RECOMBINANT YEAST SACCHAROMYCES BOULARDII FOR PRODUCTION OF NEOAGAROOLIGOSACCHARIDE AND USE THEREOF

Abstract

The present invention relates to a strain that produces neoagarooligosaccharides from agarose, which is a representative polysaccharide constituting red algae, using Saccharomyces boulardii, which is a probiotic yeast, a production method thereof, and a use thereof. The present invention aims to achieve synbiotics through the production of prebiotic substances using probiotic strains and can be used as an intestinal microbial factory.

Claims

1. Recombinant Saccharomyces boulardii transformed with a gene encoding beta-agarase.

2. The recombinant Saccharomyces boulardii of claim 1, wherein the beta-agarase gene is represented by SEQ ID NO: 1.

3. The recombinant Saccharomyces boulardii of claim 1, wherein the recombinant Saccharomyces boulardii is transformed with a gene encoding a signal peptide that secretes a beta-agarase enzyme outside strain.

4. The recombinant Saccharomyces boulardii of claim 3, wherein the signal peptide is one or more of a chicken lysozyme signal peptide (CL), a Saccharomyces cerevisiae-derived ?-binding factor signal peptide (?-MF), a Saccharomyces diastaticus-derived STA1 signal peptide (STA1), and a Saccharomyces cerevisiae-derived SED1 signal peptide (SED1).

5. The recombinant Saccharomyces boulardii of claim 4, wherein the chicken lysozyme signal peptide (CL) is represented by SEQ ID NO: 2, the Saccharomyces cerevisiae-derived ?-binding factor signal peptide (?-MF) is represented by SEQ ID NO: 3, the Saccharomyces diastaticus-derived STA1 signal peptide (STA1) is represented by SEQ ID NO: 4, and the Saccharomyces cerevisiae-derived SED1 signal peptide (SED1) is represented by SEQ ID NO: 5.

6. The recombinant Saccharomyces boulardii of claim 1, wherein transformation is achieved by CRISPR-Cas9 or a recombinant vector.

7. A composition for producing prebiotics comprising the recombinant Saccharomyces boulardii of claim 1 and agarose as a substrate.

8. The composition of claim 7, wherein the prebiotics are neoagarooligosaccharides.

9. A synbiotic composition comprising the recombinant Saccharomyces boulardii of claim 1 and agarose as a substrate.

10. The synbiotic composition of claim 9, further comprising probiotics.

11. A method of producing neoagarooligosaccharides, comprising: reacting a culture fluid or extract of the recombinant Saccharomyces boulardii of claim 1 with agarose as a substrate; and separating and purifying neoagarooligosaccharides from the product of the above step.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1 shows an overall schematic diagram of neoagarotetraose production by Saccharomyces boulardii engineered using metabolic engineering technology. The introduction of a BpGH16A gene, which is a beta-agarase, was performed using two different systems: a vector system with an auxotrophic marker and a CRISPR-Cas9 system.

[0026] FIG. 2 shows the results of confirming the fermentation product using a strain (SB-HTU_16A_C) into which the BpGH16A gene was introduced using HPLC. Fermentation was performed at 37? C. for 72 hours using 2.5 g/L of agarose as a substrate. (A) is the result of fermentation product analysis using a wild-type strain as a control group, and (B) is the result of fermentation product analysis using a strain (SB-HTU_16A_C) into which the BpGH16A gene and a chicken lysozyme signal peptide sequence were introduced. Neoagarotetraose (NeoDP4) was detected as a peak at a retention time of approximately 7.6 minutes.

[0027] FIG. 3 is the result of comparing the amounts of neoagarotetraose (NeoDP4) produced when strains, in which different signal peptide sequences were introduced in front of the BpGH16A gene, which is a beta-agarase, in Saccharomyces boulardii were fermented with agarose. Fermentation was performed at 37? C. for 72 hours using 2.5 g/L of agarose as a substrate. (A) is the result of analyzing the fermentation product using TLC, and (B) is the result of analyzing the fermentation product using HPLC and calculating the concentration.

[0028] FIG. 4 shows the results of confirming the materials and cell growth generated over time when fermentation was performed at 37? C. for 72 hours using agarose as a substrate using yeast (SB-HTU_16A_D) prepared based on a plasmid. (A) is the result of analyzing fermentation products for 72 hours using TLC. (B) shows the results of HPLC analysis and quantification of cell density and concentrations of glucose, ethanol, acetic acid, and neoagarotetraose during fermentation for 72 hours.

[0029] FIG. 5 relates to a method of preparing Saccharomyces boulardii, which can produce neoagarooligosaccharides, using CRISPR-Cas9 technology. (A) is an overall schematic diagram of the process of introducing beta-agarase into a strain using a CRISPR-Cas9 system. (B) is the result of introducing beta-agarase into the strain using the CRISPR-Cas9 system and then confirming through colony PCR whether it was actually introduced.

[0030] FIG. 6 shows the results of confirming the materials and cell growth produced over time when agarose was provided as a substrate using Saccharomyces boulardii (SB_16A_D) engineered using CRISPR-Cas9 technology and fermentation was performed for 72 hours. (A) is the result of analyzing fermentation products for 72 hours using TLC. (B) shows the results of HPLC analysis of cell density and concentrations of glucose, acetic acid, ethanol, and neoagarotetraose during fermentation for 72 hours.

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS

[0031] Hereinafter, the present invention will be described in detail by way of Examples. The following Examples merely illustrate the present invention but do not limit the scope of the present invention.

Example 1: Method of Preparing Plasmids and Strains

[0032] To use auxotrophic markers during strain production, strains with inactivated HIS3, TRP1, and URA3 genes were generated. The HIS3 gene was inactivated based on strain SB-TU in which TRP1 and URA3 were inactivated (Liu J-J., et al. (2016) Appl Environ Microbiol. 82, 2280-2287). The HIS3 gene was amplified using the primer pair gHIS3_F and gHIS3_R (Table 1), the resulting PCR product was digested by SacI and NotI, and ligated into the pRS42H vector to generate plasmid p42H_gHIS3 (Table 2). The repair DNA required after HIS3 inactivation was amplified by PCR using primers dDNA_HIS3_F and dDNA_HIS3_R (Table 1). Yeast transformation was performed using the PEG-LiAc method (Gietz R. D., et al. (1995) Yeast. 11, 335-360). After yeast transformation, Saccharomyces boulardii strain SB-HTU, in which HIS3, TRP1, and URA3 genes were inactivated, was prepared and used in the experiment (Table 3).

[0033] Plasmid construction to select an optimal signal peptide for beta-agarase secretion was performed as follows. The gene BACPLE_01670 encoding BpGH16A was cloned into the pRS426GPD plasmid. The BpGH16A gene fragment was amplified by PCR from genomic DNA of Bacteroides plebeius DSM 17135 (DSMZ, Braunschweig, Germany) using different primer pairs depending on the type of signal peptide (Table 1). A signal peptide sequence predicted at the N-terminus of BpGH16A was removed and then used. A total of four signal peptides, including a chicken lysozyme signal peptide (CL), a Saccharomyces cerevisiae-derived ?-binding factor signal peptide (?-MF), a Saccharomyces diastaticus-derived STA1 signal peptide (STA1), and a Saccharomyces cerevisiae-derived SED1 signal peptide (SED1), were compared (Liu J-J., et al. (2016) Appl Environ Microbiol. 82, 2280-2287, Inokuma K., et al. (2016) Biotechnol Bioeng. 113, 2358-2366, Yanagisawa M., et al. (2016) Enzyme Microb Technol. 85, 82-89). In addition, to construct a control strain without a signal peptide, PCR was performed using the primer pair 16A_W/OSP_F_Spel and 16A_W/OSP_R_Xhol (Table 1). Plasmids such as p426_Bp_W/OSP, p426_Bp_CL, p426_Bp_aMF, p426_Bp_STA1, and p426_Bp_SED1 were generated, and yeast transformation using SB-HTU was performed using the PEG-LiAc method. That is, strains SB-HTU_16A_C, SB-HTU_16A_A, SB-HTU_16A_S, and SB-HTU_16A_D were prepared for a signal peptide comparison experiment (Table 3). As a control strain, SB-HTU_E, which includes only the pRS426GPD vector without BpGH16A and a signal peptide, and SB-HTU_W, which includes the BpGH16A gene but no signal peptide, were prepared and used.

[0034] For stable expression of BpGH16A, guide RNA plasmid p42K_CS5 was used to integrate the BpGH16A gene into the genome of Saccharomyces boulardii (Table 2). p42K_CS5 was generated by inverse PCR of the pRS42K plasmid including a guide RNA sequence using the primer pair gRNA_CS5_F and gRNA_CS5_R (Table 1). The 20-bp targeting sequence of the guide RNA binds to the front of the PAM sequence (NGG) at an empty locus on chromosome XV (CS5). BpGH16A and SED1 signal peptides were integrated by homologous recombination without affecting the function of other genes. For homologous recombination, plasmid p426_16A_D was amplified using the primer pair dDNA-CS5-F and dDNA-CS5-R as donor DNA for CRISPR-Cas9-based genomic integration (Table 1). To overcome inefficiencies associated with genomic integration, PCR products constructed using the primer pair dDNA-CS5-F and dDNA-CS5-R were amplified once again by PCR using the primer pair CS5+60_F and CS5+60_R to increase a homology region to 120-bp (Table 1). In a yeast transformation process, 1 ?g of Cas9-NAT, 20 ?g of 16A-D-CS5, and 2 ?g of p42K_CS5 were added to Saccharomyces boulardii and transformed using the PEG-LiAc method. Verification of genomic integration was performed by yeast colony PCR using the primer pair Conf-CS5-F and Conf-CS5-R (Table 1).

TABLE-US-00001 TABLE1 Listofprimersusedintheinvention Sequence(5.fwdarw.3,restriction Primer sitesareunderlined) gHIS3_F TCCACCTAGCGGATGACTCT gHIS3_R TGCATTACCTTGTCATCTTC dDNA_HIS3_F GTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGCG ATCTCTTTAAAGGGTTAACCC dDNA_HIS3_R TTCTGGGAAGATCGAGTGCTCTATCGCTAGGGGTTAACC CTTTAAAGAGATCGCAATCTG 16A_W/OSP_ ATA F_SpeI ACTAGTGCAGAAAATTTAAATAATAAATCATACGAGTG 16A_W/OSP_ ATACTCGAGTTCTTCTGGGACCAGTGTATAAAC R_XhoI 16A_CL_F_ ATA SpeI ACTAGTATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCC TGCCCCTGGCTGCTCTGGGGGCAGAAAATTTAAATAATA AATCATAC 16A_CL_R_XhoI ATACTCGAGTTCTTCTGGGACCAGT ?MF_F_SpeI ATAACTAGTATGAGATTTCCTTCAATTTTTACTG ?MF_R_16A GCAGAAAATTTAAATAATAAAGCTTCAGCCTCTCTT TTCT 16A_F_aMF GAGAAAAGAGAGGCTGAAGCTGCAGAAAATTTA AATAATAAATCATACG 16A_R_?MF_ ATAGGATCCTTCTTCTGGGACCAGTGTAT BamHI STA1_F_EcoRI ATAGAATTCATGGTAGGCCTCAAAAATC STA1_16A_R GCAGAAAATTTAAATAATAAATCATACGAGTTTTTT CTGTCGCTGGAGC 16A_STA1_F GGCTCCAGCGACAGAAAAAAGCAGAAAATTTAA ATAATAAATCATACGAG 16A_R_XhoI ATACTCGAGTTCTTCTGGGACCAGTGTAT 16A_SED1_F_ ATA SpeI ACTAGTATGAAATTATCAACTGTCCTATTATCTGCCGGTT TAGCCTCGACTACTTTGGCCCAAGCAGAAAATTTAAATA ATAAATCA 16A_SED1_R_ ATACTCGAGTTCTTCTGGGACCAG XhoI dDNA-CS5-F AAAAGAGAAGAAAAAAGAGAAGAAATGAATTCT ATTATGATAGCGAATGCAATTAACCCTCACTAAAGG GA dDNA-CS5-R TGCTGGTTGCCTTATTAATTTATATGGAAGACGAGA TAATTCATTAATTAGTAATACGACTCACTATAGGGC dDNA-CS5+60_F ATG GTACACGCTCTTGGCAACATTGAAATTACAGCT CTCATATATAAAAAATGGAAAGAAAAAAGAGAA GAAAAAAGAGAAGAAATGAAT dDNA-CS5+60_R GGCATAACAATAGCGCACAGATCCGCAGGTTTCGTA ATACGCTTAACAATAGGCGTCTCCTGCTGGTTGCCT TATTAATTTATATGGAAG gCS5_F CTGGTAGTTGCACAGAAAGAGTTTTAGAGCTAGAAA TAGCAAG gCS5_R TCTTTCTGTGCAACTACCAGCGATCATTTATCTTTC ACTGCG Conf-CS5-F AATGAATTCTATTATGATAGCGAATGC Conf-CS5-R CACAGGATTTACGAAGACC

TABLE-US-00002 TABLE 2 List of plasmids used in the invention Plasmid Description Reference pRS42H 2? origin EUROSCARF p42H_gHIS3 pRS42H carrying HIS3 disruption gRNA This study cassette pRS426GPD URA3, GPD promoter, CYC1 terminator, 2? (Mumberg et al., origin, and Amp 1995) p426_Bp_W/OSP pRS426GPD harboring BpGH16A from B. This study plebeius, deletion signal peptide p426_Bp_CL pRS426GPD harboring BpGH16A and chicken lysozyme signal peptide This study p426_Bp_?MF pRS426GPD harboring BpGH16A and ?- This study mating factor signal peptide p426_Bp_STA1 pRS426GPD harboring BpGH16A and STA1 This study signal peptide p426_Bp_SED1 pRS426GPD harboring BpGH16A and SED1 This study signal peptide Cas9-NAT p414-TEF1p-Cas9-CYC1t-NAT1 (Zhang et al., 2014) pRS42K 2? origin, KanMX (Taxis & Knop, 2006) p42K_CS5 pRS42K, gRNA cassette targeting the This study intergenic site on Chr XV 16A-D-CS5 BpGH16A, SED1 signal peptide, donor DNA This study for CS5 site integration

TABLE-US-00003 TABLE 3 List of strains used in the invention Strain Description Reference S. boulardii ATCC MYA-796 ATCC SB-TU S. boulardii; TRP1 and URA3 disruption (Liu et al., 2016) SB-HTU S. boulardii; HIS3, TRP 1, and URA3 disruption This study SB-HTU_16A_E SB-HTU; pRS426GPD This study SB-HTU_16A_W SB-HTU; BpGH16A, deletion signal peptide, This study pRS426GPD SB-HTU_16A_C SB-HTU; BpGH16A, chicken lysozyme signal This study peptide, pRS426GPD SB-HTU_16A_A SB-HTU; BpGH16A, a-mating factor signal This study peptide, pRS426GPD SB-HTU_16A_S SB-HTU; BpGH16A, STA1 signal peptide, This study pRS426GPD SB-HTU_16A_D SB-HTU; BpGH16A, SED1 signal peptide, This study pRS426GPD SB_16A_D S. boulardii; BpGH16A, SED1 signal peptide This study

Example 2: Cell Culture Conditions

[0035] To produce neoagarooligosaccharides from the strain Saccharomyces boulardii prepared according to Example 1, 2.5 g/L of agarose was provided as a substrate at a temperature of 37? C. and fermentation was performed at 200 rpm in a 125-mL flask for 72 hours. To prevent coagulation of agarose during fermentation, agarose (Sigma-Aldrich) with a low gelation temperature was used. First, strains SB-HTU_16A_C, SB-HTU_16A_A, SB-HTU_16A_S, and SB-HTU_16A_D were cultured in yeast synthetic complete (YSC) medium at 37? C. and 200 rpm. Pre-cultured cells were centrifuged at 10,170?g for 10 minutes and washed twice with sterile distilled water, and harvested cells were inoculated into 20 mL of YSC medium containing 20 g/L of glucose and 2.5 g/L of agarose in 50 mM KHP buffer (pH 5.5). The initial cell density was inoculated at an optical density 600 nm (OD.sub.600) of 1.0. As a control, fermentation of strains SB-HTU_16A_E and SB-HTU_16A_W was also performed under the same conditions.

Example 3: Method of Quantifying Neoagarooligosaccharides Through Cell Growth Measurement and HPLC Analysis

[0036] Cell growth was measured by measuring OD.sub.600 using a UV-visible spectrophotometer (Bio-Rad, Hercules, CA, USA). HPLC analysis was performed to analyze and quantify the reaction products of Saccharomyces boulardii and agarose, including neoagarotetraose, glucose, acetic acid, and ethanol. The column used during analysis was an Aminex HPX-87H column (Bio-Rad), which was equipped with a refractive index (RI) detector. The column and RI detector temperatures were set at 65? C. and 55? C., respectively, and the column used 0.005 M sulfuric acid as a mobile phase at a flow rate of 0.5 mL/min.

Example 4: Method of Confirming Fermentation Products Through TLC Analysis

[0037] Thin layer chromatography (TLC) analysis was performed to identify the hydrolysis products of agarose during fermentation. For each time point (0, 12, 24, 36, 48, and 72-h) during fermentation, 1 mL of cell culture including fermentation products was obtained. For accurate measurements, the resulting cell culture was boiled to terminate further enzymatic reactions. After centrifugation at 16,609?g for 15 minutes at 4? C., 1 ?L of each supernatant was loaded onto a silica gel 60 plate (Merck, Damstadt, Germany). After drying the TLC plate, it was visualized using a solution of 10% (v/v) sulfuric acid in ethanol and a solution of 0.2% (w/v) naphthoresorcinol in ethanol sequentially (Yun E. J., et al. (2013) Appl Microbiol Biotechnol. 97, 2961-2970).

Example 5: Confirmation of Neoagarotetraose Production Using Saccharomyces boulardii

[0038] In order to produce neoagarotetraose using engineered yeast, secretion of beta-agarose, which enables agarose decomposition, is required in yeast. Therefore, the expression and secretion of endo-type beta-agarase BpGH16A by Saccharomyces boulardii were first tested. For testing, strain SB-HTU_16A_C was used, in which the chicken lysozyme signal peptide (CL), which was previously demonstrated to function in Saccharomyces boulardii (Liu J-J., et al. (2016) Appl Environ Microbiol. 82, 2280-2287), was introduced. In HPLC analysis of a SB-HTU_16A_C fermentation product, a peak was detected at a retention time of 7.6 minutes corresponding to neoagarotetraose (FIG. 2). In contrast, no peak was detected in the product of the control strain SB-HTU_16A_E including an empty vector. Therefore, these results confirmed that BpGH16A is functionally expressed, secreted from Saccharomyces boulardii, and produced neoagarotetraose by hydrolyzing agarose.

Example 6: Selection of Optimal Signal Peptide to Produce Neoagarotetraose

[0039] Since the enzyme BpGH16A was confirmed to be expressed and secreted in Saccharomyces boulardii, the next step was to find the optimal signal peptide to increase neoagarotetraose production. A total of four types of signal peptides: CL, ?-MF, STA1, and SED1 were tested. Each signal peptide was fixed in front of the BpGH16A sequence and introduced into the SB-HTU strain to find the signal peptide that produces the most neoagarotetraose. The production of neoagarotetraose by the engineered yeast was confirmed by TLC analysis after 72 hours of culture (FIG. 3A). As a result, neoagarotetraose was noticeably produced by the strain with CL and SED1, slightly produced by the strain with STA1, and weakly detected in the strain with ?-MF. To accurately compare the amount of neoagarotetraose generated by each engineered yeast, HPLC analysis was performed (FIG. 3B). As a result, neoagarotetraose was found to gradually increase as the 72-hour culture for each strain progressed, and the strain including SED1 produced the largest amount of neoagarotetraose. The amount of neoagarotetraose generated after 72 hours of fermentation was 1.73, 0.95, 0.99, and 1.86 g/L when signal peptides, namely CL, ?-MF, STA1, and SED1, were used, respectively. Therefore, Saccharomyces cerevisiae-derived SED1, which produces the highest amount of neoagarotetraose, was selected as the optimal signal peptide for neoagarotetraose production.

[0040] Although neoagarotetraose was generated in all groups to which the signal peptide was attached, it was not generated in two control groups (FIG. 3). In particular, SB-HTU_16A_W, used as one of the negative controls, is a strain created to confirm that the extracellular activity of BpGH16A is derived from secretion by a heterologously expressed signal peptide rather than cell lysis. Since neoagarotetraose was not detected in the culture fluid of SB-HTU_16A_W, it was confirmed that agarose was decomposed to neoagarotetraose by BpGH16A secreted outside the cells. Since there has been no report on the comparison of signal peptides in Saccharomyces boulardii so far, there is a possibility that the present invention may be used in the field of protein production and secretion by Saccharomyces boulardii.

Example 7: Fermentation to Produce Neoagarotetraose Using Improved Strains

[0041] Based on the signal peptide selection results, strain SB-HTU_16A_D including the SED1 signal peptide was cultured. Fermentation was performed for 72 hours in YSC medium containing 2.5 g/L of agarose and without uracil. Neoagarotetraose production was confirmed by TLC analysis (FIG. 4A). It was confirmed that the initially added glucose was depleted after 36 hours. As a result of analyzing the fermentation products at each time point by HPLC, 1.86 g/L of neoagarotetraose was produced after 72 hours of fermentation (FIG. 4B). Cell growth entered a stationary phase at 24 hours and reached OD.sub.600=6.7 after 72 hours. Both ethanol and acetic acid were accumulated at 4.8 g/L. In conclusion, neoagarotetraose was produced as the target primary product by engineered yeast SB-HTU_16A_D.

Example 8: Strain Production and Fermentation Using CRISPR-Cas9 Technology

[0042] The use of genomic integration technologies, such as the CRISPR-Cas9 system, can avoid problems that may occur in complex intestinal environments when using plasmids. These problems include plasmid instability in the absence of selective pressure, potential spread to other microorganisms, and increased metabolic burden associated with the maintenance of multicopy plasmids (Durmusoglu D., et al. (2020) bioRxiv. 915389). In the present invention, BpGH16A was introduced into the genome of Saccharomyces boulardii along with SED1 for stable expression of the enzyme. BpGH16A gene insertion was performed by CRISPR-Cas9-based homologous recombination (FIG. 5A). Successful insertion of the BpGH16A gene after yeast transformation was confirmed by yeast colony PCR. A primer pair Conf-CS5-F and Conf-CS5-R was designed and used to cover 2.4-kb when the gene was inserted, and 0.5-kb when the gene was not inserted (Table 2). Successful integration of BpGH16A and SED1 into Saccharomyces boulardii was confirmed by the formation of a 2.4-kb single band in lanes 4, 7, and 8 when yeast colony PCR was performed (FIG. 5B).

[0043] Finally, the SB_16A_D strain including BpGH16A and SED1 was constructed in the Saccharomyces boulardii genome using CRISPR-Cas9, and flask fermentation was performed for 72 hours in a YSC medium including 2.5 g/L of agarose. Neoagarotetraose production was confirmed by TLC analysis (FIG. 6A), suggesting that BpGH16A was secreted from strain SB 16A_D. For more accurate fermentation product analysis, HPLC analysis and growth measurements were also performed at each time point (FIG. 6B). Glucose was depleted before 12 hours of incubation, and the strain grew to OD.sub.600=15.51 in 72 hours. After fermentation, 0.80 g/L of neoagarotetraose was produced, and 3.03 g/L of ethanol and 3.65 g/L of acetic acid were accumulated.

[0044] Compared to using a plasmid vector system with an auxotrophic marker, the final OD.sub.600 after 72 hours of fermentation of the strain constructed with the CRISPR-Cas9 system was 2.3 times higher, but neoagarotetraose production was lower. The reason for this difference is estimated to be the relatively strong promoter and high copy number of the pRS426GPD plasmid (Mumberg D., et al. (1995) Gene. 156, 119-122). Nevertheless, the successful protein secretion of Saccharomyces boulardii constructed by genomic integration demonstrated the potential of Saccharomyces boulardii to be used as a microbial cell factory to produce useful proteins and substances in the human intestines.

[0045] The present invention presents a process of preparing a recombinant yeast that can produce neoagarooligosaccharides by decomposing agarose. In other words, it was found that neoagarooligosaccharides can be produced using agarose as a substrate using Saccharomyces boulardii produced through the present invention. This can be utilized to produce useful substances in the intestines, including prebiotics, using Saccharomyces boulardii, which is a probiotic yeast, and to develop recombinant enzymes.