METHODS OF ENGINEERING IMMUNE CELLS FOR ENHANCED POTENCY AND PERSISTENCE AND USES OF ENGINEERED CELLS IN IMMUNOTHERAPY
20240335536 ยท 2024-10-10
Inventors
- James Barnaby Trager (Albany, CA, US)
- Ivan CHAN (Millbrae, CA, US)
- Don-Hong Wang (Palo Alto, CA, US)
- Guangnan LI (Foster City, CA, US)
- Alexandra Leida Liana Lazetic (San Jose, CA, US)
- Chao Guo (San Francisco, CA, US)
Cpc classification
A61K2239/26
HUMAN NECESSITIES
A61K39/4611
HUMAN NECESSITIES
International classification
A61K39/00
HUMAN NECESSITIES
C07K16/28
CHEMISTRY; METALLURGY
Abstract
Several embodiments of the methods and compositions disclosed herein relate to immune cells that are engineered to Mexpress chimeric antigen receptors as well as genetically edited or otherwise engineered to alter the effectiveness with which another immune cell can target and induce cytotoxic effects on the engineered cells. In several embodiments, the methods and compositions disclosed herein reduce fratricide within a therapeutic cell population, which in some instances comprises mixture of immune cell types. Additionally, the methods and compositions disclosed herein enhance one or more aspects of the efficacy of the immune cells in cellular immunotherapy including cytotoxicity and/or persistence, as well as reduced graft versus host or host versus graft effects.
Claims
1-100. (canceled)
101. A population of genetically engineered and gene edited immune cells, comprising: genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets a tumor marker expressed by a target tumor cell, wherein the immune cells are genetically edited at one or more target locations in a CISH gene that encodes a CIS protein, wherein the edits yield reduced expression and/or function of CIS as compared to an immune cell not edited at the location or locations in the CISH gene; wherein the immune cells are genetically edited at one or more target locations in a Cbl proto-oncogene B protein (CBLB) gene that encodes CBLB protein, wherein the edits yield reduced expression and/or function of CBLB protein as compared to an immune cell not edited at the location or locations in the CBLB gene; and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells that do not comprise said genetic edits at the CISH and CBLB genes.
102. The population of genetically engineered and gene edited immune cells of claim 101, wherein the immune cells are edited at one or more additional target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell.
103. The population of genetically engineered and gene edited immune cells of claim 101, wherein the genetically engineered and gene edited cells are edited at an additional target site in a gene encoding: transforming growth factor receptor beta 2 (TGFBR2), TIGIT, NKG2A, SOCS2, B2M, PD-1, TIM-3, or TCR alpha.
104. The population of genetically engineered and gene edited immune cells of claim 101, wherein: (i) a guide sequence of any of SEQ ID NO: 153-157 or 562-565 is used to target the CISH gene; and/or (ii) a guide sequence of any of SEQ ID NO: 164 to 166 or 552-555 is used to target the CBLB gene;
105. The population of genetically engineered and gene edited immune cells of claim 101, wherein the genetically engineered and gene edited immune cells express membrane-bound interleukin-15 (mbIL15).
106. The population of genetically engineered and gene edited immune cells of claim 101, wherein the cytotoxic signaling complex comprises an OX40 subdomain and CD3zeta subdomain.
107. The population of genetically engineered and gene edited immune cells of claim 101, wherein the genetically engineered and gene edited immune cells comprise Natural Killer (NK) cells, T cells, or combinations thereof.
108. The population of genetically engineered and gene edited immune cells of claim 101, wherein the cytotoxic receptor targets ligands of NKG2D, CD19, CD70, BCMA, CD38, GPRCSD, DLL3, EGFR, PSMA, or FLT3.
109. A method for the treatment of cancer in a subject comprising administering to the subject the population of genetically engineered and gene edited immune cells according to claim 101.
110. The method of claim 109, wherein the genetically engineered and gene edited immune cells express membrane-bound interleukin-15 (mbIL15).
111. The method of claim 109, wherein the genetically engineered and gene edited immune cells comprise Natural Killer (NK) cells.
112. The method of claim 111, wherein the genetically engineered and gene edited immune cells are allogeneic to the subject.
113. A method of manufacturing a population of genetically edited immune cells, comprising: (a) contacting a population of immune cells with a first gene editing complex, wherein the first gene editing complex edits at one or more target sites in a CISH gene of the immune cell to yield reduced levels of expression of CIS protein encoded by the CISH gene as compared to an immune cell not edited at the CISH gene; and (b) contacting the population of immune cells with a second gene editing complex, wherein the second gene editing complex edits at one or more target sites in: (i) a CBLB gene of the immune cell to yield reduced levels of expression of CBLB protein encoded by the CBLB gene as compared to an immune cell not edited at the CBLB gene; (ii) a TGFBR2 gene of the immune cell to yield reduced levels of expression of TGFBR2 protein encoded by the TGFBR2 gene as compared to an immune cell not edited at the TGFBR2 gene; (iii) a TIGIT gene of the immune cell to yield reduced levels of expression of TIGIT protein encoded by the TIGIT gene as compared to an immune cell not edited at the TIGIT gene; or (iv) an additional gene of the immune cell to yield reduced levels of expression of a protein encoded by the additional gene as compared to an immune cell not edited at the additional gene; and wherein the genetically edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells that do not comprise said genetically edited target site or sites.
114. The method of claim 113, further comprising contacting the population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
115. The method of claim 113, wherein the immune cells comprise Natural Killer (NK) cells, T cells, or combinations thereof.
116. A population of genetically engineered and gene edited immune cells, comprising: genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets a tumor marker selected from the group consisting of NKG2D ligands, CD19, CD70, BCMA, CD38, GPRC5D, CD138 DLL3, EGFR, PSMA, FLT3, and KREMEN2, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane bound IL-15, wherein the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of the protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, wherein the protein is selected from the group consisting of CISH, adenosine A2 receptor, SMAD3, MAPKAPK3, CEACAM1, DDIT4, TGFBR2R, NKG2A, SOCS2, CBLB, B2M, TIGIT, PD-1, TIM-3, CD38, TCR alpha, and any combination thereof, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to immune cells that do not comprise said genetically edited target site or sites.
117. A method for the treatment of cancer in a subject comprising administering to the subject at least a portion of the population of immune cells according to claim 116.
118. A population of genetically engineered immune cells, comprising: genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane bound IL-15, wherein the genetically engineered immune cells are engineered to express at least one immunosuppressive effector comprising: (i) two or more of a truncated human CD47, a p15E peptide, an HIV peptide, and an HTLV peptide, (ii) a truncated human CD47 domain and at least one p15E peptide, an HIV peptide, and an HTLV peptide, (iii) a truncated human CD47 domain and at least one HIV peptide, (iv) a truncated human CD47 domain and at least HTLV peptide, (v) a sequence having at least 95% sequence identity to one or more of SEQ ID Nos: 256, 259, 262, 265, 268, 271, or (vi) a viral UL18 protein, wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, and wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector.
119. A method of engineering a population of genetically engineered immune cells, comprising: (a) genetically editing a mixed population of immune cells comprising NK cells and T cells to reduce expression Human Leukocyte Antigen (HLA) on the surface of the immune cells, wherein reduced expression of HLA on the surface of the immune cells reduces T cell-mediated cytotoxicity against the edited population of immune cells, wherein reduced expression of HLA on the surface of the cells renders the edited population of immune cells susceptible to NK-mediated cytotoxicity against the edited immune cells; and (b) genetically engineering the edited cells to express one or more immunosuppressive effectors that reduce NK-mediated cytotoxicity against the mixed population of immune cells, wherein the one or more immunosuppressive effectors comprises one or more of a viral immunosuppressive peptide, a viral protein that is an HLA homolog, HLA-E, HLA-G, a human protein or fragment thereof that reduces phagocytosis of cells, a chimeric construct comprising a viral immunosuppressive peptide and a human protein or fragment thereof that reduces phagocytosis of cells, or combinations thereof, wherein the reduced T cell-mediated cytotoxicity reduces engineered T cell-mediated fratricidal cytotoxicity against engineered NK cells and, upon administration to a subject, host T-cell mediated cytotoxicity against engineered NK cells, and wherein the reduced NK cell-mediated cytotoxicity reduces engineered NK cell-mediated fratricidal cytotoxicity against engineered T cells and, upon administration to a subject, host NK cell-mediated cytotoxicity against engineered NK and engineered T cells.
120. The method of claim 119, wherein the immune cells comprise Natural Killer (NK) cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
[0238]
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
[0251]
DETAILED DESCRIPTION
[0252] Some embodiments of the methods and compositions provided herein relate to engineered immune cells and combinations of the same for use in immunotherapy. In several embodiments, the engineered cells are engineered in multiple ways, for example, to express a cytotoxicity-inducing receptor complex. As used herein, the term cytotoxic receptor complexes shall be given its ordinary meaning and shall also refer to (unless otherwise indicated), Chimeric Antigen Receptors (CAR), chimeric receptors (also called activating chimeric receptors in the case of NKG2D chimeric receptors). In several embodiments, the cells are further engineered to achieve a modification of the reactivity of the cells against non-tumor tissue. Several embodiments relate to the modification of T cells, through various genetic engineering methodologies, such that the resultant T cells have reduced and/or eliminated alloreactivity. Such non-alloreactive T cells can also be engineered to express a chimeric antigen receptor (CAR) that enables the non-alloreactive T cells to impart cytotoxic effects against tumor cells. In several embodiments, natural killer (NK) cells are also engineered to express a city-inducing receptor complex (e.g., a chimeric antigen receptor or chimeric receptor). In several embodiments, combinations of these engineered immune cell types are used in immunotherapy, which results in both a rapid (NK-cell based) and persistent (T-cell based) anti-tumor effect, all while advantageously having little to no graft versus host disease. Some embodiments include methods of use of the compositions or cells in immunotherapy.
[0253] The term anticancer effect refers to a biological effect which can be manifested by various means, including but not limited to, a decrease in tumor volume, a decrease in the number of cancer cells, a decrease in the number of metastases, an increase in life expectancy, decrease in cancer cell proliferation, decrease in cancer cell survival, and/or amelioration of various physiological symptoms associated with the cancerous condition.
Cell Types
[0254] Some embodiments of the methods and compositions provided herein relate to a cell such as an immune cell. For example, an immune cell, such as a T cell, may be engineered to include a chimeric receptor such as a CD19-directed chimeric receptor, or engineered to include a nucleic acid encoding said chimeric receptor as described herein. Additional embodiments relate to engineering a second set of cells to express another cytotoxic receptor complex, such as an NKG2D chimeric receptor complex as disclosed herein. Still additional embodiments relate to the further genetic manipulation of T cells (e.g., donor T cells) to reduce, disrupt, minimize and/or eliminate the ability of the donor T cell to be alloreactive against recipient cells (graft versus host disease).
[0255] Traditional anti-cancer therapies relied on a surgical approach, radiation therapy, chemotherapy, or combinations of these methods. As research led to a greater understanding of some of the mechanisms of certain cancers, this knowledge was leveraged to develop targeted cancer therapies. Targeted therapy is a cancer treatment that employs certain drugs that target specific genes or proteins found in cancer cells or cells supporting cancer growth, (like blood vessel cells) to reduce or arrest cancer cell growth. More recently, genetic engineering has enabled approaches to be developed that harness certain aspects of the immune system to fight cancers. In some cases, a patient's own immune cells are modified to specifically eradicate that patient's type of cancer. Various types of immune cells can be used, such as T cells, Natural Killer (NK cells), or combinations thereof, as described in more detail below.
[0256] To facilitate cancer immunotherapies, there are provided for herein polynucleotides, polypeptides, and vectors that encode chimeric antigen receptors (CAR) that comprise a target binding moiety (e.g., an extracellular binder of a ligand, or a tumor marker-directed chimeric receptor, expressed by a cancer cell) and a cytotoxic signaling complex. For example, some embodiments include a polynucleotide, polypeptide, or vector that encodes, for example a chimeric antigen receptor directed against a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among others, to facilitate targeting of an immune cell to a cancer and exerting cytotoxic effects on the cancer cell. Also provided are engineered immune cells (e.g., T cells or NK cells) expressing such CARs. There are also provided herein, in several embodiments, polynucleotides, polypeptides, and vectors that encode a construct comprising an extracellular domain comprising two or more subdomains, e.g., first CD19-targeting subdomain comprising a CD19 binding moiety as disclosed herein and a second subdomain comprising a C-type lectin-like receptor and a cytotoxic signaling complex. Also provided are engineered immune cells (e.g., T cells or NK cells) expressing such bi-specific constructs. Methods of treating cancer and other uses of such cells for cancer immunotherapy are also provided for herein.
[0257] To facilitate cancer immunotherapies, there are also provided for herein polynucleotides, polypeptides, and vectors that encode chimeric receptors that comprise a target binding moiety (e.g., an extracellular binder of a ligand expressed by a cancer cell) and a cytotoxic signaling complex. For example, some embodiments include a polynucleotide, polypeptide, or vector that encodes, for example an activating chimeric receptor comprising an NKG2D extracellular domain that is directed against a tumor marker, for example, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, among others, to facilitate targeting of an immune cell to a cancer and exerting cytotoxic effects on the cancer cell. Also provided are engineered immune cells (e.g., T cells or NK cells) expressing such chimeric receptors. There are also provided herein, in several embodiments, polynucleotides, polypeptides, and vectors that encode a construct comprising an extracellular domain comprising two or more subdomains, e.g., first and second ligand binding receptor and a cytotoxic signaling complex. Also provided are engineered immune cells (e.g., T cells or NK cells) expressing such bi-specific constructs (in some embodiments the first and second ligand binding domain target the same ligand). Methods of treating cancer and other uses of such cells for cancer immunotherapy are also provided for herein.
Engineered Cells for Immunotherapy
[0258] In several embodiments, cells of the immune system are engineered to have enhanced cytotoxic effects against target cells, such as tumor cells. For example, a cell of the immune system may be engineered to include a tumor-directed chimeric receptor and/or a tumor-directed CAR as described herein. In several embodiments, white blood cells or leukocytes, are used, since their native function is to defend the body against growth of abnormal cells and infectious disease. There are a variety of types of white bloods cells that serve specific roles in the human immune system, and are therefore a preferred starting point for the engineering of cells disclosed herein. White blood cells include granulocytes and agranulocytes (presence or absence of granules in the cytoplasm, respectively). Granulocytes include basophils, eosinophils, neutrophils, and mast cells. Agranulocytes include lymphocytes and monocytes. Cells such as those that follow or are otherwise described herein may be engineered to include a chimeric receptor, such as an NKG2D chimeric receptor, and/or a CAR, such as a CD19-directed CAR, or a nucleic acid encoding the chimeric receptor or the CAR. In several embodiments, the cells are optionally engineered to co-express a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain. As discussed in more detail below, in several embodiments, the cells, particularly T cells, are further genetically modified to reduce and/or eliminate the alloreactivity of the cells.
Monocytes for Immunotherapy
[0259] Monocytes are a subtype of leukocyte. Monocytes can differentiate into macrophages and myeloid lineage dendritic cells. Monocytes are associated with the adaptive immune system and serve the main functions of phagocytosis, antigen presentation, and cytokine production. Phagocytosis is the process of uptake of cellular material, or entire cells, followed by digestion and destruction of the engulfed cellular material. In several embodiments, monocytes are used in connection with one or more additional engineered cells as disclosed herein. Some embodiments of the methods and compositions described herein relate to a monocyte that includes a tumor-directed CAR, or a nucleic acid encoding the tumor-directed CAR. Several embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain. Several embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain.
Lymphocytes for Immunotherapy
[0260] Lymphocytes, the other primary sub-type of leukocyte include T cells (cell-mediated, cytotoxic adaptive immunity), natural killer cells (cell-mediated, cytotoxic innate immunity), and B cells (humoral, antibody-driven adaptive immunity). While B cells are engineered according to several embodiments, disclosed herein, several embodiments also relate to engineered T cells or engineered NK cells (mixtures of T cells and NK cells are used in some embodiments, either from the same donor, or different donors). Several embodiments of the methods and compositions disclosed herein relate to lymphocytes engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain. Several embodiments of the methods and compositions disclosed herein relate to lymphocytes engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain.
T Cells for Immunotherapy
[0261] T cells are distinguishable from other lymphocytes sub-types (e.g., B cells or NK cells) based on the presence of a T-cell receptor on the cell surface. T cells can be divided into various different subtypes, including effector T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cell, mucosal associated invariant T cells and gamma delta T cells. In some embodiments, a specific subtype of T cell is engineered. In some embodiments, a mixed pool of T cell subtypes is engineered. In some embodiments, there is no specific selection of a type of T cells to be engineered to express the cytotoxic receptor complexes disclosed herein. In several embodiments, specific techniques, such as use of cytokine stimulation are used to enhance expansion/collection of T cells with a specific marker profile. For example, in several embodiments, activation of certain human T cells, e.g. CD4+ T cells, CD8+ T cells is achieved through use of CD3 and/or CD28 as stimulatory molecules. In several embodiments, there is provided a method of treating or preventing cancer or an infectious disease, comprising administering a therapeutically effective amount of T cells expressing the cytotoxic receptor complex and/or a homing moiety as described herein. In several embodiments, the engineered T cells are autologous cells, while in some embodiments, the T cells are allogeneic cells. Several embodiments of the methods and compositions disclosed herein relate to T cells engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others as disclosed herein, and a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain. Several embodiments of the methods and compositions disclosed herein relate to T cells engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain.
NK Cells for Immunotherapy
[0262] In several embodiments, there is provided a method of treating or preventing cancer or an infectious disease, comprising administering a therapeutically effective amount of natural killer (NK) cells expressing the cytotoxic receptor complex and/or a homing moiety as described herein. In several embodiments, the engineered NK cells are autologous cells, while in some embodiments, the NK cells are allogeneic cells. In several embodiments, NK cells are preferred because the natural cytotoxic potential of NK cells is relatively high. In several embodiments, it is unexpectedly beneficial that the engineered cells disclosed herein can further upregulate the cytotoxic activity of NK cells, leading to an even more effective activity against target cells (e.g., tumor or other diseased cells). Some embodiments of the methods and compositions described herein relate to NK cells engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain. Several embodiments of the methods and compositions disclosed herein relate to NK cells engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain. In some embodiments, the NK cells are derived from cell line NK-92. NK-92 cells are derived from NK cells, but lack major inhibitory receptors displayed by normal NK cells, while retaining the majority of activating receptors. Some embodiments of NK-92 cells described herein related to NK-92 cell engineered to silence certain additional inhibitory receptors, for example, SMAD3, allowing for upregulation of interferon-? (IFN?), granzyme B, and/or perforin production. Additional information relating to the NK-92 cell line is disclosed in WO 1998/49268 and U.S. Patent Application Publication No. 2002-0068044 and incorporated in their entireties herein by reference. NK-92 cells are used, in several embodiments, in combination with one or more of the other cell types disclosed herein. For example, in one embodiment, NK-92 cells are used in combination with NK cells as disclosed herein. In an additional embodiment, NK-92 cells are used in combination with T cells as disclosed herein.
Hematopoietic Stem Cells for Cancer Immunotherapy
[0263] In some embodiments, hematopoietic stem cells (HSCs) are used in the methods of immunotherapy disclosed herein. In several embodiments, the cells are engineered to express a homing moiety and/or a cytotoxic receptor complex. HSCs are used, in several embodiments, to leverage their ability to engraft for long-term blood cell production, which could result in a sustained source of targeted anti-cancer effector cells, for example to combat cancer remissions. In several embodiments, this ongoing production helps to offset anergy or exhaustion of other cell types, for example due to the tumor microenvironment. In several embodiments allogeneic HSCs are used, while in some embodiments, autologous HSCs are used. In several embodiments, HSCs are used in combination with one or more additional engineered cell type disclosed herein. Some embodiments of the methods and compositions described herein relate to a stem cell, such as a hematopoietic stem cell engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain. Several embodiments of the methods and compositions disclosed herein relate to hematopoietic stem cells engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain.
Induced Pluripotent Stem Cells
[0264] In some embodiments, induced pluripotent stem cells (iPSCs) are used in the method of immunotherapy disclosed herein. iPSCs are used, in several embodiments, to leverage their ability to differentiate and derive into non-pluripotent cells, including, but not limited to, CD34 cells, hemogenic endothelium cells, HSCs (hematopoietic stem and progenitor cells), hematopoietic multipotent progenitor cells, T cell progenitors, NK cell progenitors, T cells, NKT cells, NK cells, and B cells comprising one or several genetic modifications at selected sites through differentiating iPSCs or less differentiated cells comprising the same genetic modifications at the same selected sites. In several embodiments, the iPSCs are used to generate iPSC-derived NK or T cells. In several embodiments, the cells are engineered to express a homing moiety and/or a cytotoxic receptor complex. In several embodiments, iPSCs are used in combination with one or more additional engineered cell type disclosed herein. Some embodiments of the methods and compositions described herein relate to a stem cell, such as a induced pluripotent stem cell engineered to express a CAR that targets a tumor marker, for example, CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among any of the others disclosed herein, and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain. Several embodiments of the methods and compositions disclosed herein relate to induced pluripotent stem cells engineered to express an activating chimeric receptor that targets a ligand on a tumor cell, for example, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others) and optionally a membrane-bound interleukin 15 (mbIL15) co-stimulatory domain.
Genetic Engineering of Immune Cells
[0265] As discussed above, a variety of cell types can be utilized in cellular immunotherapy. Further, as elaborated on in more detail below, and shown in the Examples, genetic modifications can be made to these cells in order to enhance one or more aspects of their efficacy (e.g., cytotoxicity) and/or persistence (e.g., active life span).
Targets for Gene Editing
[0266] Additional cellular engineering strategies are provided for herein that serve to further enhance the persistence of allogeneic cellular therapy products, such as allogeneic CAR-T cells and/or allogeneic CAR-NK cells. There is provided for herein, in several embodiments, a population of genetically engineered immune cells for cancer immunotherapy where the genetically engineered immune cells are genetically modified (e.g., gene edited) at one, two, three or more gene loci to enhance the cytotoxic activity, persistence, or other feature of the cells, such as NK cells and/or T cells.
[0267] As discussed herein, in several embodiments NK cells are used for immunotherapy. In several embodiments provided for herein, gene editing of the NK cell can advantageously impart to the edited NK cell the ability to resist and/or overcome various inhibitory signals that are generated in the tumor microenvironment. It is known that tumors generate a variety of signaling molecules that are intended to reduce the anti-tumor effects of immune cells. As discussed in more detail below, in several embodiments, gene editing of the NK cell limits this tumor microenvironment suppressive effect on the NK cells, T cells, combinations of NK and T cells, or any edited/engineered immune cell provided for herein. As discussed below, in several embodiments, gene editing is employed to reduce or knockout expression of target proteins, for example by disrupting the underlying gene encoding the protein. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). In several embodiments, the gene is completely knocked out, such that expression of the target protein is undetectable. In several embodiments, gene editing is used to knock in or otherwise enhance expression of a target protein. In several embodiments, expression of a target protein can be enhanced by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). Unless indicated otherwise to the contrary, the sequences provided for guide RNAs that are recited using deoxyribonucleotides refer to the target DNA and shall be considered as also referencing those guides used in practice (e.g., employing ribonucleotides, where the ribonucleotide uracil is used in lieu of deoxyribonucleotide thymine or vice-versa where thymine is used in lieu of uracil, wherein both are complementary base pairs to adenine when reciting either an RNA or DNA sequence). For example, a gRNA with the sequence ATGCTCAATGCGTC (SEQ ID NO: 995) shall also refer to the following sequence AUGCUCAAUGCGUC (SEQ ID NO: 996) or a gRNA with sequence AUGCUCAAUGCGUC (SEQ ID NO: 996) shall also refer to the following sequence ATGCTCAATGCGTC (SEQ ID NO: 995).
[0268] By way of non-limiting example, TGF-beta is one such cytokine released by tumor cells that results in immune suppression within the tumor microenvironment. That immune suppression reduces the ability of immune cells, even engineered CAR-immune cells is some cases, to destroy the tumor cells, thus allowing for tumor progression. In several embodiments, as discussed in detail below, immune checkpoint inhibitors are disrupted through gene editing. In several embodiments, blockers of immune suppressing cytokines in the tumor microenvironment are used, including blockers of their release or competitive inhibitors that reduce the ability of the signaling molecule to bind and inhibit an immune cell. Such signaling molecules include, but are not limited to TGF-beta, IL10, arginase, inducible NOS, reactive-NOS, Arg1, Indoleamine 2,3-dioxygenase (IDO), and PGE.sub.2. However, in additional embodiments, there are provided immune cells, such as NK cells, wherein the ability of the NK cell (or other cell) to respond to a given immunosuppressive signaling molecule is disrupted and/or eliminated. For example, in several embodiments, in several embodiments, NK cells or T cells are genetically edited to become have reduced sensitivity to TGF-beta. TGF-beta is an inhibitor of NK cell function on at least the levels of proliferation and cytotoxicity. See, for example,
[0269] In accordance with additional embodiments, other modulators of one or more aspects of NK cell (or T cell) function are modulated through gene editing. A variety of cytokines impart either negative (as with TGF-beta above) or positive signals to immune cells. By way of non-limiting example, IL15 is a positive regulator of NK cells, which as disclosed herein, can enhance one or more of NK cell homing, NK cell migration, NK cell expansion/proliferation, NK cell cytotoxicity, and/or NK cell persistence. To keep NK cells in check under normal physiological circumstances, a cytokine-inducible SH2-containing protein (CIS, encoded by the CISH gene) acts as a critical negative regulator of IL-15 signaling in NK cells. As discussed herein, because IL 5 biology impacts multiple aspects of NK cell functionality, including, but not limited to, proliferation/expansion, activation, cytotoxicity, persistence, homing, migration, among others. Thus, according to several embodiments, editing CISH enhances the functionality of NK cells across multiple functionalities, leading to a more effective and long-lasting NK cell therapeutic. In several embodiments, inhibitors of CIS are used in conjunction with engineered NK cell administration. In several embodiments, the CIS expression is knocked down or knocked out through gene editing of the CISH gene, for example, by use of CRISPR-Cas editing. Small interfering RNA, antisense RNA, TALENs or zinc fingers are used in other embodiments. In some embodiments CIS expression in T cells is knocked down through gene editing.
[0270] In several embodiments, CISH gene editing endows an NK cell with enhanced ability to home to a target site. In several embodiments, CISH gene editing endows an NK cell with enhanced ability to migrate, e.g., within a tissue in response to, for example chemoattractants or away from repellants. In several embodiments, CISH gene editing endows an NK cell with enhanced ability to be activated, and thus exert, for example, anti-tumor effects. In several embodiments, CISH gene editing endows an NK cell with enhanced proliferative ability, which in several embodiments, allows for generation of robust NK cell numbers from a donor blood sample. In addition, in such embodiments, NK cells edited for CISH and engineered to express a CAR are more readily, robustly, and consistently expanded in culture. In several embodiments, CISH gene editing endows an NK cell with enhanced cytotoxicity. In several embodiments, the editing of CISH synergistically enhances the cytotoxic effects of engineered NK cells and/or engineered T cells that express a CAR.
[0271] In several embodiments, CISH gene editing activates or inhibits a wide variety of pathways. The CIS protein is a negative regulator of IL15 signaling by way of, for example, inhibiting JAK-STAT signaling pathways. These pathways would typically lead to transcription of IL15-responsive genes (including CISH). In several embodiments, knockdown of CISH disinhibits JAK-STAT (e.g., JAK1-STAT5) signaling and there is enhanced transcription of IL 5-responsive genes. In several embodiments, knockout of CISH yields enhanced signaling through mammalian target of rapamycin (mTOR), with corresponding increases in expression of genes related to cell metabolism and respiration. In several embodiments, knockout of CISH yields IL15 induced increased expression of IL-2Ra (CD25), but not IL-15Ra or IL-2/15RP, enhanced NK cell membrane binding of IL15 and/or IL2, increased phosphorylation of STAT-3 and/or STAT-5, and elevated expression of the antiapoptotic proteins, such as Bcl-2. In several embodiments, CISH knockout results in IL15-induced upregulation of selected genes related to mitochondrial functions (e.g., electron transport chain and cellular respiration) and cell cycle. Thus, in several embodiments, knockout of CISH by gene editing enhances the NK cell cytotoxicity and/or persistence, at least in part via metabolic reprogramming. In several embodiments, negative regulators of cellular metabolism, such as TXNIP, are downregulated in response to CISH knockout. In several embodiments, promotors for cell survival and proliferation including BIRC5 (Survivin), TOP2A, CKS2, and RACGAP1 are upregulated after CISH knockout, whereas antiproliferative or proapoptotic proteins such as TGFB1, ATM, and PTCH1 are downregulated. In several embodiments, CISH knockout alters the state (e.g., activates or inactivates) signaling via or through one or more of CXCL-10, IL2, TNF, IFNg, IL13, IL4, Jnk, PRF1, STAT5, PRKCQ, IL2 receptor Beta, SOCS2, MYD88, STAT3, STAT1, TBX21, LCK, JAK3, IL& receptor, ABL1, IL9, STAT5A, STAT5B, Tcf7, PRDM1, and/or EOMES.
[0272] In several embodiments, gene editing of the immune cells can also provide unexpected enhancement in the expansion, persistence and/or cytotoxicity of the edited immune cell. As disclosed herein, engineered cells (e.g., those expressing a CAR) may also be edited, the combination of which provides for a robust cell for immunotherapy. In several embodiments, the edits allow for unexpectedly improved NK cell expansion, persistence and/or cytotoxicity. In several embodiments, knockout of CISH expression in NK cells removes a potent negative regulator of I-15-mediated signaling in NK cells, disinhibits the NK cells and allows for one or more of enhanced NK cell homing, NK cell migration, activation of NK cells, expansion, cytotoxicity and/or persistence. Additionally, in several embodiments, the editing can enhance NK and/or T cell function in the otherwise suppressive tumor microenvironment. In several embodiments, CISH gene editing results in enhanced NK cell expansion, persistence and/or cytotoxicity without requiring Notch ligand being provided exogenously.
[0273] As discussed above, T cells that are engineered to express a CAR or chimeric receptor are employed in several embodiments. Also as mentioned above, T cells express a T Cell Receptor (TCR) on their surface. As disclosed herein, in several embodiments, autologous immune cells are transferred back into the original donor of the cells. In such embodiments, immune cells, such as NK cells or T cells are obtained from patients, expanded, genetically modified (e.g., with a CAR or chimeric receptor) and/or optionally further expanded and re-introduced into the patient. As disclosed herein, in several embodiments, allogeneic immune cells are transferred into a subject that is not the original donor of the cells. In such embodiments, immune cells, such as NK cells or T cells are obtained from a donor, expanded, genetically modified (e.g., with a CAR or chimeric receptor) and/or optionally further expanded and administered to the subject.
[0274] Allogeneic immunotherapy presents several hurdles to be overcome. In immune-competent hosts, the administered allogeneic cells are rapidly rejected, known as host versus graft rejection (HvG). This substantially limits the efficacy of the administered cells, particularly their persistence. In immune-incompetent hosts, allogeneic cells are able to engraft. However, if the administered cells comprise a T cell (several embodiments disclosed herein employ mixed populations of NK and T cells), the endogenous T cell receptor (TCR) specificities recognize the host tissue as foreign, resulting in graft versus host disease (GvHD). GvHD can lead to significant tissue damage in the host (cell recipient). Several embodiments disclosed herein address both of these hurdles, thereby allowing for effective and safe allogeneic immunotherapy. In several embodiments, gene edits can advantageously help to reduce and/or avoid graft vs. host disease (GvHD). A non-limiting embodiment of such an approach, using a mixed population of NK cell and T cells, is schematically illustrated in
[0275] T cell receptors (TCR) are cell surface receptors that participate in the activation of T cells in response to the presentation of an antigen. The TCR is made up of two different protein chains (it is a heterodimer). The majority of human T cells have TCRs that are made up of an alpha (?) chain and a beta (?) chain (encoded by separate genes). A small percentage of T cells have TCRs made up of gamma and delta (?/?) chains (the cells being known as gamma-delta T cells).
[0276] Rather than recognizing an intact antigen (as with immunoglobulins), T cells are activated by processed peptide fragments in association with an MHC molecule. This is known as MHC restriction. When the TCR recognizes disparities between the donor and recipient MHC, that recognition stimulates T cell proliferation and the potential development of GVHD. In some embodiments, the genes encoding either the TCR?, TCR?, TCR?, and/or the TCE? are disrupted or otherwise modified to reduce the tendency of donor T cells to recognize disparities between donor and host MHC, thereby reducing recognition of alloantigen and GVHD.
[0277] T-cell mediated immunity involves a balance between co-stimulatory and inhibitory signals that serve to fine-tune the immune response. Inhibitory signals, also known as immune checkpoints, allow for avoidance of auto-immunity (e.g., self-tolerance) and also limit immune-mediated damage. Immune checkpoint protein expression are often altered by tumors, enhancing immune resistance in tumor cells and limiting immunotherapy efficacy. CTLA4 downregulates the amplitude of T cell activation. In contrast, PD1 limits T cell effector functions in peripheral tissue during an inflammatory response and also limits autoimmunity. Immune checkpoint blockade, in several embodiments, helps to overcome a barriers to activation of functional cellular immunity. In several embodiments, antagonistic antibodies specific for inhibitory ligands on T cells including Cytotoxic-T-lymphocyte-associated antigen 4 (CTLA-4; also known as CD152) and programmed cell death protein 1 (PD1 or PDCD1 also known as CD279) are used to enhance immunotherapy.
[0278] In several embodiments, there is provided genetically modified T cells that are non-alloreactive and highly active. In several embodiments, the T cells are further modified such that certain immune checkpoint genes are inactivated, and the immune checkpoint proteins are thus not expressed by the T cell. In several embodiments, this is done in the absence of manipulation or disruption of the CD3z signaling domain (e.g., the TCRs are still able initiate T cell signaling).
[0279] In several embodiments, genetic inactivation of TCRalpha and/or TCRbeta coupled with inactivation of immune checkpoint genes in T lymphocytes derived from an allogeneic donor significantly reduces the risk of GVHD. In several embodiments, this is done by eliminating at least a portion of one or more of the substituent protein chains (alpha, beta, gamma, and/or delta) responsible for recognition of MHC disparities between donor and recipient cells. In several embodiments, this is done while still allowing for T cell proliferation and activity.
[0280] In some embodiments wherein allogeneic cells are administered, the receiving subject may receive some other adjunct treatment to support or otherwise enhance the function of the administered immune cells. In several embodiments, the subject may be pre-conditioned (e.g., with radiation or chemotherapy). In some embodiments, the adjunct treatment comprises administration of lymphocyte growth factors (such as IL-2).
[0281] Moreover, in several embodiments, editing can improve persistence of administered cells (whether NK cells, T cells, or otherwise) for example, by masking cells to the host immune response. In some cases, a recipient's immune cells will attack donor cells, especially from an allogeneic donor, known as Host vs. Graft disease (HvG).
[0282] In some embodiments of mixed allogeneic cell therapy, the populations of engineered cells actually target one another, for example when the therapeutic cells are edited to remove HLA molecules in order to avoid HvG. Such editing of, for example CAR T cells can result in the vulnerability of the edited allogeneic CAR T cells to cytotoxic attack by the CAR NK cells as well as elimination by host NK cells. This is caused by the missing self inhibitory signals generally presented by KIR molecules.
[0283] In several embodiments, genetic editing (whether knock out or knock in) of any of the target genes (e.g., CISH, TGFBR, TCR, B2M, CIISH, CD47, HLA-E, or any other target gene disclosed herein), is accomplished through targeted introduction of DNA breakage, and subsequent DNA repair mechanism. In several embodiments, double strand breaks of DNA are repaired by non-homologous end joining (NHEJ), wherein enzymes are used to directly join the DNA ends to one another to repair the break. In several embodiments, however, double strand breaks are repaired by homology directed repair (HDR), which is advantageously more accurate, thereby allowing sequence specific breaks and repair. HDR uses a homologous sequence as a template for regeneration of missing DNA sequences at the break point, such as a vector with the desired genetic elements (e.g., an insertion element to disrupt the coding sequence of a TCR) within a sequence that is homologous to the flanking sequences of a double strand break. This will result in the desired change (e.g., insertion) being inserted at the site of the DSB.
[0284] In several embodiments, gene editing is accomplished by one or more of a variety of engineered nucleases. In several embodiments, restriction enzymes are used, particularly when double strand breaks are desired at multiple regions. In several embodiments, a bioengineered nuclease is used. Depending on the embodiment, one or more of a Zinc Finger Nuclease (ZFN), transcription-activator like effector nuclease (TALEN), meganuclease and/or clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) system are used to specifically edit the genes encoding one or more of the TCR subunits.
[0285] Meganucleases are characterized by their capacity to recognize and cut large DNA sequences (from 14 to 40 base pairs). In several embodiments, a meganuclease from the LAGLIDADG family is used, and is subjected to mutagenesis and screening to generate a meganuclease variant that recognizes a unique sequence(s), such as a specific site in the TCR, or CISH, or any other target gene disclosed herein. Target sites in the TCR can readily be identified. Further information of target sites within a region of the TCR can be found in US Patent Publication No. 2018/0325955, and US Patent Publication No. 2015/0017136, each of which is incorporated by reference herein in its entirety. In several embodiments, two or more meganucleases, or functions fragments thereof, are fused to create a hybrid enzymes that recognize a desired target sequence within the target gene (e.g., CISH).
[0286] In contrast to meganucleases, ZFNs and TALEN function based on a non-specific DNA cutting catalytic domain which is linked to specific DNA sequence recognizing peptides such as zinc fingers or transcription activator-like effectors (TALEs). Advantageously, the ZFNs and TALENs thus allow sequence-independent cleavage of DNA, with a high degree of sequence-specificity in target recognition. Zinc finger motifs naturally function in transcription factors to recognize specific DNA sequences for transcription. The C-terminal part of each finger is responsible for the specific recognition of the DNA sequence. While the sequences recognized by ZFNs are relatively short, (e.g., ?3 base pairs), in several embodiments, combinations of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more zinc fingers whose recognition sites have been characterized are used, thereby allowing targeting of specific sequences, such as a portion of the TCR (or an immune checkpoint inhibitor). The combined ZFNs are then fused with the catalytic domain(s) of an endonuclease, such as Fokl (optionally a Fokl heterodimer), in order to induce a targeted DNA break. Additional information on uses of ZFNs to edit the TCR and/or immune checkpoint inhibitors can be found in U.S. Pat. No. 9,597,357, which is incorporated by reference herein.
[0287] Transcription activator-like effector nucleases (TALENs) are specific DNA-binding proteins that feature an array of 33 or 34-amino acid repeats. Like ZFNs, TALENs are a fusion of a DNA cutting domain of a nuclease to TALE domains, which allow for sequence-independent introduction of double stranded DNA breaks with highly precise target site recognition. TALENs can create double strand breaks at the target site that can be repaired by error-prone non-homologous end-joining (NHEJ), resulting in gene disruptions through the introduction of small insertions or deletions. Advantageously, TALENs are used in several embodiments, at least in part due to their higher specificity in DNA binding, reduced off-target effects, and ease in construction of the DNA-binding domain.
[0288] CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) are genetic elements that bacteria use as protection against viruses. The repeats are short sequences that originate from viral genomes and have been incorporated into the bacterial genome. Cas (CRISPR associated proteins) process these sequences and cut matching viral DNA sequences. By introducing plasmids containing Cas genes and specifically constructed CRISPRs into eukaryotic cells, the eukaryotic genome can be cut at any desired position. Additional information on CRISPR can be found in US Patent Publication No. 2014/0068797, which is incorporated by reference herein. In several embodiments, CRISPR is used to manipulate the gene(s) encoding a target gene to be knocked out or knocked in, for example CISH, TGFBR2, TCR, B2M, CIITA, CD47, HLA-E, etc. In several embodiments, CRISPR is used to edit one or more of the TCRs of a T cell and/or the genes encoding one or more immune checkpoint inhibitors. In several embodiments, the immune checkpoint inhibitor is selected from one or more of CTLA4 and PD1. In several embodiments, CRISPR is used to truncate one or more of TCR?, TCR?, TCR?, and TCR?. In several embodiments, a TCR is truncated without impacting the function of the CD3z signaling domain of the TCR. Depending on the embodiment and which target gene is to be edited, a Class 1 or Class 2 Cas is used. In several embodiments, a Class 1 Cas is used and the Cas type is selected from the following types: I, IA, IB, IC, ID, IE, IF, IU, III, IIIA, IIIB, IIIC, lID, IV IVA, IVB, and combinations thereof. In several embodiments, the Cas is selected from the group consisting of Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, and combinations thereof. In several embodiments, a Class 2 Cas is used and the Cas type is selected from the following types: II, IIA, IIB, IIC, V, VI, and combinations thereof. In several embodiments, the Cas is selected from the group consisting of Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3, Cas13a (previously known as C2c2), Cas13b, Cas13c, CasX, CasY and combinations thereof. In some embodiments, class 2 CasX is used, wherein CasX is capable of forming a complex with a guide nucleic acid and wherein the complex can bind to a target DNA, and wherein the target DNA comprises a non-target strand and a target strand. In some embodiments, class 2 CasY is used, wherein CasY is capable of binding and modifying a target nucleic acid and/or a polypeptide associated with target nucleic acid.
[0289] In several embodiments, as discussed above, editing of CISH advantageously imparts to the edited cells, particularly edited NK cells, enhanced expansion, cytotoxicity and/or persistence. Additionally, in several embodiments, the modification of the TCR comprises a modification to TCR?, but without impacting the signaling through the CD3 complex, allowing for T cell proliferation. In one embodiment, the TCR? is inactivated by expression of pre-Ta in the cells, thus restoring a functional CD3 complex in the absence of a functional alpha/beta TCR. As disclosed herein, the non-alloreactive modified T cells are also engineered to express a CAR to redirect the non-alloreactive T cells specificity towards tumor marker, but independent of MHC. Combinations of editing are used in several embodiments, such as knockout of the TCR and CISH in combination, or knock out of CISH and knock in of CD47, by way of non-limiting examples.
[0290] In several embodiments, the expression of ADORA2A (Adenosine 2a Receptor) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, ADORA2A is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, ADORA2A is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following ADORA2A-specific guide RNAs: SEQ ID NO: 503-506. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). Loss of expression of ADORA2A induces decreased sensitivity to adenosine, a well-established immunosuppressant for T cells and NK cells. Thus, according to several embodiments, gene editing ADORA2A increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0291] In several embodiments, the expression of TGFBR2 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, TGFBR2 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, TGFBR2 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following TGFBR2-specific guide RNAs: SEQ ID NO: 544-547. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). In NK cells, TGFBR2 is a potent checkpoint in NK cell-mediated tumor immunity, while for T cells, knockout of TGFBR2 rescues car T cell exhaustion induced by TGF-?1. Thus, according to several embodiments, gene editing TGFBR2 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0292] In several embodiments, the expression of NKG2A is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, NKG2A is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, NKG2A is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following NKG2A-specific guide RNAs: SEQ ID NO: 548-551. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). NKG2A binds to HLA-E and is recognized as an MHC-recognizing receptor. Since NKG2A is an inhibitor receptor, loss of expression of NKG2A induces increased activation of constituent cells. In NK and T cells, loss of NKG2A leads to increased activation and cytotoxicity against HLA-E expressing tumor cells. Thus, according to several embodiments, gene editing NKG2A increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0293] In several embodiments, the expression of Cytokine Signaling 2 (SOCS2) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, SOCS2 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, SOCS2 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following SOCS2-specific guide RNAs: SEQ ID NO: 556-561. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). SOCS proteins are negative regulators of cytokine responses, and SOCS2 specifically negatively regulates the development of NK cells through inhibiting JAK2 activity. Loss of expression of SOCS2 in NK cells induces increased NK cell development and overall cytotoxicity. Thus, according to several embodiments, gene editing SOCS2 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0294] In several embodiments, the expression of Casitas B-lineage lymphoma-b (Cbl-b) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, Cbl-b is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, Cbl-b is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following Cbl-b-specific guide RNAs: In several embodiments, the expression of Casitas B-lineage lymphoma-b (Cbl-b) is reduced and/or eliminated in order to increase overall activation in resultant T cells and NK cells. In several embodiments, Cbl-b is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, but with the use of one more of the following Cbl-b-specific guide RNAs: SEQ ID NO: 552-555. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). Cbl-b is an E3 ubiquitin ligase that negatively regulates T cell activation Loss of expression of Cbl-b in NK cells and T cells demonstrate increased antitumor immunity. Moreover, Cbl-b deficient T cells and NK cells are resistant to PD-L1/PD-1 mediated suppression. Thus, according to several embodiments, gene editing Cbl-b increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0295] In several embodiments, the expression of Beta-2 Microglobulin (B2-microglobulin) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, B2-microglobulin is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, B2-microglobulin is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following B2-microglobulin-specific guide RNAs: SEQ ID NO: 290-299. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). Loss of expression of B2-microglobulin induces greatly reduced levels of MHC class I molecules, and in both NK cells and T cells, reduction of B2-microglobulin can modulate overall cell recognition of autologous and allogenic cells. Thus, according to several embodiments, gene editing B2-microglobulin increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0296] In several embodiments, the expression of T cell immunoreceptor with Ig and ITIM domains (TIGIT) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, TIGIT is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, TIGIT is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following TIGIT-specific guide RNAs: SEQ ID NO: 507-510. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). TIGIT is a checkpoint receptor associated with T cell and NK cell exhaustion. Loss of expression of TIGIT in NK cells prevents NK cell exhaustion and promotes NK cell-dependent tumor immunity. Loss of expression of TIGIT in T cells can similarly lead to downstream activation of resultant T cells. Thus, according to several embodiments, gene editing TIGIT increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0297] In several embodiments, the expression of Programmed cell death protein-1 (PD-1) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, PD-1 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, PD-1 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following PD-1-specific guide RNAs: SEQ ID NO: 511-514. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). PD-1 plays an inhibitory role in immune regulation and down-regulates overall function by suppressing immune cell activity. Loss of expression of PD-1 in NK cells increases overall cytotoxicity due to increased secretion of interferon-gamma, granzyme B, and perforin. Similarly, T cells with loss of expression of PD-1 demonstrate increased cytotoxicity and overall caspase activation. Thus, according to several embodiments, gene editing PD-1 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0298] In several embodiments, the expression of T-cell immunoglobulin and mucin-domain containing-3 (TIM-3) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, TIM-3 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, TIM-3 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following TIM-3-specific guide RNAs: SEQ ID NO:515-518. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). TIM-3 is an inhibitory receptor involved in immune checkpoint function. Loss of expression of TIM-3 increases overall cytotoxicity in engineered NK and T cells as well as decreased exhaustion of NK cells and T cells, leading to increased effector function of constituent cells lacking TIM-3 expression. Thus, according to several embodiments, gene editing TIM-3 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0299] In several embodiments, the expression of CD38 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, CD38 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, CD38 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following CD38-specific guide RNAs: SEQ ID NO:519-522. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). CD38 plays a role in the maturation cycle of immune cells, and blood cancers can often present upregulated CD38. Loss of CD38 expression on constituent NK cells allows for greater cytotoxicity due to decreased fratricide. Wild-type NK cells self-express CD38, leading to downstream self-targeting effects in wild-type NK cells. For T cells, loss of CD38 expression for constituent T cells leads to increased cytotoxicity. Thus, according to several embodiments, gene editing CD38 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0300] In several embodiments, the expression of T cell receptor alpha (TCR a) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, TCR a is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, TCR a is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following TCR a-specific guide RNAs: SEQ ID NO:566-569.
[0301] In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). T cell receptors (TCR) are protein complexes found on T cells responsible for recognizing MHC molecules. Loss of certain TCRs and preferential expression of other TCRs can lead to increased cytotoxicity in engineered cells due to increased selective targeting and recognition by constituent cells. Thus, according to several embodiments, gene editing TCRs increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0302] In several embodiments, the expression of CISH is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, CISH is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, CISH is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following CISH-specific guide RNAs: SEQ ID NO: 562-565, or other guide disclosed herein. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). In CD8+ T cells, CISH actively silences TCR signaling to maintain tumor tolerance, and CISH has been shown to be a downstream negative regulator of IL-15 receptor signaling. In NK and T cells, CISH plays a role in checkpoint maturation and proliferation. Thus, according to several embodiments, gene editing CISH increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0303] In several embodiments, the expression of CEACAMI is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, CEACAMI is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, CEACAMI is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following CEACAMI-specific guide RNAs: SEQ ID NO: 497-499. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). CEACAMI is a checkpoint inhibitor for both NK and T cells and can inhibit lysis of CEACAMI-bearing tumor cell lines. Loss of expression of CEACAMI can increase overall cytotoxicity for NK and T cells. Thus, according to several embodiments, gene editing CEACAMI increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0304] In several embodiments, the expression of DDIT4 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, DDIT4 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, DDIT4 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following DDIT4-specific guide RNAs: SEQ ID NO: 500-502. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). In NK and T cells, DDIT4 is a negative regulator of mTORC1, which itself enhances IL-15 mediated survival and proliferation of NK cells. Moreover, DDIT4 is upregulated by oxidative stress conditions as is common in tumor microenvironments. Loss of DDIT4 function in engineered cells may increase overall glucose metabolism leading to enhanced proliferation, as well as increasing overall NK or T cell cytotoxicity. Thus, according to several embodiments, gene editing DDIT4 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0305] In several embodiments, the expression of MAPKAP Kinase 3 (MAPKAPK3) is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, MAPKAPK3 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, MAPKAPK3 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following MAPKAPK3-specific guide RNAs: SEQ ID NO: 494-496. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). MAPKAP Kinase 3 in expressed in both NK and T cells. Loss of MAPKAPK3 in engineered cells is expected to increase cytotoxicity, cytokine secretion, and overall NK signaling. Thus, according to several embodiments, gene editing MAPKAPK3 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0306] In several embodiments, the expression of SMAD3 is reduced and/or eliminated in order to increase overall activation in resultant T cells and/or NK cells, or other cell type provided for herein. In several embodiments, SMAD3 is disrupted and/or knocked out using one or more of the gene editing methods disclosed herein. In several embodiments, SMAD3 is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, with the Cas nuclease guided by the use of one more of the following SMAD3-specific guide RNAs: SEQ ID NO: 491-493. In several embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between those listed). SMAD3 is a downstream mediator of TGF-Beta and Activin A signaling. Inhibition of activin A provides an effective downstream TGFBR knockout. Smad3 silenced NK cells demonstrate increased proliferation and differentiation, as well as increased cytotoxicity in engineered T and NK cells. Thus, according to several embodiments, gene editing SMAD3 increases the cytotoxicity, persistence, immune avoidance or otherwise enhances the efficacy of engineered NK, T, or other cell as disclosed herein.
[0307] As discussed above, genetically edited cells can be edited at a plurality of locations. For example in several embodiments, cells (e.g., NK cells or T cells, or a mixture thereof) are edited at two locations. In several embodiments, one of the gene edits is made at a target site in the CISH gene. In several embodiments, one of the gene edits is made at a target site in the CBLB gene. In several embodiments, one of the gene edits is made at a target site in the TGFBR2 gene. In several embodiments, one of the gene edits is made at a target site in the TIGIT gene. Any combination of such edits is also within the provided embodiments, for example dual TGFBR2/CBLB, dual TIGIT/TGFBR2, CISH/CBLB, CISH/TGFBR2, CISH/TIGIT, etc. Moreover, any combination of edits of any of the target genes for editing (e.g., by Crispr or other nuclease) can be made according to some embodiments. Additionally, to the extent necessary to achieve a desired amount of reduction in gene expression, multiple edits may be made within a single target gene, or genes.
[0308] In several embodiments, gene edits are made at a target site in a CISH gene and a target site in a CBLB gene. In some embodiments, a double edit, e.g., CISH/CBLB is made in NK cells and/or T cells for use in therapy. In several embodiments, a combination CISH/CBLB gene edit is made in an NK cell that does not include an edit at a CD70 gene. In several embodiments, a combination CISH/CBLB gene edit is made in an NK cell that does not include an edit at any additional gene. In several embodiments, a combination CISH/CBLB gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor. In some embodiments, a triple edit, e.g., CD70/CISH/CBLB is made in NK cells and/or T cells for use in therapy. In some embodiments, a triple edit, e.g., CD70/CISH/CBLB is made in NK cells and/or T cells that are engineered to express a tumor-targeting CAR.
[0309] In several embodiments, gene edits are made at a target site in a CISH gene and a target site in a TGFBR2 gene. In some embodiments, a double edit, e.g., CISH/TGFBR2 is made in NK cells and/or T cells for use in therapy. In several embodiments, a combination CISH/TGFBR2 gene edit is made in an NK cell that does not include an edit at a CD70 gene. In several embodiments, a combination CISH/TGFBR2 gene edit is made in an NK cell that does not include an edit at any additional gene. In several embodiments, a combination CISH/TGFBR2 gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor. In some embodiments, a triple edit, e.g., CD70/CISH/TGFBR2 is made in NK cells and/or T cells for use in therapy. In some embodiments, a triple edit, e.g., CD70/CISH/TGFBR2 is made in NK cells and/or T cells that are engineered to express a tumor-targeting CAR.
[0310] In several embodiments, gene edits are made at a target site in a CISH gene and a target site in a TIGIT gene. In some embodiments, a double edit, e.g., CISH/TIGIT is made in NK cells and/or T cells for use in therapy. In several embodiments, a combination CISH/TIGIT gene edit is made in an NK cell that does not include an edit at a CD70 gene. In several embodiments, a combination CISH/TIGIT gene edit is made in an NK cell that does not include an edit at any additional gene. In several embodiments, a combination CISH/TIGIT gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor. In some embodiments, a triple edit, e.g., CD70/CISH/TIGIT is made in NK cells and/or T cells for use in therapy. In some embodiments, a triple edit, e.g., CD70/CISH/TIGIT is made in NK cells and/or T cells that are engineered to express a tumor-targeting CAR.
Engineering Enhanced Persistence Through Immunosuppressive Effector
[0311] Additional cellular engineering strategies are provided for herein that serve to further enhance the persistence of allogeneic cellular therapy products, such as allogeneic CAR-T cells and/or allogeneic CAR-NK cells. As discussed herein, there are various strategies that can be employed to reduce the tendency of an allogeneic cell therapy product to induce host cell-mediated graft rejection. For example, in several embodiments the expression of B2M is reduced and/or eliminated in order to reduce the host-mediated graft rejection. In several embodiments, B2M expression is disrupted and/or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) as disclosed elsewhere herein, but with the use of one more of the following B2M-specific guide RNAs: SEQ ID NO: 290CGCGAGCACAGCTAAGGCCA; SEQ ID NO: 291GAGTAGCGCGAGCACAGCTA; SEQ ID NO: 292GCTACTCTCTCTTTCTGGCC; SEQ ID 293GGCCGAGATGTCTCGCTCCG; SEQ ID NO: 294GGCCACGGAGCGAGACATCT; SEQ ID NO: 295CACAGCCCAAGATAGTTAAG; SEQ ID NO: 296AGTCACATGGTTCACACGGC; SEQ ID NO: 297AAGTCAACTTCAATGTCGGA; SEQ ID NO: 298ACTTGTCTTTCAGCAAGGAC; and SEQ ID NO: 299TGGGCTGTGACAAAGTCACA. Loss of expression of B2M induces a complete loss of HLA expression, which can reduce, and in some embodiments, eliminate, the host T-cell mediated graft rejection. However, this can make also render the administered cells susceptible to host NK-cell mediated graft rejection (as well as to administered engineered NK cells, when a mixed NK/T cell population is used). This, as discussed above, results in loss of the KIR inhibitory signals (e.g., missing self signals). See
Viral Immunosuppressive Peptides
[0312] Many viral infections occur, at least in part, due to the ability of a virus to evade an host immune system, either by camouflage or suppression of host immune reactivity. In vitro studies have shown that particular aspects of certain viruses have such immunosuppressive effects, for example, retroviral transmembrane envelope proteins, such as the p15E protein. Additionally, studies have identified conserved regions of sequences across multiple viral types, see for example Table 1, which includes, among others, a 17 amino acid conserved sequence, CKS-17 (SEQ ID NO: 199), and the nucleic acid encoding the same (SEQ ID NO: 216).
TABLE-US-00001 TABLE1 ViralPeptides SEQID NO: Name Sequence 199 CKS-17 LQNRRGLDLLFLKEGGL 200 MoLVp15E LQNRRGLDLLFLKEGGLCAALKEECCF 201 FLCp15E LQNRRGLDLLFLKEGGLCAALKEECCF 202 AKVp15E LQNRRGLDLLFLKEGGLCAALKEECCF 203 GLVp15E LQNRRGLDLLFLKEGGLCAALKEECCF 204 MMCFp15E LQNRRGLDLLFLKEGGLCAALKEECCF 205 AMCFp15E LQNRRGLDLLFLKEGGLCAALKEECCF 206 FeLVp15E LQNRRGLDLLFLQEGGLCAALKEECCF 207 MPMVgp20 LQNRRGLDLLTAEQGGICLALQEKCCF 208 REV-AGP20 LQNRRGLDLLTAEQGGICLALQEKCCF 209 HTLV-Igp21 AQNRRGLDLLFWEQGGLCKALQEQCRF 210 HTLV-IIgp21 AQNRRGLDLLFWEQGGLCKAIQEQCCF 211 HIV-1NEF MTYKAAVDLSHFLKEKGGL 212 HIV-1gp41 LQARVLAVERYLKDQQL 213 B26 LQNKRGLDLLFLX.sub.1X.sub.2GGL (X.sub.1=K/E,X.sub.2=E/K) 214 BaEV LQNRRGLDLLTAEQGGX.sub.1 (X.sub.1=L/I) 215 ERV-9,4-1 X.sub.1QNRX.sub.2X.sub.3LX.sub.4X.sub.5X.sub.6X.sub.7AX.sub.8X.sub.9X.sub.10GX.sub.11 (X.sub.1=L/Y,X.sub.2=*/L,X.sub.3=G/A,X.sub.4=D/N,X.sub.5=L/Y, X.sub.6=L/S,X.sub.7=L/T,X.sub.8=E/Q/A,X.sub.9=E/K,X.sub.10=G/E, X.sub.11=L/V 216 CKS-17 ctgcaaaacagaaggggattagacctgctttttcttaaagagggagggctc
[0313] In several embodiments, one or more of such viral immunosuppressive peptides (also referred to as viral peptides) are used to confer resistance to inactivation of engineered immune cells by host NK cells. Various approaches can be undertaken depending on the embodiment and the cell type to be used.
[0314] According to several embodiments, one or more viral immunosuppressive peptides are integrated into a chimeric antigen receptor that is then expressed by a population of immune cells to be used in treating a patient. In several embodiments, the immune cells are allogeneic to the patient. In several embodiments, a combination of NK cells and T are engineered to express one or more CARs that comprise one or more viral immunosuppressive peptide.
[0315] Depending on the embodiment, the length of the hinge/spacer region can be altered. In several embodiments, a CD8alpha hinge/spacer region is use, but, in some embodiments, a longer or a shorter spacer is used. The spacer can be, depending on the embodiment, an IgG1, IgG2, IgG3, IgG4, or CD28 spacer domain or be derived from IgG1, IgG2, IgG3, IgG4, CD28, or can be a fully synthetic sequence. In several embodiments, IgG-based spacers are edited to reduce or eliminate the ability of the spacer to bring Fc-receptor bearing cells, which can advantageously reduce off-target activation of immune cells (such as those bearing the immunosuppressive effectors as disclosed herein). Non-limiting editing approaches include, but are not limited to, deletion of the heavy chain constant 2 (CH2) domain to abrogate binding to the Fc receptor, or mutating certain amino acids that are essential to Fc receptor binding. In several embodiments, a longer spacer advantageously allows for enhances targeting of certain membrane-proximal epitopes expressed by cancer cells and exposure of the immunosuppressive effector such that it can interact with host and/or administered immune cells to reduce unwanted suppression of the therapeutic cells. In several embodiments, a single hinge region can be made longer by including multiple hinge-encoding sequences, e.g., two, three, four, or more hinges. In several embodiments, wherein multiple hinge regions are used, they can be of the same type (e.g., three CD8? hinges) or can vary (e.g., one CD8?hinge, one CD28 hinge, and a IgG1 hinge). In several embodiments, a shorter hinge is used, wherein the shorter hinge limits the ability of host phosphatases (like CD45) to attenuate signaling of a CAR expressed by the engineered immune cell. In several embodiments, the hinge region comprises one or more of SEQ ID NOs: 479-487. In some embodiments, the hinge region comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with any of SEQ ID NOs: 479-487.
[0316]
[0317] In several embodiments, the engineered CAR comprises one or more copies of one or more of the following amino acid or DNA sequences: SEQ ID NO: 199-216, 220-221, 225-226, 230-231, 235-236, 240-241, 245-246, 250-251, 273-274, 278, 280, 288, or 289. As discussed above, those sequences (or individual sequence) can be positioned in the hinge region, the N-terminal region or within the target binder region (e.g., within the linker of an scFv). In several embodiments, the CAR comprises an amino acid sequence or DNA sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with any of SEQ ID NOs: SEQ ID NO: 199-216, 220-221, 225-226, 230-231, 235-236, 240-241, 245-246, 250-251, 273-274, 278, 280, 288, or 289.
[0318] In several embodiments, the engineered cells provided for herein comprise a chimeric receptor that targets NKG2D, wherein the CAR comprises an amino acid of SEQ ID NO: 174 or 899, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 174 or 899 with one or more copies of one or more of the following viral immunosuppressive amino acid sequences: SEQ ID NO: 199-216, 220, 225, 230, 235, 240, 245, 250, 273, 280, 288, or 289 integrated into the sequence of SEQ ID NO: 174 or 899. In addition to, or in place of the integrated viral immunosuppressive amino acids, the CAR optionally comprises an amino acid of SEQ ID NO: 174 or 899, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 174 or 899, with one or more of the viral immunosuppressive sequences expressed on the cell in a membrane-bound format, as discussed below.
[0319] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR comprises an amino acid of SEQ ID NO: 178 or 901, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 178 or 901 with one or more copies of one or more of the following viral immunosuppressive amino acid sequences: SEQ ID NO: 199-216, 220, 225, 230, 235, 240, 245, 250, 273, 280, 288, or 289 integrated into the sequence of SEQ ID NO: 178. In addition to, or in place of the integrated viral immunosuppressive amino acid, the CAR optionally comprises an amino acid of SEQ ID NO: 178 or 901, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 178 or 901, with one or more of the viral immunosuppressive sequences expressed on the cell in a membrane-bound format, as discussed below.
[0320] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR is encoded by a nucleic acid sequence comprising SEQ ID NO: 466, or comprises an nucleic acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 466 with one or more copies of one or more of the following viral immunosuppressive amino acid sequences: SEQ ID NO: 199-216, 220, 225, 230, 235, 240, 245, 250, 273, 280, 288, or 289 integrated into the sequence encoded by SEQ ID NO: 466. In addition to, or in place of the integrated viral immunosuppressive amino acids, the CAR optionally comprises a CAR encoded by SEQ ID NO: 466, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to the sequence encoded by SEQ ID NO: 466, with one or more of the viral immunosuppressive sequences expressed on the cell in a membrane-bound format, as discussed below.
[0321] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD70, wherein the CAR comprises an amino acid of any of SEQ ID NOs: 383-465 or 912-994, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 383-465 or 912-994 with one or more copies of one or more of the following viral immunosuppressive amino acid sequences: SEQ ID NO: 199-216, 220, 225, 230, 235, 240, 245, 250, 273, 280, 288, or 289 integrated into the sequence of any of SEQ ID NO: 383-465 or 912-994. In addition to, or in place of the integrated viral immunosuppressive amino acid, the CAR optionally comprises an amino acid of any of SEQ ID NO: 383-465 or 912-994, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 383-465 or 912-994, with one or more of the viral immunosuppressive sequences expressed on the cell in a membrane-bound format, as discussed below.
[0322] In addition to incorporation of the viral immunosuppressive peptides being positioned in the CAR, the peptides can be coupled to a domain that allows them to be expressed as a membrane bound viral immunosuppressive peptide.
[0323]
[0324]
[0325] Various transmembrane proteins can be used, such as one or more of CD8?, CD4, CD3?, CD3?, CD3?, CD3?, CD28, CD137, glycophorin A, glycophorin D, nicotinic acetylcholine receptor, a GABA receptor, Fc?RI?, and a T-cell receptor. In several embodiments, a portion of one or more of these domains (e.g., a transmembrane domain) is used to anchor or otherwise tether the viral immunosuppressive peptide(s) to the immune cell surface. In several embodiments, the transmembrane protein comprises a CD8? transmembrane domain. In several embodiments, the CD8? transmembrane domain comprises the amino acid sequence of SEQ ID NO: 4, or a sequence with at least about 80%, at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 4. In several embodiments, the CD8? transmembrane domain is encoded by the nucleic acid sequence of SEQ ID NO: 3, or a sequence with at least about 80%, at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 3. In several embodiments, a hinge or other linker is used to couple the viral immunosuppressive peptide to the transmembrane protein. In several embodiments, a CD8? is used. In several embodiments, the CD8? hinge comprises the amino acid sequence of SEQ ID NO: 2, or a sequence with at least about 80%, at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 2. In several embodiments, the CD8? hinge comprises the amino acid sequence of SEQ ID NO: 1, or a sequence with at least about 80%, at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 1.
[0326]
[0327] In several embodiments, there is provided a polynucleotide encoding a synthetic CKS-17 viral immunosuppressive peptide. In several embodiments, the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 199. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 199. In several embodiments, the polynucleotide comprises SEQ ID NO: 216 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 216. In several embodiments, provided for is a membrane-bound synthetic CKS-17 viral immunosuppressive peptide. In several embodiments, the synthetic CKS-17 viral immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound synthetic CKS-17 viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound synthetic CKS-17 viral immunosuppressive peptide comprises a CD8? signal peptide, synthetic CKS-17, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound synthetic CKS-17 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 218 or SEQ ID NO: 693. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 218 or SEQ ID NO: 693. In several embodiments, the polynucleotide comprises SEQ ID NO: 219 (or SEQ ID NO: 694) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 219 (or SEQ ID NO: 694). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound synthetic CKS-17 and GFP comprises SEQ ID NO: 217 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 217. In several embodiments, the polynucleotide encoding membrane-bound synthetic CKS-17, a FLAG tag, and GFP comprises SEQ ID NO: 692 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 692. In several embodiments, the polynucleotide encoding membrane-bound synthetic CKS-17, a FLAG tag, and GFP encodes the amino acid sequence of SEQ ID NO: 691 or an amino acid sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 691.
[0328] In several embodiments, there is provided a polynucleotide encoding a p15E viral immunosuppressive peptide. In several embodiments, the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 220. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 220. In several embodiments, the polynucleotide comprises SEQ ID NO: 221 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 221. In several embodiments, provided for is a membrane-bound p15E viral immunosuppressive peptide. In several embodiments, the p15E viral immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound p15E viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound p15E viral immunosuppressive peptide comprises a CD8? signal peptide, p15E, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound p15E viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 223 (or SEQ ID NO: 697). In several embodiments, the polynucleotide encodes a sequence that shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 223 (or SEQ ID NO: 697). In several embodiments, the polynucleotide comprises SEQ ID NO: 224 (or SEQ ID NO: 698) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 224 (or SEQ ID NO: 698). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding mbp15E and GFP comprises SEQ ID NO: 222 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 222. In several embodiments, the polynucleotide encoding mbp15E, a FLAG tag, and GFP comprises SEQ ID NO: 696 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 696. In several embodiments, the membrane-bound p15E viral immunosuppressive peptide construct including GFP and a FLAG tag is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 695). In several embodiments, the polynucleotide encodes a sequence that shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 695).
[0329] In several embodiments, there is provided a polynucleotide encoding a HTLV viral immunosuppressive peptide. In several embodiments, the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 225. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 225. In several embodiments, the polynucleotide comprises SEQ ID NO: 226 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 226. In several embodiments, provided for is a membrane-bound HTLV viral immunosuppressive peptide. In several embodiments, the HTLV viral immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound HTLV viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound HTLV viral immunosuppressive peptide comprises a CD8? signal peptide, HTLV-1 (Gp21), a CD8? hinge, a and a CD8? transmembrane domain. In several embodiments, the membrane-bound HTLV viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 228 (or SEQ ID NO: 701). In several embodiments, the polynucleotide encodes an amino acid sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 228 (or SEQ ID NO: 701). In several embodiments, the polynucleotide comprises SEQ ID NO: 229 (or SEQ ID NO: 702) or shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 229 (or SEQ ID NO: 702). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound HTLV and GFP comprises SEQ ID NO: 227 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 227. In several embodiments, the polynucleotide encoding membrane-bound HTLV, a FLAG tag, and GFP comprises SEQ ID NO: 700 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 700. In several embodiments, the membrane-bound HTLV, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 699 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 699.
[0330] In several embodiments, there is provided a polynucleotide encoding a modified HIV Gp41 viral immunosuppressive peptide. In several embodiments, the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 230. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 230. In several embodiments, the polynucleotide comprises SEQ ID NO: 231 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 231. In several embodiments, provided for is a membrane-bound modified HIV Gp41viral immunosuppressive peptide. In several embodiments, the modified HIV Gp41 viral immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound modified HIV Gp41 viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound modified HIV Gp41 viral immunosuppressive peptide comprises a CD8? signal peptide, modified HIV Gp41, a CD8? hinge, a and a CD8? transmembrane domain. In several embodiments, the membrane-bound modified HIV Gp41 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 233 (or SEQ ID NO: 705). In several embodiments, the polynucleotide encodes a sequence that shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 233 (or SEQ ID NO: 705). In several embodiments, the polynucleotide comprises SEQ ID NO: 234 (or SEQ ID NO: 706) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 234 (or SEQ ID NO: 706). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound modified HIV Gp41 and GFP comprises SEQ ID NO: 232 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 232. In several embodiments, the polynucleotide encoding membrane-bound modified HIV Gp41, a FLAG tag, and GFP comprises SEQ ID NO: 704 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 704. In several embodiments, the membrane-bound modified HIV Gp41, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 703 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 703.
[0331] In several embodiments, there is provided a polynucleotide encoding a truncated HIV Gp41 viral immunosuppressive peptide. In several embodiments, the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 235. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 235. In several embodiments, the polynucleotide comprises SEQ ID NO: 236 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 236. In several embodiments, provided for is a membrane-bound HIV Gp41 viral immunosuppressive peptide. In several embodiments, the HIV Gp41 viral immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound HIV Gp41 viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound HIV Gp41 viral immunosuppressive peptide comprises a CD8? signal peptide, HIV Gp41, a CD8? hinge, a and a CD8?transmembrane domain. In several embodiments, the membrane-bound HIV Gp41 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 238 (or SEQ ID NO: 709). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 238 (or SEQ ID NO: 709). In several embodiments, the polynucleotide comprises SEQ ID NO: 239 (or SEQ ID NO: 710) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 239 (or SEQ ID NO: 710). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound HIV Gp41 and GFP comprises SEQ ID NO: 237 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 237. In several embodiments, the polynucleotide encoding membrane-bound HIV Gp41, a FLAG tag, and GFP comprises SEQ ID NO: 708 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 708. In several embodiments, the membrane-bound truncated HIV Gp41, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 707 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 707.
[0332] In several embodiments, there is provided a polynucleotide encoding a synthetic viral immunosuppressive peptide. In several embodiments, the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 240. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 240. In several embodiments, the polynucleotide comprises SEQ ID NO: 241 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 241. In several embodiments, provided for is a membrane-bound synthetic viral immunosuppressive peptide. In several embodiments, the synthetic viral immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound synthetic viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound synthetic viral immunosuppressive peptide comprises a CD8? signal peptide, a synthetic viral immunosuppressive peptide trimer, a CD8? hinge, a and a CD8? transmembrane domain. In several embodiments, the membrane-bound synthetic viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 243 (or SEQ ID NO: 713). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 243 (or SEQ ID NO: 713). In several embodiments, the polynucleotide comprises SEQ ID NO: 244 (or SEQ ID NO: 714) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 244 (or SEQ ID NO: 714). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound synthetic viral immunosuppressive peptide and GFP comprises SEQ ID NO: 242 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 242. In several embodiments, the polynucleotide encoding membrane-bound synthetic viral immunosuppressive peptide, a FLAG tag and GFP comprises SEQ ID NO: 712 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 712. In several embodiments, membrane-bound synthetic viral immunosuppressive peptide, FLAG tag, GFP construct comprises the amino acid of SEQ ID NO: 712 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 712.
[0333] In several embodiments, viral fusion peptides, or variants thereof, are used. By way of example, HIV initiates an immune evasive response by fusing to a target cell via a fusion peptide, a portion of which interacts with the T cell receptor on host T cells and suppresses their activation. In several embodiments, a portion of a viral fusion peptide is used. For example in several embodiments, an amino acid sequence comprising residues 5 to 13 of the HIV fusion peptide are used in an immunosuppressive effector as disclosed herein (e.g., incorporated into a CAR at one or more extracellular locations, or with one or more copies coupled to a transmembrane domain). In several embodiments, that amino acid sequence comprises SEQ ID NO: 467. In several embodiments, the amino acid sequence shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 467. In several embodiments, a modified viral fusion protein is used in an immunosuppressive effector as disclosed herein (e.g., incorporated into a CAR at one or more extracellular locations, or with one or more copies coupled to a transmembrane domain). In several embodiments, that amino acid sequence comprises SEQ ID NO: 468. In several embodiments, the amino acid sequence shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 468. In several embodiments, one or more consensus motifs derived from a viral fusion protein are used in an immunosuppressive effector as disclosed herein (e.g., incorporated into a CAR at one or more extracellular locations, or with one or more copies coupled to a transmembrane domain). In several embodiments, that amino acid consensus sequence comprises GXXXG (SEQ ID NO: 473) or AXXXG (SEQ ID NO: 474), where each X independently is any amino acid. In several embodiments, the amino acid sequence shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 473 or 474, while maintaining the consensus motif. In several embodiments, these motifs are particularly advantageous in that they are suppressive towards T-cells and not NKs. Thus, in several embodiments, these peptides allow engineered NK cells to be developed without gene editing to reduce/knock out B2M expression and still effect functional reduction in host versus graft rejection (e.g., through T cell suppression alone).
[0334] In several embodiments, there is provided a polynucleotide encoding a p15E viral immunosuppressive trimeric peptide. In several embodiments, the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 250. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 250. In several embodiments, the polynucleotide comprises SEQ ID NO: 251 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 251. In several embodiments, provided for is a membrane-bound p15E viral immunosuppressive trimeric peptide. In several embodiments, the p15E viral immunosuppressive trimeric peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound p15E viral immunosuppressive trimeric peptide construct comprises one or more linker sequences (e.g., in between the peptide repeats). In several embodiments, the membrane-bound p15E viral immunosuppressive trimeric peptide comprises a CD8?signal peptide, a first p15E peptide, a linker (e.g., a GS linker), a second p15E peptide, a linker (e.g., a second GS linker), a third p15E peptide, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound p15E viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 253 (or SEQ ID NO: 721). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 253 (or SEQ ID NO: 721). In several embodiments, the polynucleotide comprises SEQ ID NO: 254 (or SEQ ID NO: 722) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 254 (or SEQ ID NO: 722). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound trimeric p15E and GFP comprises SEQ ID NO: 252 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 252. In several embodiments, the polynucleotide encoding membrane-bound trimeric p15E, a FLAG tag, and GFP comprises SEQ ID NO: 720 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 720. In several embodiments, the membrane-bound trimeric p15E, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 719 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 719.
[0335] Chimeric proteins that include one or more viral immunosuppressive peptides are also used, in several embodiments. One such chimeric protein comprises the human cytomegalovirus class I MHC homolog, UL18. As described in more detail below, in several embodiments, UL18 is incorporated into a CAR, or otherwise expressed (e.g., through chimeric UL18-B2M or in a dimer/trimer construct) in order to evade host-NK cell cytotoxicity through the UL18 binding to the NK cell inhibitory receptor LIR-1.
[0336] Additionally, certain sequence domains or even particular residues within viral immunosuppressive peptides can facilitate further engineering of chimeric antigen receptors and their expression. For example, certain residues could be used to engineer CAR dimers, e.g., through disulfide bonding. Such an approach could be utilized to supplement, or replace, the use of bi-specific CARs. For example, rather than engineering a single CAR with, by way of example an anti-CD19 binder and a binder of NKG2D ligands, two separate CARs are engineered, each with cysteine residues positioned in a manner that allowed for the formation of di-sulfide bridges between the two CARs and thus the self-assembly of a dimerized CAR in vivo.
[0337] Advantageously, the use of the viral immunosuppressive peptides can not only serve to help mute the host NK cell response against administered engineered cells, but it can be used for other purposes as well. For example, in some embodiments, an antibody directed to a viral peptide is administered to a subject who has been dosed with a cell product expressing a CAR that comprises one or more viral immunosuppressive peptides. The antibody functions to bind the viral peptide and induce depletion of the CAR-expressing cells (e.g., via antibody-based immune response), thus serving as a safety mechanism or a route to end a treatment. Similarly, during manufacture of an immune cell comprising a CAR with an included viral immunosuppressive peptide, antibody-based detection of the viral immunosuppressive peptide can be used to determine CAR expression levels.
CD47 and Other Immunosuppressive Peptides, and Combinations with Viral Immunosuppressive Peptides
[0338] In addition to viral immunosuppressive peptides, other immunosuppressive peptides or polypeptides are provided for herein. Like the viral immunosuppressive peptides, these polypeptides may be included in one or more regions of a CAR, or can be expressed in a membrane-bound format. These additional immunosuppressive polypeptides can also be used in connection with one or more viral immunosuppressive peptides (see, e.g.,
[0339] In several embodiments endogenous self signals are re-purposed to impart immune evasiveness to engineered immune cells. One such self protein is CD47, which impedes phagocytosis (e.g., by macrophages) through signaling through the phagocyte receptor CD172a. In several embodiments, one or more domains (or sub-domains) of CD47 are incorporated into a CAR and/or expressed in an immune cell in a membrane-bound configuration. In several embodiments, the expression of CD47 (in whole or in part) functions to impart to the engineered immune cell the ability to reduce or avoid phagocytosis by host immune cells, thereby enhancing the persistence (and thus functional life-span) of the engineered immune cells.
[0340] Other immunosuppressive peptides are also provided for herein. In several embodiments, PD-L1 (also known as CD274, PDL1, or PDCD1 L1) or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion. In several embodiments, one or more TIGIT ligands, including but not limited to PVR (also known as CD155, NECL5, or NECL-5) and CD113 (also known as PROM1 or prominin 1) or an immunosuppressive portion of is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion. In several embodiments, CD200 or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion. In several embodiments, CD276 (also known as B7-H3) or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion. In several embodiments, B7-H4 (also known as VTCN1, B7S1, or B7X)) or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion. In several embodiments, HVEM (also known as TNFSFi4, CD270 or ATAR) or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion. In several embodiments, CEACAM5 (also known as CEA) or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion. In several embodiments, Galectin-9 (also known as LGALS9) or an immunosuppressive portion thereof is expressed by an engineered immune cell through incorporation into a CAR and/or in a membrane-bound fashion. In several embodiments, the expression of these immunosuppressive proteins (in whole or in part) functions to impart to the engineered immune cell the ability to reduce or avoid immune clearance by host immune cells (or other engineered immune cells), thereby enhancing the persistence (and thus functional life-span) of the engineered immune cells.
[0341] As discussed above with respect to the viral immunosuppressive peptides, the engineered immune cells, in several embodiments, are allogeneic cells. In several embodiments, allogeneic NK cells are used. In several embodiments, allogeneic T cells are used. In several embodiments, combinations (e.g., a mixed population) of allogeneic NK cell and allogeneic T cells are used.
[0342] In several embodiments, the engineered CAR comprises one or more copies of one or more of the following amino acid sequences: SEQ ID NO: 245, 280, 285, 286, 288, or 289. In several embodiments, the CAR includes an immunosuppressive fragment of SEQ ID NO: 287. As discussed above, those sequences (or individual sequence) can be positioned in the hinge region, the N-terminal region or within the target binder region (e.g., within the linker of an scFv). In several embodiments, the CAR comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with any of SEQ ID NOs: SEQ ID NO: 245, 280, 285, 286, 288, or 289 or an immunosuppressive fragment of SEQ ID NO: 287.
[0343] In addition to incorporation of the viral immunosuppressive peptides being positioned in the CAR, these non-viral immunosuppressive polypeptides can be coupled to a domain that allows them to be expressed as a membrane bound polypeptides.
[0344] Various transmembrane proteins can be used, such as one or more of CD8?, CD4, CD3?, CD3?, CD3?, CD3?, CD28, CD137, glycophorin A, glycophorin D, nicotinic acetylcholine receptor, a GABA receptor, Fc?RI?, and a T-cell receptor. In several embodiments, a portion of one or more of these domains (e.g., a transmembrane domain) is used to anchor or otherwise tether the immunosuppressive peptide(s) to the immune cell surface. In several embodiments, the transmembrane protein comprises a CD8?transmembrane domain. In several embodiments, the CD8? transmembrane domain comprises the amino acid sequence of SEQ ID NO: 4, or a sequence with at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 4. In several embodiments, the CD8? transmembrane domain is encoded by the nucleic acid sequence of SEQ ID NO: 3, or a sequence with at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 3. In several embodiments, a hinge or other linker is used to couple the immunosuppressive peptide to the transmembrane protein. In several embodiments, a CD8? is used. In several embodiments, the CD8? hinge comprises the amino acid sequence of SEQ ID NO: 2, or a sequence with at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 2. In several embodiments, the CD8? hinge comprises the amino acid sequence of SEQ ID NO: 1, or a sequence with at least about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% sequence identity with SEQ ID NO: 1.
[0345] In several embodiments, there is provided a polynucleotide encoding a truncated CD47 immunosuppressive peptide. In several embodiments, the polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 245. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 245. In several embodiments, the polynucleotide comprises SEQ ID NO: 246 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 246. In several embodiments, provided for is a membrane-bound truncated CD47 immunosuppressive peptide. In several embodiments, the truncated CD47 immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound truncated CD47 immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound truncated CD47 immunosuppressive peptide comprises a CD8? signal peptide, a truncated CD47 peptide (e.g., positions 110-130 of the extracellular domain), a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound synthetic truncated CD47 immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 248 (or SEQ ID NO: 717). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 248 (or SEQ ID NO: 717). In several embodiments, the polynucleotide comprises SEQ ID NO: 249 (or SEQ ID NO: 718) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 249 (or SEQ ID NO: 718). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound truncated CD47 and GFP comprises SEQ ID NO: 247 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 247. In several embodiments, the polynucleotide encoding membrane-bound truncated CD47, a FLAG tag and GFP comprises SEQ ID NO: 716 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 716. In several embodiments, the membrane-bound truncated CD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 715 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 715.
[0346] As discussed above, any of the viral immunosuppressive peptides may be used in combination with one or more non-viral immunosuppressive peptides.
[0347] In several embodiments, there is provided a polynucleotide encoding a p15E viral immunosuppressive peptide truncated CD47 construct (p15E_tCD47). In several embodiments, provided for is a membrane-bound p15E_tCD47 construct. In several embodiments, the truncated CD47 peptide comprises a peptide corresponding to positions 110-130 of the extracellular domain of CD47. In several embodiments, the p15E_tCD47 construct is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound p15E_tCD47 construct comprises one or more linker sequences. In several embodiments, the membrane-bound p15E_tCD47 construct comprises a CD8? signal peptide, a p15E peptide, a linker (e.g., a GS linker), a truncated CD47 peptide, CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound p15E_tCD47 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 256 (or SEQ ID NO: 725). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 256 (or SEQ ID NO: 725). In several embodiments, the polynucleotide comprises SEQ ID NO: 257 (or SEQ ID NO: 726) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 257 (or SEQ ID NO: 726). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding the membrane-bound p15E_tCD47 construct and GFP comprises SEQ ID NO: 255 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 255. In several embodiments, the polynucleotide encoding the membrane-bound p15E_tCD47 construct, a FLAG tag, and GFP comprises SEQ ID NO: 724 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 724. In several embodiments, the membrane-bound p15E_tCD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 723 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 723.
[0348] In several embodiments, there is provided a polynucleotide encoding a p15E viral immunosuppressive peptide truncated CD47 construct (tCD47_p15E), a swap of the peptides of the construct just described. In several embodiments, provided for is a membrane-bound tCD47_p15E construct. In several embodiments, the truncated CD47 peptide comprises a peptide corresponding to positions 110-130 of the extracellular domain of CD47. In several embodiments, the tCD47_p15E construct is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound tCD47_p15E construct comprises one or more linker sequences. In several embodiments, the membrane-bound tCD47_p15E construct comprises a CD8? signal peptide, a truncated CD47 peptide, a linker (e.g., a GS linker), a p15E peptide, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound tCD47_p15E construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 259 (or SEQ ID NO: 729). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 259 (or SEQ ID NO: 729). In several embodiments, the polynucleotide comprises SEQ ID NO: 260 (or SEQ ID NO: 730) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 260 (or SEQ ID NO: 730). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding the membrane-bound tCD47_p15E construct and GFP comprises SEQ ID NO: 258 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 258. In several embodiments, the polynucleotide encoding the membrane-bound tCD47_p15E construct, a FLAG tag, and GFP comprises SEQ ID NO: 728 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 728. In several embodiments, the membrane-bound tCD47_p15E, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 727 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 727.
[0349] In several embodiments, there is provided a polynucleotide encoding a modified HIV Gp41 viral immunosuppressive peptide truncated CD47 construct (HIV_L_tCD47). In several embodiments, provided for is a membrane-bound HIV_L_tCD47 construct. In several embodiments, the truncated CD47 peptide comprises a peptide corresponding to positions 110-130 of the extracellular domain of CD47. In several embodiments, the HIV_L_tCD47 construct is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound HIV_L_tCD47 construct comprises one or more linker sequences. In several embodiments, the membrane-bound HIV_L_tCD47 construct comprises a CD8? signal peptide, a modified HIV Gp41 viral immunosuppressive peptide, a linker (e.g., a GS linker), a truncated CD47 peptide, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound HIV_L_tCD47 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 262 (or SEQ ID NO: 733). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 262 (or SEQ ID NO: 733). In several embodiments, the polynucleotide comprises SEQ ID NO: 263 (or SEQ ID NO: 734) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 263 (or SEQ ID NO: 734). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding the membrane-bound HIV_L_tCD47 construct and GFP comprises SEQ ID NO: 261 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 261. In several embodiments, the polynucleotide encoding the membrane-bound HIV_L_tCD47 construct, a FLAG tag, and GFP comprises SEQ ID NO: 732 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 732. In several embodiments, the membrane-bound HIV_L_tCD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 731 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 731.
[0350] In several embodiments, there is provided a polynucleotide encoding an HIV Gp41 viral immunosuppressive peptide truncated CD47 construct (HIV_S_tCD47). In several embodiments, provided for is a membrane-bound HIV_S_tCD47 construct. In several embodiments, the truncated CD47 peptide comprises a peptide corresponding to positions 110-130 of the extracellular domain of CD47. In several embodiments, the HIV_S_tCD47 construct is coupled to a CD8? transmembrane protein and/or CD8?hinge domain. In several embodiments, the membrane-bound HIV_S_tCD47 construct comprises one or more linker sequences. In several embodiments, the membrane-bound HIV_S_tCD47 construct comprises a CD8? signal peptide, an HIV Gp41 viral immunosuppressive peptide, a linker (e.g., a GS linker), a truncated CD47 peptide, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound HIV_S_tCD47 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 265 (or SEQ ID NO: 737). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 265 (or SEQ ID NO: 737). In several embodiments, the polynucleotide comprises SEQ ID NO: 266 (or SEQ ID NO: 738) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 266 (or SEQ ID NO: 738). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding the membrane-bound HIV_S_tCD47 construct and GFP comprises SEQ ID NO: 264 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 264. In several embodiments, the polynucleotide encoding the membrane-bound HIV_S_tCD47 construct, a FLAG tag, and GFP comprises SEQ ID NO: 736 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 736. In several embodiments, the membrane-bound HIV_S_tCD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 735 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 735.
[0351] In several embodiments, there is provided a polynucleotide encoding an HTLV viral immunosuppressive peptide truncated CD47 construct (HTLV_tCD47). In several embodiments, provided for is a membrane-bound HTLV_tCD47 construct. In several embodiments, the truncated CD47 peptide comprises a peptide corresponding to positions 110-130 of the extracellular domain of CD47. In several embodiments, the HTLV_tCD47 construct is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound HTLV_tCD47 construct comprises one or more linker sequences. In several embodiments, the membrane-bound HTLV_tCD47 construct comprises a CD8? signal peptide, an HTLV viral immunosuppressive peptide, a linker (e.g., a GS linker), a truncated CD47 peptide, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound HTLV_tCD47 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 268 (or SEQ ID NO: 741). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 268 (or SEQ ID NO: 741). In several embodiments, the polynucleotide comprises SEQ ID NO: 269 (or SEQ ID NO: 742) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 269 (or SEQ ID NO: 742). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding the membrane-bound HTLV_tCD47 construct and GFP comprises SEQ ID NO: 267 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 267. In several embodiments, the polynucleotide encoding the membrane-bound HTLV_tCD47 construct, a FLAG tag, and GFP comprises SEQ ID NO: 740 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 740. In several embodiments, the membrane-bound HTLV_tCD47, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 739 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 739.
[0352] In several embodiments, there is provided a polynucleotide encoding a truncated CD47-p15E-dimer viral immunosuppressive peptide truncated CD47 construct (tCD47_p15Ex2). In several embodiments, provided for is a membrane-bound tCD47_p15Ex2 construct. In several embodiments, the truncated CD47 peptide comprises a peptide corresponding to positions 110-130 of the extracellular domain of CD47. In several embodiments, the tCD47_p15Ex2 construct is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound tCD47_p15Ex2 construct comprises one or more linker sequences. In several embodiments, the membrane-bound tCD47_p15Ex2 construct comprises a CD8? signal peptide, a truncated CD47 peptide, a linker (e.g., a GS linker), a first p15E peptide, a linker (e.g., a GS linker), a second p15E peptide, a CD8? hinge, and a CD8?transmembrane domain. In several embodiments, the membrane-bound tCD47_p15Ex2 construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 271 (or SEQ ID NO: 745). In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 271 (or SEQ ID NO: 745). In several embodiments, the polynucleotide comprises SEQ ID NO: 272 (or SEQ ID NO: 746) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 272 (or SEQ ID NO: 746). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding the membrane-bound tCD47_p15Ex2 construct and GFP comprises SEQ ID NO: 270 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 270. In several embodiments, the polynucleotide encoding the membrane-bound tCD47_p15Ex2 construct, a FLAG tag, and GFP comprises SEQ ID NO: 744 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 744. In several embodiments, the membrane-bound tCD47_p15Ex2, FLAG tag, GFP construct comprises the amino acid sequence of SEQ ID NO: 743 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 743.
[0353] Additionally, according to several embodiments, combinations and/or replicates of various viral peptides are provided for. See
[0354] In several embodiments, there is provided a polynucleotide encoding a synthetic CKS-17 viral immunosuppressive peptide. In several embodiments, provided for is a membrane-bound synthetic CKS-17 viral immunosuppressive peptide. In several embodiments, the synthetic CKS-17 viral immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound synthetic CKS-17 viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound synthetic CKS-17 viral immunosuppressive peptide comprises a CD8? signal peptide, synthetic CKS-17, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound synthetic CKS-17 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 749. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 749. In several embodiments, the polynucleotide comprises SEQ ID NO: 750 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 750. In several embodiments, the polynucleotide encoding membrane-bound synthetic CKS-17 also encodes GFP (without an IRES or a linker) and comprises SEQ ID NO: 748 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 748. In several embodiments, the membrane-bound synthetic CKS-17-GFP construct comprises SEQ ID NO: 747 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 747.
[0355] In several embodiments, a truncated CD47 immunosuppressive peptide is employed. In several embodiments, there is provided a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 754. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 754. In several embodiments, the polynucleotide comprises SEQ ID NO: 753 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 753. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding truncated CD47 and GFP comprises SEQ ID NO: 752 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 752. In several embodiments, the truncated CD47-GFP construct comprises the amino acid sequence of SEQ ID NO: 751 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 751.
[0356] In several embodiments, there is provided a polynucleotide encoding an HIV Gp41 viral immunosuppressive peptide construct that includes a native HIV transmembrane domain (fGP41_HIVtm). In several embodiments, the HIV Gp41 viral immunosuppressive peptide is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is MALPVTALLLPLALLLHAARP (SEQ ID NO 895) at the amino acid level and ATGGCACTCCCCGTAACTGCTCTGCTGCTG CCGTTGGCATTGCTCCTGCACGCCGCACGCCCG (SEQ ID NO 896) at the nucleotide level). In several embodiments, the HIV Gp41 viral immunosuppressive construct comprises a CD8? signal peptide and HIV Gp41 and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO:757. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 757. In several embodiments, the polynucleotide comprises SEQ ID NO: 758 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 758. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). n several embodiments, a linker (e.g., a GS linker) is positioned between the Gp41 domain and the tag. In several embodiments, the polynucleotide encoding HIV Gp41 and GFP comprises SEQ ID NO: 756 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 756. In several embodiments, the fGP41_HIVtm-GFP construct comprises that amino acid sequence of SEQ ID NO: 755 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 755.
[0357] In several embodiments, there is provided a polynucleotide encoding a p15E transmembrane domain immunosuppressive peptide (p15Etm_sf). In several embodiments, the p15E transmembrane domain is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the p15E transmembrane domain immunosuppressive construct comprises a CD8? signal peptide and the p15E transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 761. In several embodiments, the polynucleotide encodes a sequence that shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO:761. In several embodiments, the polynucleotide comprises SEQ ID NO: 762 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 762. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the p15E transmembrane domain and the tag. In several embodiments, the polynucleotide encoding the p15E transmembrane domain and GFP comprises SEQ ID NO: 760 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 760. In several embodiments, the p15E transmembrane domain-GFP construct comprises the amino acid sequence of SEQ ID NO: 759 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 759.
[0358] In several embodiments, there is provided a polynucleotide encoding a CD43-derived immunosuppressive peptide (fCD43_TM). In several embodiments, the CD43 peptide is coupled to a CD8?signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the CD43 immunosuppressive construct comprises a CD8? signal peptide and the CD43 peptide and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 765. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 765. In several embodiments, the polynucleotide comprises SEQ ID NO: 766 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 766. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CD43 and the tag. In several embodiments, the polynucleotide encoding fCD43 and GFP comprises SEQ ID NO: 764 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 764. In several embodiments, the CD43-GFP construct comprises the amino acid sequence of SEQ ID NO: 763 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 763.
[0359] In several embodiments, there is provided a polynucleotide encoding a latent membrane protein 1 (LMP1) peptide of the Epstein-Barr Virus (LMP1_TM). In several embodiments, the LMP1 peptide is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the LMP1 immunosuppressive construct comprises a CD8?signal peptide and the LMP1 peptide and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 769. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 769. In several embodiments, the polynucleotide comprises SEQ ID NO: 770 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 770. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the LMP1 and the tag. In several embodiments, the polynucleotide encoding fLMP1 and GFP comprises SEQ ID NO: 768 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 768. In several embodiments, the LMP1-GFP construct comprises the amino acid sequence of SEQ ID NO: 767 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 767.
[0360] In several embodiments, there is provided a polynucleotide encoding a glycoprotein D (gD) of the Herpes Simplex Virus (fgD_TM). In several embodiments, the gD peptide is coupled to a CD8?signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the gD immunosuppressive construct comprises a CD8? signal peptide and the gD peptide and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 773. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 773. In several embodiments, the polynucleotide comprises SEQ ID NO: 774 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 774. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the gD and the tag. In several embodiments, the polynucleotide encoding gD and GFP comprises SEQ ID NO: 772 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 772. In several embodiments, the gD-GFP construct comprises the amino acid sequence of SEQ ID NO: 771 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 771.
[0361] In several embodiments, there is provided a polynucleotide encoding a lectin-like transcript 1 (LLT1), which, when interacting with CD161, inhibits Natural Killer cell activation and contributes to tumor cell immunosuppressive properties. In several embodiments, the LLT1 peptide is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the LLT1 immunosuppressive construct comprises a CD8? signal peptide and the LLT1 peptide and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 777. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 777. In several embodiments, the polynucleotide comprises SEQ ID NO: 778 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 778. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the LLT1 and the tag. In several embodiments, the polynucleotide encoding LLT1 and GFP comprises SEQ ID NO: 776 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 776. In several embodiments, the LLT1-GFP construct comprises the amino acid sequence of SEQ ID NO: 775 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 775.
[0362] In several embodiments, there is provided a polynucleotide encoding at least a portion of the extracellular and transmembrane domains of CD47 (CD47tm162). In several embodiments, the CD47 domains are coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the CD47 immunosuppressive construct comprises a CD8? signal peptide and the CD47 extracellular and transmembrane domains (positions 19 to 162 of UniProtKBQ08722) and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 781. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 781. In several embodiments, the polynucleotide comprises SEQ ID NO: 782 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 782. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CD47 domains and the tag. In several embodiments, the polynucleotide encoding CD47 and GFP comprises SEQ ID NO: 780 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 780. In several embodiments, the CD47tm162-GFP construct comprises the amino acid sequence of SEQ ID NO: 779 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 779.
[0363] In several embodiments, there is provided a polynucleotide encoding at least a portion of the latent membrane protein (LMP) oncogene of the Epstein-Barr virus (LMP_L_CD8HTM). In several embodiments, the LMP domain is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the LMP immunosuppressive construct comprises a CD8? signal peptide, the LMP_L domain, a CD8? hinge, and a CD8? transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 785. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 785. In several embodiments, the polynucleotide comprises SEQ ID NO: 786 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 786. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CD47 domains and the tag. In several embodiments, the polynucleotide encoding the LMP_L domain and GFP comprises SEQ ID NO: 784 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 784. In several embodiments, the LMP_L_CD8HTM-GFP construct comprises the amino acid sequence of SEQ ID NO: 783 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 783.
[0364] In several embodiments, there is provided a polynucleotide encoding a synthetic immunosuppressive construct comprising a multimeric repeat (e.g., dimer, trimer, quatramer, pentamer, etc.) of a peptide with immunosuppressive properties (LALLFWLx5-CD8HTM). In several embodiments, the synthetic domain is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the synthetic immunosuppressive construct comprises a CD8? signal peptide, the five repeats of the synthetic peptide, a CD8? hinge, and a CD8? transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 789. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 789. In several embodiments, the polynucleotide comprises SEQ ID NO: 790 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 790. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the transmembrane domain and the tag. In several embodiments, the polynucleotide encoding the synthetic immunosuppressive peptide and GFP comprises SEQ ID NO: 788 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 788. In several embodiments, the synthetic immunosuppressive peptide-GFP construct comprises the amino acid sequence of SEQ ID NO: 787 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 787.
[0365] In several embodiments, there is provided a polynucleotide encoding at least a portion of the N-terminal fusion peptide (FP) of the human immunodeficiency virus (HIV)-1 envelope glycoprotein (Env) gp41 (GP41fp). In several embodiments, the GP41fp is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the GP41fp immunosuppressive construct comprises a CD8? signal peptide, the GP41fp peptide, and at least a portion of the GP41 transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 793. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 793. In several embodiments, the polynucleotide comprises SEQ ID NO: 794 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 794. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the transmembrane domain and the tag. In several embodiments, the polynucleotide encoding the GP41fp and GFP comprises SEQ ID NO: 792 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 792. In several embodiments, the GP41fp-GFP construct comprises the amino acid sequence of SEQ ID NO: 791 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 791.
[0366] In several embodiments, there is provided a polynucleotide encoding a CKS-17 viral immunosuppressive peptide. In several embodiments, provided for is a membrane-bound CKS-17 viral immunosuppressive peptide. In several embodiments, the CKS-17 viral immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound CKS-17 viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound CKS-17 viral immunosuppressive peptide comprises a CD8? signal peptide, synthetic CKS-17, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound CKS-17 viral immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 797. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 797. In several embodiments, the polynucleotide comprises SEQ ID NO: 798 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 798. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound synthetic CKS-17 and GFP comprises SEQ ID NO: 796 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 796. In several embodiments, the membrane-bound synthetic CKS-17-GFP construct comprises SEQ ID NO: 795 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 795.
[0367] In several embodiments, there is provided a polynucleotide encoding a chimeric immunosuppressive construct comprising a CKS-17 domain and an HTLV-1 (Gp21) domain. In several embodiments, provided for is a membrane-bound immunosuppressive construct comprising a CKS-17 domain and a an HTLV-1 (Gp21) domain (CKS_HTLV-8aTM). In several embodiments, the CKS_HTLV immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound CKS_HTLV viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound CKS_HTLV viral immunosuppressive peptide comprises a CD8? signal peptide, a CKS-17 peptide, an HTLV(Gp21) peptide, a CD8? hinge, and a CD8? transmembrane domain. In several embodiments, the membrane-bound CKS_HTLV immunosuppressive peptide construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 801. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 801. In several embodiments, the polynucleotide comprises SEQ ID NO: 802 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 802. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound CKS_HTLV and GFP comprises SEQ ID NO: 800 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 800. In several embodiments, the membrane-bound CKS_HTLV-GFP construct comprises an amino acid sequence of SEQ ID NO: 799 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 799.
[0368] In several embodiments, there is provided a polynucleotide encoding a chimeric immunosuppressive construct comprising a CKS-17 domain and an LMP domain. In several embodiments, provided for is a membrane-bound immunosuppressive construct comprising a CKS-17 domain and a an LMP domain (CKS_LMP-8aTM). In several embodiments, the CKS_LMP immunosuppressive peptide is coupled to a CD8? transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound CKS_LMP viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound CKS_LMP viral immunosuppressive construct comprises a CD8? signal peptide, a CKS-17 peptide, an LMP peptide, a CD8? hinge, and a CD8?transmembrane domain. In several embodiments, the membrane-bound CKS_LMP immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 805. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 805. In several embodiments, the polynucleotide comprises SEQ ID NO: 806 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 806. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound CKS_LMP and GFP comprises SEQ ID NO: 804 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 804. In several embodiments, the membrane-bound CKS_LMP-GFP construct comprises an amino acid sequence of SEQ ID NO: 803 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 803.
[0369] In several embodiments, there is provided a polynucleotide encoding a chimeric immunosuppressive construct comprising a CKS-17 domain and a GP41fp domain. In several embodiments, provided for is a membrane-bound immunosuppressive construct comprising a CKS-17 domain and an GP41fp domain (CKS_GP41fptm). In several embodiments, the membrane-bound CKS_GP41fptm viral immunosuppressive peptide construct comprises one or more linker sequences. In several embodiments, the membrane-bound CKS_GP41fptm viral immunosuppressive construct comprises a CD8? signal peptide, a first portion of the GP41fp (amino acids 1-16), a CKS-17 peptide, a second portion of the GP41fp (amino acids 17-70), and a gp41 transmembrane domain. In several embodiments, the membrane-bound CKS_GP41fptm immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 809. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 809. In several embodiments, the polynucleotide comprises SEQ ID NO: 810 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 810. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding membrane-bound CKS_GP41fptm and GFP comprises SEQ ID NO: 808 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 808. In several embodiments, the membrane-bound CKS_GP41fptm-GFP construct comprises an amino acid sequence of SEQ ID NO: 807 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 807.
[0370] In several embodiments, there is provided a polynucleotide encoding a truncated portion of the latent membrane protein 1 (LMP1) peptide of the Epstein-Barr Virus (LMP_S). In several embodiments, the LMP_S peptide is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, provided for is a membrane-bound LMP_S immunosuppressive construct comprising an LMP_S peptide coupled to a CD8?transmembrane protein and/or CD8? hinge domain. In several embodiments, the membrane-bound LMP_S immunosuppressive construct comprises one or more linker sequences. In several embodiments, the membrane-bound LMP_S immunosuppressive construct comprises a CD8? signal peptide, an LMP_S peptide, an HTLV(Gp21) peptide, a CD8? hinge, and a CD8? transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 813. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 813. In several embodiments, the polynucleotide comprises SEQ ID NO: 814 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 814. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the LMP_S and the tag. In several embodiments, the polynucleotide encoding LMP_S and GFP comprises SEQ ID NO: 812 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 812. In several embodiments, the LMP_S-GFP construct comprises the amino acid sequence of SEQ ID NO: 811 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 811.
[0371] In several embodiments, there is provided a polynucleotide encoding a chimeric immunosuppressive construct comprising at least a portion of the latent membrane protein 1 (LMP1) peptide of the Epstein-Barr Virus (LMP_L) coupled with at least a portion of the extracellular and transmembrane domains of CD47 (CD47tm162), together referred to as LMP_CD47tm162. In several embodiments, the LMP_CD47tm162 is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the LMP_CD47tm162 construct is membrane-bound based on the portion of the CD47 transmembrane domain and comprises one or more linker sequences. In several embodiments, the membrane-bound LMP_CD47tm162 immunosuppressive construct comprises a CD8? signal peptide, an LMP_L peptide, and a CD47tm162 peptide, and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 817. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 817. In several embodiments, the polynucleotide comprises SEQ ID NO: 818 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 818. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the LMP_CD47tm162 and the tag. In several embodiments, the polynucleotide encoding LMP_CD47tm162 and GFP comprises SEQ ID NO: 816 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 816. In several embodiments, the LMP_CD47tm162-GFP construct comprises the amino acid sequence of SEQ ID NO: 815 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 815.
[0372] In several embodiments, there is provided a polynucleotide encoding a chimeric immunosuppressive construct comprising at least a portion of a p15E viral peptide coupled with at least a portion of the extracellular and transmembrane domains of CD47 (CD47tm162), together referred to as p15E_CD47tm162. In several embodiments, the p15E_CD47tm162 is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the p15E_CD47tm162 construct is membrane-bound based on the portion of the CD47 transmembrane domain and comprises one or more linker sequences. In several embodiments, the membrane-bound p15E_CD47tm162 immunosuppressive construct comprises a CD8? signal peptide, a p15E peptide, and a CD47tm162 peptide, and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 821. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 821. In several embodiments, the polynucleotide comprises SEQ ID NO: 822 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 822. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the p15E_CD47tm162 and the tag. In several embodiments, the polynucleotide encoding p15E_CD47tm162 and GFP comprises SEQ ID NO: 820 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 820. In several embodiments, the p15E_CD47tm162-GFP construct comprises the amino acid sequence of SEQ ID NO: 819 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 819.
[0373] In several embodiments, there is provided a polynucleotide encoding a chimeric immunosuppressive construct comprising at least one domain derived from HIV Gp41 and at least one domain from CD47 (CD47_GP41fptm). In several embodiments, the CD47_GP41fptm is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the CD47_GP41fptm construct is membrane-bound based on a gp41 transmembrane domain. In several embodiments, the membrane-bound CD47_GP41fptm immunosuppressive construct comprises a CD8? signal peptide, a first GP41 domain (amino acids 1-16 of the extracellular domain), a CD47 domain (amino acids 2-141), a second GP41 domain (amino acids 17-70 of the extracellular domain), and a GP41 transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 825. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 825. In several embodiments, the polynucleotide comprises SEQ ID NO: 826 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 826. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CD47_GP41fptm and the tag. In several embodiments, the polynucleotide encoding CD47_GP41fptm and GFP comprises SEQ ID NO: 824 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 824. In several embodiments, the CD47_GP41fptm-GFP construct comprises the amino acid sequence of SEQ ID NO: 823 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 823.
[0374] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least a portion of an antibody that targets a signal-regulatory protein ? (SIRP?) (anti-SIRPa agonist_vHL), which is an innate immune checkpoint expressed on dendritic cells, macrophages, monocytes and neutrophils. In several embodiments, the constructs are engineered to be membrane-bound. In several embodiments, the anti-SIRPa agonist_vHL is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the anti-SIRPa agonist_vHL construct is membrane-bound based on a CD8? hinge region and/or a CD8? transmembrane domain. In several embodiments, the membrane-bound anti-SIRPa agonist_vHL immunosuppressive construct comprises a CD8? signal peptide, an anti-SIRPa heavy chain, a linker and anti-SIRPa light chain, a CD8? hinge region and, a CD8? transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 833. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 833. In several embodiments, the polynucleotide comprises SEQ ID NO: 834 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 834. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the anti-SIRPa agonist_vHL and the tag. In several embodiments, the polynucleotide encoding anti-SIRPa agonist_vHL and GFP comprises SEQ ID NO: 832 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 832. In several embodiments, the anti-SIRPa agonist_vHL-GFP construct comprises the amino acid sequence of SEQ ID NO: 831 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 831.
[0375] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from HTLV GP21 (HTLV1_GP21). In several embodiments, the HTLV1_GP21 is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the HTLV1_GP21 comprises a CD8? signal peptide and a GP21 transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 841. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 841. In several embodiments, the polynucleotide comprises SEQ ID NO: 842 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 842. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the HTLV1_GP21 and the tag. In several embodiments, the polynucleotide encoding HTLV1_GP21 and GFP comprises SEQ ID NO: 840 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 840. In several embodiments, the HTLV1_fGP62-GFP construct comprises the amino acid sequence of SEQ ID NO: 839 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 839.
[0376] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from a Lassa virus membrane glycoprotein 2 (LASV_fGP2). In several embodiments, the LASV_fGP2 is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the LASV_fGP2 comprises a CD8? signal peptide and at least a portion of a Lassa Virus GP2 domain, including a transmembrane region and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 845. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 845. In several embodiments, the polynucleotide comprises SEQ ID NO: 846 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 846. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the HTLV1_GP21 and the tag. In several embodiments, the polynucleotide encoding LASV_fGP2 and GFP comprises SEQ ID NO: 844 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 844. In several embodiments, the LASV_fGP2-GFP construct comprises the amino acid sequence of SEQ ID NO: 843 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 843.
[0377] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from a Sudan ebolavirus envelope glycoprotein (SEBOV_fGP). In several embodiments, the SEBOV_fGP is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the SEBOV_fGP comprises a CD8? signal peptide and at least two domains from the ebolavirus envelope. In several embodiments, the SEBOV_fGP comprises a full GP1 glycoprotein sequence followed by a truncated form of GP1 (known as GP2, resulting from proteolysis of the GP1 domain). In several embodiments, the GP2 domain includes a transmembrane domain. In several embodiments, the SEBOV_fGP is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 849. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 849. In several embodiments, the polynucleotide comprises SEQ ID NO: 850 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 850. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the SEBOV_fGP and the tag. In several embodiments, the polynucleotide encoding SEBOV_fGP and GFP comprises SEQ ID NO: 848 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 848. In several embodiments, the SEBOV_fGP-GFP construct comprises the amino acid sequence of SEQ ID NO: 847 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 847.
[0378] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from a Sudan ebolavirus envelope glycoprotein (SEBOV_GP2). In several embodiments, the SEBOV_GP2 is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the SEBOV_GP2 comprises a CD8? signal peptide and a GP2 domain, resulting from proteolysis of the GP1 domain. In several embodiments, the GP2 domain includes a transmembrane domain. In several embodiments, the SEBOV_GP2 is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 853. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 853. In several embodiments, the polynucleotide comprises SEQ ID NO: 854 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 854. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the SEBOV_GP2 and the tag. In several embodiments, the polynucleotide encoding SEBOV_GP2 and GFP comprises SEQ ID NO: 852 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 852. In several embodiments, the SEBOV_GP2-GFP construct comprises the amino acid sequence of SEQ ID NO: 851 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 851.
[0379] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least one domain derived from a Sars-CoV-2 spike protein (SCoV_S2). In several embodiments, the SCoV_S2 is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the SCoV_S2 comprises a CD8? signal peptide and a an S2 spike protein, including a transmembrane domain. In several embodiments, the SCoV_S2 is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 857. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 857. In several embodiments, the polynucleotide comprises SEQ ID NO: 858 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 858. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the SCoV_S2 and the tag. In several embodiments, the polynucleotide encoding SCoV_S2and GFP comprises SEQ ID NO: 856 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 856. In several embodiments, the SCoV_S2-GFP construct comprises the amino acid sequence of SEQ ID NO: 855 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 855.
[0380] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least a portion of a Galectin-3-binding protein (LGALS3BP). In several embodiments, the constructs are engineered to be membrane-bound. In several embodiments, the LGALS3BP is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, LGALS3BP construct is membrane-bound based on a CD8? hinge region and/or a CD8? transmembrane domain. In several embodiments, the membrane-bound LGALS3BP immunosuppressive construct comprises a CD8? signal peptide, a Galectin 3 binding protein, and a CD8? transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 861. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 861. In several embodiments, the polynucleotide comprises SEQ ID NO: 862 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 862. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the LGALS3BP and the tag. In several embodiments, the polynucleotide encoding LGALS3BP and GFP comprises SEQ ID NO: 860 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 860. In several embodiments, the LGALS3BP-GFP construct comprises the amino acid sequence of SEQ ID NO: 859 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 859.
[0381] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least a portion of CD24. In several embodiments, the constructs are engineered to be membrane-bound. In several embodiments, the CD24 construct comprises a CD24 signal peptide and a CD24 protein and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 865. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 865. In several embodiments, the polynucleotide comprises SEQ ID NO: 866 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 866. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a T2A domain is positioned between the CD24 and the tag. In several embodiments, the polynucleotide encoding CD24 and GFP comprises SEQ ID NO: 864 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 864. In several embodiments, the CD24-GFP construct comprises the amino acid sequence of SEQ ID NO: 863 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 863.
[0382] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least a portion of a Hepatitis C envelope glycoprotein (HCV_E2). In several embodiments, the HCV_E2 is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the HCV_E2 immunosuppressive construct comprises a CD8? signal peptide, and a E2 protein of HCV and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 869. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 869. In several embodiments, the polynucleotide comprises SEQ ID NO: 870 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 870. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the HCV_E2 and the tag. In several embodiments, the polynucleotide encoding HCV_E2 and GFP comprises SEQ ID NO: 868 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 868. In several embodiments, the HCV_E2-GFP construct comprises the amino acid sequence of SEQ ID NO: 867 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 867.
[0383] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least a portion of an antibody that targets a signal-regulatory protein ? (SIRPa) (anti-SIRPa agonist_vLH). In several embodiments, the constructs are engineered to be membrane-bound. In several embodiments, the anti-SIRPa agonist_vLH is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the anti-SIRPa agonist_vLH construct is membrane-bound based on a CD8? hinge region and/or a CD8? transmembrane domain. In several embodiments, the membrane-bound anti-SIRPa agonist_vLH immunosuppressive construct comprises a CD8? signal peptide, an anti-SIRPa light chain, a linker, anti-SIRPa heavy chain, a CD8? hinge region and, a CD8? transmembrane domain and is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 873. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 873. In several embodiments, the polynucleotide comprises SEQ ID NO: 874 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 874. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the anti-SIRPa agonist_vLH and the tag. In several embodiments, the polynucleotide encoding anti-SIRPa agonist_vLH and GFP comprises SEQ ID NO: 872 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 872. In several embodiments, the anti-SIRPa agonist_vLH-GFP construct comprises the amino acid sequence of SEQ ID NO: 871 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 871.
[0384] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising at least CEA Cell Adhesion Molecule 1-derived domain (CEACAMI). In several embodiments, the constructs are engineered to be membrane-bound. In several embodiments, the CEACAMI is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the CEACAMI immunosuppressive construct comprises a CD8? signal peptide and a CEACAMI-derived protein. In several embodiments, the CEACAMI immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 877. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 877. In several embodiments, the polynucleotide comprises SEQ ID NO: 878 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 878. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CEACAMI and the tag. In several embodiments, the polynucleotide encoding the CEACAMI and GFP comprises SEQ ID NO: 876 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 876. In several embodiments, the CEACAMI-GFP construct comprises the amino acid sequence of SEQ ID NO: 875 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 875.
[0385] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising CD155 transmembrane domain (CD155tm_3M). In several embodiments, the CD155tm_3M is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the CD155tm_3Mimmunosuppressive construct comprises a CD8? signal peptide and a CD155-derived protein. In several embodiments, the CD155tm_3M immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 881. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 881. In several embodiments, the polynucleotide comprises SEQ ID NO: 882 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 882. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CD155tm_3M and the tag. In several embodiments, the polynucleotide encoding the CD155tm_3M and GFP comprises SEQ ID NO: 880 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 880. In several embodiments, the CD155tm_3M-GFP construct comprises the amino acid sequence of SEQ ID NO: 879 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 879.
[0386] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising CD31 transmembrane domain (CD31tm). In several embodiments, the CD31tm is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the CD31tm immunosuppressive construct comprises a CD8? signal peptide and a CD31-derived protein. In several embodiments, the CD31tm immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 885. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 885. In several embodiments, the polynucleotide comprises SEQ ID NO: 886 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 886. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CD31tm and the tag. In several embodiments, the polynucleotide encoding the CD31tm and GFP comprises SEQ ID NO: 884 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 884. In several embodiments, the CD31tm-GFP construct comprises the amino acid sequence of SEQ ID NO: 883 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 883.
[0387] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising CD111 transmembrane domain (CD111tm). In several embodiments, the CD111tm is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the CD111tm immunosuppressive construct comprises a CD8? signal peptide and a CD111tm-derived protein. In several embodiments, the CD111 tm immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 889. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 889. In several embodiments, the polynucleotide comprises SEQ ID NO: 890 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 890. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CD111tm and the tag. In several embodiments, the polynucleotide encoding the CD111tm and GFP comprises SEQ ID NO: 888 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 888. In several embodiments, the CD111tm-GFP construct comprises the amino acid sequence of SEQ ID NO: 887 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 887.
[0388] In several embodiments, there is provided a polynucleotide encoding an immunosuppressive construct comprising CD200 transmembrane domain (CD200tm). In several embodiments, the CD200tm is coupled to a CD8? signal peptide (e.g., for expression purposes, the sequence of which is provided for separately herein). In several embodiments, the CD200tm immunosuppressive construct comprises a CD8? signal peptide and a CD200tm-derived protein. In several embodiments, the CD200tm immunosuppressive construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 893. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 893. In several embodiments, the polynucleotide comprises SEQ ID NO: 894 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 894. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the CD200tm and the tag. In several embodiments, the polynucleotide encoding the CD200tm and GFP comprises SEQ ID NO: 892 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 892. In several embodiments, the CD200tm-GFP construct comprises the amino acid sequence of SEQ ID NO: 891 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 891.
[0389] In several embodiments, the engineered cells provided for herein comprise a chimeric receptor that targets NKG2D, wherein the CAR comprises an amino acid of SEQ ID NO: 174, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 174 and one or more copies of one or more of the following membrane-bound immunosuppressive amino acid sequences: SEQ ID NO: 218, 223, 228, 233, 238, 243, 248, 253, 256, 259, 262, 265, 268, and 271.
[0390] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR comprises an amino acid of SEQ ID NO: 178, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 178 and one or more copies of one or more of the following membrane-bound immunosuppressive amino acid sequences: SEQ ID NO: 218, 223, 228, 233, 238, 243, 248, 253, 256, 259, 262, 265, 268, and 271.
[0391] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR comprises is encoded by SEQ ID NO: 466, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to the sequence encoded by SEQ ID NO: 466 and one or more copies of one or more of the following membrane-bound immunosuppressive amino acid sequences: SEQ ID NO: 218, 223, 228, 233, 238, 243, 248, 253, 256, 259, 262, 265, 268, and 271.
[0392] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD70, wherein the CAR comprises an amino acid of any of SEQ ID NOs: 383-465, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 383-465 and one or more copies of one or more of the following membrane-bound immunosuppressive amino acid sequences: SEQ ID NO: 218, 223, 228, 233, 238, 243, 248, 253, 256, 259, 262, 265, 268, and 271.
HLA-Modification
[0393] In several embodiments, immune cells are engineered to alter their HLA expression profile, order to interact with one or more inhibitory receptors on host immune cells. In several embodiments, the alteration of the HLA expression profile of engineered cells functions to impart to the engineered immune cell the ability to reduce or avoid cytotoxicity or other immune clearance by host immune cells (or other engineered immune cells), thereby enhancing the persistence (and thus functional life-span) of the engineered immune cells.
[0394] Human leukocyte antigen-E (HLA-E) is a major ligand for the natural killer inhibitory receptor CD94/NKG2A that is expressed on NK cells. When HLA-E is bound by the CD94/NKG2A complex, an inhibitory signaling cascade is initiated, resulting in reduced NK cell activity. Thus, expression of HLA-E can dampen the cytotoxic effects of host NK cells against an engineered immune cell (e.g., expressing a CAR and/or immunosuppressive peptides). Likewise, HLA-G also plays an important role in inhibiting natural killer (NK) cell function, not only in the maintenance of fetal-maternal immune tolerance but also in the context of organ or tissue transplantation. It also plays a role in the immune escape of tumors from host immune cells. HLA-G can inhibit the function of many immune cells such as NK cells, CD4+ and CD8+ T cells, and dendritic cells by binding to cell surface-expressed receptors, including immunoglobulin-like transcript 2 (ILT2), ILT4 and killer cell immunoglobulin-like receptor 2DL4 (KIR2DL4). In several embodiments, immune cells as disclosed herein are engineered to express HLA-E and/or HLA-G in order to suppress host NK cell (or other engineered NK cells administered) against the engineered immune cells.
[0395] Non-limiting embodiments of such an approach are schematically depicted in
[0396] In several embodiments, such as when B2M expression is reduced or knocked out, endogenous HLA expression is lost, and in several embodiments, specific re-expression of HLA-E and or HLA-G can aid in reduce NK cell activity against immune cells engineered to express HLA-E and or HLA-G. In several embodiments, this re-expression is coupled with gene editing to reduce NKG2A expression on NK cells to be administered, which limits the suppressive effect of HLA-E on the therapeutic cells themselves. In several embodiments, HLA-E expression is specifically introduced only on T cells. In several embodiments, those T cells operate to suppress NK cell activity via interaction with the NKG2A receptor on NK cells. In some embodiments, the activity of the engineered allogeneic NK cells is suppressed temporarily. In several embodiments, the temporary suppression of engineered allogeneic NK cell activity reduces the risk of NK cell exhaustion, which prolongs the persistence of the engineered allogeneic NK cells.
[0397] In several embodiments, there is provided a polynucleotide encoding HLA-E. In several embodiments, the polynucleotide encodes an HLA-E amino acid sequence comprising SEQ ID NO: 273. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 273. In several embodiments, the polynucleotide comprises SEQ ID NO: 274 or shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 274. In several embodiments, the encoded HLA-E is an HLA-E single chain trimer (SCT) composed of a canonical HLA-E binding peptide, mature human beta2-microglobulin, and mature HLA-E heavy chain (HLA-E trimer_SS). In several embodiments, the construct comprises a CD8? signal peptide, a first B2M sequence, an HLG peptide leader sequence, a linker (e.g., a GS linker), a second B2M sequence, a linker (e.g., a second GS linker), and an HLA-E sequence. In several embodiments, the HLA-E trimer_SS construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 276 or SEQ ID NO: 689. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 276 or SEQ ID NO: 689. In several embodiments, the polynucleotide comprises SEQ ID NO: 277 (or SEQ ID NO: 690) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 277 or SEQ ID NO: 690. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding the HLA-E trimer_SS construct and GFP comprises SEQ ID NO: 275 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 275. In several embodiments, the polynucleotide encoding the HLA-E trimer_SS construct, a FLAG tag, and GFP comprises SEQ ID NO: 688 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 688. In several embodiments, the HLA-E trimer_SS construct with a FLAG tag and GFP is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 687, or having at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 687.
[0398] In several embodiments, similar constructs are provided for HLA-G wherein the HLA-G trimer_SS construct comprises a CD8? signal peptide, a first B2M sequence, an HLG peptide leader sequence, a linker (e.g., a GS linker), a second B2M sequence, a linker (e.g., a second GS linker), and an HLA-G sequence. In several embodiments, the HLA-G trimer_SS construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 279. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 279. In several embodiments, the HLA-G polypeptide comprises a functional portion of SEQ ID NO: 278.
[0399] In the context of viral infection, MHC class I-restricted CD8+ cytotoxic T lymphocytes are recruited to control viral infections. These cytotoxic T lymphocytes recognize and lyse virus-infected cells through engagement of the lymphocyte T cell receptor with MHC class I molecules that present viral antigens on the surface of infected cells. MHC class I heavy chain associates with beta-2 microglobulin (B2M) to form a heterodimer, which constitutes part of the MHC class I peptide-loading complex. Human cytomegalovirus has evolved several gene products of the unique short region protein, US2, US3, US6, and US11, which interfere with antigen presentation and cell surface expression of MHC class I molecules. While interference in antigen presentation and MHC class I down-regulation on the cell surface allows infected cells to evade virus-specific cytotoxic T lymphocytes, the down-regulation of MHC class I molecules renders the virally infected cells more susceptible to host NK cells. To counteract this, human cytomegalovirus encodes multiple genes that function to evade NK-mediated cell lysis of infected cells, one of which is UL18. UL18 binds LIR-1, an NK cell inhibitory receptor. UL18 shares a high level of amino acid sequence identity with MHC class I and therefore UL18 can act as an MHCI surrogate and associate with B2M. Thus, in several embodiments, a chimeric UL18-B2M construct (see a non-limiting schematic at
[0400] In several embodiments, there is provided a polynucleotide encoding UL18. In several embodiments, the UL18-encoding polynucleotide encodes an amino acid sequence comprising SEQ ID NO: 280. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 280. In several embodiments, the polynucleotide comprises SEQ ID NO: 281 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 281. In several embodiments, the encoded UL18 is an chimeric UL18-B2M single chain trimer (SCT) composed of a canonical HLA-E binding peptide, mature human beta2-microglobulin, and UL18. In several embodiments, the chimeric UL18-B2M construct comprises a CD8? signal peptide, a first B2M sequence, an HLG peptide leader sequence, a linker (e.g., a GS linker), a second B2M sequence, a linker (e.g., a second GS linker), an a UL18 sequence. In several embodiments, the chimeric UL18-B2M construct is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 283. In several embodiments, the polynucleotide encodes a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 283 or SEQ ID NO: 686. In several embodiments, the polynucleotide comprises SEQ ID NO: 284 (or SEQ ID NO: 685) or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 284 (or SEQ ID NO: 685). Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, the polynucleotide encoding the chimeric UL18-B2M construct and GFP comprises SEQ ID NO: 292 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 292. In several embodiments, the polynucleotide encoding the chimeric UL18-B2M construct, a FLAG tag and GFP comprises SEQ ID NO: 684 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 684. In additional embodiments, the polynucleotide encoding the chimeric UL18-B2M construct with a FLAG tag and GFP encodes the amino acid sequence of SEQ ID NO: 684 or a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 684. In additional embodiments, the polynucleotide encoding the chimeric UL18-B2M construct encodes the amino acid sequence of SEQ ID NO: 285 or a sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 285. In several embodiments, the polynucleotide comprises SEQ ID NO: 281 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 285.
[0401] In several embodiments, the engineered cells provided for herein comprise a chimeric receptor that targets NKG2D, wherein the CAR comprises an amino acid of SEQ ID NO: 174, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 174 and one or more copies of one or more of the following membrane-bound immunosuppressive constructs: SEQ ID NO: 273, 276, 279, 280, or 283.
[0402] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR comprises an amino acid of SEQ ID NO: 178, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 178 and one or more copies of one or more of the following membrane-bound immunosuppressive constructs: SEQ ID NO: 273, 276, 279, 280, or 283.
[0403] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD19, wherein the CAR is encoded by SEQ ID NO: 466, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to the sequence encoded by SEQ ID NO: 466 and one or more copies of one or more of the following membrane-bound immunosuppressive constructs: SEQ ID NO: 273, 276, 279, 280, or 283.
[0404] In several embodiments, the engineered cells provided for herein comprise a CAR that targets CD70, wherein the CAR comprises an amino acid of any of SEQ ID NOs: 383-465, or comprises an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 383-465 and one or more copies of one or more of the following membrane-bound immunosuppressive constructs: SEQ ID NO: 273, 276, 279, 280, or 283.
[0405] As discussed herein, in several embodiments, knockout of B2M expression results in loss of MHC expression on the edited cell. However, in several embodiments, HLA can be re-expressed, for example HLA-E or HLA-G. In several embodiments, the re-expression of the HLA is accomplished using a disulfilde trap single chain trimer (dtSCT) is used to express HLA-E and/or HLA-G and an immunosuppressive peptide, as well as B2M (HLA-E_STE20 or HLA-E_STE15). Provided for herein, in several embodiments, is a polynucleotide encoding a chimeric immunosuppressive construct comprising an HLA-G peptide, mature B2M and mature HLA-E. In several embodiments, such a construct comprises one or more linkers. In several embodiments, the immunosuppressive construct comprises a B2M signal peptide, an HLA-G peptide (amino acids 3-11 of HLA-G), a disulfide-bridge containing linker (e.g., a GS linker comprising at least two cysteine residues), a mature B2M domain, an additional linker (e.g., a GS linker), and a mature HLA-E domain. In several embodiments, the HLA-E_STE20 is encoded by a polynucleotide that encodes an amino acid sequence comprising SEQ ID NO: 829. In several embodiments, the amino acid sequence shares at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence with SEQ ID NO: 829. In several embodiments, the polynucleotide comprises SEQ ID NO: 830 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 830. Optionally, the polynucleotide encodes a detectable tag (e.g., a FLAG tag) and/or can comprise an internal ribosome entry site (IRES) that allows for expression of an additional protein, such as a detectable tag (e.g., GFP). In several embodiments, a linker (e.g., a GS linker) is positioned between the HLA-E_STE20 and the tag. In several embodiments, the polynucleotide encoding HLA-E_STE20 and GFP comprises SEQ ID NO: 828 or shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 828. In several embodiments, the HLA-E_STE20-GFP construct comprises the amino acid sequence of SEQ ID NO: 827 or an amino acid that shares at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity with SEQ ID NO: 827.
Extracellular Domains (Tumor Binder)
[0406] Some embodiments of the compositions and methods described herein relate to a chimeric antigen receptor that includes an extracellular domain that comprises a tumor-binding domain (also referred to as an antigen-binding protein or antigen-binding domain) as described herein. The tumor binding domain, depending on the embodiment, targets, for example CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, among others. Several embodiments of the compositions and methods described herein relate to a chimeric receptor that includes an extracellular domain that comprises a ligand binding domain that binds a ligand expressed by a tumor cell (also referred to as an activating chimeric receptor) as described herein. The ligand binding domain, depending on the embodiment, targets for example MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others).
[0407] In some embodiments, the antigen-binding domain is derived from or comprises wild-type or non-wild-type sequence of an antibody, an antibody fragment, an scFv, a Fv, a Fab, a (Fab)2, a single domain antibody (SDAB), a vH or vL domain, a camelid VHH domain, or a non-immunoglobulin scaffold such as a DARPIN, an affibody, an affilin, an adnectin, an affitin, a repebody, a fynomer, an alphabody, an avimer, an atrimer, a centyrin, a pronectin, an anticalin, a kunitz domain, an Armadillo repeat protein, an autoantigen, a receptor or a ligand. In some embodiments, the tumor-binding domain contains more than one antigen binding domain. In embodiments, the antigen-binding domain is operably linked directly or via an optional linker to the NH2-terminal end of a TCR domain (e.g. constant chains of TCR-alpha, TCR-betal, TCR-beta2, preTCR-alpha, pre-TCR-alpha-Del48, TCR-gamma, or TCR-delta).
Antigen-Binding Proteins
[0408] There are provided, in several embodiments, antigen-binding proteins. As used herein, the term antigen-binding protein shall be given its ordinary meaning, and shall also refer to a protein comprising an antigen-binding fragment that binds to an antigen and, optionally, a scaffold or framework portion that allows the antigen-binding fragment to adopt a conformation that promotes binding of the antigen-binding protein to the antigen. In some embodiments, the antigen is a cancer antigen (e.g., CD19) or a fragment thereof. In some embodiments, the antigen-binding fragment comprises at least one CDR from an antibody that binds to the antigen. In some embodiments, the antigen-binding fragment comprises all three CDRs from the heavy chain of an antibody that binds to the antigen or from the light chain of an antibody that binds to the antigen. In still some embodiments, the antigen-binding fragment comprises all six CDRs from an antibody that binds to the antigen (three from the heavy chain and three from the light chain). In several embodiments, the antigen-binding fragment comprises one, two, three, four, five, or six CDRs from an antibody that binds to the antigen, and in several embodiments, the CDRs can be any combination of heavy and/or light chain CDRs. The antigen-binding fragment in some embodiments is an antibody fragment.
[0409] Nonlimiting examples of antigen-binding proteins include antibodies, antibody fragments (e.g., an antigen-binding fragment of an antibody), antibody derivatives, and antibody analogs. Further specific examples include, but are not limited to, a single-chain variable fragment (scFv), a nanobody (e.g. VH domain of camelid heavy chain antibodies; VHH fragment), a Fab fragment, a Fab fragment, a F(ab)2 fragment, a Fv fragment, a Fd fragment, and a complementarity determining region (CDR) fragment. These molecules can be derived from any mammalian source, such as human, mouse, rat, rabbit, or pig, dog, or camelid. Antibody fragments may compete for binding of a target antigen with an intact (e.g., native) antibody and the fragments may be produced by the modification of intact antibodies (e.g. enzymatic or chemical cleavage) or synthesized de novo using recombinant DNA technologies or peptide synthesis. The antigen-binding protein can comprise, for example, an alternative protein scaffold or artificial scaffold with grafted CDRs or CDR derivatives. Such scaffolds include, but are not limited to, antibody-derived scaffolds comprising mutations introduced to, for example, stabilize the three-dimensional structure of the antigen-binding protein as well as wholly synthetic scaffolds comprising, for example, a biocompatible polymer. In addition, peptide antibody mimetics (PAMs) can be used, as well as scaffolds based on antibody mimetics utilizing fibronectin components as a scaffold.
[0410] In some embodiments, the antigen-binding protein comprises one or more antibody fragments incorporated into a single polypeptide chain or into multiple polypeptide chains. For instance, antigen-binding proteins can include, but are not limited to, a diabody; an intrabody; a domain antibody (single VL or VH domain or two or more VH domains joined by a peptide linker); a maxibody (2 scFvs fused to Fc region); a triabody; a tetrabody; a minibody (scFv fused to CH3 domain); a peptibody (one or more peptides attached to an Fc region); a linear antibody (a pair of tandem Fd segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions); a small modular immunopharmaceutical; and immunoglobulin fusion proteins (e.g. IgG-scFv, IgG-Fab, 2scFv-IgG, 4scFv-IgG, VH-IgG, IgG-VH, and Fab-scFv-Fc).
[0411] In some embodiments, the antigen-binding protein has the structure of an immunoglobulin. As used herein, the term immunoglobulin shall be given its ordinary meaning, and shall also refer to a tetrameric molecule, with each tetramer comprising two identical pairs of polypeptide chains, each pair having one light (about 25 kDa) and one heavy chain (about 50-70 kDa). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
[0412] Within light and heavy chains, the variable (V) and constant regions (C) are joined by a J region of about 12 or more amino acids, with the heavy chain also including a D region of about 10 more amino acids. The variable regions of each light/heavy chain pair form the antibody binding site such that an intact immunoglobulin has two binding sites.
[0413] Immunoglobulin chains exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called complementarity determining regions or CDRs. From N-terminus to C-terminus, both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.
[0414] Human light chains are classified as kappa and lambda light chains. An antibody light chain, refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (K) and lambda (A) light chains refer to the two major antibody light chain isotypes. A light chain may include a polypeptide comprising, from amino terminus to carboxyl terminus, a single immunoglobulin light chain variable region (VL) and a single immunoglobulin light chain constant domain (CL).
[0415] Heavy chains are classified as mu (p), delta (A), gamma (?), alpha (a), and epsilon (c), and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. An antibody heavy chain refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs. A heavy chain may include a polypeptide comprising, from amino terminus to carboxyl terminus, a single immunoglobulin heavy chain variable region (VH), an immunoglobulin heavy chain constant domain 1 (CH1), an immunoglobulin hinge region, an immunoglobulin heavy chain constant domain 2 (CH2), an immunoglobulin heavy chain constant domain 3 (CH3), and optionally an immunoglobulin heavy chain constant domain 4 (CH4).
[0416] The IgG-class is further divided into subclasses, namely, IgG1, IgG2, IgG3, and IgG4. The IgA-class is further divided into subclasses, namely IgA1 and IgA2. The IgM has subclasses including, but not limited to, IgM1 and IgM2. The heavy chains in IgG, IgA, and IgD antibodies have three domains (CH1, CH2, and CH3), whereas the heavy chains in IgM and IgE antibodies have four domains (CH1, CH2, CH3, and CH4). The immunoglobulin heavy chain constant domains can be from any immunoglobulin isotype, including subtypes. The antibody chains are linked together via inter-polypeptide disulfide bonds between the CL domain and the CH1 domain (e.g., between the light and heavy chain) and between the hinge regions of the antibody heavy chains.
[0417] In some embodiments, the antigen-binding protein is an antibody. The term antibody, as used herein, refers to a protein, or polypeptide sequence derived from an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be monoclonal, or polyclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources. Antibodies can be tetramers of immunoglobulin molecules. The antibody may be humanized, chimeric or non-human. An antibody may include an intact immunoglobulin of any isotype, and includes, for instance, chimeric, humanized, human, and bispecific antibodies. An intact antibody will generally comprise at least two full-length heavy chains and two full-length light chains. Antibody sequences can be derived solely from a single species, or can be chimeric, that is, different portions of the antibody can be derived from two different species as described further below. Unless otherwise indicated, the term antibody also includes antibodies comprising two substantially full-length heavy chains and two substantially full-length light chains provided the antibodies retain the same or similar binding and/or function as the antibody comprised of two full length light and heavy chains. For example, antibodies having 1, 2, 3, 4, or 5 amino acid residue substitutions, insertions or deletions at the N-terminus and/or C-terminus of the heavy and/or light chains are included in the definition provided that the antibodies retain the same or similar binding and/or function as the antibodies comprising two full length heavy chains and two full length light chains. Examples of antibodies include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, bispecific antibodies, and synthetic antibodies. There is provided, in some embodiments, monoclonal and polyclonal antibodies. As used herein, the term polyclonal antibody shall be given its ordinary meaning, and shall also refer to a population of antibodies that are typically widely varied in composition and binding specificity. As used herein, the term monoclonal antibody (mAb) shall be given its ordinary meaning, and shall also refer to one or more of a population of antibodies having identical sequences. Monoclonal antibodies bind to the antigen at a particular epitope on the antigen.
[0418] In some embodiments, the antigen-binding protein is a fragment or antigen-binding fragment of an antibody. The term antibody fragment refers to at least one portion of an antibody, that retains the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an epitope of an antigen. Examples of antibody fragments include, but are not limited to, Fab, Fab, F(ab)2, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), a Fd fragment consisting of the VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (either vL or vH), camelid vHH domains, multi-specific antibodies formed from antibody fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, and an isolated CDR or other epitope binding fragments of an antibody. An antigen binding fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology 23: 1126-1136, 2005). Antigen binding fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3)(see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide mini bodies). An antibody fragment may include a Fab, Fab, F(ab)2, and/or Fv fragment that contains at least one CDR of an immunoglobulin that is sufficient to confer specific antigen binding to a cancer antigen (e.g., CD19). Antibody fragments may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies.
[0419] In some embodiments, Fab fragments are provided. A Fab fragment is a monovalent fragment having the VL, VH, CL and CH1 domains; a F(ab)2 fragment is a bivalent fragment having two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment has the VH and CH1 domains; an Fv fragment has the VL and VH domains of a single arm of an antibody; and a dAb fragment has a VH domain, a VL domain, or an antigen-binding fragment of a VH or VL domain. In some embodiments, these antibody fragments can be incorporated into single domain antibodies, single-chain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv. In some embodiments, the antibodies comprise at least one CDR as described herein.
[0420] There is also provided for herein, in several embodiments, single-chain variable fragments. As used herein, the term single-chain variable fragment (scFv) shall be given its ordinary meaning, and shall also refer to a fusion protein in which a VL and a VH region are joined via a linker (e.g., a synthetic sequence of amino acid residues) to form a continuous protein chain wherein the linker is long enough to allow the protein chain to fold back on itself and form a monovalent antigen binding site). For the sake of clarity, unless otherwise indicated as such, a single-chain variable fragment is not an antibody or an antibody fragment as defined herein. Diabodies are bivalent antibodies comprising two polypeptide chains, wherein each polypeptide chain comprises VH and VL domains joined by a linker that is configured to reduce or not allow for pairing between two domains on the same chain, thus allowing each domain to pair with a complementary domain on another polypeptide chain. According to several embodiments, if the two polypeptide chains of a diabody are identical, then a diabody resulting from their pairing will have two identical antigen binding sites. Polypeptide chains having different sequences can be used to make a diabody with two different antigen binding sites. Similarly, tribodies and tetrabodies are antibodies comprising three and four polypeptide chains, respectively, and forming three and four antigen binding sites, respectively, which can be the same or different.
[0421] In several embodiments, the antigen-binding protein comprises one or more CDRs. As used herein, the term CDR shall be given its ordinary meaning, and shall also refer to the complementarity determining region (also termed minimal recognition units or hypervariable region) within antibody variable sequences. The CDRs permit the antigen-binding protein to specifically bind to a particular antigen of interest. There are three heavy chain variable region CDRs (CDRH1, CDRH2 and CDRH3) and three light chain variable region CDRs (CDRL1, CDRL2 and CDRL3). The CDRs in each of the two chains typically are aligned by the framework regions to form a structure that binds specifically to a specific epitope or domain on the target protein. From N-terminus to C-terminus, naturally-occurring light and heavy chain variable regions both typically conform to the following order of these elements: FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. A numbering system has been devised for assigning numbers to amino acids that occupy positions in each of these domains. This numbering system is defined in Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, NIH, Bethesda, MD), or Chothia & Lesk, 1987, J. Mol. Biol. 196:901-917; Chothia et al., 1989, Nature 342:878-883. Complementarity determining regions (CDRs) and framework regions (FR) of a given antibody may be identified using this system. Other numbering systems for the amino acids in immunoglobulin chains include IMGT? (the international ImMunoGeneTics information system; Lefranc et al, Dev. Comp. Immunol. 29:185-203; 2005) and AHo (Honegger and Pluckthun, J. Mol. Biol. 309(3):657-670; 2001). One or more CDRs may be incorporated into a molecule either covalently or noncovalently to make it an antigen-binding protein.
[0422] In some embodiments, the antigen-binding proteins provided herein comprise one or more CDR(s) as part of a larger polypeptide chain. In some embodiments, the antigen-binding proteins covalently link the one or more CDR(s) to another polypeptide chain. In some embodiments, the antigen-binding proteins incorporate the one or more CDR(s) noncovalently. In some embodiments, the antigen-binding proteins may comprise at least one of the CDRs described herein incorporated into a biocompatible framework structure. In some embodiments, the biocompatible framework structure comprises a polypeptide or portion thereof that is sufficient to form a conformationally stable structural support, or framework, or scaffold, which is able to display one or more sequences of amino acids that bind to an antigen (e.g., CDRs, a variable region, etc.) in a localized surface region. Such structures can be a naturally occurring polypeptide or polypeptide fold (a structural motif), or can have one or more modifications, such as additions, deletions and/or substitutions of amino acids, relative to a naturally occurring polypeptide or fold. Depending on the embodiment, the scaffolds can be derived from a polypeptide of a variety of different species (or of more than one species), such as a human, a non-human primate or other mammal, other vertebrate, invertebrate, plant, bacteria or virus.
[0423] Depending on the embodiment, the biocompatible framework structures are based on protein scaffolds or skeletons other than immunoglobulin domains. In some such embodiments, those framework structures are based on fibronectin, ankyrin, lipocalin, neocarzinostain, cytochrome b, CP1 zinc finger, PST1, coiled coil, LACI-D1, Z domain and/or tendamistat domains.
[0424] There is also provided, in some embodiments, antigen-binding proteins with more than one binding site. In several embodiments, the binding sites are identical to one another while in some embodiments the binding sites are different from one another. For example, an antibody typically has two identical binding sites, while a bispecific or bifunctional antibody has two different binding sites. The two binding sites of a bispecific antigen-binding protein or antibody will bind to two different epitopes, which can reside on the same or different protein targets. In several embodiments, this is particularly advantageous, as a bispecific chimeric antigen receptor can impart to an engineered cell the ability to target multiple tumor markers. For example, CD19 and an additional tumor marker, such as CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, among others, or any other marker disclosed herein or appreciated in the art as a tumor specific antigen or tumor associated antigen can be bound by a bispecific antibody.
[0425] As used herein, the term chimeric antibody shall be given its ordinary meaning, and shall also refer to an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies. In some embodiments, one or more of the CDRs are derived from an anti-cancer antigen (e.g., CD19, CD123, CD70, Her2, mesothelin, PD-L1, Claudin 6, BCMA, EGFR, etc.) antibody. In several embodiments, all of the CDRs are derived from an anti-cancer antigen antibody (such as an anti-CD19 antibody). In some embodiments, the CDRs from more than one anti-cancer antigen antibodies are mixed and matched in a chimeric antibody. For instance, a chimeric antibody may comprise a CDR1 from the light chain of a first anti-cancer antigen antibody, a CDR2 and a CDR3 from the light chain of a second anti-cancer antigen antibody, and the CDRs from the heavy chain from a third anti-cancer antigen antibody. Further, the framework regions of antigen-binding proteins disclosed herein may be derived from one of the same anti-cancer antigen (e.g., CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc.) antibodies, from one or more different antibodies, such as a human antibody, or from a humanized antibody. In one example of a chimeric antibody, a portion of the heavy and/or light chain is identical with, homologous to, or derived from an antibody from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is/are identical with, homologous to, or derived from an antibody or antibodies from another species or belonging to another antibody class or subclass. Also provided herein are fragments of such antibodies that exhibit the desired biological activity.
[0426] In several embodiments, an antigen binding protein is directed against CD38 (also known as ADP-ribosyl cyclase 1, cADPr hydrolase 1, Cyclic ADP-ribose hydrolase 1, or T10). According to one embodiment, the CD38 antigen binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the antigen binding protein binds to an epitope of the human CD38, and in particular to an epitope of the extracellular domain of the human CD38. In several embodiments, the CD38 binding protein comprises an scFv comprising a vL and vH domain. In several embodiments, the anti-CD38 vL domain comprises the sequence of SEQ ID NO: 523, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 523. In several embodiments, the anti-CD38 vH domain comprises the sequence of SEQ ID NO: 524, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 524. In several embodiments, the anti-CD38 binding protein is an scFv that comprises the sequence of SEQ ID NO: 532, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 532. In several embodiments, the anti-CD38 CAR comprises the sequence of SEQ ID NO: 525, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 525. In several embodiments, the anti-CD38 binding protein comprises at least one CDR from SEQ ID NO: 526-531 or a CDR having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 526-531. In several embodiments, the antigen binding protein is affinity matured to enhance binding to CD38. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0427] In several embodiments, an antigen binding protein is directed against GPRCSD. According to one embodiment, the GPRCSD antigen binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the antigen binding protein binds to an epitope of the human GPRCSD. In several embodiments, the anti-GPRCSD is an scFv comprising the amino acid sequence of any one of SEQ ID NOs: 621-630, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 620-628. In several embodiments, the antigen binding protein is affinity matured to enhance binding to GPRCSD. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0428] In several embodiments, an antigen binding protein is directed against CD138. In several embodiments, the anti-CD138 binding protein comprises a vL and/or vH chain. In several embodiments, the vL chain comprises the amino acid sequence of SEQ ID NO: 533, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 533. In several embodiments, the vH chain comprises the amino acid sequence of SEQ ID NO: 534, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 534. In several embodiments, the anti-CD138 binding protein comprises at least one CDR from SEQ ID NO: 536-541 or a CDR having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 536-541. In several embodiments, the anti-CD138 binding protein is an scFv comprising the amino acid sequence of SEQ ID NO: 542, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 542. In several embodiments, the anti-CD138 binding protein is integrated into a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein comprising the amino acid sequence of SEQ ID NO: 535 or 543, or an amino acid sequence with at least about 80%, at least about 85%, at least about 90%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 535 or 543. In several embodiments, the antigen binding protein is affinity matured to enhance binding to CD138. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0429] In several embodiments, an antigen binding protein is directed against DLL3. In several embodiments, the anti-DLL3 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the anti-DLL3 antigen binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 570-581, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 570-581. In several embodiments, the anti-DLL3 antigen binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 582-593, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 582-593. In several embodiments, the anti-DLL3 binding protein comprises a polypeptide that targets DLL3 and comprises the amino acid sequence of any of SEQ ID NO: 594-595, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 594-595. In several embodiments, the anti-DLL3 binding protein comprises an scFv comprising the sequence of any of SEQ ID NO: 596-599, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 596-599. In several embodiments, the antigen binding protein is affinity matured to enhance binding to DLL3. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0430] In several embodiments, an antigen binding protein is directed against the epidermal growth factor receptor EGFR. In several embodiments, the anti-EGFR binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the anti-EGFR binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NO: 600, 606-607, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 600, 606-607. In several embodiments, the anti-EGFR binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NO: 601, 608-609, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 601, 608-609. In several embodiments, the anti-EGFR binding protein is an scFv comprising the amino acid sequence of any of SEQ ID NOs: 610-620, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 610-620. In several embodiments, the anti-EGFR binding protein is incorporated into a CAR having the sequence of any of SEQ ID NOs: 602-605, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 602-605. In several embodiments, the antigen binding protein is affinity matured to enhance binding to the EGFR. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0431] In several embodiments, an antigen binding protein is directed against PSMA. In several embodiments, the anti-PSMA binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the anti-PSMA binding protein comprises a vL chain comprising the amino acid sequence of SEQ ID NO: 634, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 634. In several embodiments, the anti-PSMA binding protein comprises a vH chain comprising the amino acid sequence of SEQ ID NO: 635, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 635. In several embodiments, the anti-PSMA binding protein comprises an scFv comprising the amino acid sequence of SEQ ID NO: 632 or 633, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 632 or 633. In several embodiments, the anti-PSMA binding protein comprises an antibody comprising the amino acid sequence of SEQ ID NO: 631, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 631. In several embodiments, the antigen binding protein is affinity matured to enhance binding to PSMA. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0432] In several embodiments, an antigen binding protein is directed against FLT3. In several embodiments, the anti-FLT3 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the anti-FLT3 binding protein comprises one or more CDRs from the vL and/or vH chain selected from SEQ ID NOs: 636-644, or a o CDR having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 636-644. In several embodiments, the anti-FLT3 binding protein comprises a vL chain comprising the amino acid sequence of SEQ ID NO: 645, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 645. In several embodiments, the anti-FLT3 binding protein comprises a vH chain comprising the amino acid sequence of SEQ ID NO: 646, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to SEQ ID NO: 646. In several embodiments, the antigen binding protein is affinity matured to enhance binding to FLT3. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0433] In several embodiments, an antigen binding protein is directed against KREMEN2. In several embodiments, the anti-KREMEN2 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the anti-KREMEN2 binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 647-651, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 647-651. In several embodiments, the anti-KREMEN2 binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 652-656, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 652-656. In several embodiments, the antigen binding protein is affinity matured to enhance binding to KREMEN2. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0434] In several embodiments, an antigen binding protein is directed against ALPPL2. In several embodiments, the anti-ALPPL2 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the anti-ALPPL2 binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 657-659, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 657-659. In several embodiments, the anti-ALPPL2 binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 660-662, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 660-662. In several embodiments, the anti-ALPPL2 binding protein is an antibody, or scFv, containing one or more combinations of the vL and vH domains comprising the amino acid sequence of any of SEQ ID NOs: 657-662, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NO: 657-662. In several embodiments, the antigen binding protein is affinity matured to enhance binding to ALPPL2. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein.
[0435] In several embodiments, an antigen binding protein is directed against CLDN4. In several embodiments, the anti-CLDN4 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the anti-CLDN4 binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 663, 664, or 667, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 663, 664, or 667. In several embodiments, the anti-CLDN4 binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 665, 666, or 668, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 665, 666, or 668. In several embodiments, the anti-CLDN4 binding protein is an antibody, or scFv, containing one or more combinations of the vL and vH domains comprising the amino acid sequence of any of SEQ ID NOs: 663-668, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 663-668. In several embodiments, the antigen binding protein is affinity matured to enhance binding to CLDN4. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein. In several embodiments, the antigen binding protein binds to CLDN4, but not to other claudins.
[0436] In several embodiments, an antigen binding protein is directed against CLDN6. In several embodiments, the anti-CLDN6 binding protein is an antigen binding domain of a CAR which comprises a transmembrane domain, a signaling domain, and optionally a co-stimulatory domain as disclosed herein. In several embodiments, the anti-CLDN6 binding protein comprises a vL chain comprising the amino acid sequence of any of SEQ ID NOs: 669-678, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 669-678. In several embodiments, the anti-CLDN6 binding protein comprises a vH chain comprising the amino acid sequence of any of SEQ ID NOs: 679-682, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 679-682. In several embodiments, the anti-CLDN6 binding protein is an antibody, or scFv, containing one or more combinations of the vL and vH domains comprising the amino acid sequence of any of SEQ ID NOs: 669-682, or a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity, homology and/or functional equivalence to any of SEQ ID NOs: 669-682. In several embodiments, the antigen binding protein is affinity matured to enhance binding to CLDN6. In several embodiments, the nucleotide sequence encoding the antigen binding protein is codon-optimized to enhance expression and/or stability of the protein. In several embodiments, the antigen binding protein binds to CLDN6, but not to other claudins.
[0437] In some embodiments, an antigen-binding protein is provided comprising a heavy chain variable domain having at least 90% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 95% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 96, 97, 98, or 99% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33. In several embodiments, the heavy chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the VH domain amino acid sequence set forth in SEQ ID NO: 33, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the heavy chain variable domain may have one or more additional mutations in the VH domain amino acid sequence set forth in SEQ ID NO: 33, but has improved specific binding to a cancer antigen (e.g., CD19).
[0438] In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 90% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 95% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 96, 97, 98, or 99% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32. In several embodiments, the light chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the VL domain amino acid sequence set forth in SEQ ID NO: 32, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the light chain variable domain may have one or more additional mutations in the VL domain amino acid sequence set forth in SEQ ID NO: 32, but has improved specific binding to a cancer antigen (e.g., CD19).
[0439] In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 90% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33, and a light chain variable domain having at least 90% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 95% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33, and a light chain variable domain having at least 95% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 96, 97, 98, or 99% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 33, and a light chain variable domain having at least 96, 97, 98, or 99% identity to the VL domain amino acid sequence set forth in SEQ ID NO: 32.
[0440] In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having the VH domain amino acid sequence set forth in SEQ ID NO: 33, and a light chain variable domain having the VL domain amino acid sequence set forth in SEQ ID NO: 32. In some embodiments, the light-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a light chain variable domain of SEQ ID NO: 32. In some embodiments, the light-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a heavy chain variable domain in accordance with SEQ ID NO: 33.
[0441] In some embodiments, the light chain variable domain comprises a sequence of amino acids that is encoded by a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the polynucleotide sequence SEQ ID NO: 32.
[0442] In some embodiments, the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a light chain variable domain in accordance with the sequence in SEQ ID NO: 32. In some embodiments, the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under stringent conditions to the complement of a polynucleotide that encodes a light chain variable domain in accordance with the sequence in SEQ ID NO: 32.
[0443] In some embodiments, the heavy chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a heavy chain variable domain in accordance with the sequence of SEQ ID NO: 33. In some embodiments, the heavy chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable domain in accordance with the sequence of SEQ ID NO: 33. In some embodiments, the heavy chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable domain in accordance with the sequence of SEQ ID NO: 33.
[0444] In several embodiments, additional anti-CD19 binding constructs are provided. For example, in several embodiments, there is provided an scFv that targets CD19 wherein the scFv comprises a heavy chain variable region comprising the sequence of SEQ ID NO. 35. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 95% identity to the HCV domain amino acid sequence set forth in SEQ ID NO: 35. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 96, 97, 98, or 99% identity to the HCV domain amino acid sequence set forth in SEQ ID NO: 35. In several embodiments, the heavy chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the HCV domain amino acid sequence set forth in SEQ ID NO: 35, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the heavy chain variable domain may have one or more additional mutations in the HCV domain amino acid sequence set forth in SEQ ID NO: 35, but has improved specific binding to a cancer antigen (e.g., CD19).
[0445] Additionally, in several embodiments, an scFv that targets CD19 comprises a light chain variable region comprising the sequence of SEQ ID NO. 36. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 95% identity to the LCV domain amino acid sequence set forth in SEQ ID NO: 36. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 96, 97, 98, or 99% identity to the LCV domain amino acid sequence set forth in SEQ ID NO: 36. In several embodiments, the light chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the LCV domain amino acid sequence set forth in SEQ ID NO: 36, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the light chain variable domain may have one or more additional mutations in the LCV domain amino acid sequence set forth in SEQ ID NO: 36, but has improved specific binding to a cancer antigen (e.g., CD19).
[0446] In several embodiments, there is also provided an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1, LC CDR2, and LC CDR3, respectively. In several embodiments, the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1, HC CDR2, and HC CDR3, respectively. In several embodiments, the LC CDR1 comprises the sequence of SEQ ID NO. 37. In several embodiments, the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 37. In several embodiments, the LC CDR2 comprises the sequence of SEQ ID NO. 38. In several embodiments, the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 38. In several embodiments, the LC CDR3 comprises the sequence of SEQ ID NO. 39. In several embodiments, the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 39. In several embodiments, the HC CDR1 comprises the sequence of SEQ ID NO. 40. In several embodiments, the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 40. In several embodiments, the HC CDR2 comprises the sequence of SEQ ID NO. 41, 42, or 43. In several embodiments, the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 41, 42, or 43. In several embodiments, the HC CDR3 comprises the sequence of SEQ ID NO. 44. In several embodiments, the HC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 44.
[0447] In several embodiments, there is also provided an anti-CD19 binding moiety that comprises a light chain variable region (VL) and a heavy chain variable region (HL), the VL region comprising a first, second and third complementarity determining region (VL CDR1, VL CDR2, and VL CDR3, respectively and the VH region comprising a first, second and third complementarity determining region (VH CDR1, VH CDR2, and VH CDR3, respectively. In several embodiments, the VL region comprises the sequence of SEQ ID NO. 45, 46, 47, or 48. In several embodiments, the VL region comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 45, 46, 47, or 48. In several embodiments, the VH region comprises the sequence of SEQ ID NO. 49, 50, 51 or 52. In several embodiments, the VH region comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 49, 50, 51 or 52.
[0448] In several embodiments, there is also provided an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1, LC CDR2, and LC CDR3, respectively. In several embodiments, the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1, HC CDR2, and HC CDR3, respectively. In several embodiments, the LC CDR1 comprises the sequence of SEQ ID NO. 53. In several embodiments, the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 53. In several embodiments, the LC CDR2 comprises the sequence of SEQ ID NO. 54. In several embodiments, the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 54. In several embodiments, the LC CDR3 comprises the sequence of SEQ ID NO. 55. In several embodiments, the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 55. In several embodiments, the HC CDR1 comprises the sequence of SEQ ID NO. 56. In several embodiments, the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 56. In several embodiments, the HC CDR2 comprises the sequence of SEQ ID NO. 57. In several embodiments, the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 57. In several embodiments, the HC CDR3 comprises the sequence of SEQ ID NO. 58. In several embodiments, the HC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 58.
[0449] In some embodiments, the antigen-binding protein comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 104. In some embodiments, the antigen-binding protein comprises a heavy chain variable region having at least 90% identity to the VH domain amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 95% sequence identity to the VH domain amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having at least 96, 97, 98, or 99% sequence identity to the VH domain amino acid sequence set forth in SEQ ID NO: 104. In several embodiments, the heavy chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the VH domain amino acid sequence set forth in SEQ ID NO: 104, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the heavy chain variable domain may have one or more additional mutations in the VH domain amino acid sequence set forth in SEQ ID NO: 104, but has improved specific binding to a cancer antigen (e.g., CD19).
[0450] In some embodiments, the antigen-binding protein comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO: 105. In some embodiments, the antigen-binding protein comprises a light chain variable region having at least 90% sequence identity to the VL domain amino acid sequence set forth in SEQ ID NO: 105. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 95% sequence identity to the VL domain amino acid sequence set forth in SEQ ID NO: 105. In some embodiments, the antigen-binding protein comprises a light chain variable domain having at least 96, 97, 98, or 99% sequence identity to the VL domain amino acid sequence set forth in SEQ ID NO: 105. In several embodiments, the light chain variable domain may have one or more additional mutations (e.g., for purposes of humanization) in the VL domain amino acid sequence set forth in SEQ ID NO: 105, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the light chain variable domain may have one or more additional mutations in the VL domain amino acid sequence set forth in SEQ ID NO: 105, but has improved specific binding to a cancer antigen (e.g., CD19).
[0451] In some embodiments, the antigen-binding protein comprises a heavy chain variable domain having the VH domain amino acid sequence set forth in SEQ ID NO: 104, and a light chain variable domain having the VL domain amino acid sequence set forth in SEQ ID NO: 105. In some embodiments, the light-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a light chain variable domain of SEQ ID NO: 105. In some embodiments, the heavy-chain variable domain comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of a heavy chain variable domain in accordance with SEQ ID NO: 104.
[0452] In some embodiments, the antigen-binding protein comprises a heavy chain variable comprising the amino acid sequence of SEQ ID NO: 106. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 90% sequence identity to the VH amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 95% sequence identity to the VH amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 96, 97, 98, or 99% identity to the VH amino acid sequence set forth in SEQ ID NO: 106. In several embodiments, the heavy chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VH amino acid sequence set forth in SEQ ID NO: 106, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the heavy chain variable may have one or more additional mutations in the VH amino acid sequence set forth in SEQ ID NO: 106, but has improved specific binding to a cancer antigen (e.g., CD19).
[0453] In some embodiments, the antigen-binding protein comprises a light chain variable comprising the amino acid sequence of SEQ ID NO: 107. In some embodiments, the antigen-binding protein comprises a light chain variable region having at least 90% sequence identity to the VL amino acid sequence set forth in SEQ ID NO: 107. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 95% sequence identity to the VL amino acid sequence set forth in SEQ ID NO: 107. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 96, 97, 98, or 99% identity to the VL amino acid sequence set forth in SEQ ID NO: 107. In several embodiments, the light chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VL amino acid sequence set forth in SEQ ID NO: 107, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the light chain variable may have one or more additional mutations in the VL amino acid sequence set forth in SEQ ID NO: 107, but has improved specific binding to a cancer antigen (e.g., CD19).
[0454] In several embodiments, there is also provided an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1, LC CDR2, and LC CDR3, respectively. In several embodiments, the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1, HC CDR2, and HC CDR3, respectively. In several embodiments, the LC CDR1 comprises the sequence of SEQ ID NO. 108. In several embodiments, the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 108. In several embodiments, the LC CDR2 comprises the sequence of SEQ ID NO. 109. In several embodiments, the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 109. In several embodiments, the LC CDR3 comprises the sequence of SEQ ID NO. 110. In several embodiments, the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 110. In several embodiments, the HC CDR1 comprises the sequence of SEQ ID NO. 111. In several embodiments, the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 111. In several embodiments, the HC CDR2 comprises the sequence of SEQ ID NO. 112, 113, or 114. In several embodiments, the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 112, 113, or 114. In several embodiments, the HC CDR3 comprises the sequence of SEQ ID NO. 115. In several embodiments, the HC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 115. In several embodiments, the anti-CD19 binding moiety comprises SEQ ID NO: 116, or is sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 116.
[0455] In some embodiments, the antigen-binding protein comprises a light chain variable comprising the amino acid sequence of SEQ ID NO: 117, 118, or 119. In some embodiments, the antigen-binding protein comprises a light chain variable region having at least 90% identity to the VL amino acid sequence set forth in SEQ ID NO: 117, 118, or 119. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 95% identity to the VL amino acid sequence set forth in SEQ ID NO: 117, 118, or 119. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 96, 97, 98, or 99% identity to the VL amino acid sequence set forth in SEQ ID NO: 117, 118, or 119. In several embodiments, the light chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VL amino acid sequence set forth in SEQ ID NO: 117, 118, or 119, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the light chain variable may have one or more additional mutations in the VL amino acid sequence set forth in SEQ ID NO: 117, 118, or 119, but has improved specific binding to a cancer antigen (e.g., CD19).
[0456] In some embodiments, the antigen-binding protein comprises a heavy chain variable comprising the amino acid sequence of SEQ ID NO: 120,121, 122, or 123. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 90% identity to the VH amino acid sequence set forth in SEQ ID NO: 120,121, 122, or 123. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 95% identity to the VH amino acid sequence set forth in SEQ ID NO: 120,121, 122, or 123. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 96, 97, 98, or 99% identity to the VH amino acid sequence set forth in SEQ ID NO: 120,121, 122, or 123. In several embodiments, the heavy chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VH amino acid sequence set forth in SEQ ID NO: 120,121, 122, or 123, but retains specific binding to a cancer antigen (e.g., CD19). In several embodiments, the heavy chain variable may have one or more additional mutations in the VH amino acid sequence set forth in SEQ ID NO: 120,121, 122, or 123, but has improved specific binding to a cancer antigen (e.g., CD19).
[0457] In several embodiments, there is also provided an anti-CD19 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1, LC CDR2, and LC CDR3, respectively. In several embodiments, the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1, HC CDR2, and HC CDR3, respectively. In several embodiments, the LC CDR1 comprises the sequence of SEQ ID NO. 124, 127, or 130. In several embodiments, the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 124, 127, or 130. In several embodiments, the LC CDR2 comprises the sequence of SEQ ID NO. 125, 128, or 131. In several embodiments, the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 125, 128, or 131. In several embodiments, the LC CDR3 comprises the sequence of SEQ ID NO. 126, 129, or 132. In several embodiments, the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 126, 129, or 132. In several embodiments, the HC CDR1 comprises the sequence of SEQ ID NO. 133, 136, 139, or 142. In several embodiments, the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 133, 136, 139, or 142. In several embodiments, the HC CDR2 comprises the sequence of SEQ ID NO. 134, 137, 140, or 143. In several embodiments, the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 134, 137, 140, or 143. In several embodiments, the HC CDR3 comprises the sequence of SEQ ID NO. 135, 138, 141, or 144. In several embodiments, the HC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 135, 138, 141, or 144.
[0458] Additional anti-CD19 binding moieties are known in the art, such as those disclosed in, for example, U.S. Pat. No. 8,399,645, US Patent Publication No. 2018/0153977, US Patent Publication No. 2014/0271635, US Patent Publication No. 2018/0251514, US Patent Publication No. 2018/0312588, and WO 2020/180882, the entirety of each of which is incorporated by reference herein.
[0459] Several embodiments relate to CARs that are directed to Claudin 6, and show little or no binding to Claudin 3, 4, or 9 (or other Claudins). In some embodiments, the antigen-binding protein comprises a heavy chain variable comprising the amino acid sequence of SEQ ID NO: 88. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 90% identity to the VH amino acid sequence set forth in SEQ ID NO: 88. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 95% identity to the VH amino acid sequence set forth in SEQ ID NO: 88. In some embodiments, the antigen-binding protein comprises a heavy chain variable having at least 96, 97, 98, or 99% identity to the VH amino acid sequence set forth in SEQ ID NO: 88. In several embodiments, the heavy chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VH amino acid sequence set forth in SEQ ID NO: 88, but retains specific binding to a cancer antigen (e.g., CLDN6). In several embodiments, the heavy chain variable may have one or more additional mutations in the VH amino acid sequence set forth in SEQ ID NO: 88, but has improved specific binding to a cancer antigen (e.g., CLDN6).
[0460] In some embodiments, the antigen-binding protein comprises a light chain variable comprising the amino acid sequence of SEQ ID NO: 89, 90 or 91. In some embodiments, the antigen-binding protein comprises a light chain variable region having at least 90% identity to the VL amino acid sequence set forth in SEQ ID NO: 89, 90 or 91. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 95% identity to the VL amino acid sequence set forth in SEQ ID NO: 89, 90 or 91. In some embodiments, the antigen-binding protein comprises a light chain variable having at least 96, 97, 98, or 99% identity to the VL amino acid sequence set forth in SEQ ID NO: 89, 90 or 91. In several embodiments, the light chain variable may have one or more additional mutations (e.g., for purposes of humanization) in the VL amino acid sequence set forth in SEQ ID NO: 89, 90 or 91, but retains specific binding to a cancer antigen (e.g., CLDN6). In several embodiments, the light chain variable may have one or more additional mutations in the VL amino acid sequence set forth in SEQ ID NO: 89, 90 or 91, but has improved specific binding to a cancer antigen (e.g., CLDN6).
[0461] In several embodiments, there is also provided an anti-CLDN6 binding moiety that comprises a light chain CDR comprising a first, second and third complementarity determining region (LC CDR1, LC CDR2, and LC CDR3, respectively. In several embodiments, the anti-CD19 binding moiety further comprises a heavy chain CDR comprising a first, second and third complementarity determining region (HC CDR1, HC CDR2, and HC CDR3, respectively. In several embodiments, the LC CDR1 comprises the sequence of SEQ ID NO. 95, 98, or 101. In several embodiments, the LC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 95, 98, or 101. In several embodiments, the LC CDR2 comprises the sequence of SEQ ID NO. 96, 99, or 102. In several embodiments, the LC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 96, 99, or 102. In several embodiments, the LC CDR3 comprises the sequence of SEQ ID NO. 97, 100, or 103. In several embodiments, the LC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 97, 100, or 103. In several embodiments, the HC CDR1 comprises the sequence of SEQ ID NO. 92. In several embodiments, the HC CDR1 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 92. In several embodiments, the HC CDR2 comprises the sequence of SEQ ID NO. 93. In several embodiments, the HC CDR2 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 93. In several embodiments, the HC CDR3 comprises the sequence of SEQ ID NO. 94. In several embodiments, the HC CDR3 comprises an amino acid sequence with at least about 85%, about 90%, about 95%, or about 98% sequence identity to the sequence of SEQ NO. 94. In several embodiments, the antigen-binding protein does not bind claudins other than CLDN6.
Natural Killer Group Domains that Bind Tumor Ligands
[0462] In several embodiments, engineered immune cells such as NK cells are leveraged for their ability to recognize and destroy tumor cells. For example, an engineered NK cell may include a CD19-directed chimeric antigen receptor or a nucleic acid encoding said chimeric antigen receptor (or a CAR directed against, for example, one or more of CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc.). NK cells express both inhibitory and activating receptors on the cell surface. Inhibitory receptors bind self-molecules expressed on the surface of healthy cells (thus preventing immune responses against self cells), while the activating receptors bind ligands expressed on abnormal cells, such as tumor cells. When the balance between inhibitory and activating receptor activation is in favor of activating receptors, NK cell activation occurs and target (e.g., tumor) cells are lysed.
[0463] Natural killer Group 2 member D (NKG2D) is an NK cell activating receptor that recognizes a variety of ligands expressed on cells. The surface expression of various NKG2D ligands is generally low in healthy cells but is upregulated upon, for example, malignant transformation. Non-limiting examples of ligands recognized by NKG2D include, but are not limited to, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, as well as other molecules expressed on target cells that control the cytolytic or cytotoxic function of NK cells. In several embodiments, T cells are engineered to express an extracellular domain to binds to one or more tumor ligands and activate the T cell. For example, in several embodiments, T cells are engineered to express an NKG2D receptor as the binder/activation moiety. In several embodiments, engineered cells as disclosed herein are engineered to express another member of the NKG2 family, e.g., NKG2A, NKG2C, and/or NKG2E. Combinations of such receptors are engineered in some embodiments. Moreover, in several embodiments, other receptors are expressed, such as the Killer-cell immunoglobulin-like receptors (KIRs).
[0464] In several embodiments, cells are engineered to express a cytotoxic receptor complex comprising a full length NKG2D as an extracellular component to recognize ligands on the surface of tumor cells (e.g., liver cells). In one embodiment, full length NKG2D has the nucleic acid sequence of SEQ ID NO: 27. In several embodiments, the full length NKG2D, or functional fragment thereof is human NKG2D. Additional information about chimeric receptors for use in the presently disclosed methods and compositions can be found in PCT Patent Publication No. WO/2018/183385, which is incorporated in its entirety by reference herein.
[0465] In several embodiments, cells are engineered to express a cytotoxic receptor complex comprising a functional fragment of NKG2D as an extracellular component to recognize ligands on the surface of tumor cells or other diseased cells. In one embodiment, the functional fragment of NKG2D has the nucleic acid sequence of SEQ ID NO: 25. In several embodiments, the fragment of NKG2D is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% homologous with full-length wild-type NKG2D. In several embodiments, the fragment may have one or more additional mutations from SEQ ID NO: 25, but retains, or in some embodiments, has enhanced, ligand-binding function. In several embodiments, the functional fragment of NKG2D comprises the amino acid sequence of SEQ ID NO: 26. In several embodiments, the NKG2D fragment is provided as a dimer, trimer, or other concatameric format, such embodiments providing enhanced ligand-binding activity. In several embodiments, the sequence encoding the NKG2D fragment is optionally fully or partially codon optimized. In one embodiment, a sequence encoding a codon optimized NKG2D fragment comprises the sequence of SEQ ID NO: 28. Advantageously, according to several embodiments, the functional fragment lacks its native transmembrane or intracellular domains but retains its ability to bind ligands of NKG2D as well as transduce activation signals upon ligand binding. A further advantage of such fragments is that expression of DAP10 to localize NKG2D to the cell membrane is not required. Thus, in several embodiments, the cytotoxic receptor complex encoded by the polypeptides disclosed herein does not comprise DAP10. In several embodiments, immune cells, such as NK or T cells (e.g., non-alloreactive T cells engineered according to embodiments disclosed herein), are engineered to express one or more chimeric receptors that target, for example CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, and an NKG2D ligand, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and/or ULBP6. Such cells, in several embodiments, also co-express mbIL15.
[0466] In several embodiments, the cytotoxic receptor complexes are configured to dimerize. Dimerization may comprise homodimers or heterodimers, depending on the embodiment. In several embodiments, dimerization results in improved ligand recognition by the cytotoxic receptor complexes (and hence the NK cells expressing the receptor), resulting in a reduction in (or lack) of adverse toxic effects. In several embodiments, the cytotoxic receptor complexes employ internal dimers, or repeats of one or more component subunits. For example, in several embodiments, the cytotoxic receptor complexes may optionally comprise a first NKG2D extracellular domain coupled to a second NKG2D extracellular domain, and a transmembrane/signaling region (or a separate transmembrane region along with a separate signaling region).
[0467] In several embodiments, the various domains/subdomains are separated by a linker such as, a GS3 linker (SEQ ID NO: 15 and 16, nucleotide and protein, respectively) is used (or a GSn linker). Other linkers used according to various embodiments disclosed herein include, but are not limited to those encoded by SEQ ID NO: 17, 19, 21 or 23. This provides the potential to separate the various component parts of the receptor complex along the polynucleotide, which can enhance expression, stability, and/or functionality of the receptor complex.
Cytotoxic Signaling Complex
[0468] Some embodiments of the compositions and methods described herein relate to a chimeric receptor, such as a chimeric antigen receptor (e.g., a CAR directed to CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, or EGFR (among others), or a chimeric receptor directed against an NKG2D ligand, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and/or ULBP6) that includes a cytotoxic signaling complex. As disclosed herein, according to several embodiments, the provided cytotoxic receptor complexes comprise one or more transmembrane and/or intracellular domains that initiate cytotoxic signaling cascades upon the extracellular domain(s) binding to ligands on the surface of target cells.
[0469] In several embodiments, the cytotoxic signaling complex comprises at least one transmembrane domain, at least one co-stimulatory domain, and/or at least one signaling domain. In some embodiments, more than one component part makes up a given domaine.g., a co-stimulatory domain may comprise two subdomains. Moreover, in some embodiments, a domain may serve multiple functions, for example, a transmembrane domain may also serve to provide signaling function.
Transmembrane Domains
[0470] Some embodiments of the compositions and methods described herein relate to chimeric receptors (e.g., tumor antigen-directed CARs and/or ligand-directed chimeric receptors) that comprise a transmembrane domain. Some embodiments include a transmembrane domain from NKG2D or another transmembrane protein. In several embodiments in which a transmembrane domain is employed, the portion of the transmembrane protein employed retains at least a portion of its normal transmembrane domain.
[0471] In several embodiments, however, the transmembrane domain comprises at least a portion of CD8, a transmembrane glycoprotein normally expressed on both T cells and NK cells. In several embodiments, the transmembrane domain comprises CD8a. In several embodiments, the transmembrane domain is referred to as a hinge. In several embodiments, the hinge of CD8? has the nucleic acid sequence of SEQ ID NO: 1. In several embodiments, the CD8? hinge is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD8?having the sequence of SEQ ID NO: 1. In several embodiments, the hinge of CD8? comprises the amino acid sequence of SEQ ID NO: 2. In several embodiments, the CD8? can be truncated or modified, such that it is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the sequence of SEQ ID NO: 2.
[0472] In several embodiments, the transmembrane domain comprises a CD8? transmembrane region. In several embodiments, the CD8? transmembrane domain has the nucleic acid sequence of SEQ ID NO: 3. In several embodiments, the CD8? hinge is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD8? having the sequence of SEQ ID NO: 3. In several embodiments, the CD8? transmembrane domain comprises the amino acid sequence of SEQ ID NO: 4. In several embodiments, the CD8? hinge is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD8?having the sequence of SEQ ID NO: 4.
[0473] Taken together in several embodiments, the CD8 hinge/transmembrane complex is encoded by the nucleic acid sequence of SEQ ID NO: 13. In several embodiments, the CD8 hinge/transmembrane complex is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD8 hinge/transmembrane complex having the sequence of SEQ ID NO: 13. In several embodiments, the CD8 hinge/transmembrane complex comprises the amino acid sequence of SEQ ID NO: 14. In several embodiments, the CD8 hinge/transmembrane complex hinge is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD8 hinge/transmembrane complex having the sequence of SEQ ID NO: 14.
[0474] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain or a fragment thereof. In several embodiments, the CD28 transmembrane domain comprises the amino acid sequence of SEQ ID NO: 30. In several embodiments, the CD28 transmembrane domain complex hinge is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD28 transmembrane domain having the sequence of SEQ ID NO: 30.
Co-Stimulatory Domains
[0475] Some embodiments of the compositions and methods described herein relate to chimeric receptors (e.g., tumor antigen-directed CARs and/or tumor ligand-directed chimeric receptors) that comprise a co-stimulatory domain. In addition the various the transmembrane domains and signaling domain (and the combination transmembrane/signaling domains), additional co-activating molecules can be provided, in several embodiments. These can be certain molecules that, for example, further enhance activity of the immune cells. Cytokines may be used in some embodiments. For example, certain interleukins, such as IL-2 and/or IL-15 as non-limiting examples, are used. In some embodiments, the immune cells for therapy are engineered to express such molecules as a secreted form. In additional embodiments, such co-stimulatory domains are engineered to be membrane bound, acting as autocrine stimulatory molecules (or even as paracrine stimulators to neighboring cells). In several embodiments, NK cells are engineered to express membrane-bound interleukin 15 (mbIL15). In such embodiments, mbIL15 expression on the NK enhances the cytotoxic effects of the engineered NK cell by enhancing the proliferation and/or longevity of the NK cells. In several embodiments, T cells, such as the genetically engineered non-alloreactive T cells disclosed herein are engineered to express membrane-bound interleukin 15 (mbIL15). In such embodiments, mbIL15 expression on the T cell enhances the cytotoxic effects of the engineered T cell by enhancing the activity and/or propagation (e.g., longevity) of the engineered T cells. In several embodiments, mbIL15 has the nucleic acid sequence of SEQ ID NO: 11. In several embodiments, mbIL15 can be truncated or modified, such that it is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the sequence of SEQ ID NO: 11. In several embodiments, the mbIL15 comprises the amino acid sequence of SEQ ID NO: 12. In several embodiments, the mbIL15 is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the mbIL15 having the sequence of SEQ ID NO: 12.
[0476] In some embodiments, the tumor antigen-directed CARs and/or tumor ligand-directed chimeric receptors are encoded by a polynucleotide that includes one or more cytosolic protease cleavage sites, for example a T2A cleavage site, a P2A cleavage site, an E2A cleavage site, and/or a F2A cleavage site. Such sites are recognized and cleaved by a cytosolic protease, which can result in separation (and separate expression) of the various component parts of the receptor encoded by the polynucleotide. As a result, depending on the embodiment, the various constituent parts of an engineered cytotoxic receptor complex can be delivered to an NK cell or T cell in a single vector or by multiple vectors. Thus, as shown schematically, in the Figures, a construct can be encoded by a single polynucleotide, but also include a cleavage site, such that downstream elements of the constructs are expressed by the cells as a separate protein (as is the case in some embodiments with IL-15). In several embodiments, a T2A cleavage site is used. In several embodiments, a T2A cleavage site has the nucleic acid sequence of SEQ ID NO: 9. In several embodiments, T2A cleavage site can be truncated or modified, such that it is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the sequence of SEQ ID NO: 9. In several embodiments, the T2A cleavage site comprises the amino acid sequence of SEQ ID NO: 10. In several embodiments, the T2A cleavage site is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the T2A cleavage site having the sequence of SEQ ID NO: 10.
Signaling Domains
[0477] Some embodiments of the compositions and methods described herein relate to a chimeric receptor (e.g., tumor antigen-directed CARs and/or tumor ligand-directed chimeric receptors) that includes a signaling domain. For example, immune cells engineered according to several embodiments disclosed herein may comprise at least one subunit of the CD3 T cell receptor complex (or a fragment thereof). In several embodiments, the signaling domain comprises the CD3 zeta subunit. In several embodiments, the CD3 zeta is encoded by the nucleic acid sequence of SEQ ID NO: 7. In several embodiments, the CD3 zeta can be truncated or modified, such that it is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD3 zeta having the sequence of SEQ ID NO: 7. In several embodiments, the CD3 zeta domain comprises the amino acid sequence of SEQ ID NO: 8. In several embodiments, the CD3 zeta domain is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD3 zeta domain having the sequence of SEQ ID NO: 8.
[0478] In several embodiments, unexpectedly enhanced signaling is achieved through the use of multiple signaling domains whose activities act synergistically. For example, in several embodiments, the signaling domain further comprises an OX40 domain. In several embodiments, the OX40 domain is an intracellular signaling domain. In several embodiments, the OX40 intracellular signaling domain has the nucleic acid sequence of SEQ ID NO: 5. In several embodiments, the OX40 intracellular signaling domain can be truncated or modified, such that it is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the OX40 having the sequence of SEQ ID NO: 5. In several embodiments, the OX40 intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 6. In several embodiments, the OX40 intracellular signaling domain is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the OX40 intracellular signaling domain having the sequence of SEQ ID NO: 6. In several embodiments, OX40 is used as the sole transmembrane/signaling domain in the construct, however, in several embodiments, OX40 can be used with one or more other domains. For example, combinations of OX40 andCD3zeta are used in some embodiments. By way of further example, combinations of CD28, OX40, 4-1 BB, and/or CD3zeta are used in some embodiments.
[0479] In several embodiments, the signaling domain comprises a 4-1 BB domain. In several embodiments, the 4-1 BB domain is an intracellular signaling domain. In several embodiments, the 4-1 BB intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 29. In several embodiments, the 4-1 BB intracellular signaling domain is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the 4-1BB intracellular signaling domain having the sequence of SEQ ID NO: 29. In several embodiments, 4-1 BB is used as the sole transmembrane/signaling domain in the construct, however, in several embodiments, 4-1BB can be used with one or more other domains. For example, combinations of 4-1 BB andCD3zeta are used in some embodiments. By way of further example, combinations of CD28, OX40, 4-1 BB, and/or CD3zeta are used in some embodiments.
[0480] In several embodiments, the signaling domain comprises a CD28 domain. In several embodiments the CD28 domain is an intracellular signaling domain. In several embodiments, the CD28 intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 31. In several embodiments, the CD28 intracellular signaling domain is truncated or modified and is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% homologous with the CD28 intracellular signaling domain having the sequence of SEQ ID NO: 31. In several embodiments, CD28 is used as the sole transmembrane/signaling domain in the construct, however, in several embodiments, CD28 can be used with one or more other domains. For example, combinations of CD28 andCD3zeta are used in some embodiments. By way of further example, combinations of CD28, OX40, 4-1 BB, and/or CD3zeta are used in some embodiments.
Cytotoxic Receptor Complex Constructs
[0481] Some embodiments of the compositions and methods described herein relate to chimeric antigen receptors, such as a CD19-directed chimeric receptor, as well as chimeric receptors, such as an activating chimeric receptor (ACR) that targets ligands of NKG2D. The expression of these cytotoxic receptors complexes in immune cells, such as genetically modified non-alloreactive T cells and/or NK cells, allows the targeting and destruction of particular target cells, such as cancerous cells. Non-limiting examples of such cytotoxic receptor complexes are discussed in more detail below.
Chimeric Antigen Receptor Cytotoxic Receptor Complex Constructs
[0482] In several embodiments, there are provided for herein a variety of cytotoxic receptor complexes (also referred to as cytotoxic receptors) are provided for herein with the general structure of a chimeric antigen receptor.
[0483] As shown in the figures, several embodiments of the chimeric receptor include an anti-tumor binder, a CD8? hinge domain, an Ig4 SH domain (or hinge), a CD8? transmembrane domain, a CD28 transmembrane domain, an OX40 domain, a 4-1BB domain, a CD28 domain, a CD3(ITAM domain or subdomain, a CD3zeta domain, an NKp80 domain, a CD16 IC domain, a 2A cleavage site, and a membrane-bound IL-15 domain (though, as above, in several embodiments soluble IL-15 is used). In several embodiments, the binding and activation functions are engineered to be performed by separate domains. Several embodiments relate to complexes with more than one tumor binder moiety or other binder/activation moiety. In some embodiments, the binder/activation moiety targets other markers besides CD19, such as a cancer target described herein. For example,
[0484] Depending on the embodiment, various binders can be used to target CD19. In several embodiments, peptide binders are used, while in some embodiments antibodies, or fragments thereof are used. In several embodiments employing antibodies, antibody sequences are optimized, humanized or otherwise manipulated or mutated from their native form in order to increase one or more of stability, affinity, avidity or other characteristic of the antibody or fragment. In several embodiments, an antibody is provided that is specific for CD19. In several embodiments, an scFv is provided that is specific for CD19. In several embodiments, the antibody or scFv specific for CD19 comprises a heavy chain variable comprising the amino acid sequence of SEQ ID NO: 104 or 106. In some embodiments, the heavy chain variable comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 104 or 106. In some embodiments, the heavy chain variable comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable of SEQ ID NO. 104 or 106. In some embodiments, the heavy chain variable domain a sequence of amino acids that is encoded by a polynucleotide that hybridizes under stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable encodes a heavy chain variable of SEQ ID NO. 104 or 106.
[0485] In several embodiments, the antibody or scFv specific for CD19 comprises a light chain variable comprising the amino acid sequence of any of SEQ ID NO. 105 or 107. In several embodiments, the light chain variable comprises a sequence of amino acids that is encoded by a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the identical to the sequence of SEQ ID NO. 105 or 107. In some embodiments, the light chain variable comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a light chain variable of SEQ ID NO. 105 or 107. In some embodiments, the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under stringent conditions to the complement of a polynucleotide that encodes a light chain variable domain of SEQ ID NO. 105 or 107.
[0486] In several embodiments, the anti-CD19 antibody or scFv comprises one, two, or three heavy chain complementarity determining region (CDR) and one, two, or three light chain CDRs. In several embodiments, a first heavy chain CDR has the amino acid sequence of SEQ ID NO: 111. In some embodiments, the first heavy chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 111. In several embodiments, a second heavy chain CDR has the amino acid sequence of SEQ ID NO: 112, 113, or 114. In some embodiments, the second heavy chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 112, 113, or 114. In several embodiments, a third heavy chain CDR has the amino acid sequence of SEQ ID NO: 115. In some embodiments, the third heavy chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 115.
[0487] In several embodiments, a first light chain CDR has the amino acid sequence of SEQ ID NO: 108. In some embodiments, the first light chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 108. In several embodiments, a second light chain CDR has the amino acid sequence of SEQ ID NO: 109. In some embodiments, the second light chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 109. In several embodiments, a third light chain CDR has the amino acid sequence of SEQ ID NO: 110. In some embodiments, the third light chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, identical to the sequence of SEQ ID NO. 110.
[0488] In several embodiments, there is provided an anti-CD19 CAR comprising the amino acid sequence of SEQ ID NO. 116. In some embodiments, there is provided an anti-CD19 CAR comprising a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, identical to the sequence of SEQ ID NO. 116.
[0489] In one embodiment, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge-CD8TM/OX40/CD3zeta chimeric antigen receptor complex (see
[0490] In several embodiments, there is provided a polynucleotide encoding a tumor binder/CD8hinge-CD8TM/OX40/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0491] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/Ig4SH-CD8TM/4-1 BB/CD3zeta chimeric antigen receptor complex (see
[0492] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/Ig4SH-CD8TM/4-1 BB/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0493] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge-CD28TM/CD28/CD3zeta chimeric antigen receptor complex (see
[0494] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge-CD28TM/CD28/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0495] It shall be appreciated that certain sequence variability, extensions, and/or truncations of the disclosed sequences may result when combining sequences, as a result of, for example, ease or efficiency in cloning (e.g., for creation of a restriction site).
[0496] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/Ig4SH-CD28TM/CD28/CD3zeta chimeric antigen receptor complex (see
[0497] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/Ig4SH-CD28TM/CD28/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0498] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/Ig4SH-CD8TM/OX40/CD3zeta chimeric antigen receptor complex (see
[0499] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/Ig4SH-CD8TM/OX40/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0500] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge-CD3aTM/CD28/CD3zeta chimeric antigen receptor complex (see
[0501] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge-CD3aTM/CD28/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0502] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge-CD28TM/CD28/4-1 BB/CD3zeta chimeric antigen receptor complex (see
[0503] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge-CD28TM/CD28/4-1 BB/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0504] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8 alpha hinge/CD8 alpha TM/4-1 BB/CD3zeta chimeric antigen receptor complex (see
[0505] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8 alpha hinge/CD8 alpha TM/4-1BB/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0506] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8 alpha hinge/CD3 TM/4-1 BB/CD3zeta chimeric antigen receptor complex (see
[0507] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8 alpha hinge/CD3 TM/4-1 BB/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0508] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8 alpha hinge/CD3 TM/4-1BB/NKp80 chimeric antigen receptor complex (see
[0509] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8 alpha hinge/CD3 TM/4-1BB/NKp80/2A/mIL-15 chimeric antigen receptor complex (see
[0510] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8 alpha hinge/CD3 TM/CD16 intracellular domain/4-1BB chimeric antigen receptor complex (see
[0511] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8 alpha hinge/CD3 TM/CD16/4-1BB/2A/mIL-15 chimeric antigen receptor complex (see
[0512] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/NKG2D Extracellular Domain/CD8hinge-CD8TM/OX40/CD3zeta chimeric antigen receptor complex (see
[0513] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/NKG2D EC Domain/CD8hinge-CD8TM/OX40/CD3zeta/2A/mIL-15 chimeric antigen receptor complex (see
[0514] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8TM/4-1 BB/CD3zeta chimeric antigen receptor complex (see
[0515] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8TM/OX40/CD3zeta chimeric antigen receptor complex (see
[0516] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD28TM/CD28/CD3zeta chimeric antigen receptor complex (see
[0517] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/ICOS/CD3zeta chimeric antigen receptor complex (see
[0518] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/CD28/4-1 BB/CD3zeta chimeric antigen receptor complex (see
[0519] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/NKG2DTM/OX40/CD3zeta chimeric antigen receptor complex (see
[0520] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/CD40/CD3zeta chimeric antigen receptor complex (see Figure CAR2c). The polynucleotide comprises or is composed of Tumor Binder, a CD8? hinge, a CD8? transmembrane domain, a CD40 signaling domain, and a CD3zeta domain. In several embodiments, the chimeric antigen receptor further comprises mbIL15 (see
[0521] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/OX40/CD3zeta/2A/EGFRt chimeric antigen receptor complex (see
[0522] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/CD40/CD3zeta chimeric antigen receptor complex (see
[0523] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/CD27/CD3zeta chimeric antigen receptor complex (see
[0524] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/CD70/CD3zeta chimeric antigen receptor complex (see
[0525] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/CD161/CD3zeta chimeric antigen receptor complex (see
[0526] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/CD40L/CD3zeta chimeric antigen receptor complex (see
[0527] In several embodiments, there is provided a polynucleotide encoding a Tumor Binder/CD8hinge/CD8aTM/CD44/CD3zeta chimeric antigen receptor complex (see
[0528] In several embodiments, there is provided a polynucleotide encoding an anti CD123/CD8?hinge/CD8? transmembrane domain/OX40/CD3zeta chimeric antigen receptor complex (see
[0529] In several embodiments, there is provided a polynucleotide encoding an anti CLDN6/CD8?hinge/CD8? transmembrane domain/OX40/CD3zeta chimeric antigen receptor complex (see
[0530] Depending on the embodiment, various binders can be used to target CLDN6. In several embodiments, peptide binders are used, while in some embodiments antibodies, or fragments thereof are used. In several embodiments employing antibodies, antibody sequences are optimized, humanized or otherwise manipulated or mutated from their native form in order to increase one or more of stability, affinity, avidity or other characteristic of the antibody or fragment. In several embodiments, an antibody is provided that is specific for CLDN6. In several embodiments, an scFv is provided that is specific for CLDN6. In several embodiments, the antibody or scFv specific for CLDN6 comprises a heavy chain variable comprising the amino acid sequence of SEQ ID NO. 88. In some embodiments, the heavy chain variable comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 88. In some embodiments, the heavy chain variable comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable of SEQ ID NO. 88. In some embodiments, the heavy chain variable domain a sequence of amino acids that is encoded by a polynucleotide that hybridizes under stringent conditions to the complement of a polynucleotide that encodes a heavy chain variable encodes a heavy chain variable of SEQ ID NO. 88.
[0531] In several embodiments, the antibody or scFv specific for CLDN6 comprises a light chain variable comprising the amino acid sequence of any of SEQ ID NO. 89, 90, or 91. In several embodiments, the light chain variable comprises a sequence of amino acids that is encoded by a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the identical to the sequence of SEQ ID NO. 89, 90, or 91. In some embodiments, the light chain variable comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under moderately stringent conditions to the complement of a polynucleotide that encodes a light chain variable of SEQ ID NO. 89, 90, or 91. In some embodiments, the light chain variable domain comprises a sequence of amino acids that is encoded by a polynucleotide that hybridizes under stringent conditions to the complement of a polynucleotide that encodes a light chain variable domain of SEQ ID NO. 89, 90, or 91.
[0532] In several embodiments, the anti-CLDN6 antibody or scFv comprises one, two, or three heavy chain complementarity determining region (CDR) and one, two, or three light chain CDRs. In several embodiments, a first heavy chain CDR has the amino acid sequence of SEQ ID NO: 92. In some embodiments, the first heavy chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 92. In several embodiments, a second heavy chain CDR has the amino acid sequence of SEQ ID NO: 93. In some embodiments, the second heavy chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 93. In several embodiments, a third heavy chain CDR has the amino acid sequence of SEQ ID NO: 94. In some embodiments, the third heavy chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 94.
[0533] In several embodiments, a first light chain CDR has the amino acid sequence of SEQ ID NO: 95, 98, or 101. In some embodiments, the first light chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 95, 98, or 101. In several embodiments, a second light chain CDR has the amino acid sequence of SEQ ID NO: 96, 99, or 102. In some embodiments, the second light chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 96, 99, or 102. In several embodiments, a third light chain CDR has the amino acid sequence of SEQ ID NO: 97, 100, or 103. In some embodiments, the third light chain CDR comprises a sequence of amino acids that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the sequence of SEQ ID NO. 97, 100, or 103.
[0534] Advantageously, in several embodiments, the CLDN6 CARs are highly specific to CLDN6 and do not substantially bind to any of CLDN3, 4, or 9.
[0535] In several embodiments, there is provided a polynucleotide encoding an anti BCMA/CD8?hinge/CD8? transmembrane domain/OX40/CD3zeta chimeric antigen receptor complex (see
[0536] In several embodiments, there is provided a polynucleotide encoding an anti HER2/CD8?hinge/CD8? transmembrane domain/OX40/CD3zeta chimeric antigen receptor complex (see
[0537] In several embodiments, there is provided a polynucleotide encoding an NKG2D/CD8?hinge/CD8? transmembrane domain/OX40/CD3zeta activating chimeric receptor complex (see
[0538] In several embodiments, there is provided a polynucleotide encoding an anti CD70/CD8?hinge/CD8? transmembrane domain/OX40/CD3zeta chimeric antigen receptor complex (see
[0539] In several embodiments, there is provided a polynucleotide encoding an anti mesothelin/CD8? hinge/CD8? transmembrane domain/OX40/CD3zeta chimeric antigen receptor complex (see
[0540] In several embodiments, there is provided a polynucleotide encoding an anti PD-L1/CD8?hinge/CD8? transmembrane domain/OX40/CD3zeta chimeric antigen receptor complex (see
[0541] In several embodiments, there is provided a polynucleotide encoding an anti EGFR/CD8?hinge/CD8? transmembrane domain/OX40/CD3zeta chimeric antigen receptor complex (see
[0542] In several embodiments, an expression vector, such as a MSCV-IRES-GFP plasmid, a non-limiting example of which is provided in SEQ ID NO: 87, is used to express any of the chimeric antigen receptors provided for herein.
Methods of Treatment
[0543] Some embodiments relate to a method of treating, ameliorating, inhibiting, or preventing cancer with a cell or immune cell comprising a chimeric antigen receptor and/or an activating chimeric receptor, as disclosed herein. In some embodiments, the method includes treating or preventing cancer. In some embodiments, the method includes administering a therapeutically effective amount of immune cells expressing a tumor-directed chimeric antigen receptor and/or tumor-directed chimeric receptor as described herein. Examples of types of cancer that may be treated as such are described herein.
[0544] In certain embodiments, treatment of a subject with a genetically engineered cell(s) described herein achieves one, two, three, four, or more of the following effects, including, for example: (i) reduction or amelioration the severity of disease or symptom associated therewith; (ii) reduction in the duration of a symptom associated with a disease; (iii) protection against the progression of a disease or symptom associated therewith; (iv) regression of a disease or symptom associated therewith; (v) protection against the development or onset of a symptom associated with a disease; (vi) protection against the recurrence of a symptom associated with a disease; (vii) reduction in the hospitalization of a subject; (viii) reduction in the hospitalization length; (ix) an increase in the survival of a subject with a disease; (x) a reduction in the number of symptoms associated with a disease; (xi) an enhancement, improvement, supplementation, complementation, or augmentation of the prophylactic or therapeutic effect(s) of another therapy. Advantageously, the non-alloreactive engineered T cells disclosed herein further enhance one or more of the above. Administration can be by a variety of routes, including, without limitation, intravenous, intra-arterial, subcutaneous, intramuscular, intrahepatic, intraperitoneal and/or local delivery to an affected tissue.
Administration and Dosing
[0545] Further provided herein are methods of treating a subject having cancer, comprising administering to the subject a composition comprising immune cells (such as NK and/or T cells) engineered to express a cytotoxic receptor complex as disclosed herein. For example, some embodiments of the compositions and methods described herein relate to use of a tumor-directed chimeric antigen receptor and/or tumor-directed chimeric receptor, or use of cells expressing a tumor-directed chimeric antigen receptor and/or tumor-directed chimeric receptor, for treating a cancer patient. Uses of such engineered immune cells for treating cancer are also provided.
[0546] In certain embodiments, treatment of a subject with a genetically engineered cell(s) described herein achieves one, two, three, four, or more of the following effects, including, for example: (i) reduction or amelioration the severity of disease or symptom associated therewith; (ii) reduction in the duration of a symptom associated with a disease; (iii) protection against the progression of a disease or symptom associated therewith; (iv) regression of a disease or symptom associated therewith; (v) protection against the development or onset of a symptom associated with a disease; (vi) protection against the recurrence of a symptom associated with a disease; (vii) reduction in the hospitalization of a subject; (viii) reduction in the hospitalization length; (ix) an increase in the survival of a subject with a disease; (x) a reduction in the number of symptoms associated with a disease; (xi) an enhancement, improvement, supplementation, complementation, or augmentation of the prophylactic or therapeutic effect(s) of another therapy. Each of these comparisons are versus, for example, a different therapy for a disease, which includes a cell-based immunotherapy for a disease using cells that do not express the constructs disclosed herein. Advantageously, the non-alloreactive engineered T cells disclosed herein further enhance one or more of the above.
[0547] Administration can be by a variety of routes, including, without limitation, intravenous, intra-arterial, subcutaneous, intramuscular, intrahepatic, intraperitoneal and/or local delivery to an affected tissue. Doses of immune cells such as NK and/or T cells can be readily determined for a given subject based on their body mass, disease type and state, and desired aggressiveness of treatment, but range, depending on the embodiments, from about 10.sup.5 cells per kg to about 10.sup.12 cells per kg (e.g., 10.sup.5-10.sup.7, 10.sup.7-10.sup.10, 10.sup.10-10.sup.12 and overlapping ranges therein). In one embodiment, a dose escalation regimen is used. In several embodiments, a range of immune cells such as NK and/or T cells is administered, for example between about 1?10.sup.6 cells/kg to about 1?10.sup.8 cells/kg. Depending on the embodiment, various types of cancer can be treated. In several embodiments, hepatocellular carcinoma is treated. Additional embodiments provided for herein include treatment or prevention of the following non-limiting examples of cancers including, but not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adrenocortical carcinoma, Kaposi sarcoma, lymphoma, gastrointestinal cancer, appendix cancer, central nervous system cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain tumors (including but not limited to astrocytomas, spinal cord tumors, brain stem glioma, glioblastoma, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloepithelioma), breast cancer, bronchial tumors, Burkitt lymphoma, cervical cancer, colon cancer, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), chronic myeloproliferative disorders, ductal carcinoma, endometrial cancer, esophageal cancer, gastric cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, hairy cell leukemia, renal cell cancer, leukemia, oral cancer, nasopharyngeal cancer, liver cancer, lung cancer (including but not limited to, non-small cell lung cancer, (NSCLC) and small cell lung cancer), pancreatic cancer, bowel cancer, lymphoma, melanoma, ocular cancer, ovarian cancer, pancreatic cancer, prostate cancer, pituitary cancer, uterine cancer, and vaginal cancer.
[0548] In some embodiments, also provided herein are nucleic acid and amino acid sequences that have sequence identity and/or homology of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% (and ranges therein) as compared with the respective nucleic acid or amino acid sequences of SEQ ID NOS. 1-174 (or combinations of two or more of SEQ ID NOS: 1-174) and that also exhibit one or more of the functions as compared with the respective SEQ ID NOS. 1-174 (or combinations of two or more of SEQ ID NOS: 1-174) including but not limited to, (i) enhanced proliferation, (ii) enhanced activation, (iii) enhanced cytotoxic activity against cells presenting ligands to which NK cells harboring receptors encoded by the nucleic acid and amino acid sequences bind, (iv) enhanced homing to tumor or infected sites, (v) reduced off target cytotoxic effects, (vi) enhanced secretion of immunostimulatory cytokines and chemokines (including, but not limited to IFNg, TNFa, IL-22, CCL3, CCL4, and CCL5), (vii) enhanced ability to stimulate further innate and adaptive immune responses, and (viii) combinations thereof.
[0549] Additionally, in several embodiments, there are provided amino acid sequences that correspond to any of the nucleic acids disclosed herein, while accounting for degeneracy of the nucleic acid code. Furthermore, those sequences (whether nucleic acid or amino acid) that vary from those expressly disclosed herein, but have functional similarity or equivalency are also contemplated within the scope of the present disclosure. The foregoing includes mutants, truncations, substitutions, or other types of modifications.
[0550] In several embodiments, polynucleotides encoding the disclosed cytotoxic receptor complexes are mRNA. In some embodiments, the polynucleotide is DNA. In some embodiments, the polynucleotide is operably linked to at least one regulatory element for the expression of the cytotoxic receptor complex.
[0551] Additionally provided, according to several embodiments, is a vector comprising the polynucleotide encoding any of the polynucleotides provided for herein, wherein the polynucleotides are optionally operatively linked to at least one regulatory element for expression of a cytotoxic receptor complex. In several embodiments, the vector is a retrovirus.
[0552] Further provided herein are engineered immune cells (such as NK and/or T cells) comprising the polynucleotide, vector, or cytotoxic receptor complexes as disclosed herein. Further provided herein are compositions comprising a mixture of engineered immune cells (such as NK cells and/or engineered T cells), each population comprising the polynucleotide, vector, or cytotoxic receptor complexes as disclosed herein. Additionally, there are provided herein compositions comprising a mixture of engineered immune cells (such as NK cells and/or engineered T cells), each population comprising the polynucleotide, vector, or cytotoxic receptor complexes as disclosed herein and the T cell population having been genetically modified to reduce/eliminate gvHD and/or HvD. In some embodiments, the NK cells and the T cells are from the same donor. In some embodiments, the NK cells and the T cells are from different donors.
[0553] Doses of immune cells such as NK cells or T cells can be readily determined for a given subject based on their body mass, disease type and state, and desired aggressiveness of treatment, but range, depending on the embodiments, from about 10.sup.5 cells per kg to about 10.sup.12 cells per kg (e.g., 10.sup.5-10.sup.7, 10.sup.7-10.sup.10, 10.sup.10-10.sup.12 and overlapping ranges therein). In one embodiment, a dose escalation regimen is used. In several embodiments, a range of NK cells is administered, for example between about 1?10.sup.6 cells/kg to about 1?10.sup.8 cells/kg. Depending on the embodiment, various types of cancer or infection disease can be treated.
Cancer Types
[0554] Some embodiments of the compositions and methods described herein relate to administering immune cells comprising a tumor-directed chimeric antigen receptor and/or tumor-directed chimeric receptor to a subject with cancer. Various embodiments provided for herein include treatment or prevention of the following non-limiting examples of cancers. Examples of cancer include, but are not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adrenocortical carcinoma, Kaposi sarcoma, lymphoma, gastrointestinal cancer, appendix cancer, central nervous system cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain tumors (including but not limited to astrocytomas, spinal cord tumors, brain stem glioma, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloepithelioma), breast cancer, bronchial tumors, Burkitt lymphoma, cervical cancer, colon cancer, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), chronic myeloproliferative disorders, ductal carcinoma, endometrial cancer, esophageal cancer, gastric cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, hairy cell leukemia, renal cell cancer, leukemia, oral cancer, nasopharyngeal cancer, liver cancer, lung cancer (including but not limited to, non-small cell lung cancer, (NSCLC) and small cell lung cancer), pancreatic cancer, bowel cancer, lymphoma, melanoma, ocular cancer, ovarian cancer, pancreatic cancer, prostate cancer, pituitary cancer, uterine cancer, and vaginal cancer.
Cancer Targets
[0555] Some embodiments of the compositions and methods described herein relate to immune cells comprising a chimeric receptor that targets a cancer antigen. Non-limiting examples of target antigens include: CD19; TNF receptor family member B cell maturation (BCMA); CD38; DLL3; G protein coupled receptor class C group 5, member D (GPRC5D); epidermal growth factor receptor (EGFR) CD138; prostate-specific membrane antigen (PSMA); Fms Like Tyrosine Kinase 3 (FLT3); KREMEN2 (Kringle Containing Transmembrane Protein 2); ALPPL2 (Alkaline phosphatase, placental-like 2); CLDN4 (Claudin 4); CLDN6 (Claudin 6); CD123; CD22; CD30; CD171; CS1 (also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); CD5, C-type lectin-like molecule-1 (CLL-1 or CLECLi); CD33; epidermal growth factor receptor variant III (EGFRviii); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(I-4)bDGlcp(I-I)Cer); Tn antigen ((Tn Ag) or (GalNAca-Ser/Thr)); Receptor tyrosine kinase-like orphan receptor 1 (ROR1); Tumor-associated glycoprotein 72 (TAG72); CD44v6; a glycosylated CD43 epitope expressed on acute leukemia or lymphoma but not on hematopoietic progenitors, a glycosylated CD43 epitope expressed on non-hematopoietic cancers, Carcinoembryonic antigen (CEA); Epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); Interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); Mesothelin; Interleukin 11 receptor alpha (IL-IIRa); prostate stem cell antigen (PSCA); Protease Serine 21 (Testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis(Y) antigen; CD24; Platelet-derived growth factor receptor beta (PDGFR-beta); Stage-specific embryonic antigen-4 (SSEA-4); CD20; Folate receptor alpha (FRa or FR1); Folate receptor beta (FRb); Receptor tyrosine-protein kinase ERBB2 (Her2/neu); Mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); Prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); Ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (LMP2); glycoprotein 100 (gplOO); oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type-A receptor 2 (EphA2); sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDClalp(I-4)bDGlcp(I-l)Cer); transglutaminase 5 (TGS5); high molecular weight-melanoma associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); tumor endothelial marker 1 (TEM1/CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); Polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide portion of globoH glycoceramide (GloboH); mammary gland differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); Hepatitis A virus cellular receptor 1 (HAVCRi); adrenoceptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); Olfactory receptor 51E2 (OR51E2); TCR Gamma Alternate Reading Frame Protein (TARP); Wilms tumor protein (WT1); Cancer/testis antigen 1 (NY-ESO-1); Cancer/testis antigen 2 (LAGE-la); Melanoma-associated antigen 1 (MAGE-A1); ETS translocation-variant gene 6, located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X Antigen Family, Member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate carcinoma tumor antigen-1 (PCT A-1 or Galectin 8), melanoma antigen recognized by T cells 1 (MelanA or MARTI); Rat sarcoma (Ras) mutant; human Telomerase; reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-Acetyl glucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); Androgen receptor; Cyclin BI; v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN); Ras Homolog Family Member C (RhoC); Tyrosinase-related protein 2 (TRP-2); Cytochrome P450 IB 1 (CYPIB 1); CCCTC-Binding Factor (Zinc Finger Protein)-Like (BORIS or Brother of the Regulator oflmprinted Sites), Squamous Cell Carcinoma Antigen Recognized By T Cells 3 (SART3); Paired box protein Pax-5 (PAX5); proacrosin binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4); synovial sarcoma, X breakpoint 2 (SSX2); Receptor for Advanced Gly cation Endproducts (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papilloma virus E6 (HPV E6); human papilloma virus E7 (HPV E7); intestinal carboxyl esterase; heat shock protein 70-2 mutated (mut hsp70-2); CD79a; CD79b; CD72; Leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); Leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); Glypican-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLLI), MPL, Biotin, c-MYC epitope Tag, CD34, LAMP1 TROP2, GFRalpha4, CDH17, CDH6, NYBR1, CDH19, CD200R, Slea (CA19.9; Sialyl Lewis Antigen); Fucosyl-GMI, PTK7, gpNMB, CDH1-CD324, CD276/B7H3, ILI IRa, IL13Ra2, CD179b-IGLII, TCRgamma-delta, NKG2D, CD32 (FCGR2A), Tn ag, Timl-/HVCR1, CSF2RA (GM-CSFR-alpha), TGFbetaR2, Lews Ag, TCR-betal chain, TCR-beta2 chain, TCR-gamma chain, TCR-delta chain, FITC, Leutenizing hormone receptor (LHR), Follicle stimulating hormone receptor (FSHR), Gonadotropin Hormone receptor (CGHR or GR), CCR4, GD3, SLAMF6, SLAMF4, HIV1 envelope glycoprotein, HTLVI-Tax, CMV pp65, EBV-EBNA3c, KSHV K8.1, KSHV-gH, influenza A hemagglutinin (HA), GAD, PDL1, Guanylyl cyclase C (GCC), auto antibody to desmoglein 3 (Dsg3), auto antibody to desmoglein 1 (Dsgl), HLA, HLA-A, HLA-A2, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, HLA-G, IgE, CD99, Ras G12V, Tissue Factor 1 (TF1), AFP, GPRC5D, Claudinl 8.2 (CLD18A2 or CLDN18A.2)), P-glycoprotein, STEAPI, Livl, Nectin-4, Cripto, gpA33, BST1/CD157, low conductance chloride channel, and the antigen recognized by TNT antibody.
EXAMPLES
[0556] The following are non-limiting descriptions of experimental methods and materials that were used in examples disclosed below.
Example 1Gene Editing of Immune Cells to Alter Cell Function
[0557] To further build on various embodiments disclosed herein, several genes that mediate NK function through different pathways were selected in order to evaluate the impact of reducing/eliminating their expression through gene editing techniques. These initial targets represent non-limiting examples of the type of gene that can be edited according to embodiments disclosed herein to enhance one or more aspect of immune cell-mediated immunotherapy, whether utilizing engineered NK cells, engineered T cells, or combinations thereof. The tumor microenvironment (TME), as suggested with the nomenclature, is the environment around a tumor, which includes the surrounding blood vessels and capillaries, immune cells circulating through or retained in the area, fibroblasts, various signaling molecules related by the tumor cells, the immune cells or other cells in the area, as well as the surrounding extracellular matrix. Various mechanisms are employed by tumors to evade detection and/or destruction by host immune cells, including modification of the TME. Tumors may alter the TME by releasing extracellular signals, promoting tumor angiogenesis or even inducing immune tolerance, in part by limiting immune cell entry in the TME and/or limiting reproduction/expansion of immune cells in the TME. The tumor can also modify the ECM, which can allow pathways to develop for tumor extravasation to new sites. Transforming Growth-Factor beta (TGFb) has beneficial effects when reducing inflammation and preventing autoimmunity. However, it can also function to inhibit anti-tumor immune responses, and thus, upregulated expression of TGFb has been implicated in tumor progression and metastasis. TGFb signaling can inhibit the cytotoxic function of NK cells by interacting with the TGFb receptor expressed by NK cells, for example the TGFb receptor isoform II (TGFBR2). In accordance with several embodiments disclosed herein, the reduction or elimination of expression of TGFBR2 through gene editing (e.g., by CRISPr/Cas9 guided by a TGFBR2 guide RNA) interrupts the inhibitory effect of TGFb on NK cells.
[0558] As discussed above, the CRISPR/Cas9 system was used to specifically target and reduce the expression of the TGFBR2 by NK cells. Various non-limiting examples of guide RNAs were tested, which are summarized below.
TABLE-US-00002 TABLE2 TGFbReceptorType2IsoformGuideRNAs SEQIDNO: Name Sequence Target 147 TGFBR2-1 CCCCTACCATGACTTTATTC Exon4 148 TGFBR2-2 ATTGCACTCATCAGAGCTAC Exon4 149 TGFBR2-3 AGTCATGGTAGGGGAGCTTG Exon4 150 TGFBR2-4 TGCTGGCGATACGCGTCCAC Exon1 151 TGFBR2-5 GTGAGCAATCCCCCGGGCGA Exon4 152 TGFBR2-6 AACGTGCGGTGGGATCGTGC Exon1
[0559] Briefly, cryopreserved purified NK cells were thawed on Day 0 and subject to electroporation with CRISPr/Cas9 and a single (or two) guide RNA (using established commercially available transfection guidelines) and were then subsequently cultured in 400 IU/ml IL-2 media for 1 day, followed by 40 IU/ml IL-2 culture with feeder cells (e.g., modified K562 cells expressing, for example, 4-1 BBL and/or mbIL15). At Day 7, knockout efficiency was determined and NK cells were transduced with a virus encoding the NK19-1 CAR construct (as a non-limiting example of a CAR). At Day 14, the knockout efficiency was determined by flow cytometry or other means and cytotoxicity of the resultant NK cells was evaluated.
[0560] Flow cytometry analysis of TGFBR2 expression is shown in
[0561]
[0562] Building on these expression knockout experiments, the ability of TGFb to inhibit the cytotoxicity of TGFBR2 knockout NK cells was evaluated. To do so, NK cells were subject to TGFBR2 gene editing as discussed above, and at 21 days post-electroporation with the gene editing machinery, the cytotoxicity of the resultant cells was evaluated against REH tumor cells at 1:1 and 1:2 effector:target ratios and in the absence (closed circles) or presence of TGFb (20 ng/mL; open squares). Data are summarized in
[0563]
[0564]
[0565]
[0566] To evaluate the potential mechanisms by which the modified immune cells exert their increased cytotoxic activity the cytokine release profile of each of the types of cells tested was evaluated, the data being shown in
[0567] In accordance with additional embodiments, a disruption of, or elimination of, expression of a receptor, pathway or protein on an immune cell can result in the enhanced activity (e.g., cytotoxicity, persistence, etc.) of the immune cell against a target cancer cell. In several embodiments, this results from a disinhibition of the immune cell. Natural killer cells, express a variety of receptors, such particularly those within the Natural Killer Group 2 family of receptors. One such receptor, according to several embodiments disclosed herein, the NKG2D receptor, is used to generate cytotoxic signaling constructs that are expressed by NK cells and lead to enhanced anti-cancer activity of such NK cells. In addition, NK cells express the NKG2A receptor, which is an inhibitory receptor. One mechanism by which tumors develop resistance to immune cells is through the expression of peptide-loaded HLA Class I molecules (HLA-E), which suppresses the activity of NK cells through the ligation of the HLA-E with the NKG2A receptor. Thus, while one approach could be to block the interaction of the HLA-E with the expressed NKG2A receptors on NK cells, according to several embodiments disclosed herein, the expression of NKG2A is disrupted, which short circuits that inhibitory pathway and allows enhanced NK cell cytotoxicity.
[0568]
TABLE-US-00003 TABLE3 NKG2AGuideRNAs SEQIDNO: Name Sequence Target 158 NKG2A-1 GGAGCTGATGGTAAATCTGC Exon4 159 NKG2A-2 TTGAAGGTTTAATTCCGCAT Exon3 160 NKG2A-3 AACAACTATCGTTACCACAG Exon4
[0569]
[0570]
[0571] While the disruption of the HLA-E/NKG2A interaction had a clear positive impact on cytotoxicity of NK cells, other pathways were investigated that may impact immune cell signaling. One such example is the CIS/CISH pathway. Cytokine-inducible SH2-containing protein (CIS) is a negative regulator of IL-15 signaling in NK cells, and is encoded by CISH gene in humans. IL-15 signaling can have positive impacts on the NK cell expansion, survival, cytotoxicity and cytokine production. Thus, a disruption of CISH could render NK cells more sensitive to IL-15, thereby increasing their anti-tumor effects.
[0572] As discussed above, CRISPr/CAs9 was used to disrupt expression of CISH, though in additional embodiments, other gene editing approaches can be used. Non-limiting examples of CISH-targeting guide RNAs are shown below in Table 4.
TABLE-US-00004 TABLE4 CISHGuideRNAs SEQIDNO: Name Sequence Target 153 CISH-1 CTCACCAGATTCCCGAAGGT Exon2 154 CISH-2 CCGCCTTGTCATCAACCGTC Exon3 155 CISH-3 TCTGCGTTCAGGGGTAAGCG Exon1 156 CISH-4 GCGCTTACCCCTGAACGCAG Exon1 157 CISH-5 CGCAGAGGACCATGTCCCCG Exon1
[0573] As with NKG2A knockout NK cells, CISH knockout (using guide RNA 1 or Guide RNA 2 (data not shown for CISH-3-5)) gene edited NK cells were challenged with Reh tumor cells at a 1:1 and 2:1E:T ratio 7 days after being electroporated with the gene editing machinery.
[0574] As with experiments described above, it was next evaluated whether the knockdown of CISH expression adversely impacted the ability to further modify the NK cells, for example, by transducing with a non-limiting example of a CAR (here an anti-CD19 CAR, CAR19-1). These data are shown in
[0575] Having established that NK cells could be gene edited to reduce CISH expression and could also be engineered thereafter to express a CAR, the cytotoxicity of such doubly modified NK cells was tested.
[0576] As seen in
[0577] These tumor-controlling effects were recapitulated in a dual challenge model as well. In this case, the experimental timeline was as described above for
[0578] Mechanistically, without being bound by theory, it appears that the double modification of knockdown of CISH and expression of CAR19-1 allow NK cells to survive for a longer period of time, thus imparting them with an enhanced persistence against tumor cells. In several embodiments, this is due, at least in part to the enhanced signaling through various metabolic pathways in the edited cells based on knockout of CISH. Data for this analysis are shown in
[0579] Further investigating the mechanisms by which these doubly modified cells are able to generate significant and persistent cytotoxicity, the cytokine release profiles of each group were assessed. These data are shown in
[0580]
[0581] CBLB is an E3 ubiquitin ligase that is known to limit T cell activation. In order to determine if disruption of expression of CBLB by NK cells could elicit a more robust anti-tumor response from engineered NK cells, as discussed above, CRISPR/Cas9 was used to disrupt expression of CBLB, though in additional embodiments, other gene editing approaches can be used.
[0582] Non-limiting examples of CBLB-targeting guide RNAs are shown below in Table 5.
TABLE-US-00005 TABLE5 CBLBGuideRNAs SEQIDNO: Name Sequence Target 164 CBLB-1 TAATCTGGTGGACCTCATGAAGG Exon5 165 CBLB-2 TCGGTTGGCAAACGTCCGAAAGG Exon10 166 CBLB-3 AGCAAGCTGCCGCAGATCGCAGG Exon2
[0583] As with the NKG2A and CISH knockout NK cells, Cbl proto-oncogene B (CBLB) knockout (using the guide RNAs shown in Table 5 [SEQ ID NO: 164, 165, 166]) and CISH knockout (using CISH guide RNA 5 [SEQ ID NO: 157]) gene edited NK cells were challenged with Reh tumor cells at a 1:1 and 2:1E:T ratio 5 days after being electroporated with the gene editing machinery. Briefly, parent NK cells were maintained in a low IL-2 media with feeder cells for 7 days, electroporated on day 7, incubated in high IL-2 media on days 7-10, low IL-2 media on days 10-12, then subjected to the Reh tumor challenge assay on day 12 (
[0584] Another E3 ubiquitin ligase, TRipartite Motif-containing protein 29 (TRIM29), is a negative regulator of NK cell functions. TRIM29 is generally not expressed by resting NK cells, but is readily upregulated following activation (in particular by IL-12/IL-18 stimulation). As discussed above, CRISPR/Cas9 was also used to disrupt expression of TRIM29, though in additional embodiments, other gene editing approaches can be used. Non-limiting examples of TRIM29-targeting guide RNAs are shown below in Table 6.
TABLE-US-00006 TABLE6 TRIM29GuideRNAs SEQID NO: Name Sequence Target 167 TRIM29-1 GAACGGTAGGTCCCCTCTCGTGG Exon4 168 TRIM29-2 AGCTGCCTTGGACGACGGGCAGG Exon7 169 TRIM29-3 TGAGCCGTAACTTCATTGAGAGG Exon4
[0585] TRIM29 knockout (using the gRNAs shown in Table 6 [SEQ ID NO: 167, 167, 169]) gene edited NK cells were challenged with Reh tumor cells at a 1:1 and 2:1E:T ratio 5 days after being electroporated with the gene editing machinery. The timeline and culture parameters were the same as the CBLB knockout example (
[0586] Interleukins, in particular interleukin-15, are important in NK cell function and survival. Suppressor of cytokine signaling (SOCS) proteins are negative regulators of cytokine release by NK cells. The protein tyrosine phosphatase CD45 is an important regulator of NK cell activity through Src-family kinase activity. CD45 expression is involved in ITAM-specific NK-cell functions and processes such as degranulation, cytokine production, and expansion. Thus, knockout of CD45 expression should result in less effective NK cells. As discussed above, CRISPR/Cas9 was used to disrupt expression of CD45 and SOCS2, though in additional embodiments, other gene editing approaches can be used. Non-limiting examples of CD45 and SOCS2-targeting guide RNAs are shown below in Table 7.
TABLE-US-00007 TABLE7 CD45andSOCS2GuideRNAs SEQ IDNO: Name Sequence Target 170 CD45-1 AGTGCTGGTGTTGGGCGCAC Exon25 171 SOCS2-1 GTGAACAGTGCCGTTCCGGGGGG Exon3 172 SOCS2-2 GGCACCGGTACATTTGTTAATGG Exon3 173 SOCS2-3 TTCGCCAGACGCGCCGCCTGCGG Exon2
[0587] Suppressor of cytokine signaling 2 (SOCS2) knockout (using the gRNAs showed in Table 7 [SEQ ID NO: 171, 172, 173]) gene edited NK cells were assessed in a time course cytotoxicity assay 7 days after being electroporated with the gene editing machinery. Briefly, parent NK cells were maintained in a low IL-2 media with feeder cells for 7 days, electroporated on day 7, incubated in high IL-2 media for days 7-11, low IL-2 media on days 11-14, then subjected to the Incucyte cytotoxicity assay against Reh cells at a 1:1E:T ratio on day 14 (
Example 2Approaches for Generating Hypoimmune Therapeutic Cells
[0588] As discussed herein, in several embodiments, a mixed immune cell population is used in therapy. In several embodiments, a mixture of T cells and NK cells are employed, each optionally engineered to express a CAR targeting a tumor marker and/or edited to reduce or alter expression of an endogenous gene. In several embodiments, the editing is required due to overlap with or similarity between an endogenous marker expressed by one, or both (or more if more than two), of the immune cell populations and the cancer marker being targeted with the CAR. In such circumstances, were the editing not performed, fratricide among the therapeutic cells would result. In some embodiments, editing is required even if only one immune cell type is used, as fratricide can occur within a single cell population as well.
[0589] In a mixed cell population, when considered in an autologous context, T cells express MHC-I in complex with a self-peptide, which functions as an inhibitory ligand for NK cell receptors, even though NK cells express both inhibitory and activating receptor. In this context, the MHC-I inhibitory signal overpowers activating signals on NK cells. Thus, using a mixed NK and T cell population from collected from and then delivered to the same donor should be compatible.
[0590] In contrast, in an allogeneic setting, graft versus host rejections can occur between graft and host T cells. In this context, the peptides presented by the host T cells (host self peptides) would interact with the graft (engineered) T cell receptor and since the host peptide would be non-self vis-?-vis the graft T cell, the graft T cell would act cytotoxically towards the host T cell. According to some embodiments provided for herein, genetic editing to remove/deplete TCR expression/function in the therapeutic T cell population (graft cells) would prevent their activation by host T cell peptide presentation. Thus, in several embodiments, therapeutic T cells are edited to knockout the TCR (referred to as TCR.sup.KO) Reversing the perspective, the graft T cells, if un-edited, still present donor peptides on MHCI, which are non-self vis-?-vis the host T cells, which would result in host versus graft effects. However, according to some embodiments disclosed herein, gene editing is performed to remove/deplete B2M expression in therapeutic T cells, which disrupts graft peptide presentation by the therapeutic T cells. Thus, in several embodiments, therapeutic T cells are edited to knockout B2M (referred to as B2M.sup.KO). A side effect of this B2M knockout, due to the loss of the presentation of self-peptide by the therapeutic T cell, is that the prior inhibitory signal that prevented therapeutic NK cell activity against therapeutic T cells has been removed. Thus, whilst B2M knockout protects therapeutic T cells from host T cells, it also renders them susceptible to therapeutic NK cells. To combat this newly generated susceptibility to therapeutic NK cells, experiments were undertaken to determine if HLA re-expression by therapeutic T cells could confer resistance to the activity of therapeutic NK cells. In several embodiments, HLA-E is re-expressed to protect therapeutic T cells. In several embodiments, HLA-G is re-expressed to protect therapeutic T cells. In several embodiments, HLA-E and G are re-expressed to protect therapeutic T cells. In several embodiments, a disulfilde trap single chain trimer (dtSCT) is used to express HLA-E and/or HLA-G and B2M (see
[0591] Various NK:T cell ratios were tested, with the resultant data shown in
[0592] Without wishing to be bound by theory, the mechanism of action of HLA-E conferring self identity that is recognized by NK cells (as discussed above) is achieved through a balance of inhibitory and activating receptors on NK cells. NKG2A is the receptor that transduces inhibitory signals, while NKG2C is the receptor that transduces activation signals. Thus, according to several embodiments, the degree of expression of NKG2A and/or NKG2C by NK cells may impact the degree of activity that the NK cells exhibit against T cells (either in the absence of, or even with the re-expression of HLA-E). To evaluate this possibility, cells from two donors (one with HLA-E based protection,
[0593] To further investigate the mechanism by which T cells can be protected from cytotoxic effects of NK cells in a mixed therapeutic cell culture, NK cells and T cells from a single donor were collected and phenotypically characterized.
[0594]
[0595] Turning to the question of whether HLA-E can confer protection on T cells vis-?-vis NK cells that are also engineered to express a CAR (e.g., representing the context of a mixed cell therapeutic),
Example 3Additional Immune Evasion Constructs and Uses Thereof
[0596] As discussed herein, various immunosuppressive constructs are provided for in order to confer on, for example an NK or a T cell in a mixed NK and T cell therapeutic population, reduced immunogenicity vis-?-vis the other therapeutic cells, as we as vis-?-vis host T cells. In several embodiments, the immunosuppressive constructs and resulting engineered (and/or edited) cells are less fratricide from another member of the therapeutic cell population, and also reduce risk of graft versus host and host versus graft side effects.
TABLE-US-00008 TABLE 8 Selected Immunosuppressive Constructs Sequence Identifiers SEQ ID NO Construct Identifier 683 UL18 trimer_SS VMAPRTLFL_IRES_GFP 684 UL18 trimer_SS VMAPRTLFL_IRES_GFP 685 UL18 trimer_SS VMAPRTLFL - AA [no Flag or GFP] 686 UL18 trimer_SS VMAPRTLFL - NT [no Flag or GFP] 687 HLA-E trimer_SS VMAPRTLFL_IRES_GFP 688 HLA-E trimer_SS VMAPRTLFL 689 HLA-E trimer_SS VMAPRTLFL - AA - [no flag or gfp] 690 HLA-E trimer_SS VMAPRTLFL [no flag or gfp] 691 CKS17-8aHTM_aa 692 CKS17-8aHTM 693 CKS17-8aHTM_aa [no flag or gfp] 694 CKS17-8aHTM [no flag or gfp] 695 p15E-L-8aHTM_IRES_GFP 696 p15E-L-8aHTM_IRES_GFP 697 p15E-L-8aHTM [no flag/gfp] 698 p15E-L-8aHTM_[no flag/gfp 699 HTLV-8aHTM_IRES_GFP 700 HTLV-8aHTM_IRES_GFP 701 HTLV-8aHTM_[no flag/gfp] 702 HTLV-8aHTM_[no flag/gfp] 703 HIV_L-8aHTM_IRES_GFP 704 HIV_L-8aHTM_IRES_GFP 705 HIV_L-8aHTM_[no flag/gfp] 706 HIV_L-8aHTM_[no flag/gfp] 707 HIV_S-8aHTM_IRES_GFP 708 HIV_S-8aHTM_IRES_GFP 709 HIV_S-8aHTM_no flag/gfp 710 HIV_S-8aHTM_no flga/gfp 711 TCR Synthetic 3x-8aHTM_IRES_GFP 712 TCR Synthetic 3x-8aHTM_IRES_GFP 713 TCR Synthetic 3x-8aHTM_no flag/gfp 714 TCR Synthetic 3x-8aHTM_no flag/gfp 715 tCD47-8aHTM_IRES_GFP 716 tCD47-8aHTM_IRES_GFP 717 tCD47-8aHTM_no flag/gfp 718 tCD47-8aHTM_no falg/gfp 719 p15Ex3-8aHTM_IRES_GFP 720 p15Ex3-8aHTM_IRES_GFP 721 p15Ex3-8aHTM_no flag/gfp 722 p15Ex3-8aHTM_no flag/gfp 723 p15E_tCD47-8aHTM_IRES_GFP 724 p15E_tCD47-8aHTM_IRES_GFP 725 p15E_tCD47-8aHTM_no flag/gfp 726 p15E_tCD47-8aHTM_no flag/gfp 727 tCD47_p15E-8aHTM_IRES_GFP 728 tCD47_p15E-8aHTM_IRES_GFP 729 tCD47_p15E-8aHTM_no flag gfp 730 tCD47_p15E-8aHTM_no flag/gfp 731 HIV_L_tCD47-8aHTM_IRES_GFP 732 HIV_L_tCD47-8aHTM_IRES_GFP 733 HIV_L_tCD47-8aHTM_no flag/gfp 734 HIV_L_tCD47-8aHTM_no flag/gfp 735 HIV_S_tCD47-8aHTM_IRES_GFP 736 HIV_S_tCD47-8aHTM_IRES_GFP 737 HIV_S_tCD47-8aHTM_no flag/gfp 738 HIV_S_tCD47-8aHTM_no flag/gfp 739 HTLV_tCD47-8aHTM_IRES_GFP 740 HTLV_tCD47-8aHTM_IRES_GFP 741 HTLV_tCD47-8aHTM_no flag/gfp 742 HTLV_tCD47-8aHTM_no flag/gfp 743 tCD47_p15Ex2-8aHTM_IRES_GFP 744 tCD47_p15Ex2-8aHTM_IRES_GFP 745 tCD47_p15Ex2-8aHTM_noflag/gfp 746 tCD47_p15Ex2-8aHTM_no flag/gfp 747 CKS17-8aHTM_eGFP_aa 748 CKS17-8aHTM_eGFP 749 CKS17-8aHTM_aa_noGFP 750 CKS17-8aHTM_NT_no GFP 751 CD47-eGFP_aa 752 CD47-eGFP 753 CD47-_ aa_no_GGFP 754 CD47-NT_no_GFP 755 fGP41_HIVtm_sfGFP_aa 756 fGP41_HIVtm_sfGFP 757 fGP41_HIVtm_aa_no_GFP 758 fGP41_HIVtm_NT_no_GFP 759 p15Etm_sfGFP_aa 760 p15Etm_sfGFP 761 p15Etm_aa_no_GFP 762 p15Etm_NT_noGFP 763 CD43_TM_sfGFP_aa 764 CD43_TM_sfGFP 765 CD43_TM_aa_No_GFP 766 CD43_TM_NT_no_GFP 767 LMP1_TM-sfGFP_aa 768 LMP1_TM-sfGFP 769 LMP1_TM_aa_no_GFP 770 LMP1_TM-NT_No-GFP 771 fgD_TM_sfGFP_aa 772 fgD_TM_sfGFP 773 fgD_TM_AA-NO_GFP 774 fgD_TM_NT_NO_GFP 775 fLLT1_TM-sfGFP_aa 776 fLLT1_TM-sfGFP 777 fLLT1_TM-_aa_No_GFP 778 fLLT1_TM-NT_No_GFP 779 CD47tm162_sfGFP_aa 780 CD47tm162_sfGFP 781 CD47tm162_aa_No_GFP 782 CD47tm162_NT_NoGFP 783 LMP_L-CD8HTM_sfGFP_aa 784 LMP_L-CD8HTM_sfGFP 785 LMP_L-CD8HTM_aa_No_GFP 786 LMP_L-CD8HTM_NT_No_GFP 787 LALLFWLx5-CD8HTM_sfGFP_aa 788 LALLFWLx5-CD8HTM_sfGFP 789 LALLFWLx5-CD8HTM_aa_no_GFP 790 LALLFWLx5-CD8HTM_NT_No_GFP 791 GP41fptm_sfGFP_aa 792 GP41fptm_sfGFP 793 GP41fptm_aa_No-GFP 794 GP41fptm_NT_No_GFP 795 CKS17-8aTM_sfGFP_aa 796 CKS17-8aTM_sfGFP 797 CKS17-8aTM_aa_No_GFP 798 CKS17-8aTM_NT_No_GFP 799 CKS_HTLV-8aTM_sfGFP_aa 800 CKS_HTLV-8aTM_NT_No_GFP 801 CKS_HTLV-8aTM_aa_No_GFP 802 CKS_HTLV-8aTM_sfGFP 803 CKS_LMP-8aTM_sfGFP_aa 804 CKS_LMP-8aTM_sfGFP 805 CKS_LMP-8aTM_aa_no_GFP 806 CKS_LMP-8aTM_NT_No_GFP 807 CKS_GP41fptm_sfGFP_aa 808 CKS_GP41fptm_sfGFP 809 CKS_GP41fptm_aa_No_GFP 810 CKS_GP41fptm_NT_No_GFP 811 LMP_S-CD8HTM_sfGFP_aa 812 LMP_S-CD8HTM_sfGFP 813 LMP_S-CD8HTM_aa_No_GFP 814 LMP_S-CD8HTM_NT_No_GFP 815 LMP_CD47tm162_sfGFP_aa 816 LMP_CD47tm162_sfGFP 817 LMP_CD47tm162_aa_No_GFP 818 LMP_CD47tm162_NT_No_GFP 819 p15E_CD47tm162_sfGFP_aa 820 p15E_CD47tm162_sfGFP 821 p15E_CD47tm162_aa_No_GFP 822 p15E_CD47tm162_NT_No_GFP 823 CD47_GP41fptm_sfGFP_aa 824 CD47_GP41fptm_sfGFP 825 CD47_GP41fptm_aa_No_GFP 826 CD47_GP41fptm_NT_No_GFP 827 HLA-E_STE20_sfGFP_aa 828 HLA-E_STE20_sfGFP 829 HLA-E_STE20_aa_NO_GFP 830 HLA-E_STE20_NT_NO_GFP 831 anti-SIRPa agonist_vHL_sfGFP_aa 832 anti-SIRPa agonist_vHL_sfGFP 833 anti-SIRPa agonist_vHL_aa_NO_GFP 834 anti-SIRPa agonist_vHL_NT_NO_GFP 835 HTLV1_fGP62_sfGFP_aa 836 HTLV1_fGP62_sfGFP 837 HTLV1_fGP62_aa_NO_GFP 838 HTLV1_fGP62_NO_GFP 839 HTLV1_GP21_sfGFP_aa 840 HTLV1_GP21_sfGFP 841 HTLV1_GP21_aa_NO_GFP 842 HTLV1_GP21_NO_GFP 843 LASV_fGP2_sfGFP_aa 844 LASV_fGP2_sfGFP 845 LASV_fGP2_aa_NO_GFP - 846 LASV_fGP2_NT_NO_GFP 847 SEBOV_fGP_sfGFP_aa 848 SEBOV_fGP_sfGFP 849 SEBOV_fGP_aa_NO_GFP 850 SEBOV_fGP_NT_NO_GFP 851 SEBOV_GP2_sfGFP_aa 852 SEBOV_GP2_sfGFP 853 SEBOV_GP2_aa_NO_GFP 854 SEBOV_GP2_NT_NO_GFP 855 SCoV_S2_sfGFP_aa 856 SCoV_S2_sfGFP 857 SCoV_S2_aa_NO_GFP 858 SCoV_S2_NT_NO_GFP 859 LGALS3BP_sfGFP_aa 860 LGALS3BP_sfGFP 861 LGALS3BP_aa_NO_GFP 862 LGALS3BP_NT_No_GFP 863 CD24_sfGFP_aa 864 CD24_sfGFP 865 CD24_aa_NO_GFP 866 CD24_NT_NO_GFP 867 HCV_E2_sfGFP_aa 868 HCV_E2_sfGFP 869 HCV_E2_aa_NO_GFP 870 HCV_E2_NT_NO_GFP 871 anti-SIRPa agonist_vLH_sfGFP_aa 872 anti-SIRPa agonist_vLH_sfGFP 873 anti-SIRPa agonist_vLH_aa_NO_GFP 874 anti-SIRPa agonist_vLH_NT_NO_GFP 875 CEACAM1_sfGFP_aa 876 CEACAM1_sfGFP 877 CEACAM1_aa_NO_GFP 878 CEACAM1_NT_NO_GFP 879 CD155tm_3M_sfGFP_aa 880 CD155tm_3M_sfGFP 881 CD155tm_3M_aa_NO_GFP 882 CD155tm_3M_NT_NO_GFP 883 CD31tm_sfGFP_aa 884 CD31tm_sfGFP 885 CD31tm_aa_NO_GFP 886 CD31tm_NT_NO_GFP 887 CD111tm_sfGFP_aa 888 CD111tm_sfGFP 889 CD111tm_aa_NO_GFP 890 CD111tm_NT_NO_GFP 891 CD200tm_sfGFP_aa 892 CD200tm_sfGFP 893 CD200tm_aa_NO_GFP 894 CD200tm_NO_GFP 895 CD8a signal peptide AA 896 CD8a signal peptide NT
[0597] As discussed above, re-expression of HLA-E or HLA-G on a therapeutic cell should impart to the cell the ability to immunosuppress cytotoxicity from co-administered therapeutic cells (as well as host T cells).
[0598]
Example 4Cytotoxic Evaluation of Selected Hypoimmune Constructs
[0599] As discussed herein, various immunosuppressive constructs are provided for in order to confer on, for example an NK or a T cell in a mixed NK and T cell therapeutic population, reduced immunogenicity vis-?-vis the other therapeutic cells, as we as vis-?-vis host T cells. Several experiments were run to assess the ability of selected hypoimmune constructs provided for herein to confer characteristics of immune evasion on cells to express the constructs.
[0600]
[0601]
[0602] Similar cytotoxicity and expression data when activated NK cells from a second donor are provided in
[0603]
[0604]
[0605]
[0606] Taken together, these data taken together suggest that certain of the immune evasion constructs may act through distinct mechanisms of action that are more, or less, effective depending on the context. These include, but are not limited to, variations in expression, activity, blocking binding of NK cells, and the like. These data also suggest that certain constructs exhibit robust expression and, generally, robust immune evasion, while others express relatively poorly but exhibit efficient immune evasion. Thus, in several embodiments, modifications of the immune evasion constructs to improve expression by human cells (e.g., codon optimization) coordinately improves the immune protection conferred. Likewise, these data suggest that there may be donor to donor variability that cause engineered NK cells (e.g., those engineered to express a CAR) to respond differently to activating/inhibitory receptor signals on target cells that alter the cytotoxicity of the engineered cells. Thus, in several embodiments, a particular donor cell profile (e.g., donor NK or T cell phenotype) may be preferred for use in an allogeneic cell therapy context. More information on an advantageous donor cell profile can be found in U.S. Provisional Patent Application Nos. 63/203,703 and 63/262,544, filed Jul. 28, 2021 and Oct. 14, 2021 (respectively), the entire contents of each of which is incorporated by reference herein. As provided for herein, an overall immune evasion strategy can employ one or more approaches to confer protection on immune cells, such as HLA-E expression modifications, expression of one or more viral immunosuppressive peptide, disruption of TCR activation, and/or use of inhibitory ligands. For example, in some embodiments, the one or more approaches to confer protection on immune cells may involve expression and/or modulation of HLA-E, HLA-E trimer, HLA-E STE20, SEBOV-GP2, CD47, LMP, LGAL3S, SIRPa (vH or vL), HTLV1, or SCOV. In several embodiments, the overall approach allows for a more effective allogeneic cell therapeutic regimen.
Example 5Further Gene Editing of Immune Cells to Alter Cell Function
[0607] As provided for herein, gene editing (e.g., using a Crispr/Cas system) is used to enhance the functionality (e.g., persistence, cytotoxicity, and/or other characteristics) of immune cells, such as NK cells and/or T cells. Edits may be made at a single gene to reduce, substantially reduce, or eliminate expression and/or function of the protein encoded by the gene. Additionally, edits may be made at multiple gene targets (e.g., two, three, four, or more targets) to reduce, substantially reduce, or eliminate expression and/or function of the protein encoded by each of the genes edited, with the lack of expression or function of the multiple proteins imparting to the edited cells an unexpectedly effective phenotype, either in terms of persistence, degree of cytotoxic signaling (either amount and/or duration), resistance to tumor microenvironment suppressive effects, or other beneficial characteristics.
[0608] For example, as discussed herein, in several embodiments, gene edits are made at a target site in a CISH gene and a target site in a CBLB gene. In some embodiments, a double edit, e.g., CISH/CBLB is made in NK cells and/or T cells for use in therapy. In several embodiments, a combination CISH/CBLB gene edit is made in an NK cell that does not include an additional edit. In several embodiments, a combination CISH/CBLB gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor, but are optionally engineered to express a CAR targeting another tumor target.
[0609] For example, as discussed herein, in several embodiments, gene edits are made at a target site in a CISH gene and a target site in a TGFBR2 gene. In some embodiments, a double edit, e.g., CISH/TGFBR2 is made in NK cells and/or T cells for use in therapy. In several embodiments, a combination CISH/TGFBR2 gene edit is made in an NK cell that does not include an additional edit. In several embodiments, a combination CISH/TGFBR2 gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor, but are optionally engineered to express a CAR targeting another tumor target.
[0610] For example, as discussed herein, in several embodiments, gene edits are made at a target site in a CISH gene and a target site in a TIGIT gene. In some embodiments, a double edit, e.g., CISH/TIGIT made in NK cells and/or T cells for use in therapy. In several embodiments, a combination CISH/TIGIT gene edit is made in an NK cell that does not include an additional edit. In several embodiments, a combination CISH/TIGIT gene edit is made in an NK cell that does not express any one or combination of any of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor, but are optionally engineered to express a CAR targeting another tumor target.
[0611] As discussed above, CRISPR/Cas9 was used to specifically target and reduce the expression of selected gene and gene combinations in NK cells and an evaluation of the resultant cytotoxicity of the edited cells was performed.
[0612]
[0613]
[0614]
[0615]
[0616] Similar experiments were performed using an alternative target cell, the ACHN RCC cells.
[0617]
[0618]
[0619] Taken together, these data demonstrate that there is an unexpectedly powerful enhancement to the cytotoxicity of edited immune cells, such as NK cells (or T cells) when edited at multiple gene targets. For example, the combination of editing to reduce, substantially eliminate, or eliminate CIS protein expression or function, in combination with another target yields enhanced cytotoxicity and/or persistence of the edited cells. In several embodiments, edits to CISH and edits to reduce, substantially eliminate, or eliminate CBLB expression are provided for and result in enhanced anti-tumor effects, regardless of the tumor type (e.g., if used, for example with any CAR that targets a tumor). In several embodiments, a CISH/CBLB combination edit is used without an edit to a CD70 gene, and/or without expression of an anti-CD70 CAR. In several embodiments, a CISH/CBLB combination edit is used without expression of an anti-CD19 CAR. In several embodiments, a CISH/CBLB combination edit is used without an additional edit and without expression of an anti-CD19 CAR.
[0620] In additional embodiments, the combination of editing to reduce, substantially eliminate, or eliminate CIS protein expression or function, in combination with another target yields enhanced cytotoxicity and/or persistence of the edited cells. In several embodiments, edits to CISH and edits to reduce, substantially eliminate, or eliminate TGFBR2 expression are provided for and result in enhanced anti-tumor effects, regardless of the tumor type (e.g., if used, for example with any CAR that targets a tumor). In several embodiments, a CISH/TGFBR2 combination edit is used without an edit to a CD70 gene, and/or without expression of an anti-CD70 CAR. In several embodiments, a CISH/TGFBR2 combination edit is used without expression of an anti-CD19 CAR. In several embodiments, a CISH/TGFBR2 combination edit is used without an additional edit and without expression of an anti-CD19 CAR.
[0621] In additional embodiments, the combination of editing to reduce, substantially eliminate, or eliminate CIS protein expression or function, in combination with another target yields enhanced cytotoxicity and/or persistence of the edited cells. In several embodiments, edits to CISH and edits to reduce, substantially eliminate, or eliminate TIGIT expression are provided for and result in enhanced anti-tumor effects, regardless of the tumor type (e.g., if used, for example with any CAR that targets a tumor). In several embodiments, a CISH/TIGIT combination edit is used without an edit to a CD70 gene, and/or without expression of an anti-CD70 CAR. In several embodiments, a CISH/TIGIT combination edit is used without expression of an anti-CD19 CAR. In several embodiments, a CISH/TIGIT combination edit is used without an additional edit and without expression of an anti-CD19 CAR.
Additional Embodiments
[0622] In several embodiments, there is provided a population of genetically engineered immune cells, comprising one or more of genetically engineered NK cells and genetically engineered T cells; wherein the plurality of genetically engineered immune cells are engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the genetically engineered immune cells are genetically engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, wherein, optionally, the genetically engineered immune cells are further engineered to express one or more of the following: IL-15, mblL-15, at least one viral immunosuppressive peptide integrated within an extracellular region, or extracellular regions, of the cytotoxic receptor, at least one viral immunosuppressive peptide expressed on a cell membrane of the genetically engineered immune cells, at least one portion of a human immunosuppressive protein or protein complex integrated within an extracellular region, or extracellular regions, of the cytotoxic receptor, at least one portion of a human immunosuppressive protein or protein complex expressed on a cell membrane of the genetically engineered immune cells, and/or at least one chimeric viral-human immunosuppressive construct expressed on a cell membrane of the genetically engineered immune cells and/or integrated at one or more extracellular regions of the cytotoxic receptor.
[0623] In several embodiments, there is also provided a population of genetically engineered immune cells, comprising: a plurality of genetically engineered NK cells and a plurality of genetically engineered T cells; wherein each of the plurality of genetically engineered NK cells and the plurality of genetically engineered T cells are engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the genetically engineered NK cells are also engineered to express membrane-bound IL15, wherein the genetically engineered immune cells are genetically engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, wherein the at least one immunosuppressive effector expressed by the plurality of genetically engineered T cells comprises HLA-E or a viral immunosuppressive peptide, wherein the HLA-E or the viral immunosuppressive peptide is configured to temporarily suppress NK cell activity against the genetically engineered T cells, wherein the NK cell activity arises either from host NK cells after administration to a subject or from the plurality of genetically engineered NK cells, and wherein the temporary suppression of activity of the genetically engineered NK cells reduces genetically engineered NK cell exhaustion and prolongs the persistence of the population of genetically engineered cells after administration.
[0624] In several embodiments, the is additionally provided a population of genetically engineered immune cells for cancer immunotherapy, comprising: a plurality of genetically engineered NK cells; wherein the plurality of genetically engineered immune cells are engineered to express a cytotoxic receptor, wherein the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the genetically engineered NK cells are engineered to express membrane bound IL-15, wherein the genetically engineered immune cells are genetically engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector.
[0625] In several embodiments, the population, further comprises a second type of immune cells. In several embodiments, the second type of immune cells comprises genetically engineered T cells or other immune cells.
[0626] In several embodiments, there is also provided a population of genetically engineered immune cells for cancer immunotherapy, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of a protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, wherein the edits are made using a Crispr/Cas system, and wherein the genetically engineered immune cells are further engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on the cytotoxic activity of natural killer cells and/or T cells, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector and said edited gene.
[0627] In several embodiments, there is also provided a population of genetically engineered immune cells for cancer immunotherapy, comprising one or more of genetically engineered NK cells and genetically engineered T cells; wherein the genetically engineered immune cells are engineered to express a cytotoxic receptor, wherein the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of a protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, wherein the edits are made using an RNA-guided endonuclease, wherein the genetically engineered immune cells are further genetically engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on the cytotoxic activity of undesired cells, wherein the undesired cells comprise one or more of non-engineered natural killer cells, non-engineered T cells, or undesired engineered cells, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector and said edited gene.
[0628] In several embodiments, there is provided a population of genetically engineered immune cells for cancer immunotherapy, comprising one or more of genetically engineered NK cells and genetically engineered T cells; wherein the plurality of genetically engineered immune cells are engineered to express a cytotoxic receptor, wherein the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cells are genetically edited at one or more target sites in the genome of the immune cell to yield reduced levels of expression of a protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell, immune cells are further genetically engineered to express at least one immunosuppressive effector, wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said immunosuppressive effector.
[0629] In several embodiments, the suppressive cells comprise host cells, non-engineered natural killer cells, non-engineered T cells, and/or suppressive engineered cells. In several embodiments, the suppressive engineered cells comprise the genetically engineered immune cells.
[0630] In several embodiments, the cells that do not comprise said immunosuppressive effector are either non-engineered or engineered cells.
[0631] In several embodiments, the genetically engineered immune cells are also genetically edited to reduce expression of beta-2 microglobulin (B2M), wherein the reduced expression of B2M enables the immune cells to be used in allogeneic cancer immunotherapy with reduced host versus graft rejection as compared to immune cells expressing endogenous levels of B2M.
[0632] In several embodiments, the cytotoxic receptor targets one or more of NKG2D, CD19, BCMA, CD70, and CD38 expressed by target tumor cells, and wherein the cytotoxic signaling complex comprises an OX40 subdomain or a 4-1 BB domain, and a CD3zeta subdomain.
[0633] In several embodiments, the at least one immunosuppressive effector comprises a virally-derived peptide, a peptide derived from a retrovirus, a peptide derived from an envelope protein of a retrovirus, at least a portion of a human protein and/or at least a portion of a human protein complex.
[0634] In several embodiments, the at least one immunosuppressive effector comprises a chimeric construct comprises at least one virally-derived peptide and at least a portion of a human protein and/or at least a portion of a human protein complex.
[0635] In several embodiments, the immunosuppressive effector is encoded by a nucleic acid or comprises a peptide having at least 85% sequence identity to one or more of the nucleotide or amino acid sequences of SEQ ID NOs: 683-894.
[0636] In several embodiments, the immunosuppressive effector comprises a peptide having at least 95% sequence identity to SEQ ID NO: 689.
[0637] In several embodiments, the immunosuppressive effector is encoded by a nucleic acid having at least 95% sequence identity to SEQ ID NO: 690.
[0638] In several embodiments, the immune cells comprise genetically engineered Natural Killer (NK) cells, genetically engineered T cells, or combinations thereof.
[0639] In several embodiments, the genetically engineered immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of graft versus host disease.
[0640] In several embodiments, the genetically engineered immune cells are suitable for use in allogeneic cancer cell therapy with reduced risk of cytotoxic activity between the genetically engineered immune cells.
[0641] In several embodiments, at least a portion of the genetically engineered immune cells are engineered to express membrane bound IL-15.
[0642] In several embodiments, at least about 60% of the NK cells are positive for NKG2A.
[0643] In several embodiments, at least about 80% of the NK cells are positive for NKG2A.
[0644] In several embodiments, the at least one immunosuppressive effector is integrated into the cytotoxic receptor: (i) between the transmembrane domain and the extracellular ligand-binding domain, (ii) within the extracellular ligand-binding domain, (iii) wherein the extracellular ligand-binding domain comprises an scFv and the at least one immunosuppressive effector is integrated into a linker region of the scFv, (iv) within an N-terminal region of the cytotoxic receptor distally positioned from the extracellular ligand-binding domain, and/or (v) at a plurality of locations within an extracellular region of the cytotoxic receptor.
[0645] In several embodiments, the at least one immunosuppressive effector is bound to an extracellular membrane of the immune cells.
[0646] In several embodiments, the at least one immunosuppressive effector comprises a transmembrane protein, wherein the transmembrane protein is selected from CD8?, CD4, CD3?, CD3?, CD3?, CD3?, CD28, CD137, glycophorin A, glycophorin D, nicotinic acetylcholine receptor, a GABA receptor, Fc?RI?, and a T-cell receptor.
[0647] In several embodiments, the immunosuppressive effector is expressed on the immune cells by a disulfide trap single chain trimer (dtSCT).
[0648] In several embodiments, there are provided methods for the treatment of cancer in a subject comprising administering to the subject genetically engineered immune cells according to any of embodiments disclosed herein. In several embodiments, there is provided a use of genetically engineered immune cells according to embodiments disclosed herein for the treatment of cancer or for the preparation of a medicament for the treatment of cancer.
[0649] In several embodiments, there is provided a method of manufacturing a population of genetically engineered immune cells for cancer immunotherapy, comprising contacting a population of immune cells with an RNA-guided endonuclease to genetically edit one or more target sites in the genome of the immune cell to yield reduced levels of expression of a protein which is encoded by a gene which comprises an edited target site as compared to a non-edited immune cell; contacting the population of immune cells with a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex; contacting the population of immune cells with an additional polynucleotide encoding at least one immunosuppressive effector, wherein the immunosuppressive effector is encoded by a nucleic acid or comprises a peptide having at least 85% sequence identity to one or more of the nucleotide or amino acid sequences of SEQ ID NOs: 683-894; wherein the at least one immunosuppressive effector exerts suppressive effects on the cytotoxic activity of suppressive cells, and wherein the genetically engineered immune cells exhibit one or more of enhanced expansion capability, enhanced cytotoxicity against target cells, and enhanced persistence, as compared to cells that do not comprise said at least one immunosuppressive effector.
[0650] In several embodiments, the target of the genetic editing is one or more of a CISH gene, a B2M gene, a CD70 gene, an adenosine receptor gene, an NKG2A gene, a CIITA gene, a TGFBR gene, or any combination thereof.
[0651] Also, there is provided a method of engineering a population of genetically engineered immune cells for enhanced allogeneic cancer immunotherapy, comprising genetically editing a mixed population of immune cells comprising NK cells and T cells to disrupt Beta-2 microglobulin (B2M) expression and coordinately reduce expression Human Leukocyte Antigen (HLA) on the surface of the immune cells, wherein reduced expression of HLA on the surface of the immune cells reduces T cell-mediated cytotoxicity against the edited population of immune cells, wherein reduced expression of HLA on the surface of the cells renders the edited population of immune cells susceptible to NK-mediated cytotoxicity against the edited immune cells; wherein at least about 60% of the NK cells in the mixed population are positive for NKG2A expression; and genetically engineering the edited cells to express one or more immunosuppressive effectors that reduce NK-mediated cytotoxicity against the mixed population of immune cells, wherein the one or more immunosuppressive effectors comprises one or more of a viral immunosuppressive peptide, a viral protein that is an HLA homolog, HLA-E, HLA-G, a human protein or fragment thereof that reduces phagocytosis of cells, a chimeric construct comprising a viral immunosuppressive peptide and a human protein or fragment thereof that reduces phagocytosis of cells, or combinations thereof, wherein the reduced T cell-mediated cytotoxicity reduces engineered T cell-mediated fratricidal cytotoxicity against engineered NK cells and, upon administration, host T-cell mediated cytotoxicity against engineered NK cells, and wherein the wherein the reduced NK cell-mediated cytotoxicity reduces engineered NK cell-mediated fratricidal cytotoxicity against engineered T cells and, upon administration, host NK cell-mediated cytotoxicity against engineered NK and engineered T cells, thereby allowing for enhanced persistence of the engineering mixed population of immune cells upon administration to an allogeneic subject and allowing for enhanced allogeneic cancer immunotherapy.
[0652] In several embodiments, the method further comprises contacting the mixed population of immune cells with a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.
[0653] In several embodiments, the polynucleotide encodes a cytotoxic receptor targeting one or more of NKG2D, CD19, CD70, BCMA, and CD38 expressed by target tumor cells.
[0654] In several embodiments, the method further comprises genetically editing the DNA of the genetically engineered immune cells to alter the expression of one or more of a CISH gene, a CD70 gene, an adenosine receptor gene, an NKG2A gene, a CIITA gene, a TGFBR gene, or any combination thereof.
[0655] In several embodiments, wherein the gene editing to reduce expression or the gene editing to induce expression is made using a CRISPR-Cas system, wherein the Cas is Cas9, Cas12, Cas13, CasX or CasY.
[0656] Additionally provided is a population of genetically engineered immune cells, comprising one or more of genetically engineered NK cells and genetically engineered T cells; wherein at least about 70% of the genetically engineered NK cells express NKG2A, wherein the plurality of genetically engineered immune cells are engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the genetically engineered immune cells are genetically engineered to express at least one immunosuppressive effector derived from a Human Leukocyte Antigen (HLA), wherein the at least one immunosuppressive effector exerts suppressive effects on undesired cytotoxic activity of suppressive cells, wherein, optionally, the genetically engineered immune cells are further engineered to express one or more of the following: IL-15, mblL-15, at least one viral immunosuppressive peptide integrated within an extracellular region, or extracellular regions, of the cytotoxic receptor, at least one viral immunosuppressive peptide expressed on a cell membrane of the genetically engineered immune cells, at least one portion of a human immunosuppressive protein or protein complex integrated within an extracellular region, or extracellular regions, of the cytotoxic receptor, at least one portion of a human immunosuppressive protein or protein complex expressed on a cell membrane of the genetically engineered immune cells, and/or at least one chimeric viral-human immunosuppressive construct expressed on a cell membrane of the genetically engineered immune cells and/or integrated at one or more extracellular regions of the cytotoxic receptor.
[0657] In several embodiments, the immunosuppressive effector derived from an HLA comprises an HLA-E peptide.
[0658] It is contemplated that various combinations or subcombinations of the specific features and aspects of the embodiments disclosed above may be made and still fall within one or more of the inventions. Further, the disclosure herein of any particular feature, aspect, method, property, characteristic, quality, attribute, element, or the like in connection with an embodiment can be used in all other embodiments set forth herein. Accordingly, it should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another in order to form varying modes of the disclosed inventions. Thus, it is intended that the scope of the present inventions herein disclosed should not be limited by the particular disclosed embodiments described above. Moreover, while the invention is susceptible to various modifications, and alternative forms, specific examples thereof have been shown in the drawings and are herein described in detail. It should be understood, however, that the invention is not to be limited to the particular forms or methods disclosed, but to the contrary, the invention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the various embodiments described and the appended claims. Any methods disclosed herein need not be performed in the order recited. The methods disclosed herein include certain actions taken by a practitioner; however, they can also include any third-party instruction of those actions, either expressly or by implication. In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0659] The ranges disclosed herein also encompass any and all overlap, sub-ranges, and combinations thereof. Language such as up to, at least, greater than, less than, between, and the like includes the number recited. Numbers preceded by a term such as about or approximately include the recited numbers. For example, about 90% includes 90%. In some embodiments, at least 95% sequence identity or homology includes 96%, 97%, 98%, 99%, and 100% sequence identity or homology to the reference sequence. In addition, when a sequence is disclosed as comprising a nucleotide or amino acid sequence, such a reference shall also include, unless otherwise indicated, that the sequence comprises, consists of or consists essentially of the recited sequence. Any titles or subheadings used herein are for organization purposes and should not be used to limit the scope of embodiments disclosed herein.
[0660] All references cited herein, including but not limited to published and unpublished applications, patents, and literature references, are incorporated herein by reference in their entirety and are hereby made a part of this specification. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.
Sequences
[0661] In several embodiments, there are provided amino acid sequences that correspond to any of the nucleic acids disclosed herein (and/or included in the accompanying sequence listing), while accounting for degeneracy of the nucleic acid code. Furthermore, those sequences (whether nucleic acid or amino acid) that vary from those expressly disclosed herein (and/or included in the accompanying sequence listing), but have functional similarity or equivalency are also contemplated within the scope of the present disclosure. The foregoing includes mutants, truncations, substitutions, or other types of modifications. Additionally, it shall be appreciated that certain nucleic acid sequences, even if not expressly included within the sequence, comprise one of the three standard stop codons (TAA, TAG, or TGA) known in the standard genetic code.
[0662] In accordance with some embodiments described herein, any of the sequences may be used, or a truncated or mutated form of any of the sequences disclosed herein (and/or included in the accompanying sequence listing) may be used and in any combination.