USE OF PHOSPHORYLATED TAU AND P38GAMMA TO TREAT A NEUROLOGICAL CONDITION
20230053214 · 2023-02-16
Assignee
Inventors
Cpc classification
A61P25/28
HUMAN NECESSITIES
C12Y207/11024
CHEMISTRY; METALLURGY
A61P9/10
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to a method of treating or preventing a neurological condition mediated by a tau-dependent signalling complex in neurons of a subject, comprising treating the subject to: (a) promote phosphorylation of one or more amino acids residues of tau, wherein the phosphorylation of the amino acid residues causes disruption of the tau-dependent signalling complex in neurons of the subject; or (b) introduce a variant of tau that causes disruption of the tau-dependent signalling complex in neurons of the subject. The invention also relates to vectors, compositions and kits for treating or preventing a neurological condition mediated by a tau-dependent signalling complex in neurons of a subject.
Claims
1-59. (canceled)
60. A method of treating or preventing a neurological condition mediated by a tau-dependent signalling complex in neurons of a subject, comprising administering an agent which elevates p38γ activity, or the activity of a variant of p38γ, in the neurons of the subject.
61. The method of claim 60, wherein the agent elevates p38γ activity, or the activity of a variant of p38γ, by elevating the amount of p38γ in the neuron or elevating the amount of the variant of p38γ in the neuron.
62. The method of claim 60, wherein the agent comprises a nucleic acid sequence encoding p38γ or a variant of p38γ, wherein the nucleic acid encoding p38γ or a variant of p38γ, is operably linked to regulatory sequence for expressing the p38γ or a variant of p38γ, in neurons of the subject.
63. The method of claim 60, wherein the variant of p38γ phosphorylates tau at T205, comprises the amino acid sequence represented by SEQ ID NO: 31 (KRVTYKEVLSFKPPRQLGARVSKETPL), and is at least 80% identical to the amino acid sequence of SEQ ID NO: 2 (p38γ).
64. The method of claim 60, wherein the agent comprises p38γ or a variant thereof, or a nucleic acid that is capable of expressing p38γ or a variant thereof, in neurons of the subject.
65. The method of claim 60, wherein the variant of p38γ phosphorylates tau at T205, comprises an amino acid sequence that is at least 85%, 90%, 95 or 99% identical to the amino acid sequence of p38γ (SEQ ID NO: 2), and comprises a PDZ interaction motif.
66. The method of claim 60, wherein the variant of p38γ is a constitutively active variant of p38γ (p38γ.sup.CA).
67. The method of claim 66, wherein the constitutively active variant of p38γ (p38γ.sup.YA) comprises an amino acid substitution of aspartic acid to alanine at position 179 of p38γ.
68. The method of claim 60, wherein the tau-dependent signalling complex comprises PSD-95, tau and FYN.
69. The method of claim 60, wherein the neurological condition is a condition caused by neuronal damage from overactivation of the tau-dependent signalling complex.
70. The method of claim 67, wherein the condition is selected from the group consisting of Alzheimer's disease, frontotemporal dementia, amyotrophic lateral sclerosis, Huntington's disease, Parkinsons's disease, neural damage from stroke, and epilepsy.
71. A method of disrupting a signalling complex comprising PSD-95, tau and FYN in a neuron, comprising contacting the neuron with an agent that elevates p38γ activity, or the activity of a variant of p38γ, in the neuron.
72. The method of claim 71, wherein the agent elevates p38γ activity, or the activity of a variant of p38γ, by elevating the amount of p38γ in the neuron, or elevating the amount of the variant of p38γ in the neuron.
73. The method of claim 71, wherein the agent comprises a nucleic acid sequence encoding p38γ or a variant of p38γ, wherein the nucleic acid encoding p38γ or a variant of p38γ, is operably linked to regulatory sequence for expressing the p38γ or a variant of p38γ, in neurons of the subject.
74. The method of claim 71, wherein the variant of p38γ phosphorylates tau at T205, comprises the amino acid sequence represented by SEQ ID NO: 31 (KRVTYKEVLSFKPPRQLGARVSKETPL), and is at least 80% identical to the amino acid sequence of SEQ ID NO: 2 (p38γ).
75. The method of claim 71, wherein the agent comprises p38γ or a variant thereof, or a nucleic acid that is capable of expressing p38γ or a variant thereof, in neurons of the subject.
76. The method of claim 71, wherein the variant of p38γ phosphorylates tau at T205, comprises an amino acid sequence that is at least 85%, 90%, 95 or 99% identical to the amino acid sequence of p38γ (SEQ ID NO: 2), and comprises a PDZ interaction motif.
77. The method of claim 71, wherein the agent comprises p38γ or a variant thereof, or a nucleic acid that is capable of expressing p38γ or a variant thereof, in the neuron.
78. The method of claim 71, wherein p38γ comprises the amino acid sequence of SEQ ID NO: 2.
79. The method of claim 71, wherein the variant of p38γ comprises an amino acid sequence that is at least 85%, 90%, 95 or 99% identical to the amino acid sequence of p38γ (SEQ ID NO: 2) and comprises a PDZ interaction motif.
80. The method of claim 71, wherein the variant of p38γ is a constitutively active mutant of p38γ.
81. The method of claim 80, wherein the constitutively active mutant of p38γ (p38γ.sup.CA) comprises an amino acid substitution of aspartic acid to alanine at position 179 of p38γ.
82. The method of claim 71, wherein the neuron is in a subject.
Description
DESCRIPTION OF THE DRAWINGS
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
DETAILED DESCRIPTION
[0175] The present invention relates to a method of treating or preventing a neurological condition mediated by a tau-dependent signalling complex in neurons of a subject. The inventors have found that promoting phosphorylation of one or more amino acid residues of tau, wherein the phosphorylation of the amino acid residues causes disruption of the tau-dependent signalling complex in neurons of the subject, or introducing a variant of tau that causes disruption of the tau-dependent signalling complex in neurons of the subject, can be used to treat or prevent neurological conditions mediated by a tau-dependent signalling complex, such as AD.
[0176] A tau-dependent signalling complex is a post-synaptic signalling complex, typically associated with the N-methyl-D aspartate receptor (NMDA receptor), which can mediate excitotoxicity in neurons. A signalling complex is a complex of proteins which are involved in transduction of a signal in a cell. A tau dependent signalling complex requires tau in order to transduce the signal. The tau-dependent signalling complex typically comprises tau as a component of the complex.
[0177] Excitotoxicity refers to the process by which neurons are damaged or killed by excessive stimulation of glutamatergic receptors, such as NMDA receptors, and is mediated via signalling complexes in the postsynaptic space. Neural damage from excitotoxicity is associated with a number of neurological conditions. Neural damage in stroke patients is believed to be caused, at least in part, by overactivation of glutamatergic receptors and associated signalling complexes by excessive amounts of extracellular glutamate that are released immediately following ischaemic stroke. Neural damage in epilepsy is also thought to result from excitotoxicity caused by overactivation of glutamatergic receptors and associated signalling complexes following release of glutamate during epileptic events.
[0178] The tau-dependent signalling complex is also thought to mediate amyloid-β (Aβ) toxicity in Alzheimer's disease (AD). In Alzheimer's disease (AD), amyloid-β (Aβ) has been shown to induce toxicity in neurons through a signalling complex comprising NMDA receptors, PSD-95, tau and FYN. □□
[0179] The tau-dependent signalling complex typically comprises tau. In one embodiment, the tau-dependent signalling complex comprises PSD-95 and tau. In one embodiment, the tau-dependent signalling complex comprises PSD-95, FYN and tau. Typically, the tau-dependent signalling complex comprises NMDA receptors, PSD-95, tau and FYN.
[0180] The neurological condition may be any neurological condition mediated by a tau-dependent signalling complex. Typically, the neurological condition is caused by neuronal damage from overactivation of the tau-dependent signalling complex. Examples of such conditions include, for example, Alzheimer's disease, frontotemporal dementia, amyotrophic lateral sclerosis, Huntington's disease, Parkinson's disease, neural damage from stroke and neural damage from epilepsy.
[0181] In one embodiment, the neurological condition is Alzheimer's disease.
[0182] In one embodiment, the neurological condition is stroke.
[0183] In one embodiment, the neurological condition is epilepsy.
[0184] In one embodiment, the method comprises treating the subject to promote phosphorylation of one or more amino acid residues of tau, wherein the phosphorylation of the amino acid residues causes disruption of the tau-dependent signalling complex. As used herein, “disruption of the tau-dependent signalling complex” refers to an effect which prevents the tau-dependent signalling complex from mediating excitotoxicity and Aβ toxicity, and includes destabilising, dismantling or preventing formation of, the signalling complex. In one embodiment, the one or more amino acid residues of tau that are phosphorylated to cause disruption of the tau-dependent signalling complex are one or more amino acid residues that would be phosphorylated by the MAP kinase p38γ. In one embodiment, the one or more amino acid residues of tau that are phosphorylated to cause disruption of the tau-dependent signalling complex is threonine at position 205 (T205). In one embodiment, the one or more amino acid residues of tau that is phosphorylated to cause disruption of the tau-dependent signalling complex is threonine at position 205 (T205) and one or more amino acid residues selected from the group consisting of serine at position 199 (S199), serine at position 396 (S396) and serine at position (S404). In various embodiments, the amino acid residues of tau that are phosphorylated to cause disruption of the tau-dependent signalling complex are: (a) T205; (b) T205, S199; (c) T205, S199, S396; (d) T205, S199, S396, S404; (e) T205, S199, S404; (f) T205, S396, S404; (g) T205, S396; or (h) T205, S404.
[0185] In one embodiment, the subject is treated to promote phosphorylation of tau at one or more amino acid residues, wherein phosphorylation of the amino acid residues causes disruption of the tau-dependent signalling complex in neurons of the brain of the subject.
[0186] In one embodiment, the subject is treated by administering an agent that elevates tau that has been phosphorylated at one or more amino acid residues, wherein the phosphorylation of the amino acid residues causes disruption of the tau-dependent signalling complex.
[0187] The agent may comprise, for example, a nucleic acid sequence, a nucleic acid analogue, a protein, a peptide, or a small molecule. Typically, administration of the agent introduces the agent into neurons of the subject. More typically, administration of the agent introduces the agent into neurons of the brain of the subject.
[0188] In some embodiments, the agent comprises a nucleic acid sequence which is introduced into neurons of the subject. The nucleic acid is then transcribed and translated in the neurons.
[0189] In some embodiments, the agent can cross the blood-brain barrier, or can be formulated to cross the blood-brain barrier.
[0190] As used herein, a “subject” is a mammal. The mammal can be a human, non-human primate, sheep, mouse, rat, dog, cat, horse, cow, pig, or any other mammals which can suffer from a neurological condition mediated by a tau-dependent signalling complex in neurons. Typically, the subject is a human.
[0191] In one embodiment, the subject is treated by administering an agent that elevates p38γ activity, or activity of a variant of p38γ, in neurons of the subject. p38γ, also known as ERK6, SAPK3 and MAPK12, is a mitogen activated protein kinase (MAP Kinase). In one embodiment, the p38γ is from a mammal. For example, the p38γ may be from a human, mouse, dog, cat, pig, cow, rat, non-human primate, goat, sheep. Typically, the p38γ is human p38γ. Wild type p38γ is activated through phosphorylation of tyrosine and threonine residues in the motif TGY. Wild type p38γ phosphorylates tau following activation. Activation of p38γ is carried out by the MAP kinase kinases MKK3 and MKK6, which are in turn activated upon phosphorylation by the MAPK kinase MAP3K.
[0192] As described in the Examples, the inventors have found that phosphorylation of tau by p38γ results in disruption of NR/PSD-95/tau/FYN complexes in cultured neurons and in a mouse model of Alzheimer's disease; limits Aβ-induced toxicity in cultured neurons in a mouse model of Alzheimer's disease; and reduces the severity of pentylenetetrazole (PTZ) induced seizures in a mouse model of excitotoxicity and epilepsy. The inventors have shown that by introducing p38γ, or a constitutively active variant of p38γ, into neurons of mice, NR/PSD-95/tau/FYN complexes in neurons are disrupted and Aβ-induced excitotoxicity is reduced in a mouse model of Alzheimer's disease, and the severity of pentylenetetrazole (PTZ) induced seizures in a mouse model of excitotoxicity and epilepsy is reduced.
[0193] An agent that elevates p38γ activity, or the activity of a variant of p38γ, in a neuron may be an agent that: (a) elevates the amount of p38γ, typically the amount of active p38γ, in the neuron; and/or (b) elevates the amount of a variant of p38γ, typically the amount of an active variant of p38γ, in the neuron; and/or (c) elevates the amount of p38γ activation in the neuron; and/or (d) elevates the amount of activation of the variant of p38γ in the neuron, if the variant if not an active variant. As used herein, “p38γ activity” is an activity of activated p38γ that causes disruption of the tau-dependent signalling complex. Typically, the activity of activated p38γ that causes disruption of the tau-dependent signalling complex is phosphorylation of tau at T205, and optionally phosphorylation of tau at one or more amino acid residues selected from the group consisting of, for example, S199, S396, and S404. The “activity of a variant of p38γ” refers to an activity of a variant of p38γ which is the same as, or substantially similar to, p38γ activity. The variant of p38γ may be capable of p38γ activity without activation (for example, an active variant, such as a constitutively active variant), or may exhibit p38γ activity following activation. p38γ activity is elevated in a neuron when the amount of p38γ activity in the neuron after treatment is increased relative to the amount of p38γ activity in the neuron prior to treatment. The activity of a variant of p38γ is elevated in a neuron when the amount of activity of the variant in the neuron after treatment is increased relative to the amount of activity of the variant in the neuron prior to treatment. The p38γ activity, or the activity of a variant of p38γ, may be elevated by administering an agent which elevates: [0194] (a) the amount of endogenous p38γ in the neurons, such as increasing expression (transcription and/or translation) of endogenous p38γ; and/or [0195] (b) the amount of exogenous p38γ in the neurons; and/or [0196] (c) the amount of a variant of p38γ in the neurons; and/or [0197] (d) the activation of endogenous p38γ, exogenous p38γ and/or variant of p38γ, in the neurons.
[0198] In one embodiment, the p38γ activity, or the activity of a variant of p38γ, is elevated by administering an agent which elevates the amount of exogenous p38γ, or a variant thereof, in neurons. The amount of exogenous p38γ, or a variant thereof, may be elevated by introducing into neurons p38γ, or a variant thereof, or by introducing into neurons a nucleic acid capable of expressing p38γ, or a variant thereof.
[0199] Thus, in one embodiment, the agent which elevates p38γ activity, or the activity of a variant of p38γ, in neurons of the subject, may comprise the p38γ protein or variant thereof, or a nucleic acid that is capable of expressing p38γ, or a variant thereof, in neurons of the subject. The nucleic acid sequence encoding full-length wild-type human p38γ, together with the amino acid sequence of full-length wild-type human p38γ, used in the Examples described herein is shown in
[0200] In one embodiment, the agent which elevates p38γ activity, or the activity of a variant of p38γ, comprises a nucleic acid that encodes p38γ or a variant thereof. Those skilled in the art will be able to determine the appropriate nucleic acid sequence which encodes the amino acid sequence of the p38γ or variant thereof. For example, a nucleic acid sequence which encodes p38γ may comprise a nucleic acid sequence that is in the range of from about 60% to 100% identical to the wild-type coding sequence of human p38γ (SEQ ID NO: 1). For example, the nucleic acid encoding p38γ may have a sequence that has at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the wild-type coding sequence of p38γ using one of the alignment programs described herein using standard parameters. Those skilled in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by a nucleotide sequence by taking into account codon degeneracy, reading frame positioning, and the like.
[0201] In one embodiment, the agent which elevates p38γ activity, or the activity of a variant of p38γ, comprises a variant of p38γ. In one embodiment, the agent which elevates p38γ activity, or the activity of a variant of p38γ, comprises a nucleic acid that encodes a variant of p38γ. As used herein, a variant of p38γ is a protein which differs from the wild-type human p38γ protein by one or more amino acid substitutions, additions or deletion, and which is capable of phosphorylating an amino acid residue of tau which causes disruption of the tau-dependent signalling complex. Typically, the variant of p38γ phosphorylates tau at residue T205, and optionally one or more residues selected from the group consisting of S199, S396, S404. In one embodiment, the variant of p38γ comprises an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to the amino acid sequence of wild-type human p38γ. In one embodiment, the variant of p38γ comprises an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to the amino acid sequence represented by SEQ ID NO: 2.
[0202] As used herein, “% identity” with reference to a polypeptide, or “% identical to the amino acid sequence of a polypeptide”, refers to the percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection.
[0203] Sequence comparison algorithms for determining % identity between two polypeptides are known in the art. Examples of such algorithms are the algorithm of Myers and Miller (1988); the local homology algorithm of Smith et al. (1981); the homology alignment algorithm of Needleman and Wunsch (1970); the search-for-similarity-method of Pearson and Lipman (1988); the algorithm of Karlin and Altschul (1990), modified as in Karlin and Altschul (1993). Computer implementations of these algorithms for determining % identity between two polypeptides include, for example: CLUSTAL (available from Intelligenetics, Mountain View, Calif.) (Pearson et al. (1994)); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wis., USA).
[0204] In some embodiments, the variant of p38γ may comprise a part of p38γ. In one embodiment, the variant of p38γ comprises a PDZ interaction motif. PSD-95 comprises a PDZ motif, and p38γ is believed to interact with PSD-95, at least in part, through the PDZ interaction motif. The PDZ interaction motif of p38γ is a short amino acid sequence in the C-terminal portion of the p38γ molecule (see
[0205] In some embodiments, the variant of p38γ may comprise a part of p38γ but otherwise differ from the wild-type p38γ. In this regard, the inventors envisage that variants of p38γ may include protein in which the PDZ interaction motif of p38γ is fused to the carboxy-terminus of other kinases, such as MAP kinase or other serine/threonine kinases, or variants of other kinases that carry mutations to modify their activity. For example, the variant of p38γ may comprise the PDZ interaction motif of p38γ fused to the carboxy-terminus of a kinase selected from the group consisting of p38α, p38β and p38δ, or variants of p38α, p38β and p38δ that carry mutations that modify their activity.
[0206] In one embodiment, the variant of p38γ is an active variant of p38γ. An active variant of p38γ is a variant which does not require activation by the MAP kinase kinases MKK3 and MKK6 in order to exhibit p38γ activity. In one embodiment, the active variant of p38γ is a constitutively active variant of p38γ. A constitutively active variant of p38γ is a variant of p38γ which is continuously active and therefore does not require activation by the MAP kinase kinases MKK3 and MKK6. Typically, a constitutively active variant comprises one or more amino acid substitutions which result in continuous activity. In one embodiment, the constitutively active variant of p38γ comprises the amino acid substitution of D179A. The amino acid sequence of an example of a constitutively active variant of p38γ is shown in
[0207] In one embodiment, there is provided a method of treating Alzheimer's disease in a subject, comprising administering a nucleic acid sequence which expresses p38γ or a variant thereof, typically a constitutively active variant of p38γ, in neurons of the subject.
[0208] In one embodiment, there is provided a method of treating stroke in a subject, comprising administering a nucleic acid sequence which expresses p38γ or a variant thereof, typically a constitutively active variant of p38γ, in neurons of the subject.
[0209] In one embodiment, there is provided a method of treating epilepsy in a subject, comprising administering a nucleic acid sequence which expresses p38γ or a variant thereof, typically a constitutively active variant of p38γ, in neurons of the subject.
[0210] In another embodiment, the subject is treated by administering an agent that introduces into neurons of the subject a variant of tau that causes disruption of the tau-dependent signalling complex. As used herein, a “variant of tau” is a tau protein comprising one or more amino acid substitutions, insertions, or deletions, of the full length wild-type tau, wherein the one or more deletions is not more than 100 contiguous amino acids, typically not more than 90, 80, 70, 60, 50, 40, 30, 20, or 10 contiguous amino acids. In one embodiment, the variant of tau comprises one or more amino acid substitutions or insertions of the wild-type tau. In one embodiment, the variant of tau comprises one or more amino acid substitutions of the wild-type tau. In one embodiment, the variant of tau is a phosphomimetic of tau that causes disruption of the tau-dependent signalling complex. As used herein, a phosphomimetic of tau is a variant of tau comprising one or more amino acid substitutions, and which functions in a manner that is the same as, or substantially the same as, that of unsubstituted tau following phosphorylation of the unsubstituted tau at a particular amino acid. A phosphomimetic comprises a phosphomimetic substitution.
[0211] As described in the Examples, the inventors have shown that introduction of a T205E variant of tau into hippocampal neurons lowered Aβ-induced toxicity in the neurons. The T205E variant of Tau is a phosphomimetic of Tau phosphorylated at T205. A phosphomimetic substitution is an amino acid substitution in a protein which results in the protein functioning in a manner which is the same as, or substantially the same as, the unsubstituted protein following phosphorylation of the unsubstituted protein. A phosphomimetic substitution of tau is an amino acid substitution at a site of tau which results in a tau protein that functions in the same, or substantially the same, manner to the wild-type tau following phosphorylation of the wild-type tau, typically at that site.
[0212] In one embodiment, the method comprises treating the subject to introduce a phosphomimetic of tau comprising a phosphomimetic substitution of tau that causes disruption of, or reduces formation of, the tau-dependent signalling complex. In one embodiment, the one or more phosphomimetic substitutions are at amino acid residues of the tau protein that are phosphorylated by p38γ. In one embodiment, the phosphomimetic substitution of tau is threonine to glutamic acid at position 205 of tau (T205E), with amino acid numbering based on the longest human tau isoform comprising 441 amino acids. The amino acid sequence of full-length wild-type human tau (SEQ ID NO: 4) and tau T205E (SEQ ID NO: 5) is shown in
[0213] Typically, the variant of tau is a variant of human tau. In other embodiments, the variant of tau may be a variant of tau from a non-human mammal. For example, the variant of tau may be a variant of tau from a mouse, dog, cat, pig, cow, rat, non-human primate, goat, sheep.
[0214] In one embodiment, there is provided a method of treating Alzheimer's disease in a subject, comprising administering a nucleic acid sequence which expresses tau which differs from wild-type tau in an amino acid substitution of threonine to glutamic acid at position 205 (T205E), in neurons of the subject.
[0215] In one embodiment, there is provided a method of treating stroke in a subject, comprising administering a nucleic acid sequence which expresses tau which differs from wild-type tau in an amino acid substitution of threonine to glutamic acid at position 205 (T205E), in neurons of the subject.
[0216] In one embodiment, there is provided a method of treating epilepsy in a subject, comprising administering a nucleic acid sequence which expresses tau which differs from wild-type tau in an amino acid substitution of threonine to glutamic acid at position 205 (T205E), in neurons of the subject.
[0217] In embodiments in which the agent comprises a nucleic acid that is capable of expressing p38γ or a variant thereof, or the variant of tau, in neurons of the subject, a nucleic acid sequence encoding p38γ or a variant thereof, or the variant of tau, is typically operably linked to regulatory sequence to direct expression of the p38γ, or variant thereof, or the variant of tau, in the neurons of the subject. A nucleic acid that is capable of expressing p38γ or a variant thereof, or a variant of tau, in neurons of a subject may comprise an expression cassette comprising the coding sequence of p38γ or variant thereof, or the variant of tau. An expression cassette is a nucleic acid sequence comprising coding sequence and regulatory sequence which operate together to express a protein encoded by the coding sequence in a cell. “Coding sequence” refers to a DNA or RNA sequence that codes for a specific amino acid sequence. It may constitute an “uninterrupted coding sequence”, i.e., lacking an intron, such as in a cDNA, or it may include one or more introns bounded by appropriate splice junctions.
[0218] The expression cassette typically includes regulatory sequences. A “regulatory sequence” is a nucleotide sequence located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding sequence, and which influences the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences are known in the art and may include, for example, transcriptional regulatory sequences such as promoters, enhancers translation leader sequences, introns, and polyadenylation signal sequences. The coding sequence is typically operably linked to a promoter. A promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding sequence usually located downstream (in the 3′ direction) from the promoter. The coding sequence may also be operably linked to termination signals. The expression cassette may also include sequences required for proper translation of the coding sequence. The expression cassette including the coding sequence may be chimeric. A “chimeric” vector or expression cassette, as used herein, means a vector or cassette including nucleic acid sequences from at least two different species, or has a nucleic acid sequence from the same species that is linked or associated in a manner that does not occur in the “native” or wild type of the species. The coding sequence in the expression cassette may be under the control of a constitutive promoter or of a regulatable promoter that initiates transcription only in a particular tissue or cell type, or when the host cell is exposed to some particular stimulus. For example, in an expression cassette comprising a nucleic acid encoding p38γ, the coding sequence may be operably linked to a promoter which is not native to the p38γ gene, such as a promoter that expresses the coding sequence in, or is inducible in, neurons. Examples of suitable neural promoters include synapsin (SYN), calcium/calmodulin-dependent protein kinase (CaMKII), tubulin alpha I (Ta1), neuron-specific enolase (NSE), platelet derived growth factor beta chain (PDGF), MfP, dox, GFAP, Preproenkephalin, dopamine β-hydroxylase (dβH), prolactin, chicken beta actin, prion protein, murine Thy1.2, myelin basic promoter, or any of the above combined with an enhancer, such as a partial cytomegaly virus promoter. Examples of other promoters which may be used to express nucleic acid sequence in neurons include, the SV40 early promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter; adenovirus major late promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. Inducible or controllable promoters include, for example, promoters whose transcriptional activity is modified in the presence or absence of mifepristone, doxycycline, tetracycline or tamoxifen.
[0219] A nucleic acid encoding a protein (coding sequence) is operably linked to a regulatory sequence when it is arranged relative to the regulatory sequence to permit expression of the protein in a cell. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence.
[0220] As used herein, “expression” of a nucleic acid sequence refers to the transcription and translation of a nucleic acid sequence comprising a coding sequence to produce the polypeptide encoded by the coding sequence.
[0221] In one embodiment, the agent is a vector. In such vectors, the nucleic acid sequence encoding p38γ or variant thereof, or the variant of tau, or an expression cassette comprising such sequences, is inserted into an appropriate vector sequence. The term “vector” refers to a nucleic acid sequence suitable for transferring genes into a host cell, such as a neuron. The term “vector” includes plasmids, cosmids, naked DNA, viral vectors, etc. In one embodiment, the vector is a plasmid vector. A plasmid vector is a double stranded circular DNA molecule into which additional sequence may be inserted. The plasmid may be an expression vector. Plasmids and expression vectors are known in the art and described in, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual, 4.sup.th Ed. Vol. 1-3, Cold Spring Harbor, N.Y. (2012).
[0222] In some embodiments, the vector is a viral vector. Viral vectors comprise viral sequence which permits, depending on the viral vector, viral particle production and/or integration into the host cell genome and/or viral replication. Viral vectors which can be utilized with the methods and compositions described herein include any viral vector which is capable of introducing a nucleic acid into neurons, typically neurons of the brain. Examples of viral vectors include adenovirus vectors; lentiviral vectors; adeno-associated viral vectors; Rabiesvirus vectors; Herpes Simplex viral vectors; SV40; polyoma viral vectors; poxvirus vector.
[0223] In one embodiment, the viral vector is an adeno-associated viral (AAV) vector for packaging in an adeno-associated virus. In one embodiment, the AAV vector is a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAVrh10, AAVrh20, AAVrh39, AAVrh43, and AAVcy5 vector or variants thereof. In one embodiment, the viral vector is serotype AAV1, AAV9, AAVrh10 or AAVcy5. In one embodiment, the serotype of the AAV vector is AAV1. In another embodiment, the serotype of the AAV vector is AAV9. In another embodiment, the serotype of the AAV vector is AAVrh10. In another embodiment, the serotype of the AAV vector is AAVcy5. The use of recombinant AAV for introducing nucleic acids into cells is known in the art and described in, for example, US20160038613; Grieger and Samulski (2005) Adeno-associated virus as a gene therapy vector: vector development, production and clinical applications, Advances in Biochemical Engineering/Biotechnology 99: 119-145; Methods for the production of recombinant AAV are known in the art and described in, for example, Harasta et al (2015) Neuropsychopharmacology 40: 1969-1978. An example of an adeno-associated viral vector capable of expressing p38γ in neuronal cells is shown in
[0224] In another embodiment, the viral vector is a lentiviral vector. Methods for production and use of lentiviral vectors are known in the art and described in, for example, Naldini et al. (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector, Science, 272:263-267; Lois et al. (2002) Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors, Science, 295:868-872; Vogel et al (2004), A single lentivirus vector mediates doxycycline-regulated expression of transgenes in the brain. Hum Gene Ther. 2004; 15(2):157-165.
[0225] Adenoviruses are also contemplated for use in delivery of nucleic acid agents. Thus, in another embodiment, the viral vector is an adenoviral vector. Adenoviral vectors are known in the art and described in, for example, Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993); Southgate et al. (2008) Gene transfer into neural cells in vitro using adenoviral vectors, Current Protocols in Neuroscience, Unit 4 23, Chapter 4; Akli et al. (1993) Transfer of a foreign gene into the brain using adenovirus vectors. Nature genetics, 3(3): 224-228.
[0226] Another aspect provides a vector as described herein, typically a viral vector as described herein.
[0227] Viral vectors are typically packaged into viral particles using methods known in the art. The viral particles may then be used to transfer cell lines, including neural cell lines, or neural tissue, either in vitro or in vivo. Thus, another aspect provides a viral particle comprising a vector described herein.
[0228] A further aspect provides an agent as described herein.
[0229] The agent described herein may be formulated as a pharmaceutical composition. Accordingly, in another aspect, there is provided a pharmaceutical composition comprising the agent described herein. The composition comprises the agent in a pharmaceutically acceptable carrier. Methods for the formulation of agents with pharmaceutical carriers are known in the art and are described in, for example, Remington's Pharmaceutical Science, (17.sup.th ed. Mack Publishing Company, Easton, Pa. 1985); Goodman & Gillman's: The Pharmacological Basis of Therapeutics (11.sup.th Edition, McGraw-Hill Professional, 2005).
[0230] Acceptable carriers, diluents and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
[0231] Administration of the agent to subject may be by intracranial, intravenous, intraperitoneal, subcutaneous, intramuscular, intranasal or intrathecal injection. Compositions suitable for intracranial, intravenous, intraperitoneal, subcutaneous, intramuscular, intranasal or intrathecal use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The pharmaceutically acceptable carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
[0232] In embodiments in which the agent is packaged in a viral particle, the pharmaceutical compositions may comprise viral particles in any concentration that allows the agent to be effective. In such embodiments, the pharmaceutical compositions may comprise the virus particle in an amount of from 0.1% to 99.9% by weight. Pharmaceutically acceptable carriers include water, buffered water, saline solutions such as, for example, normal saline or balanced saline solutions such as Hank's or Earle's balanced solutions), glycine, hyaluronic acid etc.
[0233] Titers of viral particles to be administered will vary depending on, for example, the particular vector to be used, the mode of administration, extent of the condition, the individual, and may be determined by methods standard in the art.
[0234] The agent described herein may be formulated for introduction into neuronal cells by non-viral methods such as microinjection, electroporation, microparticle bombardment, liposome uptake, nanoparticle-based delivery etc.
[0235] In one embodiment, the agents described herein may be formulated in one or more liposomes, lipoplexes, or lipid nanoparticles. In one embodiment, the agents described herein are formulated in liposomes. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Liposome design may include, for example, opsonins or ligands in order to improve the attachment of liposomes to tissue or to activate events such as, for example, endocytosis.
[0236] The formation of liposomes may depend on the physicochemical characteristics such as the agent and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the agent, any additional processes involved during the application and/or delivery of the vesicles, the optimization size, polydispersity and the shelf-life of the vesicles for the intended application, and the batch-to-batch reproducibility and possibility of large-scale production of safe and efficient liposomal products.
[0237] Methods for the production of liposomes and lipid nanoparticles for delivery of agents are known in the art, and described in, for example, U.S. Pat. No. 5,264,221.
[0238] The term “administering” should be understood to mean providing a compound or agent to a subject in need of treatment.
[0239] It will be understood that the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors including, for example, the activity of the specific compound or agent employed, the metabolic stability and length of action of that compound or agent, the age, body weight, general health, sex, diet, mode and time of administration, drug combination, the severity of the particular condition, and the host undergoing therapy.
[0240] Also provided is a kit, comprising a container comprising the agent. The container may be simply a bottle comprising the agent in parenteral dosage form, each dosage form comprising a unit dose of the agent. The kit will further comprise printed instructions. The article of manufacture will comprise a label or the like, indicating treatment of a subject according to the present method. In one form, the article of manufacture may be a container comprising the agent in a form for parenteral dosage. For example, the agent may be in the form of an injectable solution in a disposable container.
[0241] As used herein, “treating” means affecting a subject, tissue or cell to obtain a desired pharmacological and/or physiological effect and includes inhibiting the condition, i.e. arresting its development; or relieving or ameliorating the effects of the condition i.e. cause reversal or regression of the effects of the condition.
[0242] As used herein, “preventing” means preventing a condition from occurring in a cell or subject that may be at risk of having the condition, but does not necessarily mean that condition will not eventually develop, or that a subject will not eventually develop a condition. Preventing includes delaying the onset of a condition in a cell or subject.
[0243] The inventors envisage that p38γ or variants of tau can be used in transgenic animals to assess whether a neurological disease can be treated with the methods described herein.
[0244] Accordingly, a further aspect provides a transgenic non-human animal comprising a transgenic nucleic acid sequence which is capable of expressing in neurons of the transgenic animal p38γ or a variant thereof, or a variant of tau that causes disruption of the tau-dependent signalling complex.
[0245] In one embodiment, the transgenic nucleic acid sequence is a nucleic acid sequence capable of expressing p38γ or a variant thereof. In one embodiment, the transgenic nucleic acid sequence is capable of expressing an active variant of p38γ. In one embodiment, the active variant of p38γ is a constitutively active variant of p38γ. In one embodiment, the constitutively active variant of p38γ is p38γ.sup.CA.
[0246] The regulatory sequences for expressing the transgene in neurons of the animal are described above.
[0247] In one embodiment, the transgenic animal is a mouse. However, it will be understood that the transgenic animal may be any animal, including, for example, a rat, cow, sheep, pig or goat.
[0248] Another aspect provides a method of assessing whether a neurological condition can be treated or prevented by a method described herein, comprising the steps of: [0249] (a) providing a test animal suffering from the neurological condition or exhibiting a phenotype which is a model for the neurological condition; [0250] (b) crossing the test animal with a transgenic animal to obtain progeny, the transgenic animal comprising a transgenic nucleic acid sequence which is capable of expressing in neurons of the animal p38γ or a variant thereof, or a variant of tau that causes disruption of the tau-dependent signalling complex; and [0251] (c) assessing the severity of the neurological condition or the phenotype which is a model for the neurological condition in progeny expressing the transgenic nucleic acid sequence.
[0252] In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word “comprise” or variations such as “comprises” or “comprising” is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
[0253] All publications mentioned in this specification are herein incorporated by reference. It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
[0254] In order to exemplify the nature of the present invention such that it may be more clearly understood, the following non-limiting examples are provided.
EXAMPLES
Materials and Methods
[0255] Mice. APP23 mice expressing human K670N/M671L mutant APP in neurons (C Sturchler-Pierrat et al., Proc Natl Acad Sci USA 94, 13287-92 (1997)), Alz17 mice expressing human non-mutant tau in neurons (A Probst et al., Acta Neuropathol 99, 469-81 (2000)), neuron-specific Thy1.2-cre transgenic mice (I Dewachter et al., J Neurosci 22, 3445-53 (2002)), tau.sup.−/− (KL Tucker, M Meyer, Y A Barde, Nat Neurosci 4, 29-37 (2001)), p38α.sup.loxP/loxP (FB Engel et al., Genes Dev 19, 1175-87 (2005)), p38β.sup.−/− and p38γ.sup.−/− (A R Pogozelski et al., PLoS One 4, e7934 (2009)), and p38δ.sup.−/− mice (G Sumara et al., Cell 136, 235-48 (2009)) were previously described. Knockouts for p38β, p38γ and p38δ were global without overt phenotypes, while p38α deletion had to be limited to the CNS due to embryonic mortality of global p38α knockout mice. To obtain p38α.sup.Δneu mice, we crossed p38α.sup.loxP/loxP with Thy1.2-cre strain. All lines were maintained on a C57Bl/6 background. Animal experiments were approved by the Animal Ethics Committee of the University of New South Wales. Mice were genotyped by polymerase chain reaction using isopropanol-precipitated DNA from tail biopsies as template. Oligonucleotide primers for genotyping targeted alleles and transgenes by PCR are listed in the following Table 1:
TABLE-US-00001 TABLE 1 SEQ SEQ ID ID Forward primer (5′-3′) NO: Reverse primer (5′-3′) NO:: APP23 GTTCTGCTGCATCTTGGACA 56 GAATTCCGACATGACTCAGG 57 Alz17 GGGTGTCTCCAATGCCTGCTTCTTCAG 58 AAGTCACCCAGCAGGGAGGTGCTCAG 59 p38αlox TCCTACGAGCGTCGGCAAGGTG 60 AGTCCCCGAGAGTTCCTGCCTC 61 p38β AGAAGATGAAGGTGGAGGAGTACAAGC 62 TAACCCGGATGGCTGACTGTTCCATT 63 AAG TAG p38γ TGGGCTGCGAAGGTAGAGGTG 64 GTGTCACGTGCTCAGGGCCTG 65 p38δ ACGTACCTGGGCGAGGCGGCA 66 GCTCAGCTTCTTGATGGCCAC 67 tau.sup.WT CTCAGCATCCCACCTGTAAC 68 CCAGTTGTGTATGTCCACCC 69 tau.sup.KO AAGTTCATCTGCACCACCG 70 TGCTCAGGTAGTGGTTGTCG 71 Thy1.2- GCGGTCTGGCAGTAAAAACTATC 72 GTGAAACAGCATTGCTGTCACTT 73 Cre Thy1.2- AAGTCACCCAGCAGGGAGGTG 74 TCGTATGGGTACATGGCCAAAG 75 38.sub.γ.sup.CA
Generation of Transgenic Thy1.2-p38γ.sup.CA Mice.
[0256] The human p38γ coding sequence carrying the D179A mutation and an N-terminal hemagglutinin (HA)-tag was amplified by PCR and inserted into the XhoI site of the plasmid pEX12 (Ittner, et al. Proc. Natl. Acad. Sci. U.S.A. 105, 15997-16002) (2008)) carrying the mThy1.2 promoter for neuronal expression using Gibson assembly (Gibson, et al. Nat. Methods 6, 343-345 (2009) (
Seizures.
[0257] Seizures were induced with pentylenetetrazole (PTZ, Sigma-Aldrich) as previously described (LM Ittner et al., Cell 142, 387-97 (2010)). Briefly, PTZ was injected i.p. at 30 or 50 mg/kg body weight. Seizures were graded as: 0, no seizures; 1, immobility; 2, tail extension; 3, forelimb clonus; 4, generalized clonus; 5, bouncing seizures; 6, full extension; 7, status epilepticus.
Spatial Learning/Memory Testing.
[0258] Spatial learning/memory was tested in the Morris Water maze paradigm (C V Vorhees, M T Williams, Nat Protoc 1, 848-58 (2006)). Briefly, a custom-built water tank for mouse Morris Water maze (122 cm diameter, 50 cm height) with white non-reflective interior surface in a room with low-light indirect lighting was filled with water (19-22° C.) containing diluted non-irritant white dye. Four different distal cues were placed surrounding the tank at perpendicular positions reflecting 4 quadrants. In the target quadrant, a platform (10 cm.sup.2) was submerged 1 cm below the water surface. Videos were recorded on CCD camera and analyzed using AnyMaze Software. For spatial acquisition, four trials of each 60 seconds were performed per session. The starting position was randomized along the outer edge of the start quadrant for all trials. To test reference memory, probe trials without platform were performed for a trial duration of 60 seconds, and recordings were analyzed for time spent within each quadrant. For visually-cued control acquisition (to exclude vision impairments), a marker was affixed on top of the platform and four trials (60 s) per session were performed. All mice were age and gender-matched and tested at 4 months of age. Mice that displayed continuous floating behavior were excluded. Genotypes were blinded to staff recording trials and analyzing video tracks. Tracking of swim paths was done using the AnyMaze software (Stolting). Average swimming speed was determined to exclude motor impairments.
[0259] Touchscreen operant chambers (Campden Instruments) were used with 2 different paradigms to address spatio-temporal memory and learning (differential paired-associates learning, dPAL) or recognition memory/discrimination learning (pairwise discrimination task, PD). Previously described touchscreen chamber protocols were used (Horner et al. Nat. Protoc. 8, 1961-1984 (2013)). Mice in dPAL schedule underwent pre-testing procedures and training as follows: food deprivation (to 85-90% of initial body weight) and adaptation to handling (day 0-4), adaptation to touchscreen boxes (day 4), collect reward (strawberry milk shake, Nippy's) (day 5-8), panel-pushing to collect reward training (day 9), initial stimulus-dependent touch training (day 10), must touch stimulus training (day 11-16), must initiate trial training (day 17-22), punish incorrect touches (day 23-26). Followed by either dPAL acquisition for 21 consecutive days (day 27-49) or pairwise discrimination task acquisition (day 27-31). Maximum time of sessions was set to 60 minutes. Maximum number of trials was set to 36. All training sessions were repeated until mice reached criterion before next training paradigm was started. Criterion was defined as 36 trials within 60 minutes (initial touch training, must touch training, must initiate training) or 27 out of 36 correct trials (punish incorrect touches). Mice with excessive body weight loss were excluded from the protocol.
Behavior and Motor Testing
[0260] Novelty-induced locomotion and anxiety-related behavior was assessed in the open field test paradigm as previously described (Ke, et al. Acta Neuropathol. 130, 661-678 (2015)). Briefly, mice were placed individually in 40×40 cm.sup.2 boxes in dimly lit sound-insulated enclosures and movements were recorded for 15 minutes. Mice had not been exposed to open field paradigm before. Boxes were wiped with 70% ethanol between recordings. Movements were tracked using the AnyMaze software (Stolting). Analysis was either accumulated over entire recording period or split in 1-minute bins. Motor performance was tested on a 5-wheel Rota-Rod treadmill (Ugo Basile) in acceleration mode (5-60 rpm) over 120 (aged) or 180 (young) seconds (van Eersel, et al. Neuropathol. Appl. Neurobiol. 41, 906-925 (2015)). The longest time each mouse remained on the turning wheel out of 3 attempts per session was recorded. Grip strength was determined as previously described (Ke et al. (2015)). Briefly, the force required to pull mice off a metal wire was measured using s grip strength meter (Chatillon, AMETEK). Mice were placed such that they had a double grip on a thin metal wire attached to the meter, and they were pulled away from the meter in a horizontal direction until they let go, and a peak force (N) was recorded at the moment when the mice let go. The highest force from three attempts was recorded.
Calcineurin Activity Assay
[0261] Calcineurin activity in cortical extracts of p38γ.sup.−/− and p38γ.sup.+/+ littermates was determined by following the manufacturer's instructions (Abcam).
Electroencephalography.
[0262] Hippocampal EEG recording in freely moving mice was carried out as previously described (A A Ittner, A Gladbach, J Bertz, L S Suh, L M Ittner, Acta Neuropathol Commun 2, 149 (2014)). Briefly, wire EEG electrodes of remote telemetric transmitters (DSI) were implanted in mice anesthetized with ketamine/xylazine. The head was fixed in a stereotactic frame (Kopf instruments) and the bregma was located. Bone openings were drilled using a bone micro-drill (Fine Science Tools, F.S.T.) at positions previously described for the hippocampus (x 2.0, y −2.0, z −2 with reference to bregma). Electrodes were inserted at this position with reference electrode placed above the cerebellum (x 0, y −6.0, z 0 from bregma). Electrodes were fixed in place by polyacrylate followed by wound closure and rehydration. Following 10 days of recovery from the surgery, EEGs were recorded with a DSI wireless receiver setup (DSI) with amplifier matrices using the Dataquest A.R.T. recording software at 500 Hz sampling rate (M Weiergraber, M Henry, J Hescheler, N Smyth, T Schneider, Brain Res Brain Res Protoc 14, 154-64 (2005)). Two days after EEG recordings were completed, animals were transcardially perfused with cold phosphate-buffered saline (PBS) and brains extracted for biochemical and histological analysis. Correct placement of electrodes was confirmed by serial sections of paraffin embedded brain tissue stained with hematoxylin-eosin. Only recordings from mice with correct placement of electrodes were included in further analysis.
[0263] Analysis of EEG recordings was performed using the NeuroScore software v3.0 (DSI) with integrated spike detection module, to determine spike train duration, frequency and number of spikes per train were obtained. Recordings were screened manually for movement artefacts and only artefact-free EEG passages were used for analysis. Raw local field potentials (LFP) were noise filtered using a powerline noise filter (Neuroscore, DSI). Spectral analysis (i.e. analysis of signal power at individual frequencies expressed as square of the fast Fourier transform (FFT) magnitude) of intra-ictal sequences was performed using the integrated FFT spectral analysis function of NeuroScore. Frequency bands of theta and gamma wave forms were defined between 4-12 Hz and 25-100 Hz, respectively. Gamma and theta spectral contributions were quantified by area-under-curve (AUC) analysis across the defined frequency band in 8 artefact- and hypersynchronous spike-free sequences per recording (each 1 min in length). Cross-frequency coupling of theta phase and gamma amplitude was performed using MATLAB as previously described (A B Tort, R Komorowski, H Eichenbaum, N Kopell, J Neurophysiol 104, 1195-210 (2010)). Briefly, for cross frequency coupling analysis, raw LFP was noise filtered using a powerline noise filter (Neuroscore, DSI). Noise-filtered LFP was filtered at two frequency ranges of interest for gamma (f.sub.A) and theta (f.sub.p). The phase time series for theta (Φ.sub.fp(t)) and the amplitude envelope time series for gamma (Δ.sub.fA(t)) were obtained by Hilbert transformation of the filtered LFPs. The combined series [Φ.sub.fp(t), A.sub.fA(t)] was then generated. After phase binning, the means Ā.sub.fA(j) of A.sub.fA for each bin j were calculated and normalized using the sum Σ.sub.j-i.sup.NĀ.sub.fa(j) of Ā.sub.fA(j) over N bins to generate phase-amplitude distribution P(j). The modulation index is based on calculating the Kullback-Leibler distance D.sub.KL between the non-uniform (i.e. coupled) phase-amplitude distribution P(j). The modulation index is based on calculating the Kullback-Leibler distance DK, between the non-uniform (i.e. coupled) phase-amplitude distribution P(j) over all phase bins and the uniform (i.e. uncoupled) distribution U(j).
[0264] The modulation index MI is defined as
[0265] Phase-amplitude distributions and modulation indices were determined from artefact- and hypersynchronous spike-free 8 sequences (each 1 min) per recording.
[0266] Synaptosome and post-synaptic density preparation Purification of synaptosomes from cortical tissue was performed as previously described (Ittner, et al. Cell 142, 387-397 (2010)). Briefly, cortical tissue was weighed and homogenized in ice-cold sucrose buffer (0.32M sucrose, 1 mM NaHCO.sub.3, 1 mM MgCl.sub.2, 0.5 mM CaCl.sub.2), protease inhibitors (EDTA-free, Roche)) at 30 mg tissue/ml using a pre-cooled dounce homogenizer. After clearing the homogenate by centrifugation (1,400 g, 10 minutes, 4° C.), pellets were resuspended in sucrose buffer and centrifuged again (1,400 g, 10 minutes, 4° C.). Combined supernatants were centrifuged again and supernatant (total brain homogenate) was spun at 13,800 g for 10 minutes at 4° C. Pellet was resuspended in sucrose buffer and layered on top of 5% Ficoll (Sigma) and centrifuged at 45,000 g for 45 minutes at 4° C. Pellet was resuspended in 5% Ficoll and layered on top of 13% Ficoll and centrifuged at 45,000 g for 45 minutes at 4° C. The interface (synaptosomes) was collected, diluted in 5% Ficoll and centrifuged at 45,000 g for 30 minutes at 4° C. Supernatant (non-synaptic) was collected and pellet was resuspended in pH8 buffer (20 mM Tris pH8, 1% Triton-X100, 100 mM NaCl, 1 mM EGTA, 1 mM EDTA, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), protease inhibitors (EDTA-free, Roche)). After centrifugation at 40,000 g for 30 minutes at 4° C., pellets (post-synaptic densities) were resuspended in 5% SDS. The supernatants constituted synaptic non-PSD associated proteins. Protein concentrations for different fractions was determined before preparing samples for Western blotting.
Plasmids.
[0267] Plasmids for expression of rat PSD95 (kind gift from Wei-dong Yao; Addgene plasmid #15463), Fyn kinase (kind gift from Filippo Giancotti; Addgene plasmid #16032) and NR2B (kind gift from Robert Malinow; Addgene plasmid #23998), and were obtained from the Addgene depository. For live cell fluorescence confocal imaging, PSD-95 was internally tagged with mCherry between PDZ domains 2 and 3 by megaprime PCR (Bryksinet al. Biotechniques 48, 463-465 (2010)) and tau variants were tagged with eGFP by cloning into peGFP-C1 (Clontech).
[0268] Coding sequences for human p38α, human p38β and human p38γ were cloned into pcDNA3.1 with an N-terminal HA-tag. Coding sequence for human p38δ was cloned in peGFP-C1. Mutations in p38 coding sequences for generation of active variants (M Avitzour et al., FEBS J 274, 963-75 (2007)) and variants of p38γ lacking the PDZ motif (ΔPDZm) were generated using the Q5 site-directed mutagenesis kit (NEB). Coding sequence for human tau (441 amino acids) was cloned into pcDNA3.2/V5-DEST (Invitrogen). Phosphorylation-site mutants of tau were generated using the Q5 site-directed mutagenesis kit (NEB). Oligonucleootide primers for molecular cloning are listed in Table 2.
TABLE-US-00002 TABLE 2 SEQ SEQ ID ID Forward primer (5′-3′) NO: Reverse primer (5′-3′) NO: tauS46D CCTGAAAGAAgatCCCCTG 76 CCAGCGTCCGTGTCACCC 77 CAGACCCCC tauT50E TCCCCTGCAGgaaCCCACTGAGG 78 GATTCTTTCAGGCCAGCG 79 tauT52E GCAGACCCCCgaaGAGGACGGAT 80 AGGGGAGATTCTTTCAGG 81 C tauT69E TGCTAAGAGCgaaCCAACAGCGG 82 TCAGAGGTTTCAGAGCCC 83 tauT71E GAGCACTCCAgaaGCGGAAGATG 84 TTAGCATCAGAGGTTTCAG 85 tauT111E CATTGGAGACgaaCCCAGCCTGG 86 CCTGCTTCTTCAGCTGTG 87 tauT153E GAAGATCGCCgaaCCGCGGGGAG 88 GTTTTACCATCAGCCCCC 89 tauT181E CGCTCCAAAGgaaCCACCCAGCT 90 GGCGGGGTTTTTGCTGGA 91 C TauS199A CGGCTACAGCGCCCCCGGCT 92 CTGCGATCCCCTGATTTTGGA 93 CCC G TauS199D CGGCTACAGCGACCCCGGCT 94 CTGCGATCCCCTGATTTTGGA 95 CCC G tauS202A CAGCCCCGGCgccCCAGGCACTC 96 CTGTAGCCGCTGCGATCCCCTG 97 tauS202D CAGCCCCGGCgacCCAGGCACTC 98 CTGTAGCCGCTGCGATCC 99 tauS208D CACTCCCGGCgacCGCTCCCGCA 100 CCTGGGGAGCCGGGGCTG 101 C tauT212E CCGCTCCCGCgaaCCGTCCCTTC 102 CTGCCGGGAGTGCCTGGG 103 CAAC tauS235D TCCACCCAAGgacCCGTCTTCCG 104 GTACGGACCACTGCCACC 105 C TauS404A TGGGGACACGGCTCCACGGC 106 GACACCACTGGCGACTTGTAC 107 ATC ACG TauS404D TGGGGACACGGATCCACGGC 108 GACACCACTGGCGACTTG 109 ATC TauT205A CTCCCCAGGCGCTCCCGGCA 110 CCGGGGCTGCTGTAGCCGC 111 GCC TauT205E CTCCCCAGGCGAACCCGGCA 112 CCGGGGCTGCTGTAGCCG 113 GCCG TauS199 CCCAGGCGCTCCCGGCAGCC 114 GAGCCGGGGGCGCTGTAGCCG 115 AT205A GCTCCCGC CTGCGATCCCC TauS199 CCCAGGCGAACCCGGCAGCC 116 GAGCCGGGGTCGCTGTAGCCG 117 DT205E GCTCCCGC CTGCGATCCCC TauS396A CGTGTACAAGGCGCCAGTGG 118 ATCTCCGCCCCGTGGTCTG 119 TGT TauS396D CGTGTACAAGGACCCAGTGG 120 ATCTCCGCCCCGTGGTCT 121 TGTCTGGGG TauS396 TGGGGACACGGCTCCACGGC 122 GACACCACTGGCGCCTTGTAC 123 AS404A ATCTCAGCAAT ACGATCTCCGC TauS396 TGGGGACACGGACCCACGGC 124 GACACCACTGGGTCCTTGTAC 125 DS404D ATCTCAGCAAT ACGATCTCCGC tauS422D CATGGTAGACgatCCCCAGCTCG 126 TCGATGCTGCCGGTGGAG 127 CCAC tauS199A CCCAGGCGCTCCCGGCAGCCGCT 128 GAGCCGGGGGCGCTGTAGCCGCTG 129 T205A CCCGC CGATCCCC tauS199D CCCAGGCGAACCCGGCAGCCGCT 130 GAGCCGGGGTCGCTGTAGCCGCTG 131 T205E CCCGC CGATCCCC tauS396A TGGGGACACGGCTCCACGGCATC 132 GACACCACTGGCGCCTTGTACACG 133 S404A TCAGCAAT ATCTCCGC tauS396D TGGGGACACGGACCCACGGCATC 134 GACACCACTGGGTCCTTGTACACG 135 S404D TCAGCAAT ATCTCCGC mCherry CAAGCCCAGCAATGCCTACCTGA 136 CGAGGTTGTGATGTCTGGGGGAGC 137 PSD-95 GTGACGTGAGCAAGGGCGAGGAG ATAGCTCTTGTACAGCTCGTCCAT G GCC
[0269] Adeno-associated virus vectors (von Jonquieres, et al. PLOS ONE 8, e65646 (2013)) for neuronal expression (pAM-CAG) of wildtype (
Adeno-Associated Viruses.
[0270] Packaging of rAAV1 vectors was performed as described (A E Harasta et al., Neuropsychopharmacology 40, 1969-78 (2015)). Titres were determined by Quantitative polymerase chain reaction (qPCR). One μl (1×10.sup.9 viral particles) of either AAV-SG1-shR or AAV-ctr-shR vector was injected at 3 sites each bilaterally into the brains of cryoanaesthetized neonatal mice as described (G von Jonquieres et al., PLoS One 8, e65646 (2013)).
Cell Culture.
[0271] Primary hippocampal neurons from E16.5 mouse embryos were cultured, using our standard protocol (T Fath, Y D Ke, P Gunning, J Gotz, L M Ittner, Nat Protoc 4, 78-85 (2009)). Cytotoxicity was determined by measuring LDH release, using a commercial assay (Promega), or by visualization of EthD1 (Thermo Fisher Scientific) added to the cell culture medium 5 min before fixation with 4% PFA/PBS. 293T cells were cultured in DMEM/10% FBS/1% Glutamate/1% P/S (Life Technologies) and transfected by calcium precipitation (A Ittner et al., J Exp Med 209, 2229-46 (2012)). Primary neurons were transduced by AAV infection (A E Harasta et al., Neuropsychopharmacology 40, 1969-78 (2015)).
Live Cell Confocal Imaging and FLIM/FRET Analysis
[0272] FLIM/FRET measurements were performed using a time resolved, inverted confocal fluorescence microscope (Microtime200, PicoQuant GmbH). Excitation of the donor GFP was via a single-photon fiber coupled pico-second-pulsed diode 473 nm laser (20 MHz repetition rate, 2 ms dwell time, 256×256 pixel array) using a 63× water objective (1.25 NA). Fluorescence emission was collected through a 510/32 Semrock BrightLine band pass emission filter onto a single-photon avalanche diode (SPAD) coupled to high speed timing electronics for time-correlated single-photon counting (TCSPC).
[0273] Fluorescence images were analysed by phasor plot using the SimFCS software (Globals Software, USA). Briefly, Fourier transformation of the decay curve at each pixel was performed and the resulting transforms were plotted as a 2D histogram. The phasor position for the donor only was determined by measuring the donor in the absence of the acceptor. The FRET samples were measured and the phasor position along the quenching trajectory is calculated according to classical FRET efficiency calculation:
where E is FRET efficiency, t.sub.D is the fluorescence lifetime of the Donor in absence of acceptor, and t.sub.DA is the fluorescence lifetime in the presence of acceptor.
Cell Immunofluorescence Staining and Microscopy
[0274] Cell staining was done as previously described ((LM Ittner et al., Cell 142, 387-97 (2010))). Briefly, cells were fixed with 4% PFA for 10 min, washed with phosphate buffered saline (PBS), permeabilised with 0.02% NP-40 and blocked with blocking buffer (3% horse serum/1% bovine albumin in PBS). Primary antibodies diluted in blocking buffer were incubated over-night at 4° C. or for 1 hour at room temperature. After washing with PBS, secondary antibodies diluted in blocking buffer with or without addition of DAPI to visualize cell nuclei were incubated for 1 hour at room temperature. Cells were then washed and mounted using anti-fade mounting medium (Prolong Gold, Life Technologies). Secondary antibodies used were coupled to Alexa 488, 555, 568 or 647 dyes (Molecular Probes). Confocal images were acquired on a Zeiss LSM780 confocal microscope with a Plan-Apochromatic 100×1.4 NA objective or on a Zeiss LSM880 Airyscan confocal microscope with a Plan-Apochromatic 100×1.4 NA objective using the Zen software (Zeiss). Epifluorescence imaging was done on a BX51 bright field/epifluorescence microscope (UPlanFL N lenses [¥/0.17/FN26.5]: 10×/0.3, 20×/0.5, 40×/0.75, 60×/1.25oil and 100×/1.3oil) equipped with a DP70 color camera (Olympus) using CellSens software (Olympus).
Human Brain Samples
[0275] Human entorhinal cortex tissue samples were received from the New South Wales Brain Tissue Resource Centre at the University of Sydney and the Sydney Brain Bank at Neuroscience Research Australia, which are supported by The University of New South Wales, Neuroscience Research Australia and Schizophrenia Research Institute. Frozen tissue was lysed in phosphate buffered saline (20% w/v) using a rotating dounce homogeniser followed by five is sonication bursts at 20% power (Vibra Cell, Sonics). Lysates were centrifuged at 3,000×g for 10 minutes at 4° C. and supernatants were used for analysis. Details on patients are provided in Table 3. Use of human brain samples was approved by the Human Research Ethics Committees of the University of New South Wales and University of Sydney.
TABLE-US-00003 TABLE 3 APOE Group Age (y) Gender PMI CoD genotype Braak 0 93 F 21 Cardiac failure E3/E3 0 0 85 F 23 Respiratory failure E3/E3 0 0 79 M 8 Respiratory failure E2/E3 0 0 89 F 23 Metastatic adenocarcinoma E3/E4 0 0 86:5 ± 3.0 18.8 ± 3.6 I/II 78 F 11 Respiratory failure E3/E3 I I/II 80 M 12 Respiratory failure E3/E3 I I/II 103 M 20 Cardiorespiratory failure E3/E3 II I/II 101 F 9 Cardiorespiratory failure E3/E3 II I/II 88 F 31 Cardiorespiratory failure E3/E3 II I/II 90:0 ± 5.2 16.4 ± 4.1 III/IV 93 F 7 Cardiorespiratory failure E2/E3 III III/IV 102 F 5 Acute renal failure E2/E3 IV III/IV 92 F 5 Infection E3/E3 IV III/IV 76 F 3 Cardiac failure E3/E4 IV III/IV 90:8 ± 5.4 5.0 ± 0.8 V/VI 98 F 11 Stroke E3/E3 VI V/VI 85 F 10 Cardiac failure E3/E3 VI V/VI 100 F 4 Pneumonia E3/E4 VI V/VI 100 F 3 Aspiration pneumonia E3/E3 VI V/VI 91 F 6 Cardiorespiratory failure E3/E3 VI V/VI 94.8 ± 3.0 6.8 ± 1.6 PMI, post mortem; CoD, cause of death; bold values, mean ± SEM of group
Histological Sections and Staining
[0276] Mice were transcardially perfused with phosphate-buffered saline followed by 4% paraformaldehyde (PFA) and post-fixing in 4% PFA overnight. Tissue was processed in an Excelsior tissue processor (Thermo) for paraffin embedding. Thioflavin S staining to visualize amyloid plaques were performed following a standard protocol (LM Ittner et al., Cell 142, 387-97 (2010)). Muscle cross-sections were stained with primary antibodies to laminin (Sigma) as previously described (Ke, et al. Acta Neuropathol. 130, 661-678 (2015)). Brain sections from AAV-injected mice were stained with primary antibody to tau (Tau13; Abcam) or HA-tag (HA-7; Sigma-Aldrich) to visualize viral transgene expression. Serial paraffin sections of human entorhinal cortex samples were obtained from the NSW Brain Bank and stained with a standard Nissl protocol for counting. Neuronal counting was done on an Olympus BX51 microscope equipped with agraticulated ocular (U100H6; Olympus). Neurons with the nucleolus, nucleus and cytoplasm visible within a single plane of the section were considered for counting. Forthe CA fields (CA4-1), three random and non-overlapping fields of view were selected. For the entorhinal cortex, three non-overlapping strips of cortex extending from the pial surface and into the grey-white matter junction were marked for counting. Subsequent cortical counts were then performed across three adjacent graticule fields spanning perpendicularly to the pial surface. Mean cell counts across the section were then normalised into cell density values of neurons per mm2. All tissue sections were imaged on a BX51 bright field/epifluorescence microscope (UPlanFL N lenses [¥/0.17/FN26.5]: 10×/0.3, 20×/0.5, 40×/0.75, 60×/1.25oil and 100×/1.3oil) equipped with a DP70 color camera (Olympus).
Western Blotting
[0277] Western blotting was performed as previously described (A Ittner et al., J Exp Med 209, 2229-46 (2012)). Bands were visualized by chemiluminescence on X-ray films or ChemiDoc MP (Biorad). Densitometric quantification of Western blot results was performed using ImageJ 2.0.0-rc-49/1.51d (NIH). Antibodies used in this study were: anti-NR1 (Chemicon), anti-NR2B (Santa Cruz), antiphosphoTyrosine1473-NR2B (Affinity BioReagents), anti-PSD95 (Millipore), anti-Fyn (Santa Cruz), anti-phospho-Y418 Fyn (Invitrogen), anti-phospho-Y529 Fyn (Invitrogen), anti-APP (22C11), anti-Aβ (6E10), anti-tau (DAKO), anti-tau (tau-1, Millipore), anti-tau (Tau13, Abcam), anti-phospho-Serine199 tau (Abcam), anti-phospho-Serine202 tau (Abcam), anti-phospho-Threonine205 tau (Abcam), antiphospho-Threonine212 tau (Abcam), anti-phospho-Serine214 tau (Millipore), anti-phospho-Threonine231 tau (Abcam), anti-phospho-Serine235 tau (Abcam), anti-phospho-Serine356 tau (Abcam), anti-phospho-Serine396 tau (Abcam), anti-phospho-Serine404 tau (Millipore), anti-phospho-Serine422 tau (Millipore), PHF-1 (phospho-Serine396-phospho-Serine404 tau; kind gift by P. Davies), anti-p38alpha (Cell Signaling), anti-p38beta (Santa Cruz), anti-p38gamma (R&D), anti-p38delta (R&D), anti-phosphoThreonine180/Tyrosine182-p38 (Cell Signaling Technologies), anti-Flag (M2, Sigma), anti-HA7 (Sigma), anti-V5 (Invitrogen), anti-MAP2 (mouse Abcam), anti-MAP2 (chicken: Abcam), anti-β3 tubulin (Covance), anti-NeuN (Abcam), anti-Debrin (Sigma), anti-Synaptophysin (Abcam), anti-αsynuclein (Sigma), anti-glyceraldehyde dehydrogenase (anti-GAPDH, Millipore).
Immunoprecipitation.
[0278] Immunopreciptation was performed from cell or tissue lysates as previously described (L M Ittner et al., Cell 142, 387-97 (2010)). Briefly, cells were lysed in pTNN buffer (20 mM Tris pH7.4, 150 mM NaCl, 1 mM EDTA, 1 mM Na3VO4, 1 mM NaF, 1 mM glycerophosphate, 2.5 mM Na.sub.2H.sub.2P.sub.2O.sub.7, 1 mM PMSF, protease inhibitors (Complete, Roche), 1% NP-40 substitute (Sigma-Aldrich)) on ice. Lysates were cleared by centrifugation (16,000×g/10 min/4° C.). Protein concentration was determined (DC Protein Assay, BioRad) and 200 μg of lysate incubated with antibody (1:400) for 3 h on a rotator at 4° C. Equilibrated and blocked protein G-beads (Life Technologies) were incubated with lysates for 45 min on a rotator at 4° C. Beads were then washed 3 times and incubated in sample buffer for 5 min at 95° C. before SDS-PAGE. Cortical or hippocampal tissues were homogenized in RIPA buffer (20 mM Tris pH8.0, 150 mM NaCl, 1 mM EDTA, 1 mM Na3VO4, 1 mM NaF, 1 mM glycerophosphate, 2.5 mM sodium pyrophosphate, 1 mM PMSF, protease inhibitors (Complete, Roche), 1% NP-40 substitute (Sigma-Aldrich), SDS, sodium deoxycholate) and subjected to immunoprecipitation as outlined above. Quantitative densitometric analysis was performed using Image J2.0.0-rc-49/1.51d (NIH) and levels for immunoprecipiations of PSD-95/tau/Fyn complexes were expressed relative to immunopreciptateed PSD-95 protein levels.
Microscale Thermophoresis (MST)
[0279] Tau variants were purified as GST-fusion proteins from E. coli BL21DE3pLys (Promega) using glutathione resin (GE Healthcare) followed by concentration and buffer exchange using ultrafiltration spin columns (10,000 molecular weight cut-off; Vivaspin, Sartorius). eGFP-PSD-95 was expressed in 293T cells and lysates were prepared in TNN buffer (20 mM Tris pH7.4, 150 mM sodium chloride, 1% NP40 substitute, sodium orthovanadate, sodium pyrophosphate, glycerophosphate, sodium fluoride, protease inhibitors (Complete; Roche)) 48 h after transfection. Concentrations of fusion proteins were determined by absorbance measurements (Nanodrop 2000C; Thermo-Fisher) using molar extinction coefficients. Thermophoresis of GFP-PSD-95 was measured on a Monolith NT115 (Nanotemper technologies) using 50% LED power and 20% MST power with 5 s pre-MST and 30 s MST-time with serials dilutions (1:1) of GST-tau (starting concentration 9 μM). Thermophoresis and temperature-jump normalized fluorescence curves from three independent experiments were expressed as fraction of the bound state of the fluorophores-tagged protein (Wienken et al. Nat. Commun. 1, 100 (2010)). Thermophoresis was plotted as a function of tau concentration and non-linear curves fitting to determine experimental equilibrium dissociation constants (KD) was performed using sum-of-squares minimization (Marquardt method; Graphpad Prism 6).
Kinase Assay.
[0280] Recombinant proteins were expressed in bacteria and purified as previously described (A Ittner et al., J Exp Med 209, 2229-46 (2012)). Purity of proteins was assessed by SDS-PAGE and Coomassie staining. Kinase assay reactions were performed as previously described (A Ittner et al., J Exp Med 209, 2229-46 (2012)). Briefly, 0.5 μg recombinant p38γ was mixed with 1 μg of recombinant human tau in kinase reaction buffer (Promega) and incubated for 30 min at 30° C. Kinase reactions were stopped by addition of sample buffer and incubation for 5 min at 95° C.
Mass Spectrometry
[0281] Phospho-peptide mapping of tau after in vitro p38γ kinase reactions was done as previously described (Dolai, et al. Cancer Res. 76, 2766-2777 (2016), Thingholm, et al. Nat. Protoc. 1, 1929-1935 (2006)). Briefly, kinase treated protein extracts containing tau were reduced with 3 mM tris(2-carboxyethyl)phosphine (TCEP, 56° C., 10 min), alkylated with 6 mM iodoacetamide (ambient temp, 30 min), buffer exchanged and concentrated using 100 mM ammonium bicarbonate and 3 kDa spin-filters (Amicon Ultra-4 centrifugal filters, Merck KGaA, Darmstadt, Germany) followed by trypsin digest (25:1 w/w protein:trypsin ratio, 16 h, 37° C.). A portion of the material was enriched for phosphopeptides using Titansphere Phos-TiO kit, with TiO2 Spin tips (GL Sciences, Tokyo, Japan), following the manufacturer's protocol. Phosphopeptide enriched and non-enriched samples were analysed by LC-MS/MS using Orbitrap mass spectrometers (LTQ-Orbitrap Velos with CID and ETD activation modes and HCD on the QExactive Plus: Thermo Electron, Bremen, Germany) to maximize identification of phosphopeptides. Chromatography was carried out by nano-LC (Dionex UltiMate 3000 HPLC, Thermo Scientific, Waltham, USA) with autosampler system (Dionex, Amsterdam, Netherlands). Peptides (1-7 μL injected) were initially captured on a C18 cartridge (Acclaim PepMap 100, 5 μm 100 Å, Thermo Scientific Dionex, Waltham, USA), switching to a capillary column (10 cm) containing C18 reverse phase packing (Reprosil-Pur, 1.9 μm, 200 Å, Dr. Maisch GmbH, Ammerbuch-Entringen, Germany), supported within a column heater (45° C., Sonation GmbH, Germany). Peptides were eluted using a 40 min gradient of buffer A (H.sub.2O:CH.sub.3CN of 98:2 containing 0.1% formic acid) to 45% buffer B (H.sub.2O:CH.sub.3CN of 20:80 containing 0.1% formic acid) at 200 nL/min, with high voltage applied at the column inlet. Mass spectrometer settings were: electrospray voltage 2000V, capillary temperature 275-300° C., positive ion mode, data dependent acquisition mode with a survey scan acquired (m/z 375-1750) and up to ten multiply charged ions (charge state≥2+) isolated for MS/MS fragmentation (counts >2500 for CID, >5000 for ETD and intensity threshold of 8.0×104 for HCD). Nitrogen was used as HCD collision gas and fluoranthene anion reagent for ETD. Peak lists were generated from the raw data using MASCOT Distiller (Matrix Science, London, England) and searched using the MASCOT search engine (version 2.5, Matrix Science) and the NCBInr database (downloaded 24-10-15) using Homo sapiens taxonomy. Search parameters were: peptide tolerance of ±4 ppm and MS/MS tolerances of ±0.4 Da for CID and ETD or ±0.05 Da for HCD, variable modifications were carbamidomethyl cys, met oxidation, phospho (ST) and phospho (Y), peptide charge of 2+, 3+, and 4+, enzyme specificity trypsin with up to three missed cleavages allowed.
Aβ Preparation.
[0282] Aβ42 (Bachem) was prepared and pre-aggregated at a concentration of 100 μM as described (M P Lambert et al., Proc Natl Acad Sci USA 95, 6448-53 (1998)). Briefly, hexafluoro-2-propanol (Sigma) dissolved and evaporated Aβ was reconstituted in dimethyl sulfoxide (Sigma) at 5 mM and then diluted in phenol-red free F-12 medium (Invitrogen) to a final concentration of 100 μM, followed by brief vortexing and incubation at 4° C. for 24 hours. Further dilutions were done in culture medium.
Aβ Levels and Pathology.
[0283] Aβ40 and Aβ42 and levels were determined by ELISA as previously described (L M Ittner et al., Cell 142, 387-97 (2010)). Plaque load was determined as previously described (LM Ittner et al., Cell 142, 387-97 (2010)).
Statistical Analysis.
[0284] Statistical analysis was performed using Graphpad Prizm Version 6.0 (Student's t test or ANOVA). Linear regression and correlation analysis was done by sum of-squares minimization. Survival data were analyzed by log-rank Mantel-Cox testing. All values are presented as mean±standard error of the mean (SEM).
Results
[0285] To understand the molecular contributions of p38 kinases to AD, we first challenged mice with individual deletion of p38α, p38β, p38γ or p38β (
[0286] To test whether the effects of p38γ depletion on PTZ-induced seizures would also impact on Aβ-induced deficits in AD mouse models, we crossed p38γ.sup.−/− mice with mutant APP expressing APP23 mice. These APP23.p38γ.sup.−/− mice were assessed for seizure sensitivity by administering PTZ. The results are shown in
[0287] p38γ levels were determined in extracts from brains of humans without Alzheimer's disease (Braak 0) and from humans with different neuropatholocial disease stages ranging from Braak I to Braak VI (Table 3). The results are shown in FIGS. 23A and 23B. As can be seen from
[0288] In summary, p38γ modulates excitotoxicity, neuronal circuit synchronicity, premature mortality and memory deficits in APP23 mice, without changes in Aβ. In addition, p38γ levels are reduced in APP23 mice and humans suffering from AD.
[0289] To determine if levels of tau affect the excitotoxicity-limiting effects of p38γ in vivo, we crossed non-mutant human tau-expressing Alz17 mice (22) with p38γ.sup.−/− mice, to challenge these mice with PTZ. The results are shown in
[0290] To determine whether the Aβ toxicity-limiting effects of p38γ were tau-dependent, APP23.p38γ.sup.−/− mice were crossed with tau.sup.−/− mice, and the resulting crosses assessed for survival, memory deficit and neuronal network disfunction. The results are shown in
[0291] Tau resides in a post-synaptic signaling complex with Fyn and PSD-95 that mediates Aβ-induced excitotoxicity (8). Interaction of tau, Fyn and PSD95 in Alz17.p38γ.sup.−/− brains was enhanced compared to Alz17.p38γ.sup.+/+ mice (
[0292] Importantly, neither p38αCA, p38βCA nor p38δCA reduced NR2B phosphorylation, indicating that regulation of PSD-95/tau/Fyn complexes is a non-redundant function of p38γ. Interestingly, both p38γ and p38γ.sup.CA interacted with PSD-95 (
[0293] While p38γ phosphorylates tau at multiple epitopes during long-term in vitro kinase assays, possibly contributing to tau hyperphosphorylation (25), the temporal profile of p38γ-induced tau phosphorylation in acute signaling, including excitotoxicity, remained unknown. Using recombinant tau for short-term in vitro kinase reactions, we tested phosphorylation of a range of SP and TP sites, using available phosphorylation site-specific antibodies (
[0294] To determine the functional relevance of tau phosphorylation by p38γ at S199 and T205, we generated phosphorylation-mimicking (S199D and T205E) and -preventing (S199A and T205A) tau variants. We also prepared phosphorylation mimicking mutants of all other sites identified by mass spectrometry and assessed all mutants for their ability to co-purify with PSD-95, tau and Fyn. The results are shown in
[0295] Disruption of NR/PSD-95/tau/Fyn complexes prevented exitotoxicity and Aβ-induced toxicity in primary neurons and APP23 mice (8). Hence, phosphorylation of tau at T205 should mitigate or reduce Aβ-induced neurotoxicity. To test this, we used AAV-mediated gene transfer to express wild-type, T205A or T205E tau at similar levels in primary neurons (
[0296] To determine if increased neuronal p38γ levels and/or activity limits excitotoxicity in vivo, we used AAV-mediated gene transfer to express p38γ, p38γ.sup.CA or a GFP control in forebrains of newborn wild-type mice (
[0297] Memory deficits in APP23.AAV.sup.p38γCA were significantly less severe compared to those of APP23.AAV.sup.GFP mice, as assessed in the Morris-water maze paradigm (
[0298] Adeno-associated virus (AAV)-mediated expression of WT and T205A, but not T205E tau or green fluorescent protein (GFP), in the forebrains of tau.sup.−/− mice enhanced PTZ-induced seizures (
[0299] Tau is a key mediator of deficits in APP transgenic mice (7, 8), and tau has been suggested to transmit detrimental signals of Aβ in neurons by becoming aberrantly phosphorylated (4, 27). Here, we show that tau is part of an intrinsic molecular pathway involving phosphorylation at T205 mediated by p38γ to inhibit excito- and Aβ toxicity. While we formally cannot exclude further non-tested sites being phosphorylated by p38γ, our data with T205A/E tau suggest that phosphorylation at T205 is key to modulating post-synaptic PSD-95/tau/Fyn complexes. Tau is required for the toxicity-limiting effects of p38γ, as p38γ depletion failed to exacerbate seizures in tau.sup.−/−.p38γ.sup.−/− mice. Although other kinases might target T205 on tau in disease or physiologically (28-30), the very distinct localization of PSD-95, tau and p38γ in a complex at the post-synapse indicates a specific and spatially compartmentalized role of p38γ downstream of synaptic NR activation.
[0300] While different roles have been characterized for other p38 kinases, the function of p38γ remained understudied. Here, our study revealed an unprecedented function of p38γ in the brain, by showing its involvement in tau-mediated Aβ toxicity, memory deficits and survival in AD mice. Its distinct spatial expression in post-synapses and unique sequence features, when compared to neuronally expressed p38α/β, likely contribute to this non-redundant function of p38γ in neurons. p38α/β have been described as downstream mediators of excito-(11) and Aβ toxicity (12, 13). Therefore and importantly, the p38γ function in excito- and Aβ toxicity we describe here is distinct from and opposite to p38α/β.
[0301] In summary, our work suggests that phosphorylation of tau at T205 is part of an Aβ toxicity-inhibiting response. This is contrary to the current view that tau phosphorylation downstream of Aβ toxicity is a purely pathological response (27). However, it is in line with the idea that tau is involved in normal physiologic signaling events in neurons likely involving NR signal transduction (9). Finally, we have identified p38γ as an unprecedented Aβ-toxicity limiting signaling factor, which modulates tau-dependent excitotoxicity by site-specific phosphorylation of tau and controlling post-synaptic PSD-95/tau/Fyn complexes. This provides new insight into post-synaptic processes involved in early AD pathogenesis and may contribute to future drug development.
REFERENCES
[0302] 1. C Ballatore, V M Lee, J Q Trojanowski, Nature reviews. Neuroscience 8, 663-72 (2007). [0303] 2. C Haass, D J Selkoe, Nature reviews. Molecular cell biology 8, 101-12 (2007). [0304] 3. K Iqbal, F Liu, C X Gong, C Alonso Adel, I Grundke-Iqbal, Acta Neuropathol 118, 53-69 (2009). [0305] 4. E M Mandelkow, E Mandelkow, Cold Spring Harb Perspect Med 2, a006247 (2012). [0306] 5. E S Musiek, D M Holtzman, Nat Neurosci 18, 800-6 (2015). [0307] 6. M Rapoport, H N Dawson, L I Binder, M P Vitek, A Ferreira, Proc Natl Acad Sci USA 99, 6364-9 (2002). [0308] 7. E D Roberson et al., Science 316, 750-4 (2007). [0309] 8. L M Ittner et al., Cell 142, 387-97 (2010). [0310] 9. L Mucke, D J Selkoe, Cold Spring Harb Perspect Med 2, a006338 (2012). [0311] 10. J J Palop, L Mucke, Nat Neurosci 13, 812-8 (2010). [0312] 11. G E Hardingham, H Bading, Nature reviews. Neuroscience 11, 682-96 (2010). [0313] 12. Q Wang, D M Walsh, M J Rowan, D J Selkoe, R Anwyl, J Neurosci 24, 3370-8 (2004). [0314] 13. S Li et al., J Neurosci 31, 6627-38 (2011). [0315] 14. A A Ittner, A Gladbach, J Bertz, L S Suh, L M Ittner, Acta Neuropathol Commun 2, 149 (2014). [0316] 15. M A Fabian et al., Nat Biotechnol 23, 329-36 (2005). [0317] 16. M B Menon, S Dhamija, A Kotlyarov, M Gaestel, Autophagy, 0 (2015). [0318] 17. C Sturchler-Pierrat et al., Proc Natl Acad Sci USA 94, 13287-92 (1997). [0319] 18. G Buzsaki, E I Moser, Nat Neurosci 16, 130-8 (2013). [0320] 19. R Goutagny, J Jackson, S Williams, Nat Neurosci 12, 1491-3 (2009). [0321] 20. R T Canolty et al., Science 313, 1626-8 (2006). [0322] 21. A B Tort, R W Komorowski, J R Manns, N J Kopell, H Eichenbaum, Proc Natl Acad Sci USA 106, 20942-7 (2009). [0323] 22. A Probst et al., Acta Neuropathol 99, 469-81 (2000). [0324] 23. Y Rong, X Lu, A Bernard, M Khrestchatisky, M Baudry, J Neurochem 79, 382-90 (2001). [0325] 24. M Aarts et al., 1 Science 298, 846-50 (2002). [0326] 25. M Goedert et al., FEBS Lett 409, 57-62 (1997). [0327] 26. S Mondragon-Rodriguez et al., J Biol Chem 287, 32040-53 (2012). [0328] 27. L M Ittner, J Gotz, Nature reviews. Neuroscience 12, 65-72 (2011). [0329] 28. J Z Wang, Q Wu, A Smith, I Grundke-Iqbal, K Iqbal, FEBS Lett 436, 28-34 (1998). [0330] 29. V Buee-Scherrer, M Goedert, FEBS Lett 515, 151-4 (2002). [0331] 30. A Cavallini et al., J Biol Chem 288, 23331-47 (2013).