepatic Cells Differentiated from Functional Hepatic Progenitor Cells>

(98) The hepatic cells differentiated from the HepaSM cells were evaluated for their ability to proliferate on the basis of the expression of proliferating cell markers Ki67 and PCNA. The cells were fixed by paraffin embedding, then deparaffinized, and washed with PBS. Then, 2.5% goat serum/PBS was added thereto, followed by blocking treatment at room temperature for 30 minutes. An anti-Ki67 antibody (DAKO, PC10) or an anti-PCNA antibody (DAKO, MIB-1) (both diluted 1/200) was used as a primary antibody and reacted with the cells at room temperature for 1 hour. Secondary antibody reaction and DAB color development were performed using ImmPRESS Anti-Mouse IgG Kit (Vector Laboratories, Inc.). The cells were washed with water and then subjected to hematoxylin-eosin staining. The obtained specimen was observed under a microscope.

(99) The results are shown in FIGS. 9a-9b. The hepatic cells differentiated from the HepaSM cells were found to express proliferating cell markers PCNA (FIG. 9(a)) and Ki67 (FIG. 9(b)). The hepatic cells differentiated from the HepaNS cells were also confirmed to express the proliferating cell markers Ki67 and PCNA (data not shown). Both the HepaSM cells and the HepaNS cells were confirmed to have high ability to proliferate and to be culturable beyond 6 months.

(100) <6. Preparation of Functional Hepatic Progenitor Cells with Various Antibiotics(1)>

(101) Functional hepatic progenitor cells were prepared from iPSC-K cells by the same procedures as in the sections (2-1) and (2-2) except that various antibiotics were used instead of puromycin. The antibiotics used and their concentrations, and the number of culture days will be shown below.

(102) Table 5. Antibiotic and Culture Conditions (Preparation of Functional Hepatic Progenitor Cells from iPSC-K Cells)

(103) TABLE-US-00005 TABLE 5 Culture Antibiotic Product information Concentration period Phleomycin InvivoGen, ant-ph-1 80 ?g/ml 3 days Hygromycin InvivoGen, ant-hg-1 20 ?g/ml 6 days Blasticidin S InvivoGen, ant-bl-1 1 ?g/ml 3 days Zeocin.sup.(?.sup.) InvivoGen, ant-zn-l 600 ?g/ml 6 days G418 InvivoGen, ant-gn-1 300 ?g/ml 3 days

(104) The results are shown in FIGS. 10a-10e. A colony of the cells was obtained when any of the antibiotics (a) phleomycin, (b) hygromycin, (c) blasticidin S, (d) Zeocin?, and (e) G418 were used.

(105) <7. Preparation of Functional Hepatic Progenitor Cells with Various Antibiotics(2)>

(106) Functional hepatic progenitor cells were prepared from human ES cells, SEES5 cells (Akutsu, H. et al., Regen. Ther., 2015; 1: 18-29, doi:10.1016/j.reth.2014.12.004), by the following procedures: EBs were formed by the same procedures as in the section (2-1) except that Essential 8 medium (Gibco) was used instead of hiPSC medium. The EBs were recovered and suspended in XF32 medium. The EBs were placed at a concentration of 20 EBs/well in a 24-well plate coated with collagen, and adhesion-cultured at 37? C. for 10 days in 5% CO.sub.2. Then, the medium was replaced with HD medium (having the composition of the XF32 medium except for bFGF), and the cells were cultured for 10 days. The medium was further replaced with modified SCM-6F8 medium, and the cells were cultured for 7 days. Then, the medium was replaced with modified SCM-6F8 medium supplemented with each antibiotic. The antibiotics used and their concentrations, and the number of culture days will be shown below.

(107) Table 6. Antibiotic and Culture Conditions (Preparation of Functional Hepatic Progenitor Cells from SEES5 Cells)

(108) TABLE-US-00006 TABLE 6 Culture Antibiotic Product information Concentration period Phleomycin InvivoGen, ant-ph-1 40 ?g/ml 3 days Hygromycin InvivoGen, ant-hg-1 100 ?g/ml 3 days Blasticidin S InvivoGen, ant-bl-l 10 ?g/ml 3 days Zeocin.sup.(?.sup.) InvivoGen, ant-zn-1 1000 ?g/ml 3 days G418 InvivoGen, ant-gn-1 200 ?g/ml 3 days Puromycin Wako, 160-23151 5 ?g/ml 3 days

(109) The results are shown in FIGS. 11a-11f. A colony of the cells was obtained when any of the antibiotics (a) phleomycin, (b) hygromycin, (c) blasticidin S, (d) Zeocin?, (e) G418, and (f) puromycin were used. All of these cells were confirmed to express CYP3A4 at a markedly high level and to be functional hepatic progenitor cells (data not shown).

(110) <8. Preparation of Functional Hepatic Progenitor Cells with Ammonia>

(111) Functional hepatic progenitor cells prepared from iPSC-O cells and selected in the presence of puromycin by the same procedures as in the sections (2-1) and (2-2) except that iPSC-O cells were used instead of iPSC-K cells, and functional hepatic progenitor cells prepared from SEES5 cells and selected in the presence of puromycin in the section 7 were further subjected to selective culture with ammonia by the following procedures. The medium was removed from cultures (10 cm dish) of the functional hepatic progenitor cells prepared from iPSC-O cells or the functional hepatic progenitor cells prepared from SEES5 cells, and the cultures were washed with 5 ml of D-PBS (Gibco). Then, 10 ml of modified SCM-6F8 medium supplemented with 5 mg/ml ammonia or modified SCM-6F8 medium supplemented with 8 mg/ml ammonia was added to the cultures of each cell line, which were then cultured for 2 days under conditions of 37? C. and 5% Co.sub.2. Then, the medium was removed, and the cells were washed with 5 ml of D-PBS (Gibco) and supplemented with 10 ml of fresh modified SCM-6F8 medium.

(112) The cultures of the functional hepatic progenitor cells prepared from iPSC-O cells after the selective culture with ammonia are shown in FIG. 12(a), and the cultures of the functional hepatic progenitor cells prepared from SEES5 cells after the selective culture with ammonia are shown in FIG. 12(b). A colony was formed in both the cultures.

(113) Subsequently, the colony of the iPSC-O cell-derived functional hepatic progenitor cells selected in the presence of ammonia was differentiated into hepatic cells by growth culture and culture in modified SCM-6F8 medium for 7 days under conditions of 37? C. and 5% CO.sub.2. In the obtained hepatic cells, the expression levels of ?-fetoprotein, CYP3A4, carbamyl phosphate synthetase 1 (CPS1), and ornithine transcarbamylase (OTC) were quantified by qRT-PCR by the same procedures as in the section 3. Hepatic cells differentiated from iPSC-O cell-derived functional hepatic progenitor cells subcultured over an equivalent period without selection in the presence of ammonia were used as a control.

(114) Table 7. Primer Set (2) Used in qRT-PCR

(115) TABLE-US-00007 TABLE7 ForwardandReverse Gene primers(5.fwdarw.3) SEQNO. CPS1 CAAGTTTTGCAGTGGAATCG 13 GGACAGATGCCTGAGCCTAA 14 OCT TTTCCAAGGTTACCAGGTTACAA 15 CTGGGCAAGCAGTGTAAAAAT 16

(116) The results are shown in FIGS. 13a-13d. Elevation in both the expression levels of ammonia metabolizing enzymes CPS1 and OTC was confirmed in the hepatic cells differentiated from the functional hepatic progenitor cells selected in the presence of ammonia (NH.sub.3(+)) (FIGS. 13(c) and 13(d)). The selection based on ammonia was also confirmed to further elevate the expression level of CYP3A4 (FIG. 13(b)). These results showed that functional hepatic cells having excellent ability to metabolize drugs and ability to metabolize ammonia can be prepared by selection based on an antibiotic as well as selection based on ammonia.

(117) <9. Preparation of Functional Small Intestinal Epithelial Progenitor Cells>

(118) Gut organoid was prepared from Edom-iPS cells (PLoS Genet., 2011; 7 (5):e1002085, doi.org/10.1371/journal.pgen.1002085), menstrual blood-derived iPS cells, according to the procedures described in Uchida, H. et al., JCI Insight, 2017; 2 (1): e86492. After a lapse of 3 months, the gut organoid was cultured for 2 days in the presence of 2 mg/ml or 400 mg/ml puromycin.

(119) The gut organoid before the puromycin treatment is shown in FIGS. 14a-14b, and the gut organoid after the treatment is shown in FIGS. 15a-15b. Functional small intestinal epithelial progenitor cells having the ability to metabolize drugs were obtained by culture in the presence of 2 mg/ml puromycin (FIG. 15(a)) or 400 mg/ml puromycin (FIG. 15(b)).