Methods for producing isobutene from 3-methylcrotonic acid

Abstract

Described are methods for the production of isobutene comprising the enzymatic conversion of 3-methylcrotonic acid into isobutene wherein the enzymatic conversion of 3-methylcrotonic acid into isobutene is achieved by making use of an FMN-dependent decarboxylase associated with an FMN prenyl transferase, wherein said FMN prenyl transferase catalyzes the prenylation of a flavin cofactor (FMN or FAD) utilizing dimethylallyl phosphate (DMAP) into a flavin-derived cofactor, wherein said method further comprises providing said DMAP enzymatically by: (i) the enzymatic conversion of dimethylallyl pyrophosphate (DMAPP) into said DMAP; or (ii) a single enzymatic step in which prenol is directly enzymatically converted into said DMAP; or (iii) two enzymatic steps comprising: first enzymatically converting DMAPP into prenol; and then enzymatically converting the thus obtained prenol into said DMAP; or (iv) the enzymatic conversion of isopentenyl monophosphate (IMP) into said DMAP, or by a combination of any one of (i) to (iv). Moreover, described are methods for the production of isobutene comprising the enzymatic conversion of 3-methylcrotonic acid into isobutene wherein the enzymatic conversion of 3-methylcrotonic acid into isobutene is achieved by making use of an FMN-dependent decarboxylase associated with an FMN prenyl transferase, wherein said FMN prenyl transferase catalyzes the prenylation of a flavin cofactor (FMN or FAD) utilizing dimethylallyl pyrophosphate (DMAPP), wherein said method further comprises providing said DMAPP enzymatically by: (v) the enzymatic conversion of isopentenyl pyrophosphate (IPP) into said DMAPP; or (vi) the enzymatic conversion of dimethylallyl phosphate (DMAP) into said DMAPP; or (vii) the enzymatic conversion of prenol into said DMAPP; (viii) or by a combination of any one of (v) to (vii). Moreover, described are methods for providing said flavin cofactor enzymatically by the enzymatic conversion of riboflavin into flavin mononucleotide (FMN).

Claims

1. A method for the production of isobutene comprising the enzymatic conversion of 3-methylcrotonic acid into isobutene wherein the enzymatic conversion of 3-methylcrotonic acid into isobutene is achieved by making use of an FMN-dependent decarboxylase associated with a prokaryotic FMN prenyl transferase, wherein said FMN prenyl transferase catalyzes the prenylation of a flavin cofactor (FMN or FAD) utilizing dimethylallyl pyrophosphate (DMAPP), wherein said method further comprises providing said DMAPP enzymatically by: (i) the enzymatic conversion of isopentenyl pyrophosphate (IPP) into said DMAPP; or (ii) the enzymatic conversion of dimethylallyl phosphate (DMAP) into said DMAPP; or (iii) the enzymatic conversion of prenol into said DMAPP; (iv) or by a combination of any one of (i) to (iii).

2. The method of claim 1, further comprising providing said flavin cofactor enzymatically by the enzymatic conversion of riboflavin into flavin mononucleotide (FMN).

3. The method of claim 2, wherein the enzymatic conversion of riboflavin into FMN is achieved by making use of: a kinase, a phosphotransferase with an alcohol group as acceptor (EC 2.7.1), a phosphotransferase with a phosphate group as acceptor (EC 2.7.4); or a bifunctional riboflavin kinase/FMN adenylyltransferase (ribF); or a variant of a bifunctional riboflavin kinase/FMN adenylyltransferase (ribF) which shows an improved activity in converting riboflavin into FMN over the corresponding bifunctional riboflavin kinase/FMN adenylyltransferase from which it is derived.

4. The method of claim 3, wherein: (a) the kinase is an archaeal riboflavin kinase (EC 2.7.1.161), a flavokinase derived from S. cerevisiae or from Rattus norvegicus, or a flavokinase derived from Megasphaera elsdenii; (b) the phosphotransferase with an alcohol group as acceptor (EC 2.7.1) is an erythritol kinase (2.7.1.27) or a glycerol kinase (2.7.1.30); or (c) the phosphotransferase with a phosphate group as acceptor (EC 2.7.4) is an isopentenyl phosphate kinase (EC 2.7.4.26).

5. The method of claim 3, wherein said variant of a bifunctional riboflavin kinase/FMN adenylyltransferase (ribF) which shows an improved activity in converting riboflavin into FMN over the corresponding bifunctional riboflavin kinase/FMN adenylyltransferase from which it is derived is a variant having an amino acid sequence as shown in SEQ ID NO:34 or an amino acid sequence having at least 30% sequence identity to SEQ ID NO:34, in which one or more amino acid residues at a position selected from the group consisting of positions 29 and 32 in the amino acid sequence shown in SEQ ID NO:34 or at a position corresponding to any of these positions, are substituted with another amino acid residue or deleted or wherein an insertion has been effected at one or more of these positions.

6. The method of claim 5, wherein (1) an amino acid residue at position 29 in the amino acid sequence shown in SEQ ID NO:34 or at a position corresponding to this position, is deleted or substituted with alanine; and/or (2) an amino acid residue at position 32 in the amino acid sequence shown in SEQ ID NO:34 or at a position corresponding to this position, is deleted or substituted with serine or alanine.

7. The method of claim 1 (i), wherein the enzymatic conversion of isopentenyl pyrophosphate (IPP) into said DMAPP is achieved by making use of an isomerase.

8. The method of claim 7, wherein the isomerase is an isopentenyl-diphosphate DELTA isomerase (EC 5.3.3.2).

9. The method of claim 1 (ii), wherein the enzymatic conversion of dimethylallyl phosphate (DMAP) into said DMAPP is achieved by making use of a kinase.

10. The method of claim 9, wherein the kinase is an isopentenyl monophosphate kinase (EC 2.7.4.26).

11. The method of claim 9, further comprising providing the DMAP by the enzymatic conversion of prenol into DMAP or by the enzymatic conversion of isopentenyl monophosphate (IMP) into DMAP.

12. The method of claim 11, wherein the enzymatic conversion of prenol into said DMAP is achieved by making use of a kinase.

13. The method of claim 12, wherein the kinase is a phosphotransferase with an alcohol group as acceptor (EC 2.7.1.-).

14. The method of claim 13, wherein the phosphotransferase with an alcohol group as acceptor (EC 2.7.1.-) is a hydroxyethylthiazole kinase (EC 2.7.1.50).

15. The method of claim 11, wherein the enzymatic conversion of isopentenyl monophosphate (IMP) into DMAP is achieved by making use of an isomerase.

16. The method of claim 15, wherein the isomerase is an isopentenyl-diphosphate DELTA isomerase (EC 5.3.3.2).

17. The method of claim 1 (iii), wherein the enzymatic conversion of prenol into DMAPP is achieved by making use of a diphosphotransferase (EC 2.7.6.-).

18. The method of claim 17, wherein the diphosphotransferase (EC 2.7.6.-) is a thiamine diphosphokinase (EC 2.7.6.2) or a 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase (EC 2.7.6.3).

19. The method of claim 1, wherein said method is carried out in vitro.

20. The method of claim 1, wherein said method is carried out by a recombinant organism or microorganism.

Description

(1) As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the compositions as has been set forth above for the methods according to the present invention.

(2) FIG. 1: shows an artificial pathway for isobutene production from acetyl-CoA via 3-methylcrotonic acid. Moreover, enzymatic recycling of metabolites which may occur during the pathway are shown in steps Xa, Xb, XI and XII.

(3) FIG. 2A: Schematic reaction of the enzymatic prenylation of a flavin mononucleotide (FMN) into the corresponding modified (prenylated) flavin cofactor.

(4) FIG. 2B: Schematic reaction of the enzymatic conversion of 3-methylcrotonic acid into isobutene.

(5) FIG. 3: Chemical structure of DMAP and DMAPP.

(6) FIG. 4: Schematic reactions for the different routes for the provision of DMAP and to increase the DMAP pool.

(7) FIG. 5: Schematic reaction of the enzymatic conversion/dephosphorylation of DMAPP into DMAP.

(8) FIG. 6: Schematic reaction of the enzymatic conversion/dephosphorylation of DMAPP into DMAP by the formation ATP from ADP.

(9) FIG. 7: Schematic reaction of the enzymatic conversion/phosphorylation of prenol into DMAP.

(10) FIG. 8: Schematic reaction for the enzymatic conversion of DMAPP into prenol, the enzymatic conversion of prenol into DMAP as well as a preceding step of the enzymatic conversion of isopentenyl pyrophosphate into DMAPP.

(11) FIG. 9: illustrates the pathway for the biosynthesis of flavin mononucleotide (FMN) starting from GTP.

(12) FIG. 10: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid.

(13) FIG. 11: Schematic reaction of the enzymatic condensation of acetyl-CoA and acetone into 3-hydroxyisovalerate.

(14) FIG. 12: Schematic reaction of the enzymatic conversion of acetoacetate into acetone.

(15) FIG. 13: Schematic reaction of the enzymatic conversion of acetoacetyl-CoA into acetoacetate by hydrolysing the CoA thioester of acetoacetyl-CoA resulting in acetoacetate.

(16) FIG. 14: Schematic reaction of the enzymatic conversion of acetoacetyl-CoA into acetoacetate by transferring the CoA group of acetoacetyl-CoA on acetate, resulting in the formation of acetoacetate and acetyl-CoA.

(17) FIG. 15: Schematic reaction of the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid.

(18) FIG. 16: Schematic reaction of the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via step VIc as shown in FIG. 1.

(19) FIG. 17: Schematic reaction of the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via step VIb as shown in FIG. 1.

(20) FIG. 18: Schematic reaction of the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via step VIa as shown in FIG. 1.

(21) FIG. 19: Schematic illustration for the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via 3-methylbutyryl-CoA and 3-methylbutyric acid.

(22) FIG. 20: Schematic reaction of the enzymatic conversion of 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA.

(23) FIG. 21: Schematic reaction of the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA.

(24) FIG. 22: Schematic reaction of the enzymatic condensation of acetylCoA and acetoacetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA.

(25) FIG. 23: Schematic reaction of the enzymatic condensation of two molecules of acetyl-CoA into acetoacetyl-CoA.

(26) FIG. 24: Schematic reaction of the enzymatic conversion of acetyl-CoA into malonyl-CoA.

(27) FIG. 25: Schematic reaction of the enzymatic condensation of malonyl-CoA and acetyl-CoA into acetoacetyl-CoA.

(28) FIG. 26: shows enzymatic recycling steps of metabolites (steps Xa, Xb, XI and XII as also shown in FIG. 1) which may occur during the pathway of isobutene production from acetyl-CoA via 3-methylcrotonic acid.

(29) FIG. 27: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA.

(30) FIG. 28: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA.

(31) FIG. 29: Schematic reaction of the enzymatic conversion of 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA.

(32) FIG. 30: Schematic reaction of the general enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA.

(33) FIG. 31: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA via 3-hydroxyisovaleryl-adenosine monophosphate.

(34) FIG. 32: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA via 3-hydroxyisovaleryl phosphate.

(35) FIG. 33: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene.

(36) FIG. 34: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid.

(37) FIG. 35: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid by making use of a CoA-transferase.

(38) FIG. 36: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid by making use of a thioester hydrolase.

(39) FIG. 37: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid in a two-step reaction via 3-methyl-3-butenoyl phosphate.

(40) FIG. 38: Schematic reaction of the enzymatic conversion of 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA.

(41) FIG. 39: Structure of a phosphopantetheine moiety.

(42) FIG. 40: shows an overlay of typical GC-chromatograms obtained for the catalytic assay of UbiD protein from Saccharomyces cerevisiae with the corresponding controls as outlined in Example 2.

(43) FIG. 41: shows an overlay of typical chromatograms obtained for the production of isobutene from 3-methylcrotonic in a recombinant E. coli strain overexpressing UbiD protein from Saccharomyces cerevisiae and UbiX protein from Escherichia coli (strain A) or overexpressing UbiD protein from Saccharomyces cerevisiae alone (strain B) or carrying an empty vector (negative control, strain C).

(44) FIG. 42: shows bacterial growth and isobutene production without addition of external prenol. a) Bacterial growth of the constructed E. coli strains. b) Specific isobutene productivity obtained with the constructed E. coli strains.

(45) FIG. 43: shows bacterial growth and isobutene production with addition of external prenol. a) Bacterial growth of the constructed E. coli strains. b) Specific isobutene productivity obtained with the constructed E. coli strains.

(46) FIG. 44: shows the schematic reactions of the mevalonate pathway.

(47) FIG. 45: Schematic reactions for the different routes for the provision of DMAPP and to increase the DMAPP pool.

(48) FIG. 46: Schematic reaction of the enzymatic conversion of DMAP into DMAPP.

(49) In this specification, a number of documents including patent applications are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.

(50) The invention will now be described by reference to the following examples which are merely illustrative and are not to be construed as a limitation of the scope of the present invention.

EXAMPLES

General Methods and Materials

(51) All reagents and materials used in the experiences were obtained from Sigma-Aldrich Company (St. Louis, MO) unless otherwise specified. Materials and methods suitable for growth of bacterial cultures and protein expression are well known in the art.

Example 1: Gene Synthesis, Cloning and Expression of Recombinant Proteins as Used in the Below Examples 2 to 5

(52) The sequences of the studied enzymes were generated by oligonucleotide concatenation to fit the codon usage of E. coli (genes were commercially synthesized by GeneArt?). A stretch of 6 histidine codons was inserted after the methionine initiation codon to provide an affinity tag for purification. The gene thus synthesized was cloned in a pET-25b (+) expression vector (vectors were constructed by GeneArt?). Vector pCAN contained gene coding for UbiX protein (3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein) from Escherichia coli (Uniprot Accession Number: P0AG03) was purchased from NAIST (Nara Institute of Science and Technology, Japan, ASKA collection). Provided vector contained a stretch of 6 histidine codons after the methionine initiation codon.

(53) Competent E. coli BL21 (DE3) cells (Novagen) were transformed with these vectors according to standard heat shock procedure. The transformed cells were grown with shaking (160 rpm) using ZYM-5052 auto-induction medium (Studier F W, Prot. Exp. Pur. 41, (2005), 207-234) for 6 h at 30? C. and protein expression was continued at 18? C. overnight (approximately 16 h). For the recombinant strain over-expressing UbiX from E. coli, 500 ?M of Flavin Mononucleotide (FMN) were added to the growth medium. The cells were collected by centrifugation at 4? C., 10,000 rpm for 20 min and the pellets were stored at ?80? C.

(54) Protein Purification and Concentration

(55) The pellets from 200 ml of cultured cells were thawed on ice and resuspended in 6 ml of 50 mM Tris-HCl buffer pH 7.5 containing 100 mM NaCl in the case of the recombinant strain overexpressing UbiX protein and in 6 ml of 50 mM Tris-HCl buffer pH 7.5, 10 mM MgCl.sub.2, 10 mM imidazole and 5 mM DTT in the case of the recombinant strain overexpressing UbiD protein. Twenty microliters of lysonase (Novagen) were added. Cells were then incubated 10 min at room temperature, returned to ice for 20 min and the lysis was completed by sonication 3?15 seconds. The cellular lysate contained UbiX protein was reserved on ice. The bacterial extracts contained UbiD proteins were then clarified by centrifugation at 4? C., 4000 rpm for 40 min. The clarified bacterial lysates were loaded onto a PROTINO-2000 Ni-TED column (Macherey-Nagel) allowing adsorption of 6-His tagged proteins. Columns were washed and the enzymes of interest were eluted with 6 ml of 100 mM Tris-HCl buffer pH 7.5 containing 100 mM NaCl and 250 mM imidazole. Eluates were then concentrated, desalted on Amicon Ultra-4 10 kDa filter unit (Millipore) and enzymes were resuspended in 50 mM Tris-HCl buffer pH 7.5, containing 50 mM NaCl and 5 mM DTT.

(56) The purity of proteins thus purified varied from 80% to 90% as estimated by SDS-PAGE analysis. Protein concentration was determined by direct UV 280 nm measurement on the NanoDrop 1000 spectrophotometer (Thermo Scientific) and by Bradford assay (BioRad).

Example 2: In Vitro Decarboxylation of 3-Methylcrotonic Acid into Isobutene Catalyzed by an Association of Lysate, Containing UbiX Protein, with Purified UbiD Protein

(57) 0.5 M stock solution of 3-methylcrotonic acid was prepared in water and adjusted to pH 7.0 with 10 M solution of NaOH.

(58) Two UbiD proteins (Table C) were purified according to the procedure described in Example 1.

(59) Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions: 50 mM Tris-HCl buffer pH 7.5 20 mM NaCl 10 mM MgCl.sub.2 5 mM DTT 50 mM 3-methylcrotonic acid 1 mg/ml purified UbiD protein 50 ?l lysate contained UbiX protein Total volume of the assays were 300 ?l.

(60) A series of control assays were performed in parallel (Table C).

(61) The vials were sealed and incubated for 120 min at 30? C. The assays were stopped by incubating for 2 min at 80? C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID).

(62) For the GC analysis, one ml of the headspace gas was separated in a Bruker GC-450 system equipped with a GS-alumina column (30 m?0.53 mm) (Agilent) using isothermal mode at 130? C. Nitrogen was used as carrier gas with a flow rate of 6 ml/min.

(63) The enzymatic reaction product was identified by comparison with an isobutene standard. Under these GC conditions, the retention time of isobutene was 2.42 min. A significant production of isobutene from 3-methylcrotonic acid was observed in the combined assays (UbiD protein+UbiX protein). Incubation of lysate containing UbIX protein alone did not result in isobutene production. These data indicate that the two enzymes present in the assays cooperated to perform the decarboxylation of 3-methylcrotonic acid into isobutene. A typical chromatogram obtained in the assay with UbiD protein from Saccharomyces cerevisiae is shown on FIG. 40.

(64) TABLE-US-00003 TABLE C Isobutene production, arbitrary Assay composition units UbiD protein from C. dubliniensis (Uniprot 470 Acession Number : B9WJ66) + lysate contained UbiX protein from E. coli + substrate UbiD protein from C. dubliniensis (Uniprot 9.2 Acession Number : B9WJ66) + substrate UbiD protein from S. cervisiae (Uniprot Acession 1923 Number : Q03034) + lysate contained UbiX protein from E. coli + substrate UbiD protein from S. cerivisae (Uniprot Acession 31 Number : Q03034) + substrate Lysate contained UbiX protein from E. coli + substrate 0 No substrate control: UbiD protein from C. 0 dubliniensis (Uniprot Acession Number : B9WJ66) + lysate contained UbiX protein from E. coli, without substrate No substrate control : UbiD protein from S. cervisiae 0 (Uniprot Acession Number : Q03034) + lysate contained UbiX protein from E. coli, without substrate

Example 3: In Vivo Decarboxylation of 3-Methylcrotonic Acid into Isobutene Catalyzed by an Association of UbiX Protein from Escherichia coli and UbiD Protein from Saccharomyces cerevisiae

(65) The gene coding for UbiD protein from S. cerevisiae (Uniprot Accession Number: Q03034) was codon optimized for expression in E. coli and synthesized by GeneArt? (Life Technologies). This studied gene was then PCR amplified from the pMK-RQ vector (master plasmid provided by GeneArt) using forward primer with NcoI restriction site and a reverse primer, containing BamHI restriction site. The gene coding for UbiX protein from E. coli (Uniprot Accession Number: P0AG03) was amplified by PCR with a forward primer, containing NdeI restriction site and a reverse primer containing KpnI restriction site. The previously described pCAN vector (Example 1) served as template for this PCR step. These two obtained PCR products (UbiD protein and UbiX protein) were cloned into pETDuet?-1 co-expression vector (Novagen). The constructed recombinant plasmid was verified by sequencing. Competent E. coli BL21(DE3) cells (Novagen) were transformed with this vector according to standard heat shock procedure and plated out onto LB agar plates supplemented with ampicillin (0.1 mg/ml) (termed strain A).

(66) BL21(DE3) strain transformed with pET-25b(+) vector, carrying only the gene of UbiD protein from S. cerevisiae was also used in this study (termed strain B). BL21(DE3) strain transformed with an empty pET-25b(+) vector was used as a negative control in the subsequent assays (termed strain C).

(67) Single transformants were used to inoculate LB medium, supplemented with ampicillin, followed by incubation at 30? C. overnight. 1 ml of this overnight culture was used to inoculate 300 ml of ZYM-5052 auto-inducing media (Studier F W (2005), local citation). The cultures were grown for 20 hours at 30? C. and 160 rpm shaking.

(68) A volume of cultures corresponding to OD600 of 30 was removed and centrifuged. The pellet was resuspended in 30 ml of MS medium (Richaud C., Mengin-Leucreulx D., Pochet S., Johnson E J., Cohen G N. and MarHere P, The Journal of Biological Chemistry, 268, (1993), 26827-26835), containing glucose (45 g/L) and MgSO4 (1 mM) and supplemented with 10 mM 3-methylcrotonic acid. These cultures were then incubated in 160 ml bottles, sealed with a screw cap, at 30? C. with shaking for 22 h. The pH value of the cultures was adjusted to 8.5 after 8 hours of incubation by using 30% NH.sub.4OH.

(69) After an incubation period, the isobutene produced in the headspace was analysed by Gas Chromatography (GC) equipped Flame Ionization Detector (FID). One ml of the headspace gas phase was separated and analysed according to the method described in Example 2.

(70) No isobutene was formed with the control strain C carrying an empty vector. The highest production of isobutene was observed for the strain A over-expressing the both genes, UbiD protein from S. cerevisiae and UbiX protein from E. coli. A significant production of isobutene was observed for the strain B over-expressing UbiD protein alone. Thus, endogenous UbiX of E. coli can probably contribute to activate UbiD protein from S. cerevisiae (FIG. 41).

Example 4: In Vitro Screening of the UbiD Proteins for the Decarboxylation of 3-Methylcrotonic Acid into Isobutene

(71) Several genes coding for UbiD protein were codon optimized for the expression in E. coli and synthesized by GeneArt? (Thermofisher). The corresponding enzymes were purified according to the procedure described in Example 1. The list of the studied enzymes is shown in Table D.

(72) Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions: 50 mM Tris-HCl buffer pH 7.5 20 mM NaCl 10 mM MgCl.sub.2 1 mM DTT 50 mM 3-methylcrotonic acid 1 mg/ml purified UbiD protein 100 ?l lysate contained UbiX protein from E. coli Total volume of the assays were 300 ?l.

(73) A series of control assays were performed in parallel, in which either no UbiD protein was added, or no enzymes were added (Table D).

(74) The vials were sealed and incubated for 60 min at 30? C. The assays were stopped by incubating for 2 min at 80? C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID), according to the procedure described in Example 2.

(75) The results of the GC analysis are shown in Table D. No isobutene production was observed in control reactions. These results show that all the UbiD proteins, studied under the conditions of this screening assay, were able to perform the decarboxylation of 3-methylcrotonic acid into isobutene in presence of E. coli cell lysate contained UbiX protein.

(76) TABLE-US-00004 TABLE D Isobutene produced, arbitrary Candidate UbiD protein Assay composition units Saccharomyces cerevisiae UbiD protein alone 9 (Uniprot Accession Number: Q03034) UbiD protein + Cell lysate 945 contained UbiX protein Sphaerulina musiva (Uniprot UbiD protein alone 70 Accession Number: M3DF95) UbiD protein + Cell lysate 3430 contained UbiX protein Penicillium roqueforti (Uniprot UbiD protein alone 34 Accession Number: W6QKP7) UbiD protein + Cell lysate 1890 contained UbiX protein Hypocrea atroviridis (Uniprot UbiD protein alone 60 Accession Number: G9NLP8) UbiD protein + Cell lysate 5200 contained UbiX protein Fusarium oxysporum sp. UbiD protein alone 13 lycopersici (Uniprot Accession UbiD protein + Cell lysate 1390 Number: W9LTH3) contained UbiX protein Saccharomyces kudriavzevii UbiD protein alone 10 (Uniprot Accession Number: UbiD protein + Cell lysate 920 J8TRN5) contained UbiX protein ?No UbiD control?: Cell lysate contained UbiX protein alone 0 Control without any enzymes 0

Example 5: Enzymatic Decarboxylation of 3-Methylcrotonic Acid into Isobutene Catalyzed in the Presence of a Lysate Containing UbiX Protein and with Purified Decarboxylase

(77) 0.5 M stock solution of 3-methylcrotonic acid was prepared in water and adjusted to pH 7.0 with 10 M solution of NaOH.

(78) Proteins encoded by the aroY gene and one protein annotated as UbiD protein were produced according to the procedure described in Example 1.

(79) Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions: 50 mM potassium phosphate buffer pH 7.5 20 mM NaCl 10 mM MgCl.sub.2 5 mM DTT 50 mM 3-methylcrotonic acid 1 mg/ml purified AroY or UbiD protein 50 ?l lysate contained UbiX protein Total volume of the assays were 300 ?l.

(80) A series of control assays were performed in parallel (Table E).

(81) The vials were sealed and incubated for 120 min at 30? C. The assays were stopped by incubating for 2 min at 80? C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID).

(82) For the GC analysis, one ml of the headspace gas was separated in a Bruker GC-450 system equipped with a GS-alumina column (30 m?0.53 mm) (Agilent) using isothermal mode at 130? C. Nitrogen was used as carrier gas with a flow rate of 6 ml/min.

(83) The enzymatic reaction product was identified by comparison with an isobutene standard. Under these GC conditions, the retention time of isobutene was 2.42 min.

(84) A significant production of isobutene from 3-methylcrotonic acid was observed in the combined assays (AroY or UbiD protein+UbiX protein). Incubation of lysate containing UbiX protein alone did not result in isobutene production. These data indicate that the proteins encoded by aroY gene in association with UbiX protein can catalyze the decarboxylation of 3-methylcrotonic acid into isobutene.

(85) TABLE-US-00005 TABLE E Isobutene production, Assay composition arbitrary units AroY protein from K. pneumoniae 10.5 (Uniprot Acession Number : B9A9M6) + lysate contained UbiX protein from E. coli + substrate AroY protein from K. pneumoniae (Uniprot 0 Acession Number : B9A9M6) + substrate UbiD protein from E. cloacae (Uniprot 8 Acession Number : V3DX94) + lysate, contained UbiX protein from E. coli + substrate UbiD protein from E. cloacae (Uniprot 0 Acession Number : V3DX94) + substrate AroY protein from Leptolyngbya sp. (Uniprot 5.5 Acession Number : A0AOS3U6D8) + lysate, contained UbiX protein from E. coli + substrate AroY protein from Leptolyngbya sp. (Uniprot 0 Acession Number : A0AOS3U6D8) + substrate AroY protein from Phascolarctobacterium sp. 5.5 (Uniprot Acession Number :R6IIV6) + lysate, contained UbiX protein from E. coli + substrate AroY protein from Phascolarctobacterium sp. 0 (Uniprot Acession Number :R6IIV6) + substrate Lysate contained UbiX protein from E. 0 coli + substrate

Example 6: Gene Synthesis, Cloning and Expression of Recombinant Proteins as Used in the Below Examples 7 to 8

(86) Gene Synthesis, Cloning and Expression of Recombinant Proteins

(87) The sequences of the studied enzymes inferred from the genomes of microorganisms were generated by oligonucleotide concatenation to fit the codon usage of E. coli (genes were commercially synthesized by GeneArt?). A stretch of 6 histidine codons was inserted after the methionine initiation codon to provide an affinity tag for purification. The genes thus synthesized were cloned in a pET-25b(+) expression vector (vectors were constructed by GeneArt?), Competent E. coli BL21(DE3) cells (Novagen) were transformed with these vectors according to standard heat shock procedure. The transformed cells were grown with shaking (160 rpm) using ZYM-5052 auto-induction medium (Studier F W, Prot. Exp. Pur. 41, (2005), 207-234) for 20 h at 30? C. The cells were then collected by centrifugation at 4? C., 10,000 rpm for 20 min and the pellets were stored at ?80? C.

(88) Protein Purification and Concentration

(89) The pellets from 500 ml of culture cells were thawed on ice and resuspended in 5 ml of 50 mM Tris-HCl buffer pH 7.5 containing 500 mM NaCl, 10 mM MgCl.sub.2, 10 mM imidazole and 1 mM DTT. Fifty microliters of lysonase (Novagen) were added. Cells were incubated 10 minutes at room temperature and then returned to ice for 20 minutes. Cell lysis was completed by sonication for 2?30 seconds. The bacterial extracts were then clarified by centrifugation at 4? C., 10,000 rpm for 20 min. The clarified bacterial lysates were loaded onto a PROTINO-2000 Ni-NTA column (Macherey-Nagel) allowing adsorption of 6-His tagged proteins. Columns were washed and the enzymes of interest were eluted with 6 ml of 50 mM Tris-HCl buffer pH 7.5 containing 300 mM NaCl, 200 mM imidazole. Eluates were then concentrated, desalted on Amicon Ultra-4 10 kDa filter unit (Millipore) and enzymes were resuspended in solution containing 50 mM Tris-HCl pH 7.5, containing 100 mM NaCl. Protein concentrations were quantified by direct UV 280 nm measurement on the NanoDrop 1000 spectrophotometer (Thermo Scientific). The purity of proteins was estimated by SDS-PAGE analysis.

Example 7: Conversion of DMAPP into DMAP Catalyzed by Isopentenyl Phosphate Kinases

(90) The genes coding for isopentenyl phosphate kinases were synthesized and the corresponding enzymes were further produced according to the procedure described in Example 6. The enzymatic assays were conducted in total reaction volume of 0.2 ml.

(91) Standard reaction mixture contained: 50 mM Tris-HCl pH 7.5 20 mM dimethylallyl pyrophosphate (DMAPP) (Sigma-Aldrich) 20 mM ATP (Sigma-Aldrich) 5 mM MgCl.sub.2 100 mM NaCl 1 mg/ml of purified isopentenyl phosphate kinases

(92) The enzyme free control was performed in parallel. The assays were incubated for 16 h hours at 34? C. with shaking and stopped by adding half volume of acetonitrile (ice cold). Assays were then centrifuged and an aliquot of the clarified supernatant were transferred into a clean vial for LC/MS analysis.

(93) HPLC analyses were performed using a 1260 Infinity LC System (Agilent), equipped with column heating module and UV detector. 5 ?l of samples were separated on Zorbax SB-Aq column (250?4.6 mm, 5 ?m particle size, column temp. 30? C.) with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). Commercial dimethylallyl phosphate (DMAP) (Sigma-Aldrich) was used as reference. In these conditions, the retention time of DMAP was 4.32 min.

(94) AI the tested isopentenyl phosphate kinases (EC 2.7.4.26) were able to catalyze this conversion (Table F).

(95) TABLE-US-00006 TABLE F Isopentenyl phosphate Uniprot DMAP formed kinases inferred from Accession in the genome of Number assay, mM Methanocaldococcus Q60352 8.7 jannaschii Methanothermobacter O26153 8.7 thermautotrophicus Thermoplasma Q9HLX1 8.0 acidophilum

Example 8: Microorganisms with Improved Production of Isobutene from 3-Methylcrotonic Acid

(96) This working example shows the production of isobutene by recombinant E. coli, expressing: (i) recombinant proteins, associated with isobutene production from 3-methylcrotonic acid (ii) different combinations of recombinant enzymes, associated with isobutene production from 3-methylcrotonic acid and enzymes to increase the pool of DMAP.

(97) Recombinant Protein Expression

(98) The sequences of the studied enzymes inferred from the genomes of the corresponding microorganisms were generated by oligonucleotide concatenation to fit the codon usage of E. coli (Table G). All the genes were commercially synthesized by GeneArt? (Thermofisher), except the gene encoding for UbiX protein, which was directly amplified from the genomic DNA of E. coli MG1655.

(99) TABLE-US-00007 TABLE G Uniprot Gene Accession Enzyme abbreviation number Flavin prenyl transferase from ubiX P0AG03 Escherichia coli (UbiX) SEQ N?5 Variant of ferulic acid FDC1V4 decarboxylase from Hypocrea atroviridis SEQ ID NO:35 Isopentenyl phosphate kinase MJ0044 Q60352 from Methanocaldococcus jannaschii SEQ ID NO: 53 4-methyl-5-(2-hydroxethyl) thiM P76423 thiazole kinase from E.coli SEQ ID NO:31

(100) A pETDuet?-271 co-expression vector (Novagen) was used for the expression of the different combinations of ubiX, FDC1V4, thiM, MJ0044. The following constructions were created (Table H, Table I).

(101) TABLE-US-00008 TABLE H Vector Strain number pGB6346 pETDuet Strain 1, expressing recombinant PT7 FDC1V4 PT7 UbiX FDC1V4 and UbiX proteins pGB6580 Strain 2, , expressing recombinant pETDuet PT7 UbiDv4 FDC1V4 and UbiX proteins and a PT7 UbiX-MJ0044 recombinant Isopentenyl phosphate kinase MJ0044 pGB6389 pETDuet Strain 3, expressing recombinant PT7 UbiDv4 FDC1V4, and UbiX proteins and a PT7 UbiX-thiM recombinant 4-methyl-5-(2-hydroxethyl) thiazole kinase thiM

(102) TABLE-US-00009 TABLEI Plasmidssequencesusedinthisstudy Plasmid Sequences pGB6346 ctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaagga atggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaa gcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcac ctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatcgatctcgatcccgcgaaattaata cgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatatac catgagcagcaccacctataaaagtgaagcatttgatccggaaccgcctcatctgagctttcgtagctttgttaatgcac tgcgtcaggatggggatctggtggatattaatgaaccggttgatccggatctggaagcagcagcaattacccgtctggt ttgtgaaaccgatgataaagcaccgctgtttaataacgtgattggtgcaaaagatggtctgtggcgtattctgggtgcac cggcaagcctgcgtgcgagcccgaaagaacgttttggtcgtctggcacgtcatctggcactgcctccgaccgcaagc gcaaaagatattctggataaaatgctgagcgccaatagcattccgcctattgaaccggttattgttccgaccggtccggt taaagaaaatagcattgaaggcgaaaacattgatctggaagccctgcctgcaccgatggttcatcagagtgatggtg gcaagtatatcaatacctatggtatgcatgttatccagagtccggatggtgggtggaccaattggagcattgcccgtgc aatggttagcggtaaacgtaccctggcaggtctggttattagtccgcagcatattcgtaaaattcaggatcagtggcgtg caattggccaagaagaaattccttgggcactggcatttggtgttccgcctctggcaattatggcaagcagtatgccgatt ccggatggtgttagcgaagcaggttatgttggtgcaattgccggtgaaccgattaaactggttaaatgcgataccaaca atctgtatgttccggcaaatagcgaaattgttctggaaggcaccctgagcaccaccaaaatggcaccggaaggtccg tttggtgaaatgcatggttatgtttatccgggtgaaagccatccgggtccggtttataccgttaacaaaattacctatcgca acaatgcaattctgccgatgagcgcatgtggtcgtctgaccgatgaaacccagaccatgattccgaccctggcagca gcagaaattcgtcagctgtgtcagagggcaggtctgccgattaccgatgcatttgcaccgtttgttggtcaggcaacctg ggttgcactgaaagttgataccaaacgtctgcgtgcaatgaaaaccaatggtaaagcatttgcaaaagcggttggtga tgttgtgtttacccagaaaccgggttttatgattcatcgtctgattctggttggtgatgatattgatgtgtatgacgataaagat gtgatgtgggcatttgctacccgttgtcgtccgggtacagatgaagttttttttgatgatgttcctggcttttggctgatcccgt atatgagtcatggtaatgccgaagcagtgaaaggtggtaaagttgttagtgatgcactgctgaccgcagaatatacca ccggtaaagattgggaaagcgcagatttcaaaaacagctatccgaaacgtatccaggataaagttctgaatagctgg gaacgcctgggtttcaaaaaactggattaataaggatccgaattcgagctcggcgcgcctgcaggtcgacaagcttg cggccgcataatgcttaagtcgaacagaaagtaatcgtattgtacacggccgcataatcgaaattaatacgactcact ataggggaattgtgagcggataacaattccccatcttagtatattagttaagtataagaaggagatatacatatgaaac gactcattgtaggcatcagcggtgccagcggcgcgatttatggcgtgcgcttattacaggttctgcgcgatgtcacagat atcgaaacgcatctggtgatgagccaggcagcgcgccagaccttatccctcgaaacggatttttctctgcgcgaagtg caggcattagccgatgtcacgcacgatgcgcgcgatattgccgccagcatctcttccggttctttccagacgctgggga tggtgattttaccctgttcaatcaaaaccctttccggcattgtccatagctatactgatggcttactgacccgtgcggcagat gtggtgctgaaagagcgtcgcccgttggtgctctgcgtgcgtgaaacaccattgcacttaggccatctgcgtttaatgac tcaggcggcagaaatcggtgcggtgattatgcctcccgttccggcgttttatcatcgcccgcaatcccttgatgatgtgat aaatcagacggttaatcgtgttcttgaccagtttgcgataacccttcctgaagatctctttgcccgctggcagggcgcata ataaggtaccctcgagtctggtaaagaaaccgctgctgcgaaatttgaacgccagcacatggactcgtctactagcg cagcttaattaacctaggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgag gggttttttgctgaaaggaggaactatatccggattggcgaatgggacgcgccctgtagcggcgcattaagcgcggc gggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacc tcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgt tggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttata agggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatatta acgtttacaatttctggcggcacgatggcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaa gttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagc gatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggc cccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaa gggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaag tagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttc attcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtc ctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatg ccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgc tcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttctt cggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttc agcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagg gcgacacggaaatgttgaatactcatactcttcctttttcaatcatgattgaagcatttatcagggttattgtctcatgagcg gatacatatttgaatgtatttagaaaaataaacaaataggtcatgaccaaaatcccttaacgtgagttttcgttccactga gcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaa aaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcag agcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctaca tacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacga tagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacc tacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacag gtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatcttta tagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaa cgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgt ggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtg agcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgc actctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctg cgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagc tgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaa gctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcg ttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaaggggga tttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgccc ggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtca atgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacat aatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcag gtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaacc ccgccagcctagccgggtcctcaacgacaggagcacgatcatgctagtcatgccccgcgcccaccggaaggagct gactgggttgaaggctctcaagggcatcggtcgagatcccggtgcctaatgagtgagctaacttacattaattgcgttgc gctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggc ggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggcc ctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaacggcgg gatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatgtccgcaccaacgcgcagcccggactcggt aatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagca tttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgag atatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggt gacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtct ggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcatccag cggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgctt cgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggc gcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggtt gggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccac gcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactggtttcacattcaccaccctg aattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccgggatctcgacg (SEQIDNO:36) pGB6580 caccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccacc atacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatat aggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatcgatc tcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgttta actttaagaaggagatataccatgagcagcaccacctataaaagtgaagcatttgatccggaaccgcctcatctgag ctttcgtagctttgttaatgcactgcgtcaggatggggatctggtggatattaatgaaccggttgatccggatctggaagc agcagcaattacccgtctggtttgtgaaaccgatgataaagcaccgctgtttaataacgtgattggtgcaaaagatggt ctgtggcgtattctgggtgcaccggcaagcctgcgtgcgagcccgaaagaacgttttggtcgtctggcacgtcatctgg cactgcctccgaccgcaagcgcaaaagatattctggataaaatgctgagcgccaatagcattccgcctattgaaccg gttattgttccgaccggtccggttaaagaaaatagcattgaaggcgaaaacattgatctggaagccctgcctgcaccg atggttcatcagagtgatggtggcaagtatatcaatacctatggtatgcatgttatccagagtccggatggtgggtggac caattggagcattgcccgtgcaatggttagcggtaaacgtaccctggcaggtctggttattagtccgcagcatattcgta aaattcaggatcagtggcgtgcaattggccaagaagaaattccttgggcactggcatttggtgttccgcctctggcaatt atggcaagcagtatgccgattccggatggtgttagcgaagcaggttatgttggtgcaattgccggtgaaccgattaaac tggttaaatgcgataccaacaatctgtatgttccggcaaatagcgaaattgttctggaaggcaccctgagcaccacca aaatggcaccggaaggtccgtttggtgaaatgcatggttatgtttatccgggtgaaagccatccgggtccggtttatacc gttaacaaaattacctatcgcaacaatgcaattctgccgatgagcgcatgtggtcgtctgaccgatgaaacccagacc atgattccgaccctggcagcagcagaaattcgtcagctgtgtcagagggcaggtctgccgattaccgatgcatttgca ccgtttgttggtcaggcaacctgggttgcactgaaagttgataccaaacgtctgcgtgcaatgaaaaccaatggtaaa gcatttgcaaaagcggttggtgatgttgtgtttacccagaaaccgggttttatgattcatcgtctgattctggttggtgatgat attgatgtgtatgacgataaagatgtgatgtgggcatttgctacccgttgtcgtccgggtacagatgaagttttttttgatgat gttcctggcttttggctgatcccgtatatgagtcatggtaatgccgaagcagtgaaaggtggtaaagttgttagtgatgca ctgctgaccgcagaatataccaccggtaaagattgggaaagcgcagatttcaaaaacagctatccgaaacgtatcc aggataaagttctgaatagctgggaacgcctgggtttcaaaaaactggattaataaggatccgaattcgagctcggcg cgcctgcaggtcgacaagcttgcggccgcataatgcttaagtcgaacagaaagtaatcgtattgtacacggccgcat aatcgaaattaatacgactcactataggggaattgtgagcggataacaattccccatcttagtatattagttaagtataag aaggagatatacatatgaaacgactcattgtaggcatcagcggtgccagcggcgcgatttatggcgtgcgcttattac aggttctgcgcgatgtcacagatatcgaaacgcatctggtgatgagccaggcagcgcgccagaccttatccctcgaa acggatttttctctgcgcgaagtgcaggcattagccgatgtcacgcacgatgcgcgcgatattgccgccagcatctcttc cggttctttccagacgctggggatggtgattttaccctgttcaatcaaaaccctttccggcattgtccatagctatactgatg gcttactgacccgtgcggcagatgtggtgctgaaagagcgtcgcccgttggtgctctgcgtgcgtgaaacaccattgc acttaggccatctgcgtttaatgactcaggcggcagaaatcggtgcggtgattatgcctcccgttccggcgttttatcatc gcccgcaatcccttgatgatgtgataaatcagacggttaatcgtgttcttgaccagtttgcgataacccttcctgaagatct ctttgcccgctggcagggcgcataataaggtaccGAAGGAGATATACATATGCTGACCATTCTGA AACTGGGTGGTAGCATTCTGAGCGATAAAAATGTTCCGTATAGCATTAAATGGG ACAACCTGGAACGTATCGCAATGGAAATCAAAAATGCCCTGGACTACTACAAAA ATCAGAATAAAGAAATTAAACTGATTCTGGTGCATGGTGGTGGTGCATTTGGTCA TCCGGTTGCCAAAAAATACCTGAAAATTGAGGACGGCAAAAAAATCTTTATTAAC ATGGAAAAAGGCTTTTGGGAAATCCAGCGTGCAATGCGTCGTTTTAACAACATT ATCATTGATACCCTGCAGAGCTATGATATTCCGGCAGTTAGCATTCAGCCGAGC AGCTTTGTTGTTTTTGGTGATAAACTGATCTTTGACACCAGCGCCATTAAAGAAA TGCTGAAACGTAATCTGGTTCCGGTGATTCATGGTGATATTGTGATTGATGATAA AAATGGCTACCGCATCATTAGCGGTGATGATATTGTTCCGTATCTGGCCAATGA ACTGAAAGCAGATCTGATTCTGTATGCCACCGATGTTGATGGTGTTCTGATTGAT AACAAACCGATTAAACGCATTGATAAAAACAATATCTATAAAATCCTGAATTATCT GAGCGGCAGCAACAGCATTGATGTTACCGGTGGTATGAAATACAAAATCGACAT GATTCGCAAAAACAAATGCCGTGGCTTTGTGTTCAATGGCAATAAAGCCAACAA CATCTATAAAGCACTGCTGGGTGAAGTTGAAGGCACCGAAATTGATTTTAGCGA ATAATAATTAATTAAcctaggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaac gggtcttgaggggttttttgctgaaaggaggaactatatccggattggcgaatgggacgcgccctgtagcggcgcatta agcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttctt cccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgcttt acggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgc cctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattct tttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaac aaaatattaacgtttacaatttctggcggcacgatggcatgagattatcaaaaaggatcttcacctagatccttttaaatta aaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacc tatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttac catctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagcca gccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagcta gagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggt atggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctc cttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctctta ctgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgac cgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaa aacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaa ctgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaaggg aataagggcgacacggaaatgttgaatactcatactcttcctttttcaatcatgattgaagcatttatcagggttattgtctc atgagcggatacatatttgaatgtatttagaaaaataaacaaataggtcatgaccaaaatcccttaacgtgagttttcgtt ccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgca aacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactgg cttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagca ccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggac tcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggag cgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaa ggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgc ctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcc tatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatc ccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcag cgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgc atatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactg ggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgctt acagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcag ctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttct ccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtg taagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgat gaacatgcccggttactggaacgttgtgagggtaaacaactggcggtatggatgcgggggaccagagaaaaatc actcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcag atccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaaccgaagaccattca tgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccag taaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgctagtcatgccccgcgcccacc ggaaggagctgactgggttgaaggctctcaagggcatcggtcgagatcccggtgcctaatgagtgagctaacttaca ttaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgc ggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttc accgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtg gttaacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatgtccgcaccaacgcgcagc ccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgc cctcattcagcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatcggctgaatttg attgcgagtgagatatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacag cgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaaaataatact gttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcat cctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacagg cttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcga caatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgt tgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctg gcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactggtttc acattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtcc gggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgag (SEQIDNO:37) pGB6389 caccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccacc atacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatat aggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatcgatc tcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgttta actttaagaaggagatataccatgagcagcaccacctataaaagtgaagcatttgatccggaaccgcctcatctgag ctttcgtagctttgttaatgcactgcgtcaggatggggatctggtggatattaatgaaccggttgatccggatctggaagc agcagcaattacccgtctggtttgtgaaaccgatgataaagcaccgctgtttaataacgtgattggtgcaaaagatggt ctgtggcgtattctgggtgcaccggcaagcctgcgtgcgagcccgaaagaacgttttggtcgtctggcacgtcatctgg cactgcctccgaccgcaagcgcaaaagatattctggataaaatgctgagcgccaatagcattccgcctattgaaccg gttattgttccgaccggtccggttaaagaaaatagcattgaaggcgaaaacattgatctggaagccctgcctgcaccg atggttcatcagagtgatggtggcaagtatatcaatacctatggtatgcatgttatccagagtccggatggtgggtggac caattggagcattgcccgtgcaatggttagcggtaaacgtaccctggcaggtctggttattagtccgcagcatattcgta aaattcaggatcagtggcgtgcaattggccaagaagaaattccttgggcactggcatttggtgttccgcctctggcaatt atggcaagcagtatgccgattccggatggtgttagcgaagcaggttatgttggtgcaattgccggtgaaccgattaaac tggttaaatgcgataccaacaatctgtatgttccggcaaatagcgaaattgttctggaaggcaccctgagcaccacca aaatggcaccggaaggtccgtttggtgaaatgcatggttatgtttatccgggtgaaagccatccgggtccggtttatacc gttaacaaaattacctatcgcaacaatgcaattctgccgatgagcgcatgtggtcgtctgaccgatgaaacccagacc atgattccgaccctggcagcagcagaaattcgtcagctgtgtcagagggcaggtctgccgattaccgatgcatttgca ccgtttgttggtcaggcaacctgggttgcactgaaagttgataccaaacgtctgcgtgcaatgaaaaccaatggtaaa gcatttgcaaaagcggttggtgatgttgtgtttacccagaaaccgggttttatgattcatcgtctgattctggttggtgatgat attgatgtgtatgacgataaagatgtgatgtgggcatttgctacccgttgtcgtccgggtacagatgaagttttttttgatgat gttcctggcttttggctgatcccgtatatgagtcatggtaatgccgaagcagtgaaaggtggtaaagttgttagtgatgca ctgctgaccgcagaatataccaccggtaaagattgggaaagcgcagatttcaaaaacagctatccgaaacgtatcc aggataaagttctgaatagctgggaacgcctgggtttcaaaaaactggattaataaggatccgaattcgagctcggcg cgcctgcaggtcgacaagcttgcggccgcataatgcttaagtcgaacagaaagtaatcgtattgtacacggccgcat aatcgaaattaatacgactcactataggggaattgtgagcggataacaattccccatcttagtatattagttaagtataag aaggagatatacatatgaaacgactcattgtaggcatcagcggtgccagcggcgcgatttatggcgtgcgcttattac aggttctgcgcgatgtcacagatatcgaaacgcatctggtgatgagccaggcagcgcgccagaccttatccctcgaa acggatttttctctgcgcgaagtgcaggcattagccgatgtcacgcacgatgcgcgcgatattgccgccagcatctcttc cggttctttccagacgctggggatggtgattttaccctgttcaatcaaaaccctttccggcattgtccatagctatactgatg gcttactgacccgtgcggcagatgtggtgctgaaagagcgtcgcccgttggtgctctgcgtgcgtgaaacaccattgc acttaggccatctgcgtttaatgactcaggcggcagaaatcggtgcggtgattatgcctcccgttccggcgttttatcatc gcccgcaatcccttgatgatgtgataaatcagacggttaatcgtgttcttgaccagtttgcgataacccttcctgaagatct ctttgcccgctggcagggcgcataataaggtaccGAAGGAGATATACATATGCAGGTTGATCTG CTGGGTAGCGCACAGAGCGCACATGCACTGCACCTGTTTCATCAGCATAGTCC GCTGGTTCATTGTATGACCAATGATGTTGTTCAGACCTTTACCGCAAATACCCTG CTGGCACTGGGTGCAAGTCCGGCAATGGTTATTGAAACCGAAGAAGCAAGCCA GTTTGCAGCAATTGCAAGCGCACTGCTGATTAATGTTGGCACCCTGACCCAGCC TCGTGCACAGGCAATGCGTGCAGCAGTTGAACAGGCAAAAAGCAGCCAGACCC CGTGGACCCTGGACCCGGTTGCAGTTGGTGCACTGGATTATCGTCGTCATTTTT GTCATGAACTGCTGAGCTTTAAACCGGCAGCAATTCGTGGTAATGCAAGCGAAA TTATGGCACTGGCAGGTATTGCAAATGGTGGTCGTGGTGTTGATACCACCGATG CAGCAGCAAATGCAATTCCGGCAGCACAGACCCTGGCACGTGAAACCGGTGCA ATTGTTGTTGTTACCGGTGAAATGGATTATGTTACCGATGGTCATCGTATTATTG GTATTCATGGTGGTGATCCGCTGATGACCAAAGTTGTTGGCACCGGTTGTGCAC TGAGCGCAGTTGTTGCAGCATGTTGTGCACTGCCTGGTGATACCCTGGAAAATG TTGCAAGCGCATGTCATTGGATGAAACAGGCAGGCGAACGTGCAGTTGCACGT AGCGAAGGTCCGGGTAGCTTTGTTCCGCATTTTCTGGATGCACTGTGGCAGCT GACCCAGGAAGTTCAGGCATAATAATTAATTAAcctaggctgctgccaccgctgagcaataact agcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggattggcgaat gggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccag cgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggg ggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtg ggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactgga acaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctg atttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttctggcggcacgatggcatgagattatcaa aaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcg tgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccg gctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctc catccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgct acaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatg atcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatc actcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaa ccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccac atagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgag atccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaa acaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttca atcatgattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatagg tcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttga gatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaa gagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgta gttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgcca gtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacg gggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatga gaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagag cgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcg atttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttg ctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgatacc gctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattt tctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaag ccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgcc ctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggtttt caccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtct gcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagg gcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgag agaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactggcg gtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttcc acagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagac tttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgtt cgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggag cacgatcatgctagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcga gatcccggtgcctaatgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcg tgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttca ccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtt tgccccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgtatcc cactaccgagatgtccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcg ttggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccggacatggcactcc agtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgc cgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagt cgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaac attagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgc gcgagaagattgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcaccc agttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgc caatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttcc actttttcccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcat actctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccatacc gcgaaaggttttgcgccattcgatggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagccc agtagtaggttgaggccgttgag (SEQIDNO:38)

(103) A BL21(DE3) strain was transformed with the constructed vectors. The single transformants were used to inoculate LB medium, supplemented with ampicillin, followed by incubation at 30? C. overnight. This overnight pre-cultures were then used to inoculate 0.5 L of batch medium in 1 L bioreactor so to obtain an initial OD600 around of 0.05.

(104) Bioreactor Fermentation Conditions

(105) The fermentation assays were performed in 1 liter bioreactors (Multifors). The culture medium was composed of ZYM auto-induction medium (Studier F W, Prot. Exp. Pur. 41, (2005), 207-234) complemented with 0.5 mM riboflavin, 10 g/L Glycerol, 2.5 g/L Glucose, 4 g/L lactose and ampicillin (0.1 g/L). During the phase of bacterial growth, the operational fermentation parameters were temperature 30? C., medium pH 6.8 (adjusting by NH.sub.4OH and H.sub.3PO.sub.4), pO.sub.2 20%. The phase of bacterial growth was conducted until OD600 around of 20-30. The isobutene production was then initiated by modifying the fermentation parameters as: Temperature was increased to reach 34? C. Glucose concentration was increased to 3 g/L and then maintained beyond 1 g/L during isobutene (IBN) production phase. 3-methylcrotonic acid was added to the culture medium at initial concentration of 25 mM and then maintained beyond 20 mM during IBN production phase. When the external prenol was added to the culture medium, initial concentration was 8 mM through a pulse addition. There was no further addition of prenol during IBN production phase.

(106) The isobutene (IBN) production was analyzed continuously using a Prima Pro Process mass spectrometer (Thermo Scientific) calibrated with 0.5% mol isobutene in argon.

(107) The results are shown in FIG. 42 and FIG. 43.

(108) As can be derived from the results, the over-expression of enzymes capable of increasing the pool of DMAP led to an increase in the production of isobutene.

Example 9: Assay for the Formation of Prenylated FMN by Using Either DMAP or DMAPP as Co-Substrate by Different FMN Prenyl Transferases

(109) The following enzymes were used in this study (Table J).

(110) TABLE-US-00010 TABLE J Uniprot Gene accession Enzyme Organism abbreviation number Flavin prenyltransferase Escherichia coli ubiX P0AG03 UbiX SEQ ID NO:5 (strain K12) UbiX-like flavin Escherichia coli ecdB P69772 prenyltransferase O157:H7 SEQ ID NO:66 UbiX-like flavin Klebsiella pneumoniae kpdB Q462H4 prenyltransferase SEQ ID NO:70 Flavin Hypocrea atroviridis PAD1 G9NTN1 prenyltransferase (strain ATCC 20476/ PAD1, mitochondrial IMI 206040) SEQ ID NO:71 (Trichoderma atroviride)

(111) Enzyme Expression and Production

(112) The sequences of the studied enzymes were generated and cloned in a pET-25b (+) expression vector as described in Example 1. The enzymes were then expressed and purified according to the procedure from Example 1, with the following modifications. The transformed cells were grown without added Flavin Mononucleotide. 50 mM phosphate pH7.5, containing 100 mM NaCl and 10% glycerol was used during protein purification instead of a Tris-HCl buffer. The purity of proteins was estimated to be around 90-95% according to SDS-PAGE analysis.

(113) Enzymatic biosynthesis of prenylated FMN

(114) Standard assay mixture contained: 50 mM phosphate buffer pH 7.5 containing 100 mM NaCl. 10 mM dimethylallyl pyrophosphate (DMAPP) or 10 mM dimethylallyl phosphate (DMAP) (Sigma-Aldrich) 5 mM Flavin Mononucleotide (FMN) 10 mM sodium dithionite

(115) All the components of the assay (buffer, FMN, DMAP or DMAPP, sodium dithionite) were made up as stock solution, transferred into the anaerobic chamber (Whitley DG250 anaerobic workstation) and incubated for at least one hour. Enzymatic assays were typically performed in 1.5 mL Eppendorf opaque black microtubes (Dutscher) with a total assay volume of 0.25 mL. Reactions were initiated by the addition of prenyl transferase (200 ?M final concentration). The enzyme free controls were performed in parallel. The assays were incubated for 1 hour at 30? C. Then, the enzymes were removed from the incubation mixture by ultrafiltration using 10 kDa Amicon filter while being in the anaerobic chamber.

(116) The supernatant containing prenylated FMN thus synthesized was diluted by adding half a volume of acetonitrile (ice cold). Assays were then centrifuged and an aliquot of the clarified supernatant were transferred into a clean vial for HPLC analysis.

(117) HPLC Analysis of Prenylated FMN

(118) The amount of prenylated FMN was determined by alkyl reverse phase using a 1260 Infinity LC System (Agilent), equipped with a column heating module and a UV detector. 5 ?l of samples were separated on Zorbax SB-Aq column (250?4.6 mm, 5 ?m particle size, column temp. 30? C.) with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). FMN was used as reference to estimate the amount of produced prenylated FMN.

(119) The consumption of DMAP or DMAPP as well as FMN was followed in parallel. In the described conditions, the retention time of FMN and prenylated FMN were 4.8 min and 5.7 min, respectively and the retention time of DMAPP and DMAP were 3.5 min and 4.4 min, respectively.

(120) The amount of prenylated FMN formed in the enzymatic assays with DMAP and DMAPP are shown in the Table K.

(121) TABLE-US-00011 TABLE K Concentration of prenylated FMN formed in the assays, mM With DMAP With DMAPP Enzyme as co-substrate as co-substrate Flavin prenyltransferase 2.9 2.4 UbiX from Escherichia coli (strain K12) UbiX-like flavin 3.7 3.7 prenyltransferase Escherichia coli O157:H7 UbiX-like flavin 3.4 3.9 prenyltransferase from Klebsiella pneumoniae Flavin prenyltransferase 0.3 (traces) 2.4 PAD1, mitochondrial from Hypocrea atroviridis (strain ATCC 20476/IMI 206040)

(122) No prenylated FMN was observed in the control assays without enzymes either with DMAP or DMAPP as co-substrate.