Senile dementia treatment formulation and application thereof

Abstract

The invention relates to a diagnosis and therapeutic preparation for senile dementia and an application thereof, in particular to an application of ARHGAP11A gene, SPAG7 gene and C16ORF7 gene in preparing a diagnosis and therapeutic preparation for senile dementia. In order to solve the problem that molecular markers of senile dementia are scarce at present, the inventors carried out the high-throughput sequencing on peripheral blood samples of patients with senile dementia and healthy people, selected candidate genes, and confirmed that there was a good correlation between the candidate genes and senile dementia through molecular cell experiments, which laid a foundation for clinical gene diagnosis of senile dementia.

Claims

1. A method of detecting the risk of a neurodegenerative disease in a subject, the method comprising a step of determining the expression level of ARHGAP11A or SPAG7 in a sample obtained from the subject and diagnosing the subject as having a high risk of neurodegenerative disease if the ARHGAP11A or SPAG7 expression level of the sample is below that of a control subject.

2. The method of claim 1, wherein the expression level of ARHGAP11A or SPAG7 is determined by fluorescence quantitative PCR, DNA microarray, or sequencing.

3. The method of claim 1, wherein the expression level of ARHGAP11A or SPAG7 is determined by an immunoassay.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a graph showing the relative expression level of SPAG7, ARHGAP11A or C16ORF7 gene in peripheral blood of patients with senile dementia and peripheral blood of healthy people

DETAILED DESCRIPTION OF THE INVENTION

(2) The invention is further illustrated by the following specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. One of ordinary skill in the art will appreciate that: various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of the invention is defined in the claims and their equivalents. Experimental procedures in which specific conditions are not indicated in the following examples are generally carried out under conventional conditions or under conditions recommended by the manufacturer.

Example 1 High Throughput Sequencing and Analysis

(3) The samples were collected from Peking Union Medical College Hospital and the informed consent of the subjects was obtained. The peripheral blood samples of 15 patients with senile dementia and 9 healthy controls were collected for RNA extraction and agarose gel electrophoresis was carried out after RNA extraction. From the electrophoresis results, we can preliminarily determine whether the extracted RNA samples are qualified or not, and whether they can be used for further transcriptome analysis. Furthermore, the extraction condition of the RNA sample was detected through a NanoDrop 1000 spectrophotometer, and the sample requirements of RNA-seq sequencing were as follows: OD260/OD280 was 1.8-2.2.

(4) The sequencing platform is Illumina's HiSeq 2500 high-throughput sequencing platform, which carried out high-throughput transcriptome deep sequencing. After sequencing, we used Fast-QC software to evaluate the overall quality of the sequencing data, including base quality value distribution, quality value location distribution, GC content, PCR duplication content, kmer frequency and so on. In the differential gene expression analysis, according to the obtained FPKM value, an internationally recognized algorithm EB Seq was adopted for differential screening. Here, when screening, LOG 2FC>1 or ←1, FDR<0.05. In order to better understand the function of differentially expressed genes, we carried out Gene Ontology and signaling pathway analysis on differentially expressed genes, and carried out functional annotation and protein interaction network analysis on differentially expressed genes. In view of the above data analysis results, we screened the down-regulated differentially expressed genes SPAG7, ARHGAP11A or C16ORF7 in combination with literature.

Example 2 SPAG7, ARHGAP11A or C16ORF7 Gene Expression in Peripheral Blood of Patients with Senile Dementia and in Peripheral Blood of Healthy People

(5) I. Material and Method

(6) 1. Materials

(7) The peripheral blood of 95 patients with senile dementia and 31 healthy people were collected and divided into groups and numbered.

(8) 2. Method

(9) 2.1 Extraction of Total RNA from Peripheral Blood of Patients with Senile Dementia and Healthy People

(10) TRIzol® Reagent was used to extract sample RNA, and the experimental operation was carried out according to the product instructions, as shown in the instructions.

(11) RNA quality criteria: the OD260/OD280 values of RNA samples were between 1.7 and 2.2. The total RNA electrophoretic patterns had clear 28S and 18S bands, and there was no significant difference between the electrophoretic patterns after heat preservation in water bath at 70° C. for 1 hour and before heat preservation in water bath.

(12) 2.2 Synthesis of cDNA by Reverse Transcription

(13) cDNA reverse transcription was carried out with SuperScript® III Reverse Transcriptase (Invitrogen, Cat. No. 18080-044). The experimental operation was carried out according to the product instruction. The specific operations were as follows:

(14) with reverse transcription kit, using reverse transcription buffer to reverse transcribe 1 μg total RNA to synthesize cDNA. Adopting a 25 μl reaction system, taking 1 μg total RNA of each sample as template RNA, and respectively adding the following components into a PCR tube:

(15) 5× reverse transcription buffer 5 μl, 10 mmol/l dNTP 1.25 μl, 0.1 mmol/l DTT 2.5 μl, 30 μmmol/l OligodT 2 μl, 200 U/μl MMLV 1.25 template RNA 1 μg, adding sterile water to total system of 25 μl. Incubating at 42° C. for 1 hour, 72° C. for 10 minutes, and centrifuge for a short time. cDNA was stored in −20° C. refrigerator for later use.

(16) 2.3 Real-Time PCR

(17) 2.3.1 Instruments and Analytical Methods

(18) The relative quantitative analysis of the data was carried out by using ABI 7500 fluorescence quantitative PCR instrument and 2-ΔΔCT method.

(19) 2.3.2 Primer Design

(20) SPAG7 sequence NM_004890.2, ARHGAP11A sequence NM_001286479.2 or C16ORF7 sequence NM_004913.3 were designed with online primer design software, and synthesized by Invitrogen Corporation after primer design. The specific primer sequence is as follows:

(21) TABLE-US-00001 TABLE 1 Primer sequences Length of Gene Number Sequence amplification SPAG7 SEQ ID NO. 1 gagaggagcatactacat  81 bp SEQ ID NO. 2 atagcgacagtcatcatc ARHGAP11A SEQ ID NO. 3 ttgctctcctgtcttctg 114 bp SEQ ID NO. 4 gctgctgtccatcttattc C16ORF7 SEQ ID NO. 5 atacacggaatacctgag  75 bp SEQ ID NO. 6 gcttctttagtggtttcc actin SEQ ID NO. 7 agttgcgttacaccctttcttg 150 bp SEQ ID NO. 8 tcaccttcaccgttccagttt

(22) The operation process is as follows:

(23) (1) reaction system: amplification was carried out with Power SYBR® Green PCR Master Mix (Invitrogen, Cat. No. 4367659) and the experimental operation was carried out according to the product specification. The amplification procedure is as follows: 95° 10 min, (95° C. 15 sec, 55° C. 60 sec)×35 cycles.

(24) TABLE-US-00002 TABLE 2 RealTime Reaction System Component Amount of addition 2 x mix 10 μl Forward primer (10 μM) 0.5 μl Reverse primer (10 μM) 0.5 μl Template 2 μl Adding sterile distilled water To 25 μl
(2) Primer Screening

(25) After the cDNA of each sample was mixed, the samples were diluted with 5 times gradient. 2 μl of the diluted samples were taken as templates and amplified with target gene primers and internal reference gene primers respectively. At the same time, the melting curve was analyzed at 60-95° C. The primers were screened according to the principle of high amplification efficiency and unimodal dissolution profile.

(26) (3) Sample RealTime PCR Detection

(27) After cDNA 10-fold dilution, 2 μl of each sample was used as template and amplified with target gene primer and internal reference gene primer respectively. Dissolution profile analysis was also performed at 60-95° C.

(28) II. Experimental Results

(29) The inflection point of the real-time quantitative PCR amplification curve is clear, and the overall parallelism of the amplification curve is good, indicating that the amplification efficiency of each reaction tube is similar; the limit is flat but not rising now, the slope of the exponential period of the curve is large, indicating that the amplification efficiency is high; and the dissolution profiles of sample amplification products are all single peak, indicating that there is only one amplification product, which is specific amplification. According to the relative quantitative formula of qRT-PCR: 2-ΔCt×100%, the expression levels of SPAG7, ARHGAP11A or C16ORF7 gene in the peripheral blood of patients with senile dementia and healthy people were compared. The results showed that (see FIG. 1): the results of qRT-PCR amplification were stable, in which the expression levels of SPAG7 and ARHGAP11A in the peripheral blood of patients with senile dementia were lower than those of healthy people, and the expression of SPAG7 was about ⅙ of that of the control group. Compared with the gene expression of the healthy group, 72 of 95 patients with disease had low expression of SPAG7, 7 of whom had no significant difference; the expression of ARHGAP11A was about ⅕ of that of the control group, 73 of 95 patients with disease had low expression of ARHGAP11A, and 9 of whom had no significant difference; and the expression level of C16ORF7 in peripheral blood of Alzheimer patients was 7 times higher than that of healthy controls, 72 of 95 patients with Alzheimer's disease had high expression of C16ORF7, and 9 of whom had no significant difference. The above results confirmed the results of integrated analysis of expression data in high throughput transcriptional group.

Example 3 Gene Silencing Experiment in Microglia

(30) The researchers found that tau protein and α-Syn protein levels in living skin samples from patients with senile dementia or Parkinson's disease were significantly higher than those in the control group. In order to further verify the correlation between SPAG7, ARHGAP11A and senile dementia in this application, the inventor provided the SPAG7 and ARHGAP11A gene sequences to the biosynthesis company to design and synthesize interfering RNA, and fed back the synthesized products, in the meantime, providing unintentional interfering RNA as a control, silencing the expression of genes SPAG7 and ARHGAP11A in microglia respectively, and then detecting the expression of α-Syn. After the application found that SPAG7 and ARHGAP11A genes were silenced, the expression of α-Syn increased, and the expression of α-Syn protein increased more significantly in ARHGAP11A silence group. α-Syn protein was closely related to Alzheimer's disease, indicating that the two genes found in this application are not only closely related to Alzheimer's disease, but also can be further used as therapeutic targets for later drug research and development of Alzheimer's disease.

(31) The invention adopts high-throughput sequencing to screen the related pathogenic gene SPAG7, ARHGAP11A or C16ORF7 of senile dementia, and verifies that SPAG7, ARHGAP11A or C16ORF7 play an important role in senile dementia by combining with molecular biology experiments. The invention provides a new target for clinical diagnosis and treatment of senile dementia, and has good clinical application prospect.