PLATELETS TRANSFECTED BY EXOGENOUS GENETIC MATERIAL AND PLATELET MICROPARTICLES OBTAINED BY SAID TRANSFECTED PLATELETS, METHOD FOR THE PREPARATION AND USES THEREOF

Abstract

The present invention concerns platelets transfected with exogenous genetic material and microparticles deriving from said transfected platelets having a high percentage of transfection and able to transport and to transfect acceptor cells with genetic material and then used for example in gene and cell therapy. The invention further concerns a method for the preparation of mature platelets transfected with exogenous genetic material and microparticles deriving from said transfected platelets and microparticles deriving from said transfected mature platelets which permits to obtain high percentages of transfection.

Claims

1.-10. (canceled)

11. A method comprising: transfecting with exogenous genetic material in a transfection medium a population of mature platelets isolated from peripheral blood and/or platelet microparticles obtained from said mature platelets, wherein the percentage of said mature transfected platelets and/or platelet microparticles ranges from 20% to 100% of the population of platelets isolated from peripheral blood, wherein said transfection medium comprises ethyl alcohol and at least one polyamine; wherein said transfected mature platelets and/or platelet microparticles are capable of transporting and delivering said exogenous material to acceptor cells and act as vector in the transportation and delivery of genetic material to acceptor cells.

12. The method according to claim 11, wherein said genetic material is selected from the group consisting of siRNA, shRNA, ceRNA, DNA, and plasmids.

13. The method according to claim 11, wherein the at least one polyamine comprises polyethylenimmine.

14. A method of performing gene therapy or cell therapy, said method comprising: providing a population of mature platelets isolated from peripheral blood and/or platelet microparticles obtained from said mature platelets, transfecting with exogenous genetic material in a transfection medium said population of mature platelets and/or platelet microparticles obtained from said mature platelets, wherein the percentage of said mature transfected platelets and/or platelet microparticles ranges from 20% to 100% of the population of platelets isolated from peripheral blood, wherein said transfection medium comprises ethyl alcohol and at least one polyamine; wherein said transfected mature platelets and/or platelet microparticles transport and deliver said exogenous material to acceptor cells, said transfected mature platelets and/or platelets microparticles acting as vector in the transportation and transfection of said genetic material to said acceptor cells.

15. The method according to claim 14, wherein a target gene of the gene therapy is a gene of the same platelets or of the acceptor cells.

16. The method according to claim 14, wherein when said genetic material is selected from the group consisting of siRNA, shRNA, or in said siRNA and shRNA encoded by plasmids, the gene therapy consisting of post-transcriptional silencing of a target gene.

17. The method according to claim 14, wherein said genetic material is selected from the group consisting of DNA and plasmid, the gene therapy consisting in generating or modifying a target gene in platelets and in acceptor cells.

18. The method according to claim 14, wherein the at least one polyamine comprises polyethylenimmine.

19. The method according to claim 11, wherein the concentration of ethyl alcohol ranges from 0.5 to 3.5%.

20. The method according to claim 14, wherein the concentration of ethyl alcohol ranges from 0.5 to 3.5%.

Description

[0055] The present invention will be now described, for illustrative but not !imitative purposes, according to its preferred embodiments, with particular reference to the figures of the enclosed drawings, wherein:

[0056] FIG. 1 shows: A. Flow-cytometry analysis of the platelet population after transfection obtained by the process described in example 1. The use of scatters on a logarithmic scale allows the view of the platelet population based on morphology. B. Flow-cytometry analysis of the percentage of platelets positive to siRNA marked with fluorescence. C. Flow-cytometry comparison between non-transfected platelets (left curve) with transfected platelets (right curve). The shift towards higher abscissa values corresponding to a greater fluorescence, allows to define the percentage of platelets positive to marked siRNA. FS—forward scatter; SS—side scatter; FI2—emission band of the fluorofore of the siRNA.

[0057] FIG. 2 shows the percentages of platelets positive to fluorescent siRNA in relation to the incubation times with the transfection medium.

[0058] FIG. 3 shows the expression percentage of mRNA of HPRT1 gene in platelets washed and co-incubated with siRNA against mRNA of HPRT1 measured by semi-quantitative PCR.

[0059] FIG. 4 shows the comparison semi-quantitative PCR after transfection carried out with siRNA directed against HPRT1 between the target gene and one gene of the control (B2M). In figure A, PCR analysis was carried out amplifying HPRT1 gene, in figure B with B2M (j3-2 Microglobulin) gene. L-Ladder; P-washed platelets; P1 washed platelets co-incubated with siRNA; P2 platelets transfected with siRNA.

[0060] FIG. 5 shows the results of the flow-cytometry analysis of microparticles produced after 24 h of incubation of platelets washed with the transfection medium added with fluorescent marked siRNA.

[0061] Figure A shows the morphological region where microparticles are comprised previously set with spheres of appropriate sizes (Megamix Beads). I: 0.5 μm; J: 0.9 μm; G: I+J. In figure B the presence of CD61 in the microparticles (on the abscissa-F11 Log) in order to show the platelet origin of microparticles and the presence of flurescent marked siRNA (on the ordinate-FI2) is underlined.

[0062] FIG. 6 shows the results of the flow-cytometry analysis of endothelial cells (HUVEC) co-incubated with microparticles of platelet origin for 6 hours; the platelet microparticles were prepared starting from a platelet suspension in a transfection medium added with fluorescent marked siRNA, which, after 24 hours, was ultra-centrifuged for 1 hour in order to allow the isolation and the resuspension of microparticles in RPMI 1640. 38% of the endothelial cells results as positive for the siRNA previously transfected into platelets.

[0063] FIG. 7 shows the results of the flow-cytometry analysis of murine leukocytes obtained from NOS/SCID mice 24 h after the inoculum of human platelets transfected with fluorescent siRNA. Image A: control leukocytes, the mouse was inoculated with non-transfected human platelets; in the graph on the left the sample was not incubated with antiCD45 antibody; on the right the sample was incubated with antiCD45 antibody; 2.08% of positivity. ImageB: transfected leukocytes, the mouse was inoculated with human platelets transfected with fluorescent siRNA; in the graph on the left the sample was not incubated with antiCD45 antibody; on the right the sample was incubated with antiCD45 antibody; 7.83% of positivity. Image C: leukocytes obtained from mouse after injection in vivo of platelets-activating agents. The mouse was inoculated with human platelets transfected with fluorescent siRNA and stimulated, one hour after the inoculum, through the injection of 0.1 ml of a solution containing 150 μg/ml of Collagen and 0.9 μg/ml di epinephrine; in the graph on the left the sample was not incubated with antiCD45 antibody; on the right the sample was incubated with antiCD45 antibody; 13.81% of positivity.

[0064] FIG. 8 shows: Image A: control carried out with non-transfected platelets; Image B: platelets transfected with Pmax plasmid (Lonza), 10.6% resulted positive and therefore expresses an active GFP.

[0065] FIG. 9 shows the comparison in flow-cytometry between non-transfected platelets (left curve) with transfected platelets (right curve) according to example 4. The shift towards higher abscissa values corresponding to a greater fluorescence, allows to define the percentage of platelets positive to marked siRNA. FS—forward scatter; SS—side scatter; F12—emission band of the fluorofore of the siRNA.

[0066] FIG. 10 shows the comparison in flow-cytometry between non-transfected platelets (left curve) with transfected platelets (right curve) according to example 5. The shift towards higher abscissa values corresponding to a greater fluorescence, allows to define the percentage of platelets positive to marked siRNA. FS—forward scatter; SS—side scatter; F12—emission band of the fluorofore of the siRNA.

[0067] EXAMPLE 1

Method of Transfection of Platelets or Microparticles and Evaluation of the Percentage of Transfection

[0068] Materials and Methods

[0069] Method of Transfection of Platelets or Microparticles

[0070] Venous peripheral blood was harvested and collected in tubes containing 3.8% of sodium citrate as anticoagulant (1:9 citrate-blood v/v).

[0071] 1 The sample was centrifuged at 120 g for 10 minutes in order to obtain PRP (platelet-rich plasma).

[0072] 2 Proceeding in the isolation of plasma platelets by common methods (platelet washing or gel-filtration).

[0073] 3 Platelets thus isolated, were resuspended in RPMI 1640 added with antibiotics (100 U of Penicillin and 100 U of Streptomycin) or in the same plasma of the donor, at a concentration comprised between 2×10.sup.5 and 1×10.sup.6 per microliter, the lower limit of said concentration being 130,000 platelets/microliter, and rates of one milliliter were transferred to 24-well plate and incubated at 37° C. in controlled atmosphere of 5% C02.

[0074] 4 Then, the transfection medium is prepared, inserting 32 microliters of Ribojuice (Merck-Millipore) and 168 microliters of RPMI 1640 into a tube so a to achieve, in both cases, the total amount of 200 microliters.

[0075] 5 After waiting for 5 minutes, the siRNA of interest was added to the above-mentioned mixture to the maximum concentration of 200 nM and after 15 minutes of incubation at room temperature the solution was transferred into the well in which 1 ml of platelet suspension had previously been placed.

[0076] 6 After 5 minutes of incubation at 37° C., the transfection was interrupted: by platelet centrifugation (to 3,000 g for 10 minutes in the presence of PGI2 0.2 microM and, then, resuspending them in 3 ml of the culture medium RPMI 1640) or by diluting the transfection medium with the culture medium RPMI 1640 until achieving a total amount of 7 milliliters.

[0077] 7 Within 2 hours after the interruption of the transfection reaction, it is possible to point out (by PCR or rt-PCR) the degradation of the mRNA of interest, a specific target of the siRNA previously inserted into platelets.

[0078] Instead, in order to obtain platelet microparticles containing the siRNA previously transfected into platelets, it is necessary to carry out the previously described operations up to point 5 and then continuing as follows: [0079] 1. Incubating platelet suspension at 37° C. in controlled atmosphere of 5% C02 together with the transfection medium for 24/48 h. Or alternatively stimulating them with 2.5 mM of CaCl.sub.2, 20 μg/ml of Collagen and 1 U/ml of Thrombin for 30 minutes at 37° C. and stopping the stimulus with 2.5 mM of EDTA. [0080] 2. Centrifuging platelets at 3,000 g for 10 minutes. [0081] 3. Recovering supernatant and further centrifuging it at 12,000 g for 10 minutes in order to remove possible remained platelets. [0082] 4. Centrifuging supernatant at 160,000 g for 1 hour at 4° C. [0083] 5. Removing supernatant and resuspending microparticle pellet in 1 milliliter of RPMI 1640 (verifying microparticles concentration using a flow-cytometer).

[0084] The composition of RPMI 1640 medium is (grams/liter): the list of components expressed as grams/liter

[0085] L-Arginine 0.2

[0086] L-Asparagine 0.05

[0087] L-Aspartic Acid 0.02

[0088] L-Cystine.2HCl 0.0652

[0089] L-Glutamic Acid 0.02

[0090] L-Glutamine 0.3

[0091] Glycine 0.01

[0092] L-H istidine 0.015

[0093] Hydroxy-L-Proline 0.02

[0094] L-Isoleucine 0.05

[0095] L-Leucine 0.05

[0096] L-Lysine.HCl 0.04

[0097] L-Methionine 0.015

[0098] L-Phenylalanine 0.015

[0099] L-Proline 0.02

[0100] L-Serine 0.03

[0101] L-Threonine 0.02

[0102] L-Tryptophan 0.005

[0103] L-Tyrosine.2Na.2H20 0.02883

[0104] L-Valine 0.02

[0105] Biotin 0.0002

[0106] Choline Chloride 0.003

[0107] Folic Acid 0.001

[0108] myo-Inositol 0.035

[0109] Niacinamide 0.001

[0110] D-Pantothenic Acid Hemicalcium 0.00025

[0111] PABA 0.001

[0112] Pyridoxine.HCl 0.001

[0113] Riboflavin 0.0002

[0114] Thiamine.HCl 0.001

[0115] Vitamin 812 0.000005

[0116] Calcium Nitrate.4 H20 0.1

[0117] Magnesium Sulfate 0.04884

[0118] Potassium Chloride 0.4

[0119] Sodium Chloride 6.0

[0120] Sodium Phosphate Dibasic 0.8

[0121] D-Glucose 2.0

[0122] Glutathione, Reduced 0.001

[0123] Phenol Red.Na 0.0053

[0124] Detection of Platelets and Microparticles by Flow-Cytometry (FIGS. 1 and 5).

[0125] For the detection of microparticles by flow-cytometry, the dimensional gate corresponding to microparticles was set calibrating the instrument by means of Megamix (American Diagnostic), a mixture of microspheres of 3 different sizes (0.5; 0.9 and 3 micron).

[0126] The microparticles prepared as indicated in the materials and methods, were marked incubating them for 30 minutes with the fluorescent anti-CD61 antibody (Beckman Coulter), antigen with exclusively platelet localization.

[0127] Platelets were analyzed setting the morphological gate with a control without transfection prepared as describe in the materials and methods, and using a fluorescent anti-CD61 antibody (Beckman Coulter)-fitc and detecting the fluorescence emitted from the siRNA TYE 563 DS Transfection Control (IDT).

[0128] All the trials were carried out using FC500 flow-cytometer (Beckman Coulter).

[0129] RT-PCR Platelets Transfected with siRNA (FIG. 4)

[0130] The transfected platelets were prepared as specified in the materials and methods, from point 1 to point 7, using a siRNA directed against HPRT1 at the concentration of 200 nM.

[0131] The control was obtained washing platelets according to the method previously described and blocking the preparation at point 3 and inserting into the medium 200 nM of siRNA directed against HPRT1.

[0132] RT-PCR was carried out as follows: the total RNA was extracted from platelets preparations using TRIzol (Invitrogen) according to the chloroform/isopropanol method of extraction.

[0133] The total RNA was reverse-transcribed using iScript (Biorad) according to the manufacturer's instructions.

[0134] The PCR was carried out using the following primers:

TABLE-US-00002 HPRT (for: TGAGGATTTGGAAAGGGTGT (SEQ ID NO: 47) rev: TGTAATCCAGCAGGTCAGCA(SEQ ID NO: 48)); Beta 2 Microglobulin (for: TGACTTTGTCACAGCCCAAGATAG (SEQ ID NO: 49) rev: CTCTAAGTTGCCACCCCTCCTAG(SEQ ID NO: 50)).

[0135] Endothelial Cell (HUVEC) Detection by Flow-Cytometry (FIG. 6)

[0136] HUVEC Endothelial cells (Lonza) were cultured in EBM2 Bullet Kit medium (Lonza) into 12-well plates until reaching about 75% of confluence.

[0137] Microparticles of platelet origin obtained as previously described after 48 hours of platelet incubation, were resuspended in 1 ml of RPMI 1640 medium and added to the endothelial cell culture.

[0138] After 6 hours of co-incubation, the supernatant was removed, endothelial cells were washed for two times in PBS and then removed from platelets by mild trypsinization, resuspended in 1 ml of PBS for the flow cytometry analysis.

[0139] The morphological gate was set using HUVEC cells of the control not preincubated with microparticles.

[0140] The fluorescence emitted from siRNA TYE 563 OS Transfection Control (IDT)was detected.

[0141] All the trials were carried out using FC500 flow-cytometer (Beckman Coulter).

[0142] Results

[0143] Fluorescent Scrambled-siRNA (Integrated DNA Technologies) was inserted into human platelets washed (3.5×10.sup.5) according to the above-described procedure, in order to verify the transfection efficacy.

[0144] Through flow-citometry tests, a high transfection efficacy was demonstrated (FIG. 1). Particularly, we demonstrated that after 1 h of incubation, almost an optimal efficacy percentage of transfection is achieved (about 97% of efficacy) (FIG. 2).

[0145] A high transfection efficacy (>95%) is also achieved incubating platelets only for 30 minutes, thus reducing cellular stress induced by transfection.

[0146] We carried out tests of platelet mRNA silencing, evaluating mRNA degradation of HPRT1 gene (Hypoxanthine-guanine phosphoribosyltransferase) in platelets washed (3×10.sup.5) and transfected with 200 nM of siRNA directed against HPRT1 (HPRT-S1 OS Positive Control IDT).

[0147] mRNA silencing was verified by semi-quantitative PCR.

[0148] A silencing efficacy of the mRNA of interest equal to 94% was obtained (FIGS. 3 e 4). Furthermore, washed human platelets were induced to produce microparticles by the method previously described and it was evaluated by flow-citometry whether the fluorescent siRNA, previously transfected into the same platelets, is transferred into microparticles produced (FIG. 5). In fact it was demonstrated that 96% of microparticles contains the siRNA previously transfected (FIG. 5). Human endothelial cells were incubated in culture (HUVEC) with microparticles deriving from platelets transfected with siRNA verifying that fluorescent siRNA, deriving from platelets from which they were produced, is transferred into about 38% of HUVEC cells (FIG. 6).

EXAMPLE 2

Study on NODISCID Mouse Leukocytes After the Intravenous Inoculum of Human Platelets Transfected with Fluorescent siRNA and Evaluation of Silencing Capability of Platelets or Microparticles Transfected with siRNA

[0149] Immunodeficient NOD/SCIO mice, therefore unable of immunologically reacting to human platelet infusion, were inoculated by intravenous injection, with 200 μl of a suspension of 5×10.sup.8 human platelets transfected according to the method described in the example 1 with fluorescent siRNA.

[0150] 24 hours after the inoculum, mice were sacrificed and a whole blood cardiac sampling was carried out.

[0151] Mouse whole blood was co-incubated for 30 minutes with murine antibody anti-CD45 (BD Pharmingen).

[0152] The fluorescence emitted from siRNA TYE 563 DS Transfection Control (IDT) in mouse leukocytes marked with antibody anti-CD45 (BD Pharmingen) after 30 minutes of incubation was detected.

[0153] All the tests were carried out using flow-cytometer FC500 (Beckman Coulter). The experimental results in vivo, with the experimental animal, which show the persistence in the bloodstream of platelets “transfected” with siRNA and the transfer of the latter to murine leukocytes are shown in FIG. 7.

EXAMPLE 3

GFP Detection on Human Platelets Transfected by Flow-Cytometry (FIG. 8)

[0154] A total of 1 μg of plasmid containing the sequence of GFP (Pmax, Lonza) was inserted into human platelets using the method described in the example 1, replacing the plasmid with siRNA in the above-described method.

[0155] After, platelets were analyzed setting the morphological gate with a platelet suspension of control without transfection prepared as described in the materials and methods, and detecting the fluorescence emitted from GFP produced by Pmax plasmid (max emission 509 nm). All the tests were carried out using the instrument FC500 (Beckman Coulter). Through flow-cytometry it was observed that human platelet transfection with recombinant plasmid containing the sequence for GFP (Green Fluorescent Protein) caused its translation and therefore the expression of plasmid product (FIG. 8).

EXAMPLE 4

Method of Platelet or Microparticle Transfection and Evaluation of the Transfection Percentage

Materials and Methods

Method of Platelet or Microparticle Transfection

[0156] Venous peripheral blood was harvested and collected in tubes containing 3.8% of sodium citrate as anticoagulant (1:9 citrate-blood v/v). [0157] 1. The sample was centrifuged at 120 g for 10 minutes in order to obtain PRP (platelet-rich plasma). [0158] 2. Proceeding in the isolation of plasma platelets by common methods (platelet washing or gel-filtration). [0159] 3. Platelets thus isolated were resuspended in RPMI 1640 added with antibiotics (100 U of Penicillin and 100 U of Streptomycin) or in the same plasma of the donor, at a concentration comprised between 2×10.sup.5 and 1×10.sup.6 per microliter, the lower limit of said concentration being 130,000 platelets/microliter, and rates of one milliliter were transferred into a 24-well plate and incubated at 37° C. in controlled atmosphere of 5% C02. [0160] 4. Then, the transfection medium is prepared, inserting 32.4 microliter of absolute ethyl alcohol into a tube, 3 microliters of a polyethylenimmine solution (0.1% in water) and 164.6 microliters of RPMI 1640 medium. [0161] 5. After waiting for 5 minutes, the siRNA of interest was added to the above-mentioned mixture to the maximum concentration of 200 nM and after 15 minutes of incubation at room temperature, the solution was transferred into the well in which 1 ml of platelet suspension had previously been placed. [0162] 6. After 5 minutes of incubation at 37° C., the transfection was interrupted: by platelet centrifugation (at 3,000 g for 10 minutes in the presence of PGI2 0.2 microM and, then resuspending them in 3 ml of the culture medium RPMI 1640) or by diluting the transfection medium with the culture medium RPMI 1640 until achieving a total amount of 7 milliliters. [0163] 7. Within 2 hours after the interruption of the transfection reaction, it is possible to point out (by PCR or rt-PCR) the degradation of the mRNA of interest, a specific target of the siRNA previously inserted, into platelets.

[0164] Instead, in order to obtain platelet microparticles containing the siRNA previously transfected into platelets, it is necessary to carry out the previously described operations up to point 5 and then continuing as follows: [0165] 6. Incubating platelet suspension at 37° C. in controlled atmosphere of 5% C02 together with the transfection medium for 24/48 h. Or alternatively stimulating them with 2.5 mM of CaCl.sub.2, 20 μg/ml of Collagen and 1 U/ml of thrombin for 30 minutes at 37° C. and blocking the stimulus with 2.5 mM of EDTA. [0166] 7. Centrifuging platelets at 3,000 g for 10 minutes. [0167] 8. Recovering supernatant and further centrifuging it at 12,000 g for 10 minutes in order to remove possible remained platelets. [0168] 9. Centrifuging supernatant at 160,000 g for 1 hour at 4° C. [0169] 10. Removing supernatant and resuspending microparticle pellet in 1 milliliter of RPMI 1640 (verifying microparticles concentration using a flow-cytometer).

[0170] The composition of RPMI 1640 medium is (grams/liter): the list of components expressed as grams/liter

[0171] L-Arginine 0.2

[0172] L-Asparagine 0.05

[0173] L-Aspartic Acid 0.02

[0174] L-Cystine.2HCl 0.0652

[0175] L-Glutamic Acid 0.02

[0176] L-Glutamine 0.3

[0177] Glycine 0.01

[0178] L-Histidine 0.015

[0179] Hydroxy-L-Proline 0.02

[0180] L-Isoleucine 0.05

[0181] L-Leucine 0.05

[0182] L-Lysine.HCl 0.04

[0183] L-Methionine 0.015

[0184] L-Phenylalanine 0.015

[0185] L-Proline 0.02

[0186] L-Serine 0.03

[0187] L-Threonine 0.02

[0188] L-Tryptophan 0.005

[0189] L-Tyrosine.2Na.2H20 0.02883

[0190] L-Valine 0.02

[0191] Biotin 0.0002

[0192] Choline Chloride 0.003

[0193] Felic Acid 0.001

[0194] myo-Inositol 0.035

[0195] Niacinamide 0.001

[0196] D-Pantothenic Acid Hemicalcium 0.00025

[0197] PABA 0.001

[0198] Pyridoxine.HCl 0.001

[0199] Riboflavin 0.0002

[0200] Thiamine.HCl 0.001

[0201] Vitamin B12 0.000005

[0202] Calcium Nitrate-4 H20 0.1

[0203] Magnesium Sulfate 0.04884

[0204] Potassium Chloride 0.4

[0205] Sodium Chloride 6.0

[0206] Sodium Phosphate Dibasic 0.8

[0207] D-Glucose 2.0

[0208] Glutathione, Reduced 0.001

[0209] Phenol Red.Na 0.0053

[0210] Platelet Detection by Flow-Cytometry (FIG. 9).

[0211] Platelets were analyzed setting the morphological gate with a control without transfection prepared as describe in the materials and methods of example 4, using a fluorescent anti-CD61 antibody (Beckman Coulter)-fitc and detecting the fluorescence emitted from the siRNA TYE 563 DS Transfection Control (IDT).

[0212] All the trials were carried out using FC500 flow-cytometer (Beckman Coulter).

EXAMPLE 5

Method of Platelet or Microparticle Transfection and Evaluation of the Transfection Percentage

[0213] Materials and Methods

[0214] Method of Platelet or Microparticle Transfection

[0215] Venous peripheral blood was harvested and collected in tubes containing 3.8% of sodium citrate as anticoagulant (1:9 citrate-blood v/v). [0216] 1. The sample was centrifuged at 120 g for 10 minutes in order to obtain PRP (platelet-rich plasma). [0217] 2. Proceeding to the isolation of plasma platelets by common methods (platelet washing or gel-filtration). [0218] 3. Platelets thus isolated were resuspended in RPMI 1640 added with antibiotics (100 U of Penicillin and 100 U of Streptomycin) or in the same plasma of the donor, at a concentration comprised between 2×10.sup.5 and 1×10.sup.6 per microliter, the lower limit of said concentration being 130,000 platelets/microliter, and rates of one milliliter were transferred to a 24-well plate and incubated at 37° C. in controlled atmosphere of 5% C02. [0219] 4. Then, the transfection medium is prepared, inserting 32.4 microliter of absolute ethyl alcohol, 120 microliters of a polyethylammine solution (0.1% in water) and 47.6 microliters of RPMI 1640 medium. [0220] 5. After waiting for 5 minutes, the siRNA of interest was added to the above-mentioned mixture of the siRNA of interest to the maximum concentration of 200 nM and after 15 minutes of incubation at room temperature, the solution was transferred into the well in which 1 ml of platelet suspension had previously been placed. [0221] 6. After 5 minutes of incubation at 37° C., the transfection was interrupted: by platelet centrifugation (at 3,000 g for 10 minutes in the presence of PG12 0.2 microM and, then resuspending them in 3 ml of the culture medium RPMI 1640) or by diluting the transfection medium with the culture medium RPMI 1640 until achieving a total amount of 7 milliliters. [0222] 7. Within 2 hours after the interruption of the transfection reaction, it is possible to point out (by PCR or rt-PCR) the degradation of the mRNA of interest, a specific target of the siRNA previously inserted, into platelets.

[0223] Instead, in order to obtain platelet microparticles containing the siRNA previously transfected into platelets, it is necessary to carry out the previously described operations up to point 5 and then continuing as follows: [0224] 11. Incubating platelet suspension at 37° C. in controlled atmosphere of 5% C0.sub.2 together with the transfection medium for 24/48 h. Or alternatively stimulating them with 2.5 mM of CaCl2 , 20 μg/ml of Collagen and 1 U/ml of thrombin for 30 minutes at 37° C. and blocking the stimulus with 2.5 mM of EDTA. [0225] 12. Centrifuging platelets at 3,000 g for 10 minutes.

[0226] 13. Recovering supernatant and further centrifuging it at 12,000 g for 10 minutes in order to remove possible remained platelets.

[0227] 14. Centrifuging supernatant at 160,000 g for 1 hour at 4° C.

[0228] 15. Removing supernatant and resuspending microparticle pellet in 1 milliliter of RPMI 1640 (verifying microparticles concentration using a flow-cytometer).

[0229] The composition of RPMI 1640 medium is (grams/liter): the list of components expressed as grams/liter

[0230] L-Arginine 0.2

[0231] L-Asparagine 0.05

[0232] L-Aspartic Acid 0.02

[0233] L-Cystine.2HCl 0.0652

[0234] L-Glutamic Acid 0.02

[0235] L-Glutamine 0.3

[0236] Glycine0.01

[0237] L-H istidine 0.015

[0238] Hydroxy-L-Proline 0.02

[0239] L-Isoleucine 0.05

[0240] L-Leucine 0.05

[0241] L-Lysine.HCl 0.04

[0242] L-M ethionine 0.015

[0243] L-Phenylalanine 0.015

[0244] L-Proline 0.02

[0245] L-Serine 0.03

[0246] L-Threonine 0.02

[0247] L-Tryptophan 0.005

[0248] L-Tyrosine.2Na.2H20 0.02883

[0249] L-Valine 0.02

[0250] Biotin 0.0002

[0251] Choline Chloride 0.003

[0252] Folic Acid 0.001

[0253] myo-Inositol 0.035

[0254] Niacinamide 0.001

[0255] D-Pantothenic Acid Hemicalcium 0.00025

[0256] PABA 0.001

[0257] Pyridoxine.HCl 0.001

[0258] Riboflavin 0.0002

[0259] Thiamine.HCl 0.001

[0260] Vitamin B12 0.000005

[0261] Calcium Nitrate.4 H20 0.1

[0262] Magnesium Sulfate 0.04884

[0263] Potassium Chloride 0.4

[0264] Sodium Chloride 6.0

[0265] Sodium Phosphate Dibasic 0.8

[0266] D-Glucose 2.0

[0267] Glutathione, Reduced 0.001

[0268] Phenol Red.Na 0.0053

[0269] Platelet Detection by Flow-Cytometry (FIG. 10).

[0270] Platelets were analyzed setting the morphological gate with a control without transfection prepared as describe in the materials and methods of example 5, using a fluorescent anti-CD61 antibody (Beckman Coulter)-fitc and detecting the fluorescence emitted from the siRNA TYE 563 DS Transfection Control (IDT).

[0271] All the trials were carried out using FC500 flow-cytometer (Beckman Coulter).