Compositions and methods for genomic integration of nucleic acids into exogenous landing pads
12110498 ยท 2024-10-08
Assignee
Inventors
Cpc classification
C12N15/1082
CHEMISTRY; METALLURGY
C12N15/1082
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
Abstract
Provided herein are compositions and methods of integrating one or more exogenous donor nucleic acids into one or more exogenous landing pads engineered into a host cell's genome. In certain embodiments, the exogenous landing pads and exogenous donor nucleic acids comprise standardized, compatible homology regions so that exogenous donor nucleic acids can integrate into any of the landing pads, independent of the genomic sequences surrounding the landing pads. In certain embodiments, the methods comprise contacting the host cell comprising landing pads with one or more exogenous donor nucleic acids, and a nuclease capable of causing a double-strand break within the landing pads, and recovering a host cell comprising one or more exogenous donor nucleic acids integrated in any of the landing pads.
Claims
1. A method for integrating one or more exogenous donor nucleic acids into a yeast host cell's genome, the method comprising: contacting a host cell, the host cell comprising one or more exogenous landing pads integrated in the host cell's genome, wherein each exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP), with: (i) one or more exogenous donor nucleic acids (ES), comprising a nucleic acid of interest (D) positioned between an upstream library sequence (UL) and a downstream library sequence (DL), wherein each (UL) is capable of homologously recombining at any (ULP), and each (DL) is capable of homologously recombining at any (DLP) of any of the one or more exogenous landing pads wherein any of the exogenous donor nucleic acids (ES) is integrated at any of the exogenous landing pads and is independent of genomic sequences surrounding each landing pad, and wherein the one or more exogenous landing pads are selected from SEQ ID NOs: 8, 9, and 10.
2. The method of claim 1, wherein the one or more exogenous donor nucleic acids ES comprise upstream library sequences UL that are identical to one another and downstream library sequences DL that are identical to one another.
3. The method of claim 1, wherein each of ULP and DLP comprises about 100 base pairs of homology with each of UL and DL, respectively.
4. The method of claim 1, wherein each of ULP and DLP comprises about 200 base pairs of homology with each of UL and DL, respectively.
5. The method of claim 1, wherein each ULP and DLP comprises about 500 base pairs of homology with each of UL and DL, respectively.
6. The method of claim 1, wherein each of UL and DL comprises about 500 base pairs, wherein at least a portion of each of UL and DL is at least 70% identical to ULP and DLP, respectively, for host cell-mediated homologous recombination.
7. The method of claim 1, wherein the host cell comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 exogenous landing pads.
8. The method of claim 1, wherein the one or more exogenous landing pads are integrated at selected neutral loci in the host cell's genome.
9. The method of claim 1, wherein the one or more exogenous landing pads are integrated at intergenic regions in the host cell's genome.
10. The method of claim 1, wherein the host cell comprises two or more exogenous landing pads, wherein each UL is capable of homologously recombining at any ULP, and each DL is capable of homologously recombining at any DLP, of any of the one or more exogenous landing pads.
11. The method of claim 1, wherein the one or more exogenous donor nucleic acids (ES), a group of component polynucleotides, or both the ES and the group of component polynucleotides are capable of integrating at any of the one or more landing pads, independent of genomic sequences surrounding each exogenous landing pad.
12. The method of claim 1, wherein the host cell further comprises at least one secondary landing pad integrated in the host cell's genome, the secondary landing pad comprising a secondary nuclease target sequence positioned between a secondary upstream landing pad homology sequence and a secondary downstream landing homology pad sequence, wherein; (a) the secondary upstream landing pad sequence is different from ULP of the one or more exogenous landing pads; (b) the secondary downstream landing pad sequence is different from DLP of the one or more exogenous landing pads; (c) the secondary nuclease target sequence is different from the NTS of the one or more exogenous landing pads; or (d) any combination thereof.
13. The method of claim 1, wherein the yeast host cell is selected from Aciculoconidium, Ambrosiozyma, Arthroascus, Arxiozyma, Ashbya, Babjevia, Bensingtonia, Botryoascus, Botryozyma, Brettanomyces, Bullera, Bulleromyces, Candida, Citeromyces, Clavispora, Cryptococcus, Cystofilobasidium, Debaryomyces, Dekkara, Dipodascopsis, Dipodascus, Eeniella, Endomycopsella, Eremascus, Eremothecium, Erythrobasidium, Fellomyces, Filobasidium, Galactomyces, Geotrichum, Guilliermondella, Hanseniaspora, Hansenula, Hasegawaea, Holtermannia, Hormoascus, Hyphopichia, Issatchenkia, Kloeckera, Kloeckeraspora, Kluyveromyces, Kondoa, Kuraishia, Kurtznanomyces, Leucosporidium, Lipomyces, Lodderomyces, Malassezia, Metschnikowia, Mrakia, Myxozyma, Nadsonia, Nakazawaea, Nematospora, Ogataea, Oosporidium, Pachysolen, Phachytichospora, Phafia, Pichia, Rhodosporidium, Rhodotorula, Saccharomyces, Saccharomycodes, Saccharomycopsis, Saitoella, Sakaguchia, Saturnospora, Schizoblastosporion, SchizoSaccharomyces, Schwanniomyces, Sporidiobolus, Sporobolomyces, Sporopachydermia, Stephanoascus, Sterigmatomyces, Sterigmatosporidium, Symbiotaphrina, Sympodiomyces, Sympodiomycopsis, Torulaspora, Trichosporiella, Trichosporon, Trigonopsis, Tsuchiyaea, Udeniomyces, Waltomyces, Wickerhamia, Wickerhamiella, Williopsis, Yamadazyma, Yarrowia, Zygoascus, ZygoSaccharomyces, Zygowilliopsis, and Zygozyma.
14. The method of claim 1, wherein the yeast host cell is Saccharomyces cerevisisae.
15. A yeast host cell genetically modified according to the method of claim 1.
16. The yeast host cell of claim 15, wherein the yeast host cell belongs to a genera selected from Aciculoconidium, Ambrosiozyma, Arthroascus, Arxiozyma, Ashbya, Babjevia, Bensingtonia, Botryoascus, Botryozyma, Brettanomyces, Bullera, Bulleromyces, Candida, Citeromyces, Clavispora, Cryptococcus, Cystofilobasidium, Debaryomyces, Dekkara, Dipodascopsis, Dipodascus, Eeniella, Endomycopsella, Eremascus, Eremothecium, Erythrobasidium, Fellomyces, Filobasidium, Galactomyces, Geotrichum, Guilliermondella, Hanseniaspora, Hansenula, Hasegawaea, Holtermannia, Hormoascus, Hyphopichia, Issatchenkia, Kloeckera, Kloeckeraspora, Kluyveromyces, Kondoa, Kuraishia, Kurtznanomyces, Leucosporidium, Lipomyces, Lodderomyces, Malassezia, Metschnikowia, Mrakia, Myxozyma, Nadsonia, Nakazawaea, Nematospora, Ogataea, Oosporidium, Pachysolen, Phachytichospora, Phafia, Pichia, Rhodosporidium, Rhodotorula, Saccharomyces, Saccharomycodes, Saccharomycopsis, Saitoella, Sakaguchia, Saturnospora, Schizoblastosporion, SchizoSaccharomyces, Schwanniomyces, Sporidiobolus, Sporobolomyces, Sporopachydermia, Stephanoascus, Sterigmatomyces, Sterigmatosporidium, Symbiotaphrina, Sympodiomyces, Sympodiomycopsis, Torulaspora, Trichosporiella, Trichosporon, Trigonopsis, Tsuchiyaea, Udeniomyces, Waltomyces, Wickerhamia, Wickerhamiella, Williopsis, Yamadazyma, Yarrowia, Zygoascus, ZygoSaccharomyces, Zygowilliopsis, and Zygozyma.
17. The yeast host cell of claim 16, wherein the yeast host cell is Saccharomyces cerevisiae.
Description
5. BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
6. DETAILED DESCRIPTION OF THE EMBODIMENTS
6.1 Definitions
(28) As used herein, the term landing pad refers to a recombination target site engineered into a host cell's genome to further facilitate insertion of an exogenous donor nucleic acid. In certain embodiments, a landing pad comprises a nuclease target sequence (NTS) which is positioned between landing pad homology sequences used for homologous recombination of an exogenous donor nucleic acids. The nuclease target sequence (NTS) is recognized by a site-specific nuclease, and the nuclease binds to (NTS) and cleaves a site within the exogenous landing pad. Those of skill will recognize that the nuclease may cleave within or outside the NTS.
(29) The term exogenous landing pad refers to a landing pad which is not normally found in nature. In certain embodiments, an exogenous landing pad comprises landing pad homology sequences (e.g., an upstream landing pad homology sequence and a downstream landing pad homology sequence) that are not present in the host cell's genome prior to their insertion and/or its landing pad homology sequences are positioned outside of their natural locus (i.e., at a non-native locus) in the host cell's genome.
(30) The term heterologous or exogenous refers to what is not normally found in nature. For example, the term heterologous nucleotide sequence or exogenous nucleic acid refers to a nucleotide sequence not normally found in a given cell in nature. As such, a heterologous nucleotide sequence or an exogenous nucleotide sequence may be: (a) foreign to its host cell (i.e., is exogenous to the cell); (b) naturally found in the host cell (i.e., endogenous) but present at an unnatural quantity in the cell (i.e., greater or lesser quantity than naturally found in the host cell); or (c) be naturally found in the host cell but positioned outside of its natural locus.
(31) The term exogenous donor nucleic acid refers to an exogenous nucleic acid which is being donated to integrate into the host cell's genome. In certain embodiments, an exogenous donor nucleic acid can be a single part DNA piece which has necessary homology sequences for integration into an exogenous landing pad. In other embodiments, an exogenous donor nucleic acid can be a component polynucleotide, which generally combine with other component polynucleotide, to integrate into an exogenous landing pad.
(32) As used herein, the term endogenous nucleic acid refers to a nucleic acid that is normally found in and/or produced by a given bacterium, organism, or cell in nature. An endogenous nucleic acid is also referred to as a native nucleic acid or a nucleic acid that is native to a given bacterium, organism, or cell, and is positioned at its natural locus in the host cell's genome.
(33) As used herein, the term contacting refers to nucleic acids being placed in sufficiently close proximity, internally or externally, to the host cell to enable the nucleic acids to be taken up to be integrated into a host cell's genome.
(34) As used herein, the term library refers to the collection of nucleic acids containing known common sequences or substantially common sequences at their 5 and 3 ends. In certain embodiments, exogenous donor nucleic acids in a library comprise an upstream library sequence at its 5 region and a downstream library sequence at its 3 region used for homologous recombination into exogenous landing pads in the host cell's genome. In certain embodiments, component polynucleotides in a library can comprise an upstream library sequence at their 5 region and a linker at their 3 region. In certain embodiments, component polynucleotides in a library can comprise a linker at their 5 region and a downstream library sequence at their 3 region. In certain embodiments, a library of component polynucleotides can comprise a linker at both 5 and 3 regions.
(35) As used herein, the terms cleaves, cleavage and/or cleaving with respect to a nuclease, e.g. a homing endonuclease, zinc-finger nuclease or TAL-effector nuclease, refer to the act of creating a double-stranded break (DSB) in a particular nucleic acid. The DSB can leave a blunt end or sticky end (i.e., 5 or 3 overhang), as understood by those of skill in the art.
(36) As used herein, the term engineered host cell refers to a host cell that is generated by genetically modifying a parent cell using genetic engineering techniques (i.e., recombinant technology). The engineered host cell may comprise additions, deletions, and/or modifications of nucleotide sequences to the genome of the parent cell.
(37) As used herein, the term homology refers to the identity between two or more nucleic acid sequences, or two or more amino acid sequences. Sequence identity can be measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more near to identical the sequences are to each other. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity when aligned using standard methods. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. Biosc. 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations. The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, Md. 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.
(38) As used herein, the term sequence identity or percent identity, in the context or two or more nucleic acid or protein sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same. For example, the sequence can have a percent identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91% at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher identity over a specified region to a reference sequence when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection. For example, percent of identity is determined by calculating the ratio of the number of identical nucleotides (or amino acid residues) in the sequence divided by the length of the total nucleotides (or amino acid residues) minus the lengths of any gaps.
(39) For convenience, the extent of identity between two sequences can be ascertained using computer program and mathematical algorithms known in the art. Such algorithms that calculate percent sequence identity generally account for sequence gaps and mismatches over the comparison region. Programs that compare and align sequences, like Clustal W (Thompson et al., (1994) Nucleic Acids Res., 22: 4673-4680), ALIGN (Myers et al., (1988) CABIOS, 4: 11-17), FASTA (Pearson et al., (1988) PNAS, 85:2444-2448; Pearson (1990), Methods Enzymol., 183: 63-98) and gapped BLAST (Altschul et al., (1997) Nucleic Acids Res., 25: 3389-3402) are useful for this purpose. The BLAST or BLAST 2.0 (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI) and on the Internet, for use in connection with the sequence analysis programs BLASTP, BLASTN, BLASTX, TBLASTN, and TBLASTX. Additional information can be found at the NCBI web site.
(40) In certain embodiments, the sequence alignments and percent identity calculations can be determined using the BLAST program using its standard, default parameters. For nucleotide sequence alignment and sequence identity calculations, the BLASTN program is used with its default parameters (Gap opening penalty=5, Gap extension penalty=2, Nucleic match=1, Nucleic mismatch=?3, Expectation value=10.0, Word size=11). For polypeptide sequence alignment and sequence identity calculations, BLASTP program is used with its default parameters (Gap opening=11, Gap extension penalty=2; Nucleic match=1; Nucleic mismatch=?3, Expectation value=10.0; Word size=11; matrix Blosum 62). Alternatively, the following program and parameters are used: Align Plus software of Clone Manager Suite, version 5 (Sci-Ed Software); DNA comparison: Global comparison, Standard Linear Scoring matrix, Mismatch penalty=2, Open gap penalty=4, Extend gap penalty=1. Amino acid comparison: Global comparison, BLOSUM 62 Scoring matrix.
(41) As used herein, the term markerless refers to integration of a donor DNA (e.g., an exogenous donor nucleic acid) into an exogenous landing pad within a host cell's genome without accompanying integration of a selectable marker. In some embodiments, the term also refers to the recovery of such a host cell without utilizing a selection scheme that relies on integration of selectable marker into the host cell's genome. For example, in certain embodiments, a selection marker that is episomal or extrachromosomal may be utilized to select for cells comprising a plasmid encoding a nuclease capable of cleaving a genomic target site. Such use would be considered markerless so long as the selectable marker is not integrated into the host cell's genome.
(42) As used herein, the term polynucleotide refers to a polymer composed of nucleotide units as would be understood by one of skill in the art. Preferred nucleotide units include but are not limited to those comprising adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). Useful modified nucleotide units include but are not limited to those comprising 4-acetylcytidine, 5-(carboxyhydroxylmethyl)uridine, 2-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylamino-methyluridine, dihydrouridine, 2-O-methylpseudouridine, 2-O-methylguanosine, inosine, N6-isopentyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, 5-methoxyuridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 2-methylthio-N6-isopentyladenosine, uridine-5-oxyacetic acid-methylester, uridine-5-oxyacetic acid, wybutoxosine, wybutosine, pseudouridine, queuosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, 2-O-methyl-5-methyluridine, 2-O-methyluridine, and the like. Polynucleotides include naturally occurring nucleic acids, such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), as well as nucleic acid analogs. Nucleic acid analogs include those that include non-naturally occurring bases, nucleotides that engage in linkages with other nucleotides other than the naturally occurring phosphodiester bond or that include bases attached through linkages other than phosphodiester bonds. Thus, nucleotide analogs include, for example and without limitation, phosphorothioates, phosphorodithioates, phosphorotriesters, phosphoramidates, boranophosphates, methylphosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs), and the like.
(43) Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5-direction.
(44) As used herein, the term DNA segment, alternately referred to as Bits in the examples below, refers to any isolated or isolatable molecule of DNA. Useful examples include but are not limited to a protein-coding sequence, reporter gene, fluorescent marker coding sequence, promoter, enhancer, terminator, intron, exon, poly-A tail, multiple cloning site, nuclear localization signal, mRNA stabilization signal, selectable marker, integration loci, epitope tag coding sequence, degradation signal, a spacer sequence, or a barcode sequence, or any other naturally occurring or synthetic DNA molecule. In some embodiments, the DNA segment can be of natural origin. Alternatively, a DNA segment can be completely of synthetic origin, produced in vitro. Furthermore, a DNA segment can comprise any combination of isolated naturally occurring DNA molecules, or any combination of an isolated naturally occurring DNA molecule and a synthetic DNA molecule. For example, a DNA segment may comprise a heterologous promoter operably linked to a protein coding sequence, a protein coding sequence linked to a poly-A tail, a protein coding sequence linked in-frame with a epitope tag coding sequence, and the like.
(45) Primer refers to a polynucleotide sequence that is capable of specifically hybridizing to a polynucleotide template sequence, e.g., a primer binding segment, and is capable of providing a point of initiation for synthesis of a complementary polynucleotide under conditions suitable for synthesis, i.e., in the presence of nucleotides and an agent that catalyzes the synthesis reaction (e.g., a DNA polymerase). The primer is complementary to the polynucleotide template sequence, but it need not be an exact complement of the polynucleotide template sequence. For example, a primer can be at least about 80, 85, 90, 95, 96, 97, 98, or 99% identical to the complement of the polynucleotide template sequence. A primer can be of variable length but generally is at least 15 bases. In some embodiments, the primer is between 15 and 35 bases long. In some embodiments, the primer is more than 35 bases long. In other embodiments, the primer has a melting temperature (T.sub.m), i.e., the temperature at which one half of the DNA duplex will dissociate to become single stranded, of at least 50? C. In other embodiments, the primer has a T.sub.m between about 50? C. and 70? C. In still other embodiments, the primer does not form appreciable DNA or RNA secondary structures so as to not impact the efficiency of hybridization to the polynucleotide template sequence.
(46) As used herein, the term primer binding segment is a polynucleotide sequence that binds to a primer so as to provide a point of initiation for synthesis of a complementary polynucleotide under conditions suitable for synthesis.
(47) As used herein, the term linker sequence refers to a polynucleotide sequence in a component polynucleotide, which is capable of homologously recombining with a linker sequence in another component polynucleotide via homologous recombination in vivo. In certain embodiments, a linker sequence of a component polynucleotide is capable of homologously recombining with a landing pad linker sequence of an exogenous landing pad.
(48) As used herein, the term simultaneous, when used with respect to multiple integration, encompasses a period of time beginning at the point at which a host cell is co-transformed with a nuclease, e.g. a plasmid encoding a nuclease, and more than one donor DNA to be integrated into the host cell's genome, and ending at the point at which the transformed host cell, or clonal populations thereof, is screened for successful integration of the donor DNAs at landing pads. In some embodiments, the period of time encompassed by simultaneous is at least the amount of time required for the nuclease to bind and cleave its target sequence within the host cell's chromosome(s). In some embodiments, the period of time encompassed by simultaneous is at least 6, 12, 24, 36, 48, 60, 72, 96 or more than 96 hours, beginning at the point at which the a host cell is co-transformed with a nuclease, e.g. a plasmid encoding a nuclease, and more than one donor DNA.
(49) The term degron sequence refers to a nucleic acid that encodes a protein that confers instability to another protein fused in frame to the degron protein by changing the degradation rate of the fused protein.
(50) The term terminator refers to a transcription terminator sequence which defines the end of a transcriptional unit (such as a gene) and initiate the process of releasing the newly synthesized RNA from the transcription machinery.
(51) The term insulator sequence refers to a nucleotide sequence inserted in an exogenous landing pad, and it insulates the landing pad from unintended read-through transcription from another promoter located upstream to the landing pad in the host cell's genome. An example of an insulator sequence is a transcription terminator or a nucleic acid forming a structure that sterically hinder an unintended read through transcription from an upstream promoter.
(52) The term neutral loci refers to locations in a host cell's genome with no known function or gene transcription or at which integration of an exogenous landing pad and/or integration of an exogenous donor nucleic acid therein does not significantly affect cell viability or function compared to a control cell. The term neutral loci in the context of multiple exogenous landing pads can refer to genomic loci at which the integration of the same DNA construct encoding a protein results in the level of protein expression being similar.
(53) The term intergenic region refers to a stretch of DNA sequences located between genes with no known function and is a subset of noncoding DNA.
6.2 Generating Host Cells with Exogenous Landing Pad(s) in Host Cell's Genome
(54) Provided herein are host cells modified to comprise one or more exogenous landing pads integrated in the host cell's genome and methods of generating such host cells. As used herein, an exogenous landing pad refers to a recombinantly generated target site that is stably integrated into the host cell's genome to further facilitate the insertion of an exogenous donor nucleic acid of interest via homologous recombination. An exogenous landing pad comprises landing pad homology regions at its 5 and 3 ends to facilitate homologous recombination of an exogenous donor nucleic acid comprising compatible homology sequence. In certain embodiments, the landing pad's homology regions at its 5 and 3 ends (also referred to as landing pad homology sequences) are exogenous to and are not represented in the host cell's genome, and the integration of exogenous donor nucleic acids does not rely any endogenous genomic sequences for homologous recombination in the host cell. As such, in certain embodiments, an integration event of an exogenous donor nucleic acid at the landing pad is independent of endogenous genomic sequences around at which the exogenous landing pad is located.
(55) In certain embodiments, a landing pad further comprises a nuclease target sequence (NTS) recognizable and cleavable by a site-specific nuclease, which is capable of generating a DNA double strand break (DSB) within the landing pad. The DSB within the landing pad increases integration efficiencies of exogenous donor nucleic acids and enrichment of transformed host cells that are able to repair the DSBs. In particular embodiments, a landing pad integrated in a host cell's genome comprises an upstream landing pad homology sequence (ULP), a downstream landing pad homology sequence (DLP), and a nuclease target sequence (NTS) positioned between (ULP) and (DLP).
(56)
(57)
(58) In the embodiment illustrated in
(59)
(60)
(61) The middle of
(62) The bottom of
(63) While
(64)
(65) In particular embodiments, a host cell comprises two or more exogenous landing pads integrated in the host cell's genome. In certain embodiments, the two or more exogenous landing pads are standardized in that their upstream landing pad homology sequences (ULP) are identical or substantially identical to one another, and their downstream landing pad homology sequences (DLP) are identical or substantially identical to one another. The standardized landing pad homology sequences facilitate host cell-mediated homologous recombination of any exogenous donor nucleic acids into any landing pads, as long as the exogenous donor nucleic acids comprise compatible homology regions at their 5 and 3 regions. Thus, in certain embodiments, all exogenous donor nucleic acids in a library comprise a standardized upstream library sequence (UL) at their 5 end, which can homologously recombine with any (ULP) in any of the landing pads and a standardized downstream library sequence (DL) at their 3 end, which can homologously recombine with any (DLP) in any of the landing pads.
(66) In certain embodiments, the landing pads are integrated into genomic loci that are pre-determined to be neutral loci of the host cell's genome. In certain embodiments, a genomic locus for landing pad integration is considered as a neutral locus if no gene transcript is found in the region around the genomic locus by RNA sequencing. In certain embodiments, a genomic locus for landing pad integration is considered as a neutral locus if no gene transcription is found in the region around the genomic locus by RNA sequence, and if the genomic locus does not comprise a sequence that is homologous to a similarly positioned genomic locus in other closely related species (e.g., Saccharomyces cerevisiae and Saccharomyces paradoxus) when their genomic sequences are aligned. The genomic sequences of closely related species can be compared using any suitable methods, for example, visually or using an algorithm such as BLASTn, UCSC Genome Browser from genome.ucsc.edu, and the like. In some embodiments, one or more landing pads are integrated at intergenic regions in the host cell's genome with no known function. In some embodiments, one or more landing pads are integrated at non-coding regions of the host cell's genome. In some embodiments, one or more landing pads are integrated at or adjacent to the coding regions of the host cell's genome.
(67) In some embodiments, these genomic loci determined to be neutral by sequence analysis are further validated based on the host cell function. For example, the effects of landing pad integration on parameters, such as the target molecule production, biomass yield, cell growth rate, and the like, can be measured and compared to a control host cell without integration of landing pads. In some embodiments, expression of a reporter gene integrated in one landing pad can be compared to those integrated in other landing pads in the host cell's genome to determine any variability in integration efficiencies or expression of the reporter gene in different landing pads.
(68) The term neutral loci in the context of multiple exogenous landing pads can refer to genomic loci at which the integration of the same DNA construct encoding a protein results in the level of protein expression being similar. For example, the expression levels of a reporter gene integrated at multiple exogenous landing pads can vary less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, or less than 5%, if the exogenous landing pads are integrated at neutral loci. Therefore, in certain embodiments, the integration of exogenous landing pads at neutral loci removes any genomic location context for expression of an exogenous nucleic acid integrated at the exogenous landing pads.
(69)
(70) Any suitable number of landing pads may be integrated into the host cell's genome. In certain embodiments, the number of landing pads integrated into the host cell's genome is between 1 and 500. In certain embodiments, the number of landing pads integrated in the host cell's genome is between 2 and 250. In certain embodiments, the number of landing pads integrated in the host cell's genome is between 3 and 200. In certain embodiments, the number of landing pads integrated in the host cell's genome is between 3 and 50. In certain embodiments, the number of landing pads integrated in the host cell's genome is between 3 and 20. In certain embodiments, the number of landing pads integrated in the host cell's genome is between 3 and 10. In certain embodiments, the number of landing pads integrated in the host cell's genome is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, or any number between these numbers.
(71) While
(72) Each landing pad sequence can be generated using any techniques known in the art. In some embodiments, the entire landing pad sequence can be synthesized de novo using chemical synthesis and/or recombinant molecular biology techniques. See, e.g., Kosuri & Church, Nature Methods 11: 499-507 (2014). In certain embodiments, parts of each landing pad (e.g., ULP, DLP, and NTS) can be separately synthesized as separate parts and then ligated together. Alternatively, a landing pad sequence can be obtained from commercial nucleic acid synthesis services. These include, for example, Twist Bioscience (San Francisco, CA), Biomatik (Wilmington, DE), Genescript (Piscataway, NJ), and GeneArt gene synthesis services available through www.introgen.com.
(73) The landing pads can be integrated into the host cell's genome using any suitable methods known in the art. For example, traditional gene targeting method by homologous recombination using a selectable marker may be used to introduce and integrate a landing pad into the host cell's genome. In some embodiments, the selectable marker gene may be subsequently excised from the host cell's genome. See, e.g., U.S. Pat. Nos. 7,919,605, and 9,018,364. In some embodiments, designer nucleases, such as CRISPR-Cas system, can be used to facilitate integration of one or more landing pads into desired specific target genomic loci. See, e.g., U.S. Patent Application Publication No. 2015/0184199; Horwitz et al., Cell Systems 1, 88-96, Jul. 29, 2015; Cong et al., 2013, Science 339: 819-823; Jao et al., 2013, Proc. Natl. Acad. Sci USA 110, 13904-13909; Wang et al. 2013, Cell 153, 910-918; Jacobs et al; 2014, Nat. Commun. 5, 5344.
6.2.1. Upstream and Downstream Landing Pad Homology Sequences
(74) In certain embodiments, each of exogenous landing pads engineered into the host cell's genome comprises an upstream landing pad homology sequence (ULP) at its 5 region and a downstream landing pad homology sequence (DLP) at its 3 region. These sequences provide regions of homology for host cell-mediated recombination and integration of exogenous donor nucleic acids. In particular embodiments, the landing pad homology sequences are exogenous to the genomic loci at which they are integrated. In other word, these landing pad homology sequences are not part of endogenous sequences of the genomic loci at which they are integrated. In other embodiments, landing pad homologous sequences may exist in the host cell's genome, but they are located at their non-native locus in the landing pad.
(75) In certain embodiments, the landing pad homology sequences do not share sequence homology with any genomic DNA. In certain embodiments, the nucleotide sequences of (ULP) and/or (DLP) are synthetic. In certain embodiments, the nucleotide sequences of (ULP) and/or (DLP) are randomly generated by a computer algorithm. Suitable landing pad homology sequences are selected by removing randomly generated sequences with undesirable features, such as sequences with tandem and/or inverted repeats, DNA secondary structure, and any significant homology to known biological sequences in the host cell's genome. In certain embodiments, the randomly generated nucleotides are further filtered to select those which comprise between about 30% to about 70%, typically about 40% to 60%, typically between about 45% to about 55%, or about 50% GC content (or guanine-cytosine content).
(76) In some embodiments, (ULP) and (DLP) can comprise any nucleotide sequence of sufficient length and sequence identity that allows for genomic integration of the exogenous nucleic acid (ES), at any landing pads. In certain embodiments, each of (ULP) and (DLP), independently consists of about 20 to 5,000 nucleotides. In certain embodiments, each of (ULP) and (DLP) independently consists of about 20 to 2,500 nucleotides. In certain embodiments, each of (ULP) and (DLP) independently consists of about 25 to 1,000 nucleotides. In certain embodiments, each of (ULP) and (DLP) independently consists of about 50 to 500 nucleotides. In certain embodiments, each of (ULP) and (DLP) independently consists of about 100 to about 500 nucleotides. In certain embodiments, each of (ULP) and (DLP), independently consists of about 20, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000 nucleotides, or any numbers in between these numbers. In some embodiments, each of (ULP) and (DLP) independently consists of about 500 nucleotides. In some embodiments, each of (ULP) and (DLP) independently consists of about 200 nucleotides. In some embodiments, each of (ULP) and (DLP) independently consists of about 100 nucleotides.
(77) In certain embodiments where there are two or more landing pads integrated in the host cell's genome, the nucleotide sequences of all (ULP) in the landing pads are substantially identical to one another, and the nucleotide sequences in all (DLP) in the landing pads are substantially identical to one another. For example, all (ULP) in the landing pads comprise nucleotide sequences that are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one another; and all (DLP) in the landing pads comprise nucleotide sequences that are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one another. In some embodiments, the nucleotide sequences of all (ULP) in the landing pads are identical to one another, and the nucleotide sequences in all (DLP) in the landing pads are identical to one another. Such an exemplary embodiment is illustrated in
(78) In certain embodiments, the host cell's genome can comprise one or more alternative landing pads which are different from the primary landing pads. Exemplary embodiments of these alternative landing pads are illustrated in
6.2.2. Nuclease Target Sequence
(79) The nuclease target sequence (NTS) in each landing pad comprises a nucleotide sequence that is recognized by a nuclease. When a nuclease recognizes and binds to the nuclease target sequence (NTS) in each landing pad, it can cleave a site within or nearby (NTS) in the landing pad. In certain embodiments, the nuclease target sequence is located adjacent to at least one of the landing pad sequences. In certain embodiments, the nuclease target sequence (NTS) is positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP). When a nuclease is introduced to the host cell comprising landing pads with a nuclease target sequence, the nuclease is capable of causing a double-strand break at a site within the landing pads, which greatly increases the frequency of homologous recombination at or near the cleavage site.
(80) In some embodiments, multiple landing pads comprise the same nuclease target sequence, thereby facilitating simultaneous multiple integration events with the use of only a single nuclease that specifically recognizes the nuclease target sequence. In some embodiments, some of multiple landing pads in the host cell's genome can have different nuclease target sequences which are recognizable and cleavable by different nucleases. In such embodiments, different nucleases may be used simultaneously or sequentially to cleave different nuclease target sequences for simultaneous or sequential integration of exogenous donor nucleic acids in the host cell's genome.
(81) In some embodiments, the nuclease target sequence in a landing pad comprises a nuclease target sequence that is not otherwise represented in the native genome of the host cell. In some embodiments, the nuclease target sequence which is recognized by the nuclease is present in the host cell's genome only within the landing pads, thereby minimizing any off-target genomic binding and cleavage by the nuclease. In certain embodiments, a specific nuclease may be a rare-cutting endonuclease that has a polynucleotide recognition site of at least 12 base pairs in length, or in some instances, from 14 to 55 base pairs in length. Such endonucleases can either be derived from natural proteins having endonuclease activity, such as homing endonucleases (WO 2004/067736), or by fusion of various nucleic acid binding polypeptides to nuclease components, such as Fok-1 or Tev-1 catalytic domains (WO2012138927). Appropriate nucleic acid binding domains that can be engineered in this respect are, for instance, Zinc Finger domains (Kim et al., 1994, Chimeric restriction endonuclease, PNAS, 91:883-887), TAL effectors originating from microbes related to Xanthomonas (WO 2011/072246) or MBBBD (Modular base-per-base binding domains) originating from the endosymbiotic Burkholderia rhizoxinica. In addition, a system involving nuclease Cas9 homologues and RNaseIII (CRISPR/Cas9) has been developed from the immune system of bacterial microorganisms. In this system, the specificity of the endonuclease protein complex is addressed by specific single stranded RNAs called guide-RNA (gRNA). This guide-RNA has the ability to hybridize the nucleic acid target sequence to be cleaved by the nuclease component Cas9 (Le Cong et al., 2013, Science, 339 (6121): 819-823). Nuclease target sequences that are recognizable and/or cleavable by these nucleases are well-known and described in the art. The description of suitable nucleases and nuclease target sequences are further described in detail in Section 5.6 below.
6.2.3. Suitable Host Cells
(82) Suitable host cells for generating a parent strain with landing pads include any cell in which integration of a nucleic acid or donor DNA of interest into a chromosomal or episomal locus is desired. In some embodiments, the cell is a cell of an organism having the ability to perform homologous recombination. Although several of the illustrative embodiments are demonstrated in yeast (S. cerevisiae), it is believed that the methods of genomic modification provided herein can be practiced on all biological organisms having a functional recombination system, even where the recombination system is not as proficient as in yeast. Other cells or cell types that have a functional homologous recombination systems include bacteria such as Bacillus subtilis and E. coli (which is RecE RecT recombination proficient; Muyrers et al., EMBO rep. 1: 239-243, 2000); protozoa (e.g., Plasmodium, Toxoplasma); other yeast (e.g., SchizoSaccharomyces pombe); filamentous fungi (e.g., Ashbya gossypii); plants, for instance the moss Physcomitrella patens (Schaefer and Zryd, Plant J. 11: 1195-1206, 1997); and animal cells, such as mammalian cells and chicken DT40 cells (Dieken et al., Nat. Genet. 12:174-182, 1996).
(83) In some embodiments, the host cell is a prokaryotic cell. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the cell is a fungal cell (for instance, a yeast cell), a bacteria cell, a plant cell, or an animal cell (for instance, a chicken cell). In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a Chinese hamster ovary (CHO) cell, a COS-7 cell, a mouse fibroblast cell, a mouse embryonic carcinoma cell, or a mouse embryonic stem cell. In some embodiments, the host cell is an insect cell. In some embodiments, the host cell is a S2 cell, a Schneider cell, a S12 cell, a 5B1-4 cell, a Tn5 cell, or a Sf9 cell. In some embodiments, the host cell is a unicellular eukaryotic organism cell.
(84) In particular embodiments, the host cell is a yeast cell. Useful yeast host cells include yeast cells that have been deposited with microorganism depositories (e.g. IFO, ATCC, etc.) and belong to the genera Aciculoconidium, Ambrosiozyma, Arthroascus, Arxiozyma, Ashbya, Babjevia, Bensingtonia, Botryoascus, Botryozyma, Brettanomyces, Bullera, Bulleromyces, Candida, Citeromyces, Clavispora, Cryptococcus, Cystofilobasidium, Debaryomyces, Dekkara, Dipodascopsis, Dipodascus, Eeniella, Endomycopsella, Eremascus, Eremothecium, Erythrobasidium, Fellomyces, Filobasidium, Galactomyces, Geotrichum, Guilliermondella, Hanseniaspora, Hansenula, Hasegawaea, Holtermannia, Hormoascus, Hyphopichia, Issatchenkia, Kloeckera, Kloeckeraspora, Kluyveromyces, Kondoa, Kuraishia, Kurtznanomyces, Leucosporidium, Lipomyces, Lodderomyces, Malassezia, Metschnikowia, Mrakia, Myxozyma, Nadsonia, Nakazawaea, Nematospora, Ogataea, Oosporidium, Pachysolen, Phachytichospora, Phafia, Pichia, Rhodosporidium, Rhodotorula, Saccharomyces, Saccharomycodes, Saccharomycopsis, Saitoella, Sakaguchia, Saturnospora, Schizoblastosporion, SchizoSaccharomyces, Schwanniomyces, Sporidiobolus, Sporobolomyces, Sporopachydermia, Stephanoascus, Sterigmatomyces, Sterigmatosporidium, Symbiotaphrina, Sympodiomyces, Sympodiomycopsis, Torulaspora, Trichosporiella, Trichosporon, Trigonopsis, Tsuchiyaea, Udeniomyces, Waltomyces, Wickerhamia, Wickerhamiella, Williopsis, Yamadazyma, Yarrowia, Zygoascus, ZygoSaccharomyces, Zygowilliopsis, and Zygozyma, among others.
(85) In some embodiments, the yeast host cell is a Saccharomyces cerevisiae cell, a Pichia pastoris cell, a SchizoSaccharomyces pombe cell, a Dekkera bruxellensis cell, a Kluyveromyces lactis cell, a Arxula adeninivorans cell, or a Hansenula polymorpha (now known as Pichia angusta) cell. In a particular embodiment, the yeast host cell is a Saccharomyces cerevisiae cell. In some embodiments, the yeast host cell is a Saccharomyces fragilis cell or a Kluyveromyces lactis (previously called Saccharomyces lactis) cell. In some embodiments, the yeast host cell is a cell belonging to the genus Candida, such as Candida lipolytica, Candida guilliermondii, Candida krusei, Candida pseudotropicalis, or Candida utilis. In another particular embodiment, the yeast host cell is a Kluyveromyces marxianus cell.
(86) In particular embodiments, the yeast host cell is a Saccharomyces cerevisiae cell selected from the group consisting of a Baker's yeast cell, a CBS 7959 cell, a CBS 7960 cell, a CBS 7961 cell, a CBS 7962 cell, a CBS 7963 cell, a CBS 7964 cell, a IZ-1904 cell, a TA cell, a BG-1 cell, a CR-1 cell, a SA-1 cell, a M-26 cell, a Y-904 cell, a PE-2 cell, a PE-5 cell, a VR-1 cell, a BR-1 cell, a BR-2 cell, a ME-2 cell, a VR-2 cell, a MA-3 cell, a MA-4 cell, a CAT-1 cell, a CB-1 cell, a NR-1 cell, a BT-1 cell, and a AL-1 cell. In some embodiments, the host cell is a Saccharomyces cerevisiae cell selected from the group consisting of a PE-2 cell, a CAT-1 cell, a VR-1 cell, a BG-1 cell, a CR-1 cell, and a SA-1 cell. In a particular embodiment, the Saccharomyces cerevisiae host cell is a PE-2 cell. In another particular embodiment, the Saccharomyces cerevisiae host cell is a CAT-1 cell. In another particular embodiment, the Saccharomyces cerevisiae host cell is a BG-1 cell.
(87) In some embodiments, the yeast host cell is a cell that is suitable for industrial fermentation, e.g., bioethanol fermentation. In particular embodiments, the cell is conditioned to subsist under high solvent concentration, high temperature, expanded substrate utilization, nutrient limitation, osmotic stress due, acidity, sulfite and bacterial contamination, or combinations thereof, which are recognized stress conditions of the industrial fermentation environment.
6.3 Exogenous Donor Nucleic Acids to be Integrated into Landing Pads
(88) In another aspect, provided herein are exogenous donor nucleic acids comprising standardized homology sequences that are re-usable in any host cells with standardized landing pads engineered into their genome. In certain embodiments, exogenous donor nucleic acids introduced into a host cell comprise both upstream and downstream library sequences so that they can homologously recombine into the landing pads on their own. In certain embodiments, exogenous donor nucleic acids are component polynucleotides, each of which does not have both upstream and downstream library sequences for homologously recombining at the landing pads. When component polynucleotides with compatible linker sequences are assembled in vivo via homologous recombination, the assembled component polynucleotides with both upstream and downstream library sequences are capable of homologously recombining at the landing pads in the host cell's genome. In some embodiments, each component polynucleotide comprises a nucleic acid of interest positioned between an upstream library sequence (UL) and a linker sequence. In other embodiments, each component polynucleotide comprises a nucleic acid of interest positioned between a linker sequence and a downstream library sequence (DL). In certain embodiments, component polynucleotides comprise a nucleic acid of interest positioned between two linker sequences. When these different sets of component polynucleotides contact the host cell, their respective linker sequences can homologously recombine in vivo and integrate the assembled component polynucleotides into any one of the landing pads in the host cell's genome. In certain embodiments, exogenous donor nucleic acids are introduced into the host cell as linear DNA molecules. In certain embodiments, exogenous donor nucleic acids are introduced in to the host as circular DNA molecules.
(89) The exogenous donor nucleic acids can be generated by any technique apparent to one skilled in the art. In certain embodiments, the integration polynucleotide is generated using polymerase chain reaction (PCR) and molecular cloning techniques well known in the art. See, e.g., PCR Technology: Principles and Applications for DNA Amphlication, ed. H A Erlich, Stockton Press, New York, N.Y. (1989); Sambrook et al., 2001, Molecular CloningA Laboratory Manual, 3.sup.rd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; PCR Technology: Principles and Applications for DNA Amphlication, ed. H A Erlich, Stockton Press, New York, NY (1989); U.S. Pat. No. 8,110,360.
6.3.1. Upstream and Downstream Library Sequences in Exogenous Donor Nucleic Acids
(90) In certain embodiments, an exogenous donor nucleic acid (ES) comprises a nucleic acid of interest (D) positioned between an upstream library sequence (UL) and a downstream library sequence (DL), wherein (UL) and (DL) are capable of initiating host cell mediated homologous recombination at one or more landing pads in the host cell's genome. In certain embodiments, for a library of exogenous donor nucleic acids, their upstream library sequences (UL) are identical or substantially identical, and their downstream library sequences (DL) are identical or substantially identical. To integrate an exogenous donor nucleic acid into the genome by homologous recombination, the exogenous donor polynucleotide generally comprises (UL) at one terminus and (DL) at the other terminus. In some embodiments, (UL) is homologous to a 5 region of one or more landing pads integrated in the host cell's genome, for example, an upstream landing pad homology sequence (ULP). In certain embodiments, (DL) is homologous to a 3 region of the one or more landing pads, for example, a downstream landing pad homology sequence (DLP). In some embodiments, (UL) comprises a nucleotide sequence that is about 70%, 75%, 80%, 85%, 90%, 95%, 96% 97%, 98%, 99% or 100% homologous or identical to a 5 region of one or more landing pads, for example, (ULP). In some embodiments, (DL) comprises a nucleotide sequence that is about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homologous or identical to a 3 region of one or more landing pads, for example, (DLP).
(91) In certain embodiments, (UL) is positioned 5 to a nucleic acid of interest (D). In some embodiments, (UL) is positioned immediately adjacent to the 5 end of (D). In some embodiments, (UL) is positioned upstream to the 5 of (D). In certain embodiments, (DL) is positioned 3 to a nucleic acid of interest (D). In some embodiments, (DL) is positioned immediately adjacent to the 3 end of (D). In some embodiments, (DL) is positioned downstream to the 3 of (D).
(92) Typically, properties that may affect the integration of an exogenous donor polynucleotide at a landing pad include but are not limited to: the lengths of the upstream and downstream library sequences used for genomic integration, the overall length of the exogenous donor nucleic acid construct, and the nucleotide sequence or location of the genomic integration locus of the landing pad. For instance, effective heteroduplex formation between one strand of a library sequence and one strand of a particular landing pad homology sequence in a host cell's genome may depend on the length of the upstream and downstream library sequences of exogenous donor nucleic acids in relation to the landing pad homology sequences. An effective range for the length of a library sequence used as a genomic integration sequence is generally 20 to 5,000 nucleotides, typically 25 to 5,000 nucleotides, more typically 50 to 5,000 nucleotides. For a discussion of effective lengths of homology between genomic integration sequences and genomic loci. See, Hasty et al., Mol Cell Biol 11:5586-91 (1991).
(93) In certain embodiments, (UL) and (DL) can comprise any nucleotide sequence of sufficient length and sequence identity that allows for genomic integration of the exogenous nucleic acid (ES) at any landing pads with compatible landing pad homology sequences. In certain embodiments, each of (UL) and (DL) independently consists of about 20 to 5,000 nucleotides. In certain embodiments, each of (UL) and (DL) independently consists of about 100 to 2,500 nucleotides. In certain embodiments, each of (UL) and (DL) independently consists of about 100 to 1,000 nucleotides. In certain embodiments, each of (UL) and (DL) independently consists of about 250 to 750 nucleotides. In certain embodiments, each of (UL) and (DL) independently consists of about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900 or 5,000 nucleotides. In some embodiments, each of (UL) and (DL) independently consists of about 500 nucleotides.
(94) In certain embodiments, the nucleotide sequences of (UL) in the one or more exogenous donor nucleic acids are substantially identical to one another. In certain embodiments, the nucleotide sequences of (DL) in the one or more exogenous donor nucleic acids are substantially identical to one another. For example, all (UL) in the one or more exogenous donor nucleic acids comprise nucleotide sequences that are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one another; and all (DL) in the one or more exogenous donor nucleic acids comprise nucleotide sequences that are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one another. In some embodiments, the nucleotide sequences of all (DL) in the one or more exogenous donor nucleic acids are identical to one another; and the nucleotide sequences in all (DL) in the one or more exogenous donor nucleic acids are identical to one another.
6.3.2. Nucleic Acids of Interest
(95) In some embodiments, the exogenous donor nucleic acid further comprises a nucleic acid of interest (D). The nucleic acid of interest can be any DNA segment deemed useful by one of skill in the art. For example, the DNA segment may comprise a gene of interest that can be knocked in to a host genome. In other embodiments, the DNA segment functions as a knockout construct that is capable of specifically disrupting a target gene upon integration of the construct into the target site of the host cell's genome, thereby rendering the disrupted gene non-functional. Useful examples of a nucleic acid of interest (D) include but are not limited to: a protein-coding sequence, reporter gene, fluorescent marker coding sequence, promoter, enhancer, terminator, transcriptional activator, transcriptional repressor, transcriptional activator binding site, transcriptional repressor binding site, intron, exon, poly-A tail, multiple cloning site, nuclear localization signal, mRNA stabilization signal, integration loci, epitope tag coding sequence, degradation signal, a spacer or stuffer sequence (e.g., a randomly generated sequence with no known function), a linker sequence, a degron sequence, a fusion partner sequence, any other naturally occurring or synthetic DNA molecule, or a combination or a subcombination thereof. In some embodiments, (D) can be of natural origin. Alternatively, (D) can be completely of synthetic origin, produced in vitro.
(96) Furthermore, (D) can comprise any combination of isolated naturally occurring DNA molecules, or any combination of an isolated naturally occurring DNA molecule and a synthetic DNA molecule. For example, (D) may comprise a heterologous promoter operably linked to a protein coding sequence, a protein coding sequence linked to a poly-A tail, a protein coding sequence linked in-frame with a epitope tag coding sequence, and the like. The nucleic acid of interest (D) may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA library), by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell, or by PCR amplification and cloning. See, for example, Sambrook et al., Molecular Cloning, A Laboratory Manual, 3d. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (2001); Glover, D. M. (ed.), DNA Cloning: A Practical Approach, 2d. ed., MRL Press, Ltd., Oxford, U.K. (1995).
(97) In particular embodiments, the nucleic acid of interest (D) does not comprise nucleic acid encoding a selectable marker. In these embodiments, the high efficiency of integration provided by the methods described herein allows for the screening and identification of integration events without the requirement for growth of transformed cells on selection media. However, in other embodiments where growth on selective media is nonetheless desired, the nucleic acid of interest (D) can comprise a selectable marker that may be used to select for the integration of the exogenous nucleic acid into a host genome.
(98) A wide variety of selectable markers are known in the art (see, for example, Kaufinan, Meth. Enzymol. 185:487 (1990); Kaufman, Meth. Enzymol., 185:537 (1990); Srivastava and Schlessinger, Gene, 103:53 (1991); Romanos et al., in DNA Cloning 2: Expression Systems, 2nd Edition, pages 123-167 (IRL Press 1995); Markie, Methods Mol. Biol., 54:359 (1996); Pfeifer et al., Gene, 188:183 (1997); Tucker and Burke, Gene, 199:25 (1997); Hashida-Okado et al., FEBS Letters, 425:117 (1998)). In some embodiments, the selectable marker is a drug resistant marker. A drug resistant marker enables cells to detoxify an exogenous drug that would otherwise kill the cell. Illustrative examples of drug resistant markers include but are not limited to those which confer resistance to antibiotics such as ampicillin, tetracycline, kanamycin, bleomycin, streptomycin, hygromycin, neomycin, Zeocin?, and the like. In other embodiments, the selectable marker is an auxotrophic marker. An auxotrophic marker allows cells to synthesize an essential component (usually an amino acid) while grown in media that lacks that essential component. Selectable auxotrophic gene sequences include, for example, hisD, which allows growth in histidine free media in the presence of histidinol. Other selectable markers include a bleomycin-resistance gene, a metallothionein gene, a hygromycin B-phosphotransferase gene, the AURI gene, an adenosine deaminase gene, an aminoglycoside phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a xanthine-guanine phosphoribosyltransferase gene, and the like. In other embodiments, the selectable marker is a marker other than one which rescues an auxotrophic mutation. For example, the host cell strain can comprise mutations other than auxotrophic mutations, for example, mutations that are not lethal to the host and that also do not cause adverse effects on the intended use of the strain, e.g., industrial fermentation, so long as the mutations can be identified by a known selection method.
(99) Host cell transformants comprising a chromosomally integrated polynucleotide can also be identified by selecting host cell transformants exhibiting other traits encoded by individual DNA segments (e.g., component polynucleotides) or by combinations of DNA segments, e.g., expression of peptides that emit light, or by molecular analysis of individual host cell colonies, e.g., by restriction enzyme mapping, PCR amplification, or sequence analysis of isolated assembled polynucleotides or chromosomal integration sites. In certain embodiments, a barcode sequence associated with each exogenous donor nucleic acid can be used to identify individual DNA segments or combinations of DNA segments integrated in the host cell's genome.
6.3.3. Component Polynucleotides and their Integration at Landing Pads
(100) Most large-scale host cell engineering involves the use and re-use of existing DNA parts. In certain embodiments, exogenous donor nucleic acids are DNA parts (also referred to as component polynucleotides) that can be co-transformed as modular parts to generate various combinations of assembled polynucleotides. When various combinations of assembled polynucleotides are integrated in the landing pads, they generate a greater molecular diversity in the engineered host cells, as compared to a single piece polynucleotides with homology sequences at both 5 and 3 regions for integration in the landing pads. The greater molecular diversity can result in more diverse phenotypes exhibited by the engineered host cells. Such results are demonstrated in
(101) Thus, provided herein are component polynucleotides, which can be assembled in vivo via homologous recombination to generate assembled component polynucleotides. In certain embodiments, two component polynucleotidesa first component polynucleotide and a last component polynucleotideare homologously recombined in a host cell in vivo to integrate into any of the landing pads in the host cell's genome. In this embodiment, each of one or more first component polynucleotides comprises, in a 5 to 3 orientation: an upstream library sequence (UL) capable of homologously recombining with an upstream landing pad homology sequence (ULP); a first nucleic acid of interest, and a first linker sequence. Each of one or more last component polynucleotides comprises, in a 5 to 3 orientation: a last linker sequence, a last nucleic acid of interest, and a downstream library sequence (DL) capable of homologously recombining with the downstream landing pad homology sequence (DLP). Each first linker sequence at the 3 end of the one or more first component polynucleotides is capable of homologously recombining with each last linker sequence at the 5 end of the one or more last component polynucleotides to generate various combinations of component polynucleotides. Upon induction of a double-stranded break within the landing pad by a site-specific nuclease, endogenous homologous recombination machinery integrates the assembled component polynucleotides at the cleaved site in the landing pad with high integration efficiencies. An example of two component polynucleotides is illustrated shown in the middle of
(102) In certain embodiments, three or more different types of component polynucleotides (e.g., a first component polynucleotide, an intermediate component polynucleotide, and a last component polynucleotide) are co-transformed into a host cell. In this embodiment, each of one or more first component polynucleotides comprises, in a 5 to 3 orientation, an upstream library sequence (UL) capable of homologously recombining with the upstream landing pad homology sequence (ULP), any DNA segment selected from the group D.sub.0, a linker sequence LB.sub.0. Each of one or more intermediate component polynucleotides comprises, in a 5 to 3 orientation, a first linker sequence LAS, any DNA segment selected from the group D.sub.n, a second linker sequence LB.sub.n. In this embodiment, n represents an integer from one to the number of intermediate component polynucleotides. Each of one or more last component polynucleotides comprises, in a 5 to 3 orientation, a linker sequence LA.sub.m, any DNA segment selected from the group D.sub.m, and a downstream library sequence (DL) capable of homologously recombining with the downstream landing pad homology sequence (DLP). In this embodiment, each linker sequence LB.sub.(p-1) is capable of homologously recombining with the linker sequence LA.sub.p, wherein n is an integer that varies from 1 to (m?1), wherein p represents an integer from 1 to m, and wherein each group D.sub.0, . . . D.sub.n, . . . D.sub.m, independently consists of one or more DNA segments.
(103) In certain embodiments, a DNA segment (in Group D.sub.0, group D.sub.n, or group D.sub.m) can be any nucleic acids of interest. For example, any nucleic acids of interest described in Section 5.2.2 can be incorporated as a DNA segment in component polynucleotides.
(104) In certain embodiments, three component polynucleotides can be assembled and integrated into the landing pad. An example of three component polynucleotides (a first component polynucleotide, an intermediate component polynucleotide, and a last component polynucleotide) is illustrated at the bottom of
(105) In certain embodiments, linker sequences that homologously recombine component polynucleotides to one another in vivo can be of any nucleotide sequence of sufficient length and sequence identity that allows for homologous recombination to its counterpart linker sequence. In certain embodiments, each linker sequence consists of about 20 to 5,000 nucleotides. In certain embodiments, each linker sequence consists of about 24 to 2,500 nucleotides. In certain embodiments, each linker sequence consists of about 24 to about 1,000 nucleotides. In certain embodiments, each linker sequence consists of about 24 to about 500 nucleotides. In certain embodiments, each linker sequence consists of about 24 to about 100 nucleotides. In certain embodiments, shorter linker sequences (e.g., about 24 to about 36 nucleotides) are used when they are used to assemble two component polynucleotides with DNA segments that need to be in close proximity (e.g., a promoter and an open reading frame). For example, linker sequence A shown in
(106) In certain embodiments, the two linker sequences that homologously recombine component polynucleotides in vivo can comprise nucleotide sequences that are about 70%, 75%, 80%, 85%, 90%, 95%, 96% 97%, 98%, 99% or 100% homologous or identical to one another. For example, if a first component polynucleotide and a last component polynucleotide are assembled in vivo and integrate into a landing pad, a first linker sequence at the 3 end of the first component polynucleotide and a last linker sequence at the 5 end of the last component polynucleotide comprise nucleotide sequences that are about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homologous or identical to each other. When one or more intermediate component polynucleotides are co-introduced with one or more first component polynucleotides and one or more last component polynucleotides, linker sequence LB.sub.(p-1) and linker LA.sub.p comprise nucleotide sequences that are about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homologous or identical to each other.
(107) Suitable component polynucleotides and other features related to component polynucleotides are further described in detail in U.S. Pat. No. 8,110,360, which is incorporated herein by reference in its entirety.
6.3.4. Additional Functional Elements: Barcode Sequences and Additional Nuclease Target Sequences
(108) Exogenous donor nucleic acids provided herein can comprise additional functional elements. In certain embodiments, the additional functional elements can include a nuclease target sequence which is different from those present in the exogenous landing pad(s) in the host cell's genome. For example, as shown in
(109) In certain embodiments, a unique barcode of a known sequence is associated with each exogenous donor nucleic acid. The barcode sequence can be used to further facilitate identification of exogenous donor nucleic acids that are integrated within the landing pads in the host cell's genome. Generally, barcode sequences are of a sufficient length and sufficiently different from one another to allow identification of exogenous donor nucleic acids or component polynucleotides integrated in the landing pads in the host cell's genome. In certain embodiment, each barcode sequence may include at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more nucleotides in length. In an embodiment, a barcode sequence can include 7 nucleotides in length.
(110) A barcode sequence can be incorporated at any suitable location in each exogenous donor nucleic acid or in a component polynucleotide. Exemplary locations of a barcode sequence in component polynucleotides are shown as a series of horizontal bar lines (also noted as NNNNNNN 7 nt barcode) in
6.4 Methods of Genomic Integration of Exogenous Donor Nucleic Acids
(111) Provided herein are methods for genomic integration of one or more exogenous donor nucleic acids into one or more landing pads engineered in the host cell's genome. As described above, in certain embodiments, each landing pad integrated into the host cell's genome comprises standardized homology sequences to facilitate host cell-mediated homologous recombination of exogenous donor nucleic acids. In such embodiments, the standardized landing pad homology sequences allow any exogenous donor nucleic acids to be integrated at any landing pads in the host cell's genome, as long as exogenous donor nucleic acids themselves comprise homology sequences compatible with the landing pad homology sequences. Therefore, in certain embodiments, an integration event of exogenous donor nucleic acids is independent of the genomic locus surrounding the landing pads and does not rely on homology with endogenous genomic sequences for recombination. In particular embodiments, the methods comprise contacting the host cell with one or more exogenous donor nucleic acids and one or more nucleases capable of cleaving the nuclease target sequence located in the landing pad. Cleavage within the landing pad greatly increases the frequency of homologous recombination at or near the cleavage site.
6.4.1. Integration of Exogenous Donor Nucleic Acids at Landing Pads
(112)
(113) In the embodiment illustrated in
(114) In some embodiments, markerless recovery of a transformed cell comprising a successfully integrated exogenous nucleic acid occurs within a frequency of about one every 1000, 900, 800, 700, 600, 500, 400, 300, 200 or 100 contacted host cells, or clonal populations thereof, screened. In particular embodiments, markerless recovery of a transformed cell comprising a successfully integrated exogenous nucleic acid occurs within a frequency of about one every 90, 80, 70, 60, 50, 40, 30, 20, or 10 contacted host cells, or clonal populations thereof, screened. In more particular embodiments, markerless recovery of a transformed cell comprising a successfully integrated exogenous nucleic acid occurs within a frequency of about one every 9, 8, 7, 6, 5, 4, 3, or 2 contacted host cells, or clonal populations thereof, screened. In certain embodiments, the success rate of integration of exogenous donor nucleic acids into all landing pads (e.g., 3 landing pads) engineered into the host cell's genome is greater than 90%. In certain embodiments, the success rate of integration of exogenous donor nucleic acids into all landing pads (e.g., 3 landing pads) engineered into the host cell's genome is greater than 95%. In more particular embodiments, the host cell is a yeast cell, and the increased frequency of integration derives from yeast's increased capacity for homologous recombination relative to other host cell types.
(115) A variety of methods are available to identify those cells having exogenous donor nucleic acids integrated in the landing pads without the use of a selectable marker. In some embodiments, such methods seek to detect any change in the landing pads, and include but are not limited to PCR methods, sequencing methods, nuclease digestion, e.g., restriction mapping, Southern blots, and any combination thereof. In certain embodiments, barcode sequences associated with exogenous donor nucleic acids can be used to determine identities of exogenous donor nucleic acids integrated at the landing pads. Because the success rate of genomic integration of exogenous donor nucleic acids (or component polynucleotides) in the landing pad is high, the transformed host cells' phenotypes can be used to identify those cells having exogenous donor nucleic acids of interest without genotyping the host cells.
(116) In a particular embodiment, provided herein is a method for simultaneous genomic integration of exogenous nucleic acids in a plurality of exogenous landing pads the host cell's genome. The method comprises:
(117) (a) contacting a host cell, the host cell comprising a plurality of (x) exogenous landing pads integrated in the host cell's genome, wherein each exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP), with: (i) one or more exogenous donor nucleic acids (ES), wherein each (ES) comprises a nucleic acid of interest (D) positioned between an upstream library sequence (UL) and a downstream library sequence (DL), wherein each (UL) is capable of homologously recombining at any (ULP), and each (DL) is capable of homologously recombining at any (DLP), of any of the (x) exogenous landing pads; and (ii) one or more nuclease (N) capable of binding to (NTS) of any of the plurality of (x) exogenous landing pads and cleaving a site within the (x) exogenous landing pads; and
(b) recovering a host cell generated from the contacted host cell, wherein any of the exogenous donor nucleic acids (ES) is integrated at any of the plurality of (x) exogenous landing pads, independent of genomic sequences surrounding each landing pad. In certain embodiment, x is an integer of at least two. In certain embodiments, x is an integer of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
(118)
(119)
(120) In some embodiments, two or more different types of exogenous donor nucleic acids shown in
(121) In some embodiments, the exogenous donor nucleic acid may be introduced in combination with another exogenous donor nucleic acid comprising a stuffer or spacer sequence (e.g., randomly generated, non-functional sequence). See, e.g.,
(122) In the embodiment illustrated in
(123) In certain embodiments, the number of different types of exogenous nucleic acids (ES) contacting a host cell is not limited by the number (x) of landing pads present in the host cell's genome. In one embodiment, the number of different types of exogenous donor nucleic acids introduced into the host cell can exceed the number (x) of landing pads present in the host cell's genome. In other embodiments, the number of different types of exogenous donor nucleic acids introduced into the host can be less than the number (x) of landing pads present in the host cell's genome.
(124) As with integration of a single exogenous nucleic acid at a single landing pad illustrated in
6.4.1.1 Integration of Component Polynucleotides at Landing Pads
(125) In another aspect, provided herein is a method for integrating exogenous donor nucleic acids which are component polynucleotides. The component polynucleotides, when introduced into the host cell, homologously recombine with one another to generate one or more assembled component polynucleotides. These assembled component polynucleotides comprise homology regions at their 5 and 3 ends, which allow them to homologously recombine and integrate at any of the landing pads in the host cell's genome. In certain embodiments, each component polynucleotide comprises at least one linker sequence, which allows each component polynucleotide to homologously recombine with another component polynucleotide in vivo using the linker sequences. In certain embodiments, the component polynucleotides are co-introduced into a host cell in a single transformation reaction.
(126) Thus, in one aspect, provided herein is a method of genomically integrating component polynucleotides in one or more landing pad in the host cell's genome. In one embodiment, the method comprises:
(127) (a) contacting a host cell, comprising one or more (x) exogenous landing pads integrated in the host cell's genome, wherein each exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP), with: (i) one or more first component polynucleotides, wherein each first component polynucleotide comprises, in a 5 to 3 orientation: (1) an upstream library sequence (UL) capable of homologously recombining with the upstream landing pad homology sequence (ULP); (2) a first nucleic acid of interest, and (3) a first linker sequence; (ii) one or more last component polynucleotides, wherein each last component polynucleotide comprises, in a 5 to 3 orientation: (1) a last linker sequence, (2) a last nucleic acid of interest, and (3) a downstream library sequence (DL) capable of homologously recombining with the downstream landing pad homology sequence (DLP), wherein any first linker sequence of the one or more first component polynucleotides is capable of homologously recombining with any last linker sequence of the one or more last component polynucleotides; and (iii) a nuclease (N) capable of cleaving any (NTS) in any of the one or more (x) exogenous landing pads; and
(b) recovering a host cell generated from the contacted host cell, wherein any combination of a first component polynucleotide from the one or more first component polynucleotides and a last component polynucleotide from the one or more last component polynucleotides, which are homologously recombined in vivo via their linker sequences, is integrated at any of the one or more (x) exogenous landing pads, independent of genomic sequences surrounding each landing pad. In some embodiments, x is an integer of at least one.
(128) In this embodiment, a component polynucleotide is referred to as a first component polynucleotide if it comprises a homology region at its 5 end to homologously recombine and integrate into an upstream landing pad homology sequence (ULP) in one or more landing pads. Similarly, a component polynucleotide is referred to as a last component polynucleotide if it comprises a homology region at its 3 end to homologously recombine with a downstream landing pad homology sequence (DLP) in one or more landing pads.
(129) In certain embodiments, the number (x) of landing pads present in the host cell's genome is at least two, and any combinations of first and last component polynucleotides are integrated at any of the (x) number of landing pads. In certain embodiments, the number (x) of landing pads present in the host cell's genome is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In certain embodiments, any combinations of first and last component polynucleotides are integrated at any of these multiple (x) landing pads.
(130)
(131) While component polynucleotides shown in
(132)
(133) While
(134) Thus, in one aspect, provided herein is a method of genomically integrating three or more component polynucleotides, which are assembled in vivo, to integrate into any of one or more landing pads engineered into the host cell's genome. In one embodiment, the method comprises:
(135) (a) contacting a host cell, comprising one or more (x) exogenous landing pads integrated in a host cell's genome, wherein each of the one or more exogenous landing pads comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP), with: (i) one or more first component polynucleotides, wherein each first component polynucleotide comprises, in a 5 to 3 orientation, an upstream library sequence (UL) capable of homologously recombining with the upstream landing pad homology sequence (ULP), any DNA segment selected from the group D.sub.0, a linker sequence LB.sub.0; (ii) one or more intermediate component polynucleotides, wherein each intermediate component polynucleotide comprises, in a 5 to 3 orientation, a first linker sequence LA.sub.n, any DNA segment selected from the group D.sub.n, a second linker sequence LB.sub.n, wherein n represents an integer from one to the number of intermediate component polynucleotides; (iii) one or more last component polynucleotides, wherein each last component polynucleotide comprises, in a 5 to 3 orientation, a linker sequence LA.sub.m, any DNA segment selected from the group D.sub.n, and a downstream library sequence (DL) capable of homologously recombining with the downstream landing pad homology sequence (DLP), wherein each linker sequence LB.sub.(p-1) is capable of homologously recombining with the linker sequence LA.sub.p, wherein n is an integer that varies from 1 to (m?1), wherein p represents an integer from 1 to m, and wherein each group D.sub.0, . . . D.sub.n, . . . D.sub.m, independently consists of one or more DNA segments; and
(b) recovering a host cell generated from the contacted host cell, wherein any combination of a first component polynucleotide from the one or more first component polynucleotides, an intermediate component polynucleotide from the one or more intermediate component polynucleotides, and a last component polynucleotide from the one or more last component polynucleotides, which are homologously recombined in vivo via their linker sequences, is integrated at any of the one or more (x) exogenous landing pads, independent of genomic sequences surrounding each landing pad. In some embodiments, x is an integer of at least one. In some embodiments, x is an integer of two. In some embodiments, x is an integer of three. In some embodiments, x is an integer of 4, 5, 6, 7, 8, 9, or 10.
(136) In certain embodiments, the number (x) of landing pads present in the host cell's genome is at least two, and any combinations of first, intermediate, and last component polynucleotides are integrated at any of the landing pads. In certain embodiments, the number (x) of landing pads present in the host cell's genome is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In certain embodiments, any combinations of first, intermediate, and last component polynucleotides are integrated at any of these multiple landing pads.
(137) Additional details of compositions and methods related to component polynucleotides can be found in U.S. Pat. No. 8,110,360, which is herein incorporated by reference in its entirety.
6.4.2. Tracking Genotype/Phenotype Relationships of Exogenous Donor Nucleic Acids
(138) The compositions and methods provided herein provide a rapid and efficient way to generate hundreds and thousands of combinatorial integrations of exogenous donor nucleic acids. The diverse combinatorial integration of exogenous donor nucleic acids can generate engineered host cells with certain observable traits or phenotypes (e.g., cellular function, target molecule production, and the like). Such different phenotypes generated by the diverse combinatorial integrations can be tracked and mapped with genotype contributions by various combinations of exogenous donor nucleic acids.
(139) Thus, provided herein is a method of screening phenotype contributions by exogenous donor nucleic acids. In one embodiment, the method comprises:
(140) (a) contacting a host cell with a plurality of exogenous nucleic acids (ES), each (ES) tagged with a barcode sequence, wherein the host cell's genome is configured to integrate any one or combinations of the plurality of (ES) in the host cell's genome via host cell-mediated homologous recombination;
(b) screening host cells, generated from the contacted host cell, which exhibit a specific phenotype; and
(c) determining, using the barcode sequence associated with each (ES), identities of (ES) integrated into the host cell's genome.
(141) In certain embodiments, the host cells' genome is configured to integrate any one or combinations of the plurality of (ES) in the host cell's genome by providing a plurality of (x) exogenous landing pads integrated in the host cell's genome. In certain embodiments, each exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP) in each landing pad. In certain embodiments, the host cell is simultaneously contacted with a nuclease or a plasmid encoding a nuclease with the plurality of (ES).
(142) In certain embodiments, at least two of the plurality of exogenous donor nucleic acids (ES) are component polynucleotides which are co-transformed into the host cell and assembled in vivo via homologous recombination to integrate at the landing pads. In such embodiment, each component polynucleotide can be associated with its unique barcode sequence which distinguishes each component polynucleotide from other component polynucleotides. In certain embodiments, one or more first component polynucleotides and one or more last component polynucleotides are contacted with the host cell to generate a plurality of assembled component polynucleotides integrated at the landing pads in the host cell's genome. In certain embodiments, one or more first component polynucleotides, one or more intermediate component polynucleotides, and one or more last component polynucleotides are contacted with the host cell to generate a plurality of assembled component polynucleotides integrated at the landing pads in the host cell's genome.
(143)
(144) The transformed cells can be grown in any suitable media. For example, as shown in
(145) While
6.4.3. Genomic Integration with Addressable or Optional Landing Pads
(146) In another aspect, provided herein are methods of genomic integration of exogenous donor nucleic acids in the host cell's genome comprising optional or addressable landing pads in addition or in alternative to primary, standardized landing pads shown in
(147)
(148)
(149) The addressable landing pads at locus1 and locus2 are also optional landing pads, because they comprise target nuclease sequences that are not cleaved when an X-cutter is introduced to cleave primary landing pads, but are optionally opened or cleaved by separate nucleases. The optional landing pad at locus.sub.1 comprises a target nuclease sequence G, which is recognized by a G-cutter. The optional landing pad at locus.sub.2 comprises a target nuclease sequence H, which is recognized and/or cleavable by a H-cutter. These optional landing pads can be cleaved by its own nuclease (e.g., G-cutter and H-cutter) simultaneously with or sequentially after cleavage of primary landing pads.
(150)
(151) There are many other variations for optional and/or addressable landing pads. For example, a host cell can comprise an additional set of landing pads which comprise different homology sequences for both upstream landing pad homology sequence and downstream landing pad homology sequence, compared to the primary set of standardized landing pads. In certain embodiments, a landing pad can comprise an upstream landing pad homology sequence which is exogenous to the genomic sequence (e.g., a randomly generated nucleotide sequence) and a downstream landing pad homology sequence which is endogenous to the genomic locus (e.g., an open reading frame of the genomic locus). In certain embodiments, a landing pad can comprise an upstream landing pad homology sequence which endogenous to the genomic locus (e.g., an open reading frame of the genomic locus) and a downstream landing pad homology sequence which is exogenous to the genomic locus.
6.4.4. Targeted Landing Pad and Integration of Exogenous Donor Nucleic Acids into the Targeted Landing Pad
(152) The compositions and methods provided herein can be applied in targeted integration of exogenous donor nucleic acids into specific genomic sites and screening their effects on the phenotype of genetically modified host cells. In certain embodiments, the targeted integration of exogenous donor nucleic acids at specific genomic sites can be achieved by integrating a landing pad at those genomic sites prior to introduction of exogenous donor nucleic acids into a host cell. Once integrated at the specific genomic sites adjacent to a genetic element of interest (e.g., an open reading frame), these landing pads allow exogenous donor nucleic acids to be integrated at specific genomic sites. Such an exogenous landing pad built at a specific genomic site is referred to as targeted landing pads because it allows exogenous donor nucleic acids to be targeted and integrated at the landing pads at specific genomic sites. Thus, in certain embodiments, exogenous donor nucleic acids comprising nucleic acids of interest (e.g., promoters, terminators, or degron sequences) can be integrated at the targeted landing pads to screen their effects on the transcription of the open reading frame and/or its protein expression or stability.
(153) In certain embodiments, the targeted landing pads comprise homology sequences that are compatible with homology sequences of exogenous donor nucleic acids in the existing library of parts (e.g., (UL), (DL), (A) shown in
(154) Thus, in one aspect, provided herein is a method for targeted integration of nucleic acids into a host cell's genome, the method comprising: (a) contacting a host cell, the host cell comprising an exogenous landing pad integrated 5 to an open reading frame, wherein the exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad linker sequence (DLPL), with (i) one or more first component polynucleotides, each first component polynucleotide comprises, in a 5 to 3 orientation: (1) an upstream library sequence (UL) capable of homologously recombining with the (ULP); (2) a first nucleic acid of interest; and (3) a first linker sequence; (ii) a nuclease (N) capable of binding to the (NTS) and cleaving a site within the exogenous landing pad, (b) recovering a host cell generated from the contacted host cell, wherein the (DLPL) is capable of homologously recombining with the first linker sequence of any of the one or more first component polynucleotides to integrate a first component polynucleotide from the one or more first component polynucleotides at the exogenous landing pad.
(155) In certain embodiments, an open reading frame is that of an endogenous gene at its native locus. In other embodiments, an open reading frame is that of an exogenous gene which is integrated into a non-native locus prior to introduction of a targeted landing pad at the specific genomic site at which the open reading frame is located.
(156) In certain embodiments, the method further comprises: (a) screening phenotypes of the recovered host cells to select host cells with a particular phenotype; and (b) determining the identity of a first component polynucleotide integrated in the exogenous landing pad in the host cell. In certain embodiments, each component polynucleotide comprises a unique barcode sequence, and the barcode sequence can be used to identify the first component polynucleotide integrated in the targeted landing pad. In certain embodiments, the targeted landing pad is present in the host cell's genome together with one or more standardized landing pads described in Section 5.2 above.
(157) In certain embodiments, the method can be applied in titrating (e.g., downregulating or upregulating) an endogenous gene of interest with a library of first component polynucleotides comprising regulatory sequences (e.g., promoters).
(158) Referring to
(159) The promoter swap landing pad can be integrated at the desired genomic site using any suitable method. For example, as shown in
(160) Referring to
(161) In
(162) The method of titrating an endogenous gene expression (e.g., an open reading frame at its native locus) shown in
(163) In another aspect, a targeted landing pad can be engineered and positioned 3 to an open reading frame at a specific genomic site. Thus, also provided herein is a method for targeted integration of nucleic acids into a host cell's genome, the method comprising: (a) contacting a host cell, the host cell comprising an exogenous landing pad integrated 3 to an open reading frame, wherein the exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad linker sequence (ULPL) and a downstream landing pad homology sequence (DLP), with: (i) one or more last component polynucleotides, each last component polynucleotide comprises, in a 5 to 3 orientation: (1) a last linker sequence; (2) a last nucleic acid of interest; and (3) a downstream library sequence (DL) capable of homologously recombining with the (DLP); (ii) a nuclease (N) capable of binding to (NTS) and cleaving a site within the exogenous landing pad, (c) recovering a host cell generated from the contacted host cell, wherein the (ULPL) is capable of homologously recombining with the last linker sequence of any of the one or more last component polynucleotides to integrate a last component polynucleotide from the one or more last component polynucleotides at the exogenous landing pad.
(164) An exemplary embodiment of utilizing a targeted landing pad positioned 3 of an open reading frame is illustrated in
(165) In certain embodiments, the terminator swap landing pad can be used to integrate a degron library as shown in
(166) In other embodiments, the terminator swap landing pad comprises a stop codon at the 3 end of the open reading frame. Such a terminator swap landing pad is useful in integrating a terminator library of last component polynucleotides. The terminator plays an important role in RNA processing and contributes to variability in RNA half-life, and ultimately gene-expression. In
(167) In another aspect, provided herein is a method of combining a targeted integration of an exogenous donor nucleic acid into a targeted landing pad and a genomic locus independent integration of an exogenous donor nucleic acid into another landing pad. For example, a host cell comprises a targeted landing pad as described in relation to
(168) In certain embodiments, the targeted integration of exogenous donor nucleic acids into a targeted landing pad can be combined with random integration of exogenous donor nucleic acids into standardized landing pads (e.g., shown in
(169) In the embodiment illustrated in
(170) The native ERG 9 encodes a squalene synthase which catalyzes the first step of sterol biosynthesis in various organisms. The production of sterol is important in various cellular functions including cellular biomass production. However, the cellular biomass production needs to be balanced against the target molecule production in industrial microbes during fermentation. In the exemplary embodiment shown in
(171) To achieve an optimal balance for expression of ERG9 and farnesene synthase, the expression of two genes can be titrated simultaneously in a host cell using different sets of promoter libraries as shown in
(172) In another aspect, provided herein is a method of utilizing standardized landing pads in the host cell's genome for targeted integration of exogenous donor nucleic acids. In some instances, instead of creating a targeted landing pad, the targeted integration of specific genes can be achieved using endogenous genomic sequences adjacent to landing pad homology sequences. Thus, provided here is a method of targeted integration of exogenous donor nucleic acids into the host cell's genome comprises: (a) contacting a host cell, the host cell comprising one or more (x) exogenous landing pads integrated in the host cell's genome, wherein each exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP), wherein each landing pad is nested within an upper endogenous genomic sequence (UEG).sub.x and a downstream endogenous genomic sequence (DEG).sub.x, with: (i) a nuclease capable of cleaving (NTS) in the one or more (x) exogenous landing pads; and (ii) one or more first component polynucleotides, wherein each first component polynucleotide comprises, in a 5 to 3 orientation: (1) an upstream library sequence (UL) capable of homologously recombining with any (ULP) of any of the one or more exogenous landing pads; (2) a first nucleic acid of interest; (3) a first linker sequence; and (iii) one or more last component polynucleotides, wherein each last component polynucleotide comprises, in a 5 to 3 orientation: (1) a last linker sequence; (2) a last nucleic acid of interest; and (3) a downstream library sequence (DL) capable of homologously recombining with (DEG).sub.x of the one or more (x) exogenous landing pads, (b) recovering a host cell generated from the contacted cell, wherein any combination of a first component polynucleotide from the one or more first component polynucleotides and a last component polynucleotide from the one or more last component polynucleotides, which are homologously recombined in vivo via their linker sequences, is integrated at an exogenous landing pad with (DEG).sub.x, and x is an integer of at least one.
(173) An exemplary embodiment is illustrated in
(174) In another aspect, the method of targeted integration of exogenous donor nucleic acids into the host cell's genome utilizes an upstream endogenous genomic sequence (UEG) for homologous recombination of a library of first component polynucleotides which comprise (UEG) as upstream library sequences for homologous recombination. The method comprises: (a) contacting a host cell, the host cell comprising one or more (x) exogenous landing pads integrated in the host cell's genome, wherein each exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP), wherein each landing pad is nested within an upper endogenous genomic sequence (UEG).sub.x and a downstream endogenous genomic sequence (DEG).sub.x, with: (i) a nuclease capable of cleaving (NTS) in the one or more (x) exogenous landing pads; and (ii) one or more first component polynucleotides, wherein each first component polynucleotide comprises, in a 5 to 3 orientation: (1) an upstream library sequence (UL) capable of homologously recombining with (UEG).sub.x of the one or more (x) exogenous landing pads; (2) a first nucleic acid of interest; (3) a first linker sequence; and (iii) one or more last component polynucleotides, wherein each last component polynucleotide comprises, in a 5 to 3 orientation: (1) a last linker sequence; (2) a last nucleic acid of interest; and (3) a downstream library sequence (DL) capable of homologously recombining with any DLP of any of the one or more (x) exogenous landing pads, (b) recovering a host cell generated from the contacted host cell, wherein any combination of a first component polynucleotide from the one or more first component polynucleotides and a last component polynucleotide from the one or more last component polynucleotides, which are homologously recombined in vivo via their linker sequences, is integrated at an exogenous landing pad with (UEG).sub.x, and x is an integer of at least one.
6.5 Methods for Metabolic Pathway Engineering
(175) The methods and compositions described herein provide particular advantages for constructing recombinant organisms comprising optimized biosynthetic pathways, for example, towards the conversion of biomass into biofuels, pharmaceuticals or biomaterials. Functional non-native biological pathways have been successfully constructed in microbial hosts for the production of precursors to the antimalarial drug artemisinin (see, e.g., Martin et al., Nat Biotechnol 21:796-802 (2003); fatty acid derives fuels and chemicals (e.g., fatty esters, fatty alcohols and waxes; see, e.g., Steen et al., Nature 463:559-562 (2010); methyl halide-derived fuels and chemicals (see, e.g., Bayer et al., J Am Chem Soc 131:6508-6515 (2009); polyketide synthases that make cholesterol lowering drugs (see, e.g., Ma et al., Science 326:589-592 (2009); and polyketides (see, e.g., Kodumal, Proc Natl Acad Sci USA 101:15573-15578 (2004).
(176) Traditionally, metabolic engineering, and in particular, the construction of biosynthetic pathways or optimizing the metabolic flux through the biosynthetic pathways, has proceeded in a one-at-a-time serial fashion whereby pathway components have been introduced, i.e., integrated into the host cell's genome at a single loci at a time. The methods of integration provided herein can be utilized to reduce the time typically required to engineer a host cell, for example, a microbial cell, to comprise one or more heterologous nucleotide sequences encoding enzymes of a new metabolic pathway, i.e., a metabolic pathway that produces a metabolite that is not endogenously produced by the host cell. In other particular embodiments, the methods of integration provided herein can be used to efficiently engineer a host cell to comprise one or more heterologous nucleotide sequences encoding enzymes of a metabolic pathway that is endogenous to the host cell, i.e., a metabolic pathway that produces a metabolite that is endogenously produced by the host cell. In other particular embodiments, the methods of integration provided herein can be used to optimize metabolic flux through and achieve high product titers by balancing expression of two or more heterologous nucleotide sequences encoding enzymes of a metabolic pathway that produces a product. For example, as described above in relation to
6.5.1. Isoprenoid Pathway Engineering
(177) In some embodiments, the methods provided herein can be utilized to simultaneously introduce, replace, or titrate one or more components of a biosynthetic pathway to modify the product profile of an engineered host cell. In some embodiments, the biosynthetic pathway is the isoprenoid pathway.
(178) Terpenes are a large class of hydrocarbons that are produced in many organisms. When terpenes are chemically modified (e.g., via oxidation or rearrangement of the carbon skeleton) the resulting compounds are generally referred to as terpenoids, which are also known as isoprenoids. Isoprenoids play many important biological roles, for example, as quinones in electron transport chains, as components of membranes, in subcellular targeting and regulation via protein prenylation, as photosynthetic pigments including carotenoids, chlorophyll, as hormones and cofactors, and as plant defense compounds with various monoterpenes, sesquiterpenes, and diterpenes. They are industrially useful as antibiotics, hormones, anticancer drugs, insecticides, and chemicals.
(179) Terpenes are derived by linking units of isoprene (C.sub.5H.sub.8), and are classified by the number of isoprene units present. Hemiterpenes consist of a single isoprene unit. Isoprene itself is considered the only hemiterpene. Monoterpenes are made of two isoprene units, and have the molecular formula C.sub.10H.sub.16. Examples of monoterpenes are geraniol, limonene, and terpineol. Sesquiterpenes are composed of three isoprene units, and have the molecular formula C.sub.15H.sub.24. Examples of sesquiterpenes are farnesenes and farnesol. Diterpenes are made of four isoprene units, and have the molecular formula C.sub.20H.sub.32. Examples of diterpenes are cafestol, kahweol, cembrene, and taxadiene. Sesterterpenes are made of five isoprene units, and have the molecular formula C.sub.25H.sub.40. An example of a sesterterpenes is geranylfarnesol. Triterpenes consist of six isoprene units, and have the molecular formula C.sub.30H.sub.48. Tetraterpenes contain eight isoprene units, and have the molecular formula C.sub.40H.sub.64. Biologically important tetraterpenes include the acyclic lycopene, the monocyclic gamma-carotene, and the bicyclic alpha- and beta-carotenes. Polyterpenes consist of long chains of many isoprene units. Natural rubber consists of polyisoprene in which the double bonds are cis.
(180) Terpenes are biosynthesized through condensations of isopentenyl pyrophosphate (isopentenyl diphosphate or IPP) and its isomer dimethylallyl pyrophosphate (dimethylallyl diphosphate or DMAPP). Two pathways are known to generate IPP and DMAPP, namely the mevalonate-dependent (MEV) pathway of eukaryotes (
(181) Terpene synthases are organized into large gene families that form multiple products. Examples of terpene synthases include monoterpene synthases, which convert GPP into monoterpenes; diterpene synthases, which convert GGPP into diterpenes; and sesquiterpene synthases, which convert FPP into sesquiterpenes. An example of a sesquiterpene synthase is farnesene synthase, which converts FPP to farnesene. Terpene synthases are important in the regulation of pathway flux to an isoprenoid because they operate at metabolic branch points and dictate the type of isoprenoid produced by the cell. Moreover, the terpene synthases hold the key to high yield production of such terpenes. As such, one strategy to improve pathway flux in hosts engineered for heterologous isoprenoid production is to introduce multiple copies of nucleic acids encoding terpene synthases. For example, in engineered microbes comprising the MEV pathway where the production of sesquiterpenes such as farnesene is desired, a sesquiterpene synthase, e.g., a farnesene synthase is utilized as the terminal enzyme of the pathway, and multiple copies of farnesene synthase genes may be introduced into the host cell towards the generation of a strain optimized for farnesene production.
(182) Because the biosynthesis of any isoprenoid relies on the same pathway components upstream of the prenyl disphosphate synthase and terpene synthase, these pathway components, once engineered into a host platform strain, can be utilized towards the production of any sesquiterpene, and the identity of the sesquiterpene can be dictated by the particular sesquiterpene synthase introduced into the host cell. Moreover, where production of terpenes having different isoprene units is desired, for example a monoterpene instead of a sesquiterpene, both the prenyl diphosphate synthase and the terpene synthase can be replaced to produce the different terpene while still utilizing the upstream components of the pathway.
(183) Accordingly, the methods and compositions provided herein can be utilized to efficiently modify a host cell comprising an isoprenoid producing pathway, e.g., the MEV pathway to produce a desired isoprenoid and/or an enhanced level of isoprenoid production. In some embodiments, the host cell comprises the MEV pathway, and the methods of simultaneous multiple integration provided herein can be utilized to simultaneously introduce multiple copies of a prenyl diphosphate synthase and/or a terpene synthase to define the terpene product profile of the host cell. In some embodiments, the prenyl diphosphate synthase is GPP synthase and the terpene synthase is a monoterpene synthase. In some embodiments, the prenyl diphosphate synthase is FPP synthase and the terpene synthase is a sesquiterpene synthase. In some embodiments, the prenyl diphosphate synthase is GGPP synthase and the terpene synthase is a diterpene synthase. In other embodiments, the host cell comprises the MEV pathway and a prenyl diphosphate synthase and/or a terpene synthase for the production of a first type of terpene, for example, farnesene, and the methods of simultaneous multiple integration provided herein can be utilized to simultaneously replace one or more copies of the prenyl diphosphate synthase and/or a terpene synthase to produce a second type of terpene, for example, amorphadiene. The methods provided herein can be similarly utilized towards the construction and/or modification of any biosynthetic pathway which utilizes multiple copies of pathway components, and are particularly useful for engineering host cells whose product profile can be readily modified with the addition or exchange of multiple copies of a single pathway component.
6.5.2. Methods of Generating Combinatorial Integration Libraries for Biosynthetic Pathways
(184) Once biosynthetic pathways are constructed, the expression levels of all the components need to be orchestrated to optimize metabolic flux and achieve high product titers. Common approaches for optimizing flux include varying the identity of the pathway component gene, the codon optimization of the gene, the use of solubility tags, the use of truncations or known mutations, and the expression context of the gene (i.e. promoter and terminator choice). To sample this variability in the course of building a strain using traditional methods requires generating and archiving an impractically large number of strains. For example, if a strain engineer plans to integrate constructs at three loci, and has devised 10 variants for each locus, 1,000 strains would need to be generated to fully sample the combinatorial diversity. Since pathway genes work in concert, and not all metabolite intermediates can easily be screened for, it is often impossible to evaluate the individual contribution of the pathway genes after each integration cycle. Thus, strain engineers routinely make choices that severely limit the design space that they sample when constructing a novel metabolic pathway.
(185) To better identify the optimal pathway design, the methods of genomic modification provided herein can be utilized to generate strains comprising combinatorial libraries of exogenous donor nucleic acids. In some embodiments, the methods rely on contacting the host cell's genome with one or more nucleases and one or more donor DNA assemblies (e.g., component polynucleotides) to facilitate multiple simultaneous integration of donor DNA at standardized landing pads in the genome. To generate a diversity of engineered strains, the methods comprise co-transforming a library of donor DNAs, i.e., a mixture of integration constructs for one or more standardized landing pads and/or targeted landing pads, such that combinatorial integration libraries of host strains can be generated. The high frequency of multiple integrations achieved means that the resultant strains can reasonably be screened directly for product without extensive genomic quality control, and the identity of top strains can be determined after screening, for example, by sequencing. This method removes the burden of individual strain generation, quality control and archiving, and allows the engineer to generate diverse integration combinations in a single tube, and sort out the best performing strains by screening, e.g., for the terminal product of the pathway.
(186) Thus, in some embodiments, the methods for integrating a plurality of exogenous nucleic acids into a host cell's genome provided herein comprise contacting a host cell comprising one or more landing pads described herein with a plurality of libraries, wherein each library (L) comprises a plurality of exogenous nucleic acids, wherein a selected exogenous nucleic acid comprises, in a 5 to 3 orientation, an upstream library sequence (UL), any nucleic acid of interest selected from the group (D), and a downstream library sequence (DL), wherein (UL) and (DL) are capable of initiating host cell mediated homologous recombination the selected exogenous nucleic acid at the one or more landing pads in a host cell's genome; and a nuclease (N) capable of cleaving at (NTS), whereupon said cleaving results in homologous recombination of the landing pads.
(187) In some embodiments, each library (L) comprises exogenous nucleic acids encoding enzymes of a common biosynthetic pathway. In some embodiments, the group (D) comprises at least 10.sup.1, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, or more than 10.sup.6 unique nucleic acids of interest. In some embodiments, each library (L) comprises a plurality of exogenous nucleic acids encoding variants of an enzyme of a biosynthetic pathway. As used herein, the term variant refers to an enzyme of a biosynthetic pathway that compared to a selected enzyme has a different nucleotide or amino acid sequence. For example, in some embodiments, a library (L) comprises sesquiterpene synthase variants, and compared to the wild-type version of the selected sesquiterpene synthase, the sesquiterpene synthase variant may comprise nucleotide additions, deletions, and/or substitutions that may or may not result in changes to the corresponding amino acid sequence. In other embodiments, the enzyme variant comprises amino acid additions, deletions and/or substitutions relative to a reference enzyme, e.g., the wild-type version.
(188) In some embodiments, the host cell comprises one or more heterologous nucleotide sequences encoding one or more enzymes of a biosynthetic pathway prior to said contacting. In some embodiments, the one or more heterologous nucleotide sequences encoding one or more enzymes of a biosynthetic pathway are genomically integrated into the landing pads.
6.6 Nucleases
(189) In some embodiments of the methods described herein, a host cell's genome is contacted with one or more nucleases capable of cleaving, i.e., causing a double-stranded break at or nearby the nuclease target sequence (NTS) in a landing pad. In some embodiments, a double-strand break inducing agent is any agent that recognizes and/or binds to a specific polynucleotide recognition sequence to produce a break at or near the recognition sequence. Examples of double-strand break inducing agents include, but are not limited to, endonucleases, site-specific recombinases, transposases, topoisomerases, and zinc finger nucleases, and include modified derivatives, variants, and fragments thereof.
(190) In some embodiments of the methods described herein, a host cell's genome is contacted with one or more nucleases capable of cleaving, i.e., causing a break at a designated region within a landing pad. In some embodiments, the break is a single-stranded break, that is, one but not both DNA strands of the nuclease target sequence are cleaved (i.e., nicked). In some embodiments, the break is a double-stranded break. In some embodiments, a break inducing agent is any agent that recognizes and/or binds to a specific polynucleotide recognition sequence to produce a break at or near the recognition sequence. Examples of break inducing agents include, but are not limited to, endonucleases, site-specific recombinases, transposases, topoisomerases, and zinc finger nucleases, and include modified derivatives, variants, and fragments thereof.
(191) In some embodiments, each of the one or more nucleases is capable of causing a break at a designated region within a selected nuclease target sequence (NTS). In some embodiments, the nuclease is capable of causing a break at a region positioned between the 5 and 3 regions of (NTS) in a landing pad. In other embodiments, the nuclease is capable of causing a break at a region positioned upstream or downstream of the 5 and 3 regions of (NTS).
(192) A nuclease target sequence (NTS) comprises a recognition sequence, which is any polynucleotide sequence that is specifically recognized and/or bound by a break inducing agent. The length of the recognition site sequence can vary, and includes, for example, sequences that are at least 10, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more nucleotides in length.
(193) In some embodiments, the recognition sequence is palindromic, that is, the sequence on one strand reads the same in the opposite direction on the complementary strand. In some embodiments, the nick/cleavage site is within the recognition sequence. In other embodiments, the nick/cleavage site is outside of the recognition sequence. In some embodiments, cleavage produces blunt end termini. In other embodiments, cleavage produces single-stranded overhangs, i.e., sticky ends, which can be either 5 overhangs, or 3 overhangs.
(194) In some embodiments, the recognition sequence within the landing pad can be endogenous or exogenous to the host cell's genome. When the recognition site is an endogenous sequence, it may be a recognition sequence recognized by a naturally-occurring, or native break inducing agent. Alternatively, an endogenous recognition site could be recognized and/or bound by a modified or engineered break inducing agent designed or selected to specifically recognize the endogenous recognition sequence to produce a break. In some embodiments, the modified break inducing agent is derived from a native, naturally-occurring break inducing agent. In other embodiments, the modified break inducing agent is artificially created or synthesized. Methods for selecting such modified or engineered break inducing agents are known in the art. For example, amino acid sequence variants of the protein(s) can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations include, for example, Kunkel, (1985) Proc Natl Acad Sci USA 82:488-92; Kunkel, et al., (1987) Meth Enzymol 154:367-82; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance regarding amino acid substitutions not likely to affect biological activity of the protein is found, for example, in the model of Dayhoff, et al., (1978) Atlas of Protein Sequence and Structure (Natl Biomed Res Found, Washington, D.C.). Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be preferable. Conservative deletions, insertions, and amino acid substitutions are not expected to produce radical changes in the characteristics of the protein, and the effect of any substitution, deletion, insertion, or combination thereof can be evaluated by routine screening assays. Assays for double strand break inducing activity are known and generally measure the overall activity and specificity of the agent on DNA substrates containing recognition sites.
6.6.1. Clustered Regulatory Interspaced Short Palindromic Repeats (CRISPR)
(195) In some embodiments of the methods provided herein, the nuclease is a CRISPR/Cas-derived RNA-guided endonuclease. CRISPR is a genome editing tool based on the type II prokaryotic CRISPR (clustered regularly interspersed short palindromic repeats) adaptive immune system. CRISPR systems in eubacteria and archaea use small RNAs and CRISPR-associated (Cas) endonucleases to target and cleave invading foreign DNAs. See, e.g., Bhaya et al., Annu Rev Genet 45:273-297 (2011); Terns et al., Curr Opin Microbiol 14(3):321-327 (2011); and Wiedenheft et al., Nature 482 (7385):331-338. In bacteria, CRISPR loci are composed of a series of repeats separated by segments of exogenous DNA (of ?30 bp in length) called spacers. The repeat-spacer array is transcribed as a long precursor and processed within repeat sequences to generate small crRNAs that specify the target sequences (also known as protospacers) cleaved by the CRISPR nuclease. CRISPR spacers are then used to recognize and silence exogenous genetic elements at the RNA or DNA level. Essential for cleavage is a sequence motif immediately downstream on the 3 end of the target region, known as the protospacer-adjacent motif (PAM). The PAM is present in the target DNA, but not the crRNA that targets it.
(196) One of the simplest CRISPR systems is the type II CRISPR system from Streptococcus pyognes. The CRISPR-associated Cas9 endonuclease and two small RNAs, a target-complimentary CRISPR RNA (crRNA); and a transacting crRNA (tracrRNA), are sufficient for RNA-guided cleavage of foreign DNAs. The Cas9 protein, a hallmark protein of the type II CRISPR-Cas system, is a large monomeric DNA nuclease containing two nuclease domains homologous to RuvC and HNH nucleases. Cas9 is guided to a DNA target sequence adjacent to the PAM (protospacer adjacent motif) sequence motif by a crRNA:tracrRNA complex. Mature crRNA base-pairs to tracrRNA to form a two-RNA structure that directs Cas9 to the target DNA. At sites complementary to the crRNA-guide sequence, the Cas9 HNH nuclease domain cleaves the complementary strand, whereas the Cas9 RuvC-like domain cleaves the noncomplementary strand, resulting in a double strand break in the target DNA. See, e.g., Deltcheva et al., Nature 47(7340):602-607 (2011).
(197) Recent studies show that a single guide RNA (gRNA) chimera that mimics the crRNA:tracrRNA complex can be utilized with Cas9 as a genome editing tool to guide Cas9 to introduce site specific DNA double-stranded breaks in vitro. Specificity of the cleavage within the target genome is determined by the spacer-like moiety of a chimeric guide RNA molecule (gRNA), which mimics the native crRNA:tracrRNA complex. Thus, the minimum number of components in a functional CRISPR/Cas system is two: Cas9 and sgRNA. The sgRNA guide sequence located at its 5 end confers DNA target specificity. Therefore, by modifying the guide sequence, it is possible to create sgRNAs with different target specificities. The canonical length of the guide sequence is 20 bp. Consequently, a DNA target is also 20 bp followed by a PAM sequence that follows the consensus NGG. Use of this modified CRISPR system has been demonstrated in vitro (see, e.g., Jinek et al., Science 337(6096):816-821 (2012)), in mammalian cell lines (see, e.g., Mali et al., Science 339(6121):823-826 (2013), Jinek et al., Elife 2:e00417 (2013); Cong et al., Science 339(6121):819-823 (2013); and Cho et al., Nat Biotechnol 31(3):230-232 (2013)), in bacteria (see, e.g., Jiang et al., Nat Biotechnol 31(3):233-239 (2013); and Gasiunas et al., Proc Natl Acad Sci USA 109(39):E2579-E2586. (2012)), yeast (see, e.g., DiCarlo et al., Nucleic Acid Res 41(7):4336-4343 (2013)), zebrafish (see, e.g., Hwang et al., Nat Biotechnol 31(3):227-229 (2013); and Chang et al., Cell Res 23(4):465-472 (2013)), mice (see, e.g., Wang et al., Cell 153(4):910-918 (2013), and plants (see e.g., Belhaj et al., Plant Methods 9:39 (2013)).
(198) The Cas9 nuclease may be modified by: (1) codon optimization for increased expression within a heterologous host; (2) fusion to a nuclear localization signal (NLS) for proper compartmentalization; and (3) site directed mutagenesis of either the HNH or RuvC domain to convert the nuclease into a strand-specific nickase. Site-directed mutagenesis of Cas9 in either the RuvC- or HNH-motif showed strand cleavage specificity, thereby providing two strand-specific nickases, in addition to the wild-type endonuclease and enabling targeted single-strand breaks of DNA. See, e.g., Jinek et al., Science 337(6096):816-821 (2012), and Gasiunas et al., Proc Natl Acad Sci USA 109(39):E2579-E2586. (2012). As has been reported for zinc finger nucleases and TALENs, modifying the nuclease to function as a nickase that breaks only one strand reduces toxicity from off-target cutting, and may also lower rates of break repair via non-HR mechanisms, e.g., NHEJ. See, e.g., Jinek et al., Science 337(6096):816-821 (2012).
(199) Any CRISPR/Cas system known in the art finds use as a nuclease in the methods and compositions provided herein. The highly diverse CRISPR-Cas systems are categorized into three major types, which are further subdivided into ten subtypes, based on core element content and sequences (see, e.g., Makarova et al., Nat Rev Microbiol 9:467-77 (2011)). The structural organization and function of nucleoprotein complexes involved in crRNA-mediated silencing of foreign nucleic acids differ between distinct CRISPR/Cas types (see Wiedenheft et al., Nature 482:331-338 (2012)). In the Type 1-E system, as exemplified by Escherichia coli, crRNAs are incorporated into a multisubunit effector complex called Cascade (CRISPR-associated complex for antiviral defence) (Brouns et al., Science 321: 960-4 (2008)), which binds to the target DNA and triggers degradation by the signature Cas3 protein (Sinkunas et al., EMBO J 30:1335{circumflex over ()}2 (2011); Beloglazova et al., EMBO J30:616-27 (2011)). In Type III CRISPR/Cas systems of Sulfolobus solfataricus and Pyrococcus furiosus, Cas RAMP module (Cmr) and crRNA complex recognize and cleave synthetic RNA in vitro (Hale et al., Mol Cell 45:292-302 (2012); Zhang et al., Mol Cell, 45:303-13 (2012)), while the CRISPR/Cas system of Staphylococcus epidermidis targets DNA in vivo (Marraffini & Sontheimer, Science. 322:1843-5 (2008)). RNP complexes involved in DNA silencing by Type II CRISPR/Cas systems, more specifically in the CRISPR3/Cas system of Streptococcus thermophilus DGCC7710 (Horvath & Barrangou, Science 327:167-70 (2010)), consists of four cas genes: cas9, cas1, cas2, and csn2, that are located upstream of 12 repeat-spacer units. Cas9 (formerly named cas5 or csn1) is the signature gene for Type II systems (Makarova et al., Nat Rev Microbiol 9:467-77 (2011)).
(200) CRISPR systems that find use in the methods and compositions provided herein also include those described in International Publication Numbers WO 2013/142578 A1 and WO 2013/098244 A1, the contents of which are hereby incorporated in their entireties.
6.6.2. Transcription Activator-Like Effector Nucleases (TALENs)
(201) In some embodiments of the methods provided herein, one or more of the nucleases is a TAL-effector DNA binding domain-nuclease fusion protein (TALEN). TAL effectors of plant pathogenic bacteria in the genus Xanthomonas play important roles in disease, or trigger defense, by binding host DNA and activating effector-specific host genes. see, e.g., Gu et al. (2005) Nature 435:1122-5; Yang et al., (2006) Proc. Natl. Acad. Sci. USA 103:10503-8; Kay et al., (2007) Science 318:648-51; Sugio et al., (2007) Proc. Natl. Acad. Sci. USA 104:10720-5; Romer et al., (2007) Science 318:645-8; Boch et al., (2009) Science 326(5959):1509-12; and Moscou and Bogdanove, (2009) 326(5959):1501. A TAL effector comprises a DNA binding domain that interacts with DNA in a sequence-specific manner through one or more tandem repeat domains. The repeated sequence typically comprises 34 amino acids, and the repeats are typically 91-100% homologous with each other. Polymorphism of the repeats is usually located at positions 12 and 13, and there appears to be a one-to-one correspondence between the identity of repeat variable-diresidues at positions 12 and 13 with the identity of the contiguous nucleotides in the TAL-effector's target sequence.
(202) The TAL-effector DNA binding domain may be engineered to bind to a desired target sequence, and fused to a nuclease domain, e.g., from a type II restriction endonuclease, typically a nonspecific cleavage domain from a type II restriction endonuclease such as FokI (see. e.g., Kim et al. (1996) Proc. Natl. Acad. Sci. USA 93:1156-1160). Other useful endonucleases may include, for example, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AlwI. Thus, in preferred embodiments, the TALEN comprises a TAL effector domain comprising a plurality of TAL effector repeat sequences that, in combination, bind to a specific nucleotide sequence in the target DNA sequence, such that the TALEN cleaves the target DNA within or adjacent to the specific nucleotide sequence. TALENS useful for the methods provided herein include those described in WO10/079430 and U.S. Patent Application Publication No. 2011/0145940.
(203) In some embodiments, the TAL effector domain that binds to a specific nucleotide sequence within the target DNA can comprise 10 or more DNA binding repeats, and preferably 15 or more DNA binding repeats. In some embodiments, each DNA binding repeat comprises a repeat variable-diresidue (RVD) that determines recognition of a base pair in the target DNA sequence, wherein each DNA binding repeat is responsible for recognizing one base pair in the target DNA sequence, and wherein the RVD comprises one or more of: HD for recognizing C; NG for recognizing T; NI for recognizing A; NN for recognizing G or A; NS for recognizing A or C or G or T; N* for recognizing C or T, where * represents a gap in the second position of the RVD; HG for recognizing T; H* for recognizing T, where * represents a gap in the second position of the RVD; IG for recognizing T; NK for recognizing G; HA for recognizing C; ND for recognizing C; HI for recognizing C; HN for recognizing G; NA for recognizing G; SN for recognizing G or A; and YG for recognizing T. In some embodiments of the methods provided herein, one or more of the nucleases is a site-specific recombinase. A site-specific recombinase, also referred to as a recombinase, is a polypeptide that catalyzes conservative site-specific recombination between its compatible recombination sites, and includes native polypeptides as well as derivatives, variants and/or fragments that retain activity, and native polynucleotides, derivatives, variants, and/or fragments that encode a recombinase that retains activity. For reviews of site-specific recombinases and their recognition sites, see, Sauer (1994) Curr Op Biotechnol 5:521-7; and Sadowski, (1993) FASEB 7:760-7. In some embodiments, the recombinase is a serine recombinase or a tyrosine recombinase. In some embodiments, the recombinase is from the Integrase or Resolvase families. In some embodiments, the recombinase is an integrase selected from the group consisting of FLP, Cre, lambda integrase, and R. For other members of the Integrase family, see for example, Esposito, et al., (1997) Nucleic Acids Res 25:3605-14 and Abremski, et al., (1992) Protein Eng 5:87-91. Methods for modifying the kinetics, cofactor interaction and requirements, expression, optimal conditions, and/or recognition site specificity, and screening for activity of recombinases and variants are known, see for example Miller, et al., (1980) Cell 20:721-9; Lange-Gustafson and Nash, (1984) J Biol Chem 259:12724-32; Christ, et al., (1998) J Mol Biol 288:825-36; Lorbach, et al., (2000)J Mol Biol 296:1175-81; Vergunst, et al., (2000) Science 290:979-82; Dorgai, et al., (1995) J Mol Biol 252:178-88; Dorgai, et al., (1998) J Mol Biol 277:1059-70; Yagu, et al., (1995) J Mol Biol 252:163-7; Sclimente, et al., (2001) Nucleic Acids Res 29:5044-51; Santoro and Schultze, (2002) Proc Natl Acad Sci USA 99:4185-90; Buchholz and Stewart, (2001) Nat Biotechnol 19:1047-52; Voziyanov, et al., (2002) Nucleic Acids Res 30:1656-63; Voziyanov, et al., (2003) J Mol Biol 326:65-76; Klippel, et al., (1988) EMBO J7:3983-9; Arnold, et al., (1999) EMBO J 18:1407-14; WO03/08045; WO99/25840; and WO99/25841. The recognition sites range from about 30 nucleotide minimal sites to a few hundred nucleotides. Any recognition site for a recombinase can be used, including naturally occurring sites, and variants. Variant recognition sites are known, see for example Hoess, et al., (1986) Nucleic Acids Res 14:2287-300; Albert, et al., (1995) Plant J 7:649-59; Thomson, et al., (2003) Genesis 36:162-7; Huang, et al., (1991) Nucleic Acids Res 19:443-8; Siebler and Bode, (1997) Biochemistry 36:1740-7; Schlake and Bode, (1994) Biochemistry 33:12746-51; Thygarajan, et al., (2001)Mol Cell Biol 21:3926-34; Umlauf and Cox, (1988) EMBO J 7:1845-52; Lee and Saito, (1998) Gene 216:55-65; WO01/23545; WO99/25821; WO99/25851; WO01/11058; WO01/07572 and U.S. Pat. No. 5,888,732.
(204) In some embodiments of the methods provided herein, one or more of the nucleases is a transposase. Transposases are polypeptides that mediate transposition of a transposon from one location in the genome to another. Transposases typically induce double strand breaks to excise the transposon, recognize subterminal repeats, and bring together the ends of the excised transposon, in some systems other proteins are also required to bring together the ends during transposition. Examples of transposons and transposases include, but are not limited to, the Ac/Ds, Dt/rdt, Mu-M1/Mn, and Spm(En)/dSpm elements from maize, the Tam elements from snapdragon, the Mu transposon from bacteriophage, bacterial transposons (Tn) and insertion sequences (IS), Ty elements of yeast (retrotransposon), Tal elements from Arabidopsis (retrotransposon), the P element transposon from Drosophila (Gloor, et al., (1991) Science 253:1110-1117), the Copia, Mariner and Minos elements from Drosophila, the Hermes elements from the housefly, the PiggyBack elements from Trichplusia ni, Tc1 elements from C. elegans, and IAP elements from mice (retrotransposon).
6.6.3. Zinc Finger Nucleases (ZFNs)
(205) In some embodiments of the methods provided herein, one or more of the nucleases is a zinc-finger nuclease (ZFN). ZFNs are engineered break inducing agents comprised of a zinc finger DNA binding domain and a break inducing agent domain. Engineered ZFNs consist of two zinc finger arrays (ZFAs), each of which is fused to a single subunit of a non-specific endonuclease, such as the nuclease domain from the FokI enzyme, which becomes active upon dimerization. Typically, a single ZFA consists of 3 or 4 zinc finger domains, each of which is designed to recognize a specific nucleotide triplet (GGC, GAT, etc.). Thus, ZFNs composed of two 3-finger ZFAs are capable of recognizing an 18 base pair target site; an 18 base pair recognition sequence is generally unique, even within large genomes such as those of humans and plants. By directing the co-localization and dimerization of two FokI nuclease monomers, ZFNs generate a functional site-specific endonuclease that creates a break in DNA at the targeted locus.
(206) Useful zinc-finger nucleases include those that are known and those that are engineered to have specificity for one or more nuclease target sequences (NTS) described herein. Zinc finger domains are amenable for designing polypeptides which specifically bind a selected polynucleotide recognition sequence, for example, within the target site of the host cell's genome. ZFNs consist of an engineered DNA-binding zinc finger domain linked to a non-specific endonuclease domain, for example nuclease domain from a Type IIs endonuclease such as HO or FokI. Alternatively, engineered zinc finger DNA binding domains can be fused to other break inducing agents or derivatives thereof that retain DNA nicking/cleaving activity. For example, this type of fusion can be used to direct the break inducing agent to a different target site, to alter the location of the nick or cleavage site, to direct the inducing agent to a shorter target site, or to direct the inducing agent to a longer target site. In some examples a zinc finger DNA binding domain is fused to a site-specific recombinase, transposase, or a derivative thereof that retains DNA nicking and/or cleaving activity. Additional functionalities can be fused to the zinc-finger binding domain, including transcriptional activator domains, transcription repressor domains, and methylases. In some embodiments, dimerization of nuclease domain is required for cleavage activity.
(207) Each zinc finger recognizes three consecutive base pairs in the target DNA. For example, a 3 finger domain recognized a sequence of 9 contiguous nucleotides, with a dimerization requirement of the nuclease, two sets of zinc finger triplets are used to bind a 18 nucleotide recognition sequence. Useful designer zinc finger modules include those that recognize various GNN and ANN triplets (Dreier, et al., (2001) J Biol Chem 276:29466-78; Dreier, et al., (2000) J Mol Biol 303:489-502; Liu, et al., (2002) J Biol Chem 277:3850-6), as well as those that recognize various CNN or TNN triplets (Dreier, et al., (2005) J Biol Chem 280:35588-97; Jamieson, et al., (2003) Nature Rev Drug Discov 2:361-8). See also, Durai, et al., (2005) Nucleic Acids Res 33:5978-90; Segal, (2002) Methods 26:76-83; Porteus and Carroll, (2005) Nat Biotechnol 23:967-73; Pabo, et al., (2001) Ann Rev Biochem 70:313-40; Wolfe, et al., (2000) Ann Rev Biophys Biomol Struct 29:183-212; Segal and Barbas, (2001) Curr Opin Biotechnol 12:632-7; Segal, et al., (2003) Biochemistry 42:2137-48; Beerli and Barbas, (2002) Nat Biotechnol 20:135-41; Carroll, et al., (2006) Nature Protocols 1:1329; Ordiz, et al., (2002) Proc Natl Acad Sci USA 99:13290-5; Guan, et al., (2002) Proc Nat Acad Sci USA 99:13296-301; WO2002099084; WO00/42219; WO02/42459; WO2003062455; US20030059767; US patent application publication number 2003/0108880; U.S. Pat. Nos. 6,140,466, 6,511,808 and 6,453,242. Useful zinc-finger nucleases also include those described in WO03/080809; WO05/014791; WO05/084190; WO08/021207; WO09/042186; WO09/054985; and WO10/065123.
6.6.4. Endonucleases
(208) In some embodiments of the methods provided herein, one or more of the nucleases is an endonuclease. Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain, and include restriction endonucleases that cleave DNA as specific sites without damaging the bases. Restriction endonucleases include Type I, Type II, Type III, and Type IV endonucleases, which further include subtypes. Restriction endonucleases are further described and classified, for example in the REBASE database (webpage at rebase.neb.com; Roberts, et al., (2003) Nucleic Acids Res 31:418-20), Roberts, et al., (2003) Nucleic Acids Res 31:1805-12, and Belfort, et al., (2002) in Mobile DNA II, pp. 761-783, Eds. Craigie, et al., ASM Press, Washington, D.C.
(209) As used herein, endonucleases also include homing endonucleases, which like restriction endonucleases, bind and cut at a specific recognition sequence. However the recognition sites for homing endonucleases are typically longer, for example, about 18 bp or more. Homing endonucleases, also known as meganucleases, have been classified into the following families based on conserved sequence motifs: an LAGLIDADG (SEQ ID NO:1) homing endonuclease, an HNH homing endonuclease, a His-Cys box homing endonuclease, a GIY-YIG (SEQ ID NO:2) homing endonuclease, and a cyanobacterial homing endonuclease. See, e.g., Stoddard, Quarterly Review of Biophysics 38(1): 49-95 (2006). These families differ greatly in their conserved nuclease active-site core motifs and catalytic mechanisms, biological and genomic distributions, and wider relationship to non-homing nuclease systems. See, for example, Guhan and Muniyappa (2003) Crit Rev Biochem Mol Biol 38:199-248; Lucas, et al., (2001) Nucleic Acids Res 29:960-9; Jurica and Stoddard, (1999) Cell Mol Life Sci 55:1304-26; Stoddard, (2006) Q Rev Biophys 38:49-95; and Moure, et al., (2002) Nat Struct Biol 9:764. Examples of useful specific homing endonucleases from these families include, but are not limited to: I-CreI (see, Rochaix et al., Nucleic Acids Res. 13: 975-984 (1985), I-MsoI (see, Lucas et al., Nucleic Acids Res. 29: 960-969 (2001), I-SceI (see, Foury et al., FEBS Lett. 440: 325-331 (1998), I-SceIV (see, Moran et al., Nucleic Acids Res. 20: 4069-4076 (1992), H-DreI (see, Chevalier et al., Mol. Cell 10: 895-905 (2002), I-HmuI (see, Goodrich-Blair et al., Cell 63: 417-424 (1990); Goodrich-Blair et al., Cell 84: 211-221 (1996), I-PpoI (see, Muscarella et al., Mol. Cell. Biol. 10: 3386-3396 (1990), I-DirI (see, Johansen et al., Cell 76: 725-734 (1994); Johansen, Nucleic Acids Res. 21: 4405 (1993), I-NjaI (see, Elde et al., Eur. J. Biochem. 259: 281-288 (1999); De Jonckheere et al., J. Eukaryot. Microbiol. 41: 457-463 (1994), I-NanI (see, Elde et al., S. Eur. J. Biochem. 259: 281-288 (1999); De Jonckheere et al., J. Eukaryot. Microbiol. 41: 457-463 (1994)), I-NitI (see, De Jonckheere et al., J. Eukaryot. Microbiol. 41: 457-463 (1994); Elde et al., Eur. J. Biochem. 259: 281-288 (1999), I-TevI (see, Chu et al., Cell 45: 157-166 (1986), I-TevII (see, Tomaschewski et al., Nucleic Acids Res. 15: 3632-3633 (1987), I-TevIII (see, Eddy et al., Genes Dev. 5: 1032-1041 (1991), F-TevI (see, Fujisawa et al., Nucleic Acids Res. 13: 7473-7481 (1985), F-TevII (see, Kadyrov et al., Dokl. Biochem. 339: 145-147 (1994); Kaliman, Nucleic Acids Res. 18: 4277 (1990), F-CphI (see, Zeng et al., Curr. Biol. 19: 218-222 (2009), PI-MgaI (see, Saves et al., Nucleic Acids Res. 29:4310-4318 (2001), I-CsmI (see, Colleaux et al., Mol. Gen. Genet. 223:288-296 (1990), I-CeuI (see, Turmel et al., J. Mol. Biol. 218: 293-311 (1991) and PI-SceI (see, Hirata et al., J. Biol. Chem. 265: 6726-6733 (1990).
(210) In some embodiments of the methods described herein, a naturally occurring variant, and/or engineered derivative of a homing endonuclease is used. Methods for modifying the kinetics, cofactor interactions, expression, optimal conditions, and/or recognition site specificity, and screening for activity are known. See, for example, Epinat, et al., (2003) Nucleic Acids Res 31:2952-62; Chevalier, et al., (2002)Mol Cell 10:895-905; Gimble, et al., (2003) Mol Biol 334:993-1008; Seligman, et al., (2002) Nucleic Acids Res 30:3870-9; Sussman, et al., (2004) J Mol Biol 342:31-41; Rosen, et al., (2006) Nucleic Acids Res 34:4791-800; Chames, et al., (2005) Nucleic Acids Res 33:e178; Smith, et al., (2006) Nucleic Acids Res 34:e149; Gruen, et al., (2002) Nucleic Acids Res 30:e29; Chen and Zhao, (2005) Nucleic Acids Res 33:e154; WO2005105989; WO2003078619; WO2006097854; WO2006097853; WO2006097784; and WO2004031346. Useful homing endonucleases also include those described in WO04/067736; WO04/067753; WO06/097784; WO06/097853; WO06/097854; WO07/034262; WO07/049095; WO07/049156; WO07/057781; WO07/060495; WO08/152524; WO09/001159; WO09/095742; WO09/095793; WO10/001189; WO10/015899; and WO10/046786.
(211) Any homing endonuclease can be used as a double-strand break inducing agent including, but not limited to: H-DreI, I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, Pi-PspI, F-SceI, F-SceII, F-SuvI, F-CphI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NclIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorI, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp68031, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MgaI, PI-MtuI, PI-MtuHIP PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, or PI-TliII, or any variant or derivative thereof.
(212) In some embodiments, the endonuclease binds a native or endogenous recognition sequence. In other embodiments, the endonuclease is a modified endonuclease that binds a non-native or exogenous recognition sequence and does not bind a native or endogenous recognition sequence.
6.6.5. Nuclease Target Sequence in a Landing Pad
(213) In the methods provided herein, a nuclease is introduced to the host cell that is capable of causing a double-strand break near or within a nuclease target sequence in a landing pad, which greatly increases the frequency of homologous recombination at or near the cleavage site. In preferred embodiments, the nuclease target sequence (NTS) comprising a recognition sequence for the nuclease is present in the host cell's genome only at the landing pad(s), thereby minimizing any off-target genomic binding and cleavage by the nuclease.
(214) If the nuclease to be utilized is a CRISPR/Cas-derived RNA-guided endonuclease, optimal nuclease target sequence may be selected in accordance with the requirements for target recognition of the particular CRISPR-Cas endonuclease being used. For example Cas9 target recognition occurs upon detection of complementarity between a protospacer sequence in the target DNA and the remaining spacer sequence in the crRNA. Cas9 cuts the DNA only if a correct protospacer-adjacent motif (PAM) is also present at the 3 end. Different Type II systems have differing PAM requirements. The S. pyogenes system requires an NGG sequence, where N can be any nucleotide. S. thermophilus Type II systems require NGGNG and NNAGAAW, respectively, while different S. mutans systems tolerate NGG or NAAR. Bioinformatic analyses have generated extensive databases of CRISPR loci in a variety of bacteria that may serve to identify new PAMs and expand the set of CRISPR-targetable sequences. See, e.g., Rho et al., PLoS Genet. 8, e1002441 (2012); and D. T. Pride et al., Genome Res. 21, 126 (2011). In S. thermophilus, Cas9 generates a blunt-ended double-stranded break 3 bp upstream of the protospacer, a process mediated by two catalytic domains in the Cas9 protein: an HNH domain that cleaves the complementary strand of the DNA and a RuvC-like domain that cleaves the non-complementary strand.
(215) If the nuclease to be utilized is a zinc finger nuclease, optimal nuclease target sequence may be selected using a number of publicly available online resources. See, e.g., Reyon et al., BMC Genomics 12:83 (2011), which is hereby incorporated by reference in its entirety. For example, Oligomerized Pool Engineering (OPEN) is a highly robust and publicly available protocol for engineering zinc finger arrays with high specificity and in vivo functionality, and has been successfully used to generate ZFNs that function efficiently in plants, zebrafish, and human somatic and pluripotent stem cells. OPEN is a selection-based method in which a pre-constructed randomized pool of candidate ZFAs is screened to identify those with high affinity and specificity for a desired target sequence. ZFNGenome is a GBrowse-based tool for identifying and visualizing potential target sites for OPEN-generated ZFNs. ZFNGenome provides a compendium of potential ZFN target sites in sequenced and annotated genomes of model organisms. ZFNGenome currently includes a total of more than 11.6 million potential ZFN target sites, mapped within the fully sequenced genomes of seven model organisms; S. cerevisiae. C. reinhardtii. A. thaliana. D. melanogaster. D. rerio. C. elegans, and H. sapiens. Additional model organisms, including three plant species; Glycine max (soybean), Oryza sativa (rice), Zea mays (maize), and three animal species Tribolium castaneum (red flour beetle), Mus musculus (mouse), Rattus norvegicus (brown rat) will be added in the near future. ZFNGenome provides information about each potential ZFN target site, including its chromosomal location and position relative to transcription initiation site(s). Users can query ZFNGenome using several different criteria (e.g., gene ID, transcript ID, target site sequence).
(216) If the nuclease to be utilized is a TAL-effector nuclease, in some embodiments, optimal nuclease target sequence may be selected in accordance with the methods described by Sanjana et al., Nature Protocols, 7:171-192 (2012), which is hereby incorporated by reference in its entirety. In brief, TALENs function as dimers, and a pair of TALENs, referred to as the left and right TALENs, target sequences on opposite strands of DNA. TALENs are engineered as a fusion of the TALEN DNA-binding domain and a monomeric FokI catalytic domain. To facilitate FokI dimerization, the left and right TALEN target sites are chosen with a spacing of approximately 14-20 bases. Therefore, for a pair of TALENs, each targeting 20-bp sequences, an optimal target site should have the form 5-TN19N14-20N19A-3, where the left TALEN targets 5-TN19-3 and the right TALEN targets the antisense strand of 5-N19A-3 (N=A, G, T or C).
(217) In other embodiments of the methods provided herein, the nuclease target sequence is exogenous to the host cell. In some embodiments, multiple copies of the same nuclease target sequence are engineered into the landing pads, thereby facilitating simultaneous multiple integration events with the use of only a single nuclease that specifically recognizes the nuclease target sequence. In other embodiments, a plurality of different nuclease target sequences is engineered into the host cell's genome at different landing pads. In some embodiments, the engineered landing pads comprise a target nuclease sequence that is not otherwise represented in the native genome of the host cell. For example, homing endonucleases target large recognition sites (12-40 bp) that are usually embedded in introns or inteins, and as such, their recognition sites are extremely rare, with none or only a few of these sites present in a mammalian-sized genome. Thus, in some embodiments, the exogenous nuclease target sequence is a recognition sequence for a homing endonuclease. In some embodiments, the homing nuclease is selected from the group consisting of: H-DreI, I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, Pi-PspI, F-SceI, F-SceII, F-SuvI, F-CphI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NclIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorI, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp68031, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MgaI, PI-MtuI, PI-MtuHIP PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, or PI-TliII, or any variant or derivative thereof. In particular embodiments, the exogenous genomic nuclease target sequence is the recognition sequence for I-SceI, VDE (PI-SceI), F-CphI, PI-MgaI or PI-MtuII, each of which are provided below.
(218) TABLE-US-00001 TABLE1 Recognitionandcleavagesitesforselect homingendonucleases. Nuclease Recognitionsequence I-SceI TAGGGATAACAGGGTAAT(SEQIDNO:3) VDE TATGTCGGGTGCGGAGAAAGAGGTAATGAAA(SEQ (PI-SceI) IDNO:4) F-CphI GATGCACGAGCGCAACGCTCACAA(SEQIDNO:5) PI-MgaI GCGTAGCTGCCCAGTATGAGTCAG(SEQIDNO:6) PI-MtuII ACGTGCACTACGTAGAGGGTCGCACCGCACCGATCTACA A(SEQIDNO:7)
6.6.6. Delivery
(219) In some embodiments, the one or more nucleases useful for the methods described herein are provided, e.g., delivered into the host cell as a purified protein. In other embodiments, the one or more nucleases are provided via polynucleotide(s) comprising a nucleic acid encoding the nuclease. In other embodiments, the one or more nucleases are introduced into the host cell as purified RNA which can be directly translated in the host cell nucleus.
(220) In certain embodiments, an integration polynucleotide, a polynucleotide encoding a nuclease, or a purified nuclease protein as described above, or any combination thereof, may be introduced into a host cell using any conventional technique to introduce exogenous protein and/or nucleic acids into a cell known in the art. Such methods include, but are not limited to, direct uptake of the molecule by a cell from solution, or facilitated uptake through lipofection using, e.g., liposomes or immunoliposomes; particle-mediated transfection; etc. See, e.g., U.S. Pat. No. 5,272,065; Goeddel et al., eds, 1990, Methods in Enzymology, vol. 185, Academic Press, Inc., CA; Krieger, 1990, Gene Transfer and ExpressionA Laboratory Manual, Stockton Press, NY; Sambrook et al., 1989, Molecular CloningA Laboratory Manual, Cold Spring Harbor Laboratory, NY; and Ausubel et al., eds., Current Edition, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, NY. Particular methods for transforming cells are well known in the art. See Hinnen et al., Proc. Natl. Acad. Sci. USA 75:1292-3 (1978); Cregg et al., Mol. Cell. Biol. 5:3376-3385 (1985). Exemplary techniques include but are not limited to, spheroplasting, electroporation, PEG 1000 mediated transformation, and lithium acetate or lithium chloride mediated transformation.
(221) In some embodiments, biolistics are utilized to introduce an integration polynucletide, a polynucleotide encoding a nuclease, a purified nuclease protein, or any combination thereof into the host cell, in particular, host cells that are otherwise difficult to transform/transfect using conventional techniques, such as plants. Biolistics work by binding the transformation reaction to microscopic gold particles, and then propelling the particles using compressed gas at the target cells.
(222) In some embodiments, the polynucleotide comprising nucleic acid encoding the nuclease is an expression vector that allows for the expression of a nuclease within a host cell. Suitable expression vectors include but are not limited to those known for use in expressing genes in Escherichia coli, yeast, or mammalian cells. Examples of Escherichia coli expression vectors include but are not limited to pSCM525, pDIC73, pSCM351, and pSCM353. Examples of yeast expression vectors include but are not limited to pPEX7 and pPEX408. Other examples of suitable expression vectors include the yeast-Escherichia coli pRS series of shuttle vectors comprising CEN.ARS sequences and yeast selectable markers; and 2? plasmids. In some embodiments, a polynucleotide encoding a nuclease can be modified to substitute codons having a higher frequency of usage in the host cell, as compared to the naturally occurring polynucleotide sequence. For example the polynucleotide encoding the nuclease can be modified to substitute codons having a higher frequency of usage in S. cerevisiae, as compared to the naturally occurring polynucleotide sequence.
(223) In some embodiments where the nuclease functions as a heterodimer requiring the separate expression of each monomer, as is the case for zinc finger nucleases and TAL-effector nucleases, each monomer of the heterodimer may be expressed from the same expression plasmid, or from different plasmids. In embodiments where multiple nucleases are introduced to the cell to effect double-strand breaks at different target sites, the nucleases may be encoded on a single plasmid or on separate plasmids.
(224) In certain embodiments, the nuclease expression vector further comprises a selectable marker that allows for selection of host cells comprising the expression vector. Such selection can be helpful to retain the vector in the host cell for a period of time necessary for expression of sufficient amounts of nuclease to occur, for example, for a period of 12, 24, 36, 48, 60, 72, 84, 96, or more than 96 hours, after which the host cells may be grown under conditions under which the expression vector is no longer retained. In certain embodiments, the selectable marker is selected from the group consisting of: URA3, hygromycin B phosphotransferase, aminoglycoside phosphotransferase, zeocin resistance, and phosphinothricin N-acetyltransferase. In some embodiments, the nuclease expression vector may comprise a counter-selectable marker that allows for selection of host cells that do not contain the expression vector subsequent to integration of the one or more donor nucleic acid molecules. The nuclease expression vector used may also be a transient vector that has no selection marker, or is one that is not selected for. In particular embodiments, the progeny of a host cell comprising a transient nuclease expression vector loses the vector over time.
(225) In certain embodiments, the expression vector further comprises a transcription termination sequence and a promoter operatively linked to the nucleotide sequence encoding the nuclease. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. Illustrative examples of promoters suitable for use in yeast cells include, but are not limited to the promoter of the TEF1 gene of K. lactis, the promoter of the PGK1 gene of Saccharomyces cerevisiae, the promoter of the TDH3 gene of Saccharomyces cerevisiae, repressible promoters, e.g., the promoter of the CTR3 gene of Saccharomyces cerevisiae, and inducible promoters, e.g., galactose inducible promoters of Saccharomyces cerevisiae (e.g., promoters of the GAL1, GAL7, and GAL10 genes).
(226) In some embodiments, an additional nucleotide sequence comprising a nuclear localization sequence (NLS) is linked to the 5 of the nucleotide sequence encoding the nuclease. The NLS can facilitate nuclear localization of larger nucleases (>25 kD). In some embodiments, the nuclear localization sequence is an SV40 nuclear localization sequence. In some embodiments, the nuclear localization sequence is a yeast nuclear localization sequence.
(227) A nuclease expression vector can be made by any technique apparent to one skilled in the art. In certain embodiments, the vector is made using polymerase chain reaction (PCR) and molecular cloning techniques well known in the art. See, e.g., PCR Technology: Principles and Applications for DNA Amplification, ed. HA Erlich, Stockton Press, New York, N.Y. (1989); Sambrook et al., 2001, Molecular CloningA Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
6.7 Kits
(228) In another aspect, provided herein is a kit useful for performing the methods of genomically integrating one or more exogenous nucleic described herein. In some embodiments, the kit comprises:
(229) (a) a host cell comprising a plurality of exogenous landing pads integrated in a host cell's genome, wherein each exogenous landing pad comprises a nuclease target sequence (NTS) positioned between an upstream landing pad homology sequence (ULP) and a downstream landing pad homology sequence (DLP);
(b) a plurality of exogenous donor nucleic acids, wherein each exogenous donor nucleic acid (ES) comprises: a nucleic acid of interest (D) positioned between an upstream library sequence (UL) and a downstream library sequence (DL), wherein each (UL) is capable of homologously recombining at any upstream landing pad homology sequence (ULP) and each (DL) is capable of homologously recombining at any downstream landing pad homology sequence (DLP) of landing pads in a host cell's genome; and
(c) one or more nucleases (N) capable of cleaving any (NTS) in the landing pads.
(230) In some embodiments, (D) is selected from the group consisting of a selectable marker, a promoter, a nucleic acid sequence encoding an epitope tag, a gene of interest, a reporter gene, a nuclei acid sequence encoding a termination codon. In some embodiments, the kit further comprises a plurality of primer pairs, wherein each primer pair is capable of identifying integration of exogenous donor nucleic acids by PCR.
(231) In some embodiments, the kit further comprises instructions for use that describe methods of integrating one or more exogenous donor nucleic acids into any landing pads of a host cell.
7. EXAMPLES
7.1 Example 1: CLiX Parent Strain Construction and Transformation
(232) To generate a CLiX (combinatorial library integration using X-cutter) parent strain, DNA landing pads consisting of upstream library (UL) and downstream library (DL) sequences flanking an endonuclease recognition site (F-CphI) were integrated into 3 separate genomic loci of Saccharomyces cerevisiae CEN.PK2. Specifically, landing pads were targeted to the intergenic regions downstream of ALG1 (iALG1), MGA1 (iMGA1), and YCT1 (iYCT1). DNA integration at each of these loci was previously confirmed to have no measurable impact on strain phenotype. UL and DL sequences were derived from a random sequence generator with constraints of 500 bp length and 50% GC content. These sequences were manually curated to remove tandem and inverted repeats, DNA secondary structure, and any significant homology to known biological sequences based on nucleotide and translated BLAST search (BLASTn and BLASTx, respectively). Nucleotide sequences for each landing pad including locus targeting sequences are provided as SEQ ID NO: 8-10.
(233) Each landing pad was integrated into CEN.PK2 with standard molecular biology techniques in an optimized lithium acetate (LiAc) transformation. Briefly, cells were grown overnight in yeast extract peptone dextrose (YPD) media at 30? C. with shaking (200 rpm), diluted to an OD.sub.600 of 0.1 in 100 mL YPD, and grown to an OD.sub.600 of 0.6-0.8. For each transformation, 5 mL of culture was harvested by centrifugation, washed in 5 mL of sterile water, spun down again, resuspended in 1 mL of 100 mM LiAc, and transferred to a microcentrifuge tube. Cells were spun down (13,000?g) for 30 seconds, the supernatant was removed, and the cells were resuspended in a transformation mix consisting of 240 ?L 50% PEG, 36 ?L 1 M LiAc, 10 ?L boiled salmon sperm DNA, and 74 ?L of donor DNA. Following a heat shock at 42? C. for 40 minutes, cells were recovered overnight in YPD media before plating on selective media. Landing pad integration was confirmed by colony PCR with primers targeting the 5 and 3 integration flanks.
7.2 Example 2: Comparing Genomic Integration of Locked Promoter and Split Promoter Designs
(234) A number of design variants are compatible with CLiX integrations. Locked promoter designs contain fixed promoters driving individual open reading frames (ORFs) flanked by UL and DL homology. Split designs consist of multiple parts that are combined through recombination at small homologous linker sequences. Most commonly, one part is a split promoter consisting of a UL homology sequence followed by a promoter and DNA linker, and a second part is a promoterless ORF consisting of a DNA linker, an open reading frame, and a DL homology sequence. Using this design variant, a pooled transformation of multiple split promoters can be used to combinatorially titrate the expression of each ORF. We used DNA constructs encoding fluorescent proteins (GFP, RFP, and BFP) along with spacer constructs containing a spacer sequence to test both locked and slit promoter designs.
(235) For locked promoter designs, each fluorescent gene was transcribed by a pGAL1 promoter and flanked by UL and DL homology sequences to enable integration at each landing pad. The spacer construct consisted of a 1 kb spacer sequence flanked by UL and DL homology. We pooled equimolar amounts of these 4 constructs together (locked promoter GFP, RFP, BFP, and spacer, see
(236) For split designs, we constructed 9 split promoters of different expression strengths to pair with promoterless ORFs for GFP, RFP, BFP, and a spacer sequence (
(237) For the locked promoter designs, each fixed-promoter fluorescent construct can vary by copy number only (i.e., how many times the construct integrated into the 3 available landing pads). Accordingly, we observed that fluorescent values from each measured well fell into 4 distinct bins corresponding to 0?, 1?, 2?, and 3? integrations. The 1?, 2?, and 3? bins for GFP fluorescence, corresponding to the number of pGAL1>GFP integrations, are clearly visible as hatch marked columns in
(238) For split designs, each fluorescent construct can vary in promoter strength (i.e., which split promoter recombined with the promoterless-ORF) and copy number. Since the additional promoters are weaker than pGAL1, we anticipated that fluorescent measurements from split designs would fill in the spaces between 1?, 2?, and 3? copies of each locked promoter fluorescent construct. As observed in
7.3 Example 3: Genomic Integration Efficiency Using CLiX Parent Strain
(239) This example provides results which demonstrate simultaneous integration at three different landing pads of a S. cerevisiae host following the induction of targeted double-stranded breaks in the host cell's genome. The strains A, B, and C are derived from the same S. cerevisiae strain, and they all comprise three CLiX landing pads located in the downstream intergenic regions of ALG1, MGA1, and YCT1. The differences between these strains are the lengths of upstream and downstream landing pad homology sequences (UI/DL). The lengths of each of UL and DL of the landing pads in strain A is 500 base pairs; the lengths of each of UL and DL of the landing pads in strain B is 200 base pairs; and the lengths of each of UL and DL of the landing pads in Strain C is 100 base pairs. Strain A was transformed with a locked stitch design (i.e., a GFP operably linked to a promoter), and in a separate experiment, strain A was also transformed with a split promoter design where two separately DNA constructs are used to introduce a GFP and different promoters of varying strengths similar to those described in Example 2. Strain B was transformed with DNA constructs of a split promoter design. Strain C was transformed with DNA constructs of a split promoter design. In all DNA constructs of either locked stitch design or split promoter design, each of the upstream library sequence and downstream library sequence used for homologous recombination is 500 base pairs. Integrations were validated by cPCR, fluorescence measurement, and Sanger sequencing.
(240) As shown in
7.4 Example 4: Performance of Combinatorial Integration of Library Components and Landing Pads in Production of Isoprenoid
(241) As illustrated in
(242) This library of 15 constructs was pooled together in equimolar amounts to a final concentration of 1 ?g and transformed into the parent strain along with 1 ?g of a G418-resistant plasmid encoding F-CphI. Colonies were recovered on solid media consisting of LB+G418 as previously described in 1.1. 5760 colonies were picked into 96 well plates containing minimal media (BSM) with 2% sugar. After overnight growth, cultures were subinoculated into liquid media containing either 4% sugar 1 or 6% sugar 2. After 3 days of growth, cultures were assayed for isoprenoid titer using a UV-based assay. A parent control strain (the isoprenoid-producing strain with 3 landing pads but no integrations) was provided for comparison.
(243) 42 strains were selected from the library that had improved performance in sugar 1, sugar 2, or both sugars (known as hits). These strains were re-assayed for isoprenoid titer with increased replication (12 replicates per strain) and compared to 42 hits from a separate library where the parent strain was mutagenized by UV. 37 of the 42 strains from the combinatorial library repeated as significantly improved over parent in terms of isoprenoid titer. The average effect size, or magnitude of improvement over parent, was dramatically increased over the mutagenesis library.
(244) The 42 strains that were assayed with increased replication were genotyped using standardized barcodes to determine the identity of the promoter and ORF that integrated at each locus. Instances of ORF1, a transcriptional activator, were enriched over the rest of the library. P3, the weakest promoter in the library, was paired with ORF1 in over 75% of the integrations. These results suggested that ORF1 overexpression was an effective way to increase isoprenoid titer, but only when expressed at a low level.
(245) These results shown in
(246) One or more features from any embodiments described herein or in the figures may be combined with one or more features of any other embodiment described herein in the figures without departing from the scope of the invention.
(247) A recitation of a, an, or the is intended to mean one or more unless specifically indicated to the contrary.
(248) All publications and patent, applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. While the claimed subject matter has been described in terms of various embodiments, the skilled artisan will appreciate that various modifications, substitutions, omissions, and changes may be made without departing from the spirit thereof. Accordingly, it is intended that the scope of the subject matter limited solely by the scope of the following claims, including equivalents thereof.