Expression method of Haemocoagulase Acutus (Halase) recombinant protein

Abstract

The disclosure relates to an expression method of a Haemocoagulase Acutus (Halase) recombinant protein. The method includes the following steps: (1) optimizing a halase gene; (2) performing Polymerase Chain Reaction (PCR) amplification on an optimized halase gene; (3) constructing an Agkis-pMCX expression vector, transforming plasmids to competent cells of an Escherichia coli for amplification, screening in an Amp-resistant manner for positive cloning, sequencing and extracting recombinant plasmids with correct sequencing; (4) transfecting recombinant plasmids to CHO cells; and (5) expressing the recombinant protein and identifying. According to the expression method, a recombinant halase is expressed first using the CHO cells cultured in a serum-free suspension manner; and by utilizing a bioengineering means, the actual production problems of insufficient raw material sources and unstable quality of a snake venom product are solved successfully.

Claims

1. A method of isolating a recombinant Haemocoagulase Acutus (Halase) protein comprising: (1) obtaining an optimized Halase gene comprising the sequence of SEQ ID NO:1; (2) inserting the optimized Halase gene into a mammalian expression vector; (3) transfecting the expression vector into a CHO cell; (4) culturing the transfected CHO cell in a serum-free medium, wherein the CHO cell expresses the recombinant Halase protein; and (5) isolating the recombinant Halase protein from the CHO cell.

2. The method of claim 1, wherein after (1) and before (2) the optimized Halase is amplified with PCR.

3. The method of claim 1, wherein the mammalian expression vector is a pMCX cloning vector.

4. A method of isolating a recombinant Haemocoagulase Acutus (Halase) protein comprising: (1) independently obtaining an optimized Halase gene subunit A comprising the sequence of SEQ ID NO: 13 and an optimized Halase gene subunit B comprising the of SEQ ID NO: 14; (2) independently inserting each of the subunit A and subunit B into a mammalian expression vector to obtain plasmid 1 and plasmid 2 respectively; (3) co-transfecting plasmid 1 and plasmid 2 into a CHO cell; (4) culturing the transfected CHO cell in a serum-free medium, wherein the CHO cell expresses the recombinant Halase protein; and (5) isolating the recombinant Halase protein from the CHO cell.

5. The method of claim 4, wherein after (1) and before (2) the optimized Halase subunit A and subunit B are independently amplified with PCR.

6. The method of claim 4, wherein the mammalian expression vector is a pMCX cloning vector.

7. An expression vector comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO: 13 and SEQ ID NO: 14.

8. The expression vector of claim 7, wherein the expression vector is a mammalian expression vector.

9. The expression vector of claim 8, wherein the mammalian expression vector is a pMCX cloning vector.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of SDS-PAGE electrophoresis of a recombinant halase according to an embodiment of the disclosure; and

(2) FIG. 2 is a schematic diagram of Western Blot of a recombinant halase according to an embodiment of the disclosure.

DETAILED DESCRIPTION

(3) The disclosure will be further described below with reference to specific embodiments.

(4) Embodiment: an operation method for expressing a halase recombinant protein

(5) 1. Experimental Materials

(6) 1.1 Experimental Instruments

(7) A PCR instrument: Bio-Rad Company; an electrophoresis apparatus: Beijing Junyi Dongfang Electrophoresis Equipment Co., Ltd.; a gel imaging system: Zhuhai Heima Medical Instrument Co., Ltd.; a gel cutter: Hangzhou Miu Instruments Co., Ltd.; a constant temperature mixer: Hangzhou Miu Instruments Co., Ltd.; an ultramicro ultraviolet and visible spectrophotometer: American Quawell Company; a 2-8° C. refrigerated container: Zhongke Meiling Cryogenics Co., Ltd.; a −20° C. medical low temperature container: Zhongke Meiling Cryogenics Co., Ltd.; a three-hole electrothermal constant-temperature water bath: Shanghai Hengyi Science Instrument Co., Ltd.; a bacteriological incubator: Shanghai Hengyi Science Instrument Co., Ltd.; a horizontal full-temperature shaking incubator: Shanghai Zhichu Instruments Co., Ltd.; a cell culture shaker: Adolf Kuhner Company; an ultrasonic cell crusher: Ningbo Scientz Biotechnology Co., Ltd.; a magnetic stirrer: Wiggens Company; a pH meter: Ohaus Instrument (Shanghai) Co., Ltd.; a double purification workbench: Shanghai Sujing Industry Co., Ltd.; a transfer printing system: Bio-Rad Company; a vertical electrophoresis system: Bio-Rad Company; a decolourization shaker: Shanghai Tanon Science & Technology Co., Ltd.; and an autoclave: Shanghai ShenAn Medical instrument Factory.

(8) 1.2 Experiment Reagents

(9) An expression carrier pMCX, an Escherichia coli DH5 α and CHO DG44 cells all are prepared and provided by Guangzhou Cantonbio Co., Ltd.; a KOD DNA polymerase: Toyobo (Shanghai) Biotech Co., Ltd.; a T4 DNA ligase: Novoprotein Scientific Inc.; a restriction endonuclease NotI: Thermo Fisher Scientific Company; a restriction endonuclease BamHI: Thermo Fisher Scientific Company; a plasmid extraction kit: American OMEGA Company; a DNA agarose gel recovery kit: American OMEGA Company; a DNA Marker: Thermo Fisher Scientific Company; a CHO culture medium: Lonza Company; DMSO: Tianjin No. 1 Chemical Reagent Factory; PEI: Sigma Aldrich Company; a Trypan Blue dyeing liquor: Sigma Aldrich Company; a specific polyclonal antibody: Cloud-clone Company; a rabbit IgG antibody: Proteintech Company; ampicillin: Sangon Biotech Co., Ltd.; agar powder: Guangdong Huankai Microbial Sci.&Tech, Co., Ltd.; yeast extract powder: Oxoid Company; and a peptone: Oxoid Company.

(10) 2. Experimental Methods

(11) 2.1 Gene Amplification

(12) Through a Java Codon Adaptation Tool (JCAT), a halase protein sequence is translated into a DNA sequence. The sequence is optimized according to an encoding preference of a mammal and an optimized gene sequence is synthesized by Guangzhou IGE Biotechnology Ltd, as shown in SEQ ID NO: 1.

(13) Upstream primers and downstream primers are designed according to the synthesized halase gene. Two enzyme-cut sites of Not I and BamH I are introduced to the primers. And additionally, a segment of secreted signal peptide sequence is further added, see Table 1 and the sequence (from SEQ ID NO:2 to SEQ ID NO:12).

(14) TABLE-US-00001 TABLE 1 PCR primers of recombinant halase (SEQ ID NOs: 2-12) Signal peptide Primers Sequences (5′ .fwdarw. 3) Forward primers HGFs HGF-Agkis-AB-F1 CTGCTGCAGCATGTCCTCCTGCATCTCCTCCTGCTCCCC ATCGACTGCCCCAGCGACTGG HGF-Agkis-AB-F2 ATAGCGGCCGCATGTGGGTGACCAAACTCCTGCCAGCC CTGCTGCTGCAGCATGTCCTCCT Actin A Acti-Agkis-AB-F1 TTCTGTTGGCAAGTTGCTGGATTATAGTGAGGAGGAC TGCCCCAGCGACTGGAG Acti-Agkis-AB-F2 ATAGCGGCCGCATGCCCTTGCTTTGGCTGAGAGGATTT CTGTTGGCAAGTTGCTGG Heavy chain Heavy-Agkis-AB-F1 CATTCCTGATGGCAGCTGCCCAAGGTGTCGACGCAGAC TGCCCCAGCGACTGGAG Heavy-Agkis-AB-F2 ATAGCGGCCGCATGGCTTGGGTGTGGACCTTGCCATTC CTGATGGCAGCTGCCCAA Light chain Light-Agkis-AB-F1 TTGCTGCTGCTGTGGCTTACAGGTACGCGTTGTGACTG CCCCAGCGACTGGAG Light-Agkis-AB-F2 ATAGCGGCCGCATGAGTGTGCTCACTCAGGTCCTGGCG TTGCTGCTGCTGTGGCTT Light-Agkis-B-F1 TTGCTGCTGCTGTGGCTTACAGGTACGCGTTGTGACTG CAGCAGCGGCTGGAGC Reverse primers Agkis-AB-R ATAGGATCCTTATTAGGCCTCGCACACGAAGGGGTCCT Agkis-A-R ATAGGATCCATTATTGGCCTGGAACTCGCACACGAAGT

(15) The gene sequence includes two sub-gene (A and B) sequences of the protein. Through adjusting the upstream and downstream primers, a protein gene sequence full length, an A sub-gene sequence and a B sub-gene sequence can be respectively amplified. PCR amplification is performed on the synthesized gene and a PCR product is recovered using agarose gel electrophoresis.

(16) Endonuclease digestion is performed on the amplified halase gene and a gene target segment is connected to the expression vector using the T4 ligase. An Amp (Ampicillin) is selected as a screening antibiotic.

(17) 2.2 Expression Vector Construction

(18) The recovered PCR product and the pMCX cloning vector are cut by an enzyme and are connected to construct Agkis-pMCX plasmids. The Agkis-pMCX plasmids are transformed to competent cells of an Escherichia coli for amplification, are screened in an Amp-resistant manner for positive cloning and are sent to Guangzhou IGE Biotechnology Ltd. for sequencing. The recombinant plasmids with correct sequencing are extracted and are used in a sequent CHO cell transfection test.

(19) 2.3 CHO Cell Transfection

(20) On the same day of transfection, a cell density (mioc/mL) is recorded and an appropriate amount of cells is taken and is centrifuged for 3 min at 1300 rpm. A fresh solution (31° C., preheated in advance) is used for resuspension so that the final cell density is 5 mioc/mL. During centrifugation, plasmid DNA and PEI are premixed in a clean centrifugal pipe, are blown and beaten slightly and are incubated for 3-5 min at a room temperature. A treated DNA & PEI mixture is added to prepared cells, is shaken to mix uniformly and is cultured at 31° C. After 10 min of the transfection, an appropriate amount of DMSO is added, is shaken to mix uniformly and is cultured at 31° C. After the transfection, a sample is taken to detect. Wherein, the recombinant plasmids containing the protein gene full length are independently transfected, and the recombinant plasmids containing the A sub-gene sequence and the B sub-gene sequence are co-transfected to the CHO cells.

(21) 2.4 Protein Expression and Identification

(22) (1) Sample Preparation

(23) 80 μl of cells cultured for several days is taken and is centrifugated for 3 min at 1300 rpm, a supernatant and the cells are respectively collected to precipitate, about 80 μl of supernatant is taken and is added to 20 μl of 5× loading buffer to mix uniformly, after 80 μl 1×PBS (pH7.5) of buffer is added to the cells to resuspend the cells, 20 μl (reduced) of 5× loading buffer is added to mix uniformly, the sample is boiled for 8 min at 100° C. and is centrifugated for 1 min at 1200 rpm for later use/is stored at a −20° C. refrigerator.

(24) (2) SDS-PAGE

(25) Electrophoresis on a first piece of gel: 15 μl of polyacrylamide gel which is prepared in advance and whose concentration is 12% is loaded to each pore, and after running is operated at 80V of voltage till the sample has a spacer gel and after the voltage is adjusted to 120V, the electrophoresis is performed for 90 min. Electrophoresis on a second piece of gel: 15 μl of polyacrylamide gel which is prepared in advance and whose concentration is 12% is loaded to each pore, and after running is operated at 80V of voltage till the sample has a spacer gel and after the voltage is adjusted to 120V, the electrophoresis is performed for 90 min. As shown in FIG. 1, the M is a protein marker, the cell is a cell broken liquid, and the sup is a cell culture supernate.

(26) (3) Western Blot

(27) Membrane transfer is performed for 40 min at 80 mA, and 5% of skimmed milk powder is added and is sealed for 1 h at a room temperature. A specific antibody is incubated for 2 h at the room temperature according to a proportion of 1:5000; TBST is used to clean for 3 times, 5 min for each; a rabbit anti-IgG antibody is incubated for 1 h at the room temperature; PBST is used to clean for 3 times, 5 min for each; and the membrane is developed with ECL, is exposed for 1 min and is photographed. As shown in FIG. 2, M is a protein marker, the cell is a cell broken liquid, and the sup is a cell culture supernate.

(28) 3. Experiment Result

(29) As shown in an SDS-PAGE electrophoretogram, a protein close to a molecular weight of a target protein is respectively detected in cell broken liquids containing six recombinant vectors such as HGFs, Heavy, Acti, Light, HA+HB and LA+HB and there is nearly no visible strip in the cell culture supernate. With further detection and identification of Western Blot, in addition to HGFs, the expression of the target protein is detected in the cell broken liquids containing the five recombinant vectors such as the Heavy, the Acti, the Light, the HA+HB and the LA+HB and the molecular weight is about 32 kDa, and no visible strip is seen in the cell culture supernate.