Adeno-associated vectors for enhanced transduction and reduced immunogenicity
10081659 ยท 2018-09-25
Assignee
- The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services (Washington, DC)
- University Of Florida Research Foundation, Inc. (Gainesville, FL)
Inventors
- John A. Chiorini (Dayton, MD)
- Sandra Wainer (Bethesda, MD, US)
- Mavis Agbandje-McKenna (Gainesville, FL)
- Sujata Halder (Gainesville, FL, US)
Cpc classification
A61K48/0008
HUMAN NECESSITIES
A61K48/0075
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
Abstract
A modified adeno-associated virus (AAV) capsid protein comprising at least one non-native amino acid that confers to the modified AAV particles new properties, such as increased transduction efficiency and reduced immunogenicity. These modified AAV proteins and particles are particularly useful for gene therapy and the treatment of various diseases and conditions.
Claims
1. A modified adeno-associated virus (AAV) capsid protein comprising at least one non-native amino acid at a location corresponding to a location in an AAV5 capsid protein selected from the group consisting of L587, M569, Y585, and T571.
2. The modified capsid protein of claim 1, wherein the modified capsid protein is produced by modification of a capsid protein from an AAV virus selected from the group consisting of AAV1, AAV2, AAV3, AAV 3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AVV10, AAV11, AAV12, BAAV, AAAV and AAV VR-942.
3. The modified AAV capsid protein of claim 1, wherein the modified capsid protein is produced by modification of a capsid protein from an AAV that binds sialic acid.
4. The modified AAV capsid protein of claim 1, wherein the modified capsid protein is produced from a native AAV capsid protein comprising an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12.
5. The modified AAV capsid protein of claim 1, wherein the modified capsid protein is produced from a native AAV capsid protein comprising an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6.
6. The modified capsid protein of claim 1, wherein the modified capsid protein comprises a modification of a sialic acid-binding AAV capsid protein, and the one or more amino acid(s) substituted at the amino acid position(s) known to be involved in binding of the capsid protein to a cellular receptor, is/are amino acids that are not present at corresponding locations in sialic acid-binding AAV capsid proteins.
7. The modified capsid protein of claim 1, wherein the modified capsid protein comprises a modification of a non-sialic acid-binding AAV capsid protein, the amino acid(s) being substituted at the amino acid position known to be involved in binding of the capsid protein to a cellular receptor, is/are amino acids that are not present at corresponding locations in non-sialic acid-binding AAV capsid proteins.
8. The modified capsid protein of claim 1, wherein the modified capsid protein comprises at least one non-native amino acid at a location of the capsid protein that interacts with sialic acid.
9. The modified capsid protein of claim 1, wherein the modified capsid protein comprises at least one non-native amino acid in the A-site or the B-site of the modified capsid protein.
10. The modified capsid protein of claim 1, wherein the modified AAV capsid protein comprises an amino acid sequence of a wild type AAV1, AAV4, AAV5 or AAV6 capsid protein.
11. The modified capsid protein of claim 1, wherein the modified AAV capsid protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:38 and SEQ ID NO:41.
12. A method for treating a disease in an individual, the method comprising administering to an individual in need of such treatment a recombinant virus comprising the modified AAV capsid protein of claim 1 and at least one heterologous nucleic acid molecule.
13. The method of claim 12, wherein the virus is administered to a tissue selected from a tissue of the eye, the CNS, the liver, the salivary gland, and a muscle tissue.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(11) The present disclosure provides novel, modified adeno-associated virus (mAAV) capsid proteins and modified AAV (mAAV) virions produce using such proteins. Modified AAV capsid proteins of the invention are produced by introducing mutations into specific locations of a nucleic acid molecule encoding an AAV capsid protein. The locations of the mutations are chosen so that the resulting alterations in the AAV capsid protein amino acid sequence occur in specific locations in the AAV capsid protein, resulting in the modified capsid proteins having phenotypic properties that differ from those of the capsid protein used to produce the modified capsid protein. Consequently, when the modified capsid proteins are used to produce AAV virions, the resulting virions have properties that differ from those observed in AAV virions having un-modified capsid proteins (e.g., wild-type (wt)). Such properties include, for example, altered receptor recognition, altered receptor binding affinity, enhanced transduction efficiency, reduced immunogenicity and reduced binding of the modified AAV virion by neutralizing antibodies. Thus, a general embodiment of the invention can be practiced by producing nucleic acid molecules encoding capsid proteins having an altered amino acid sequence at the specific regions disclosed herein. Another general embodiment of the present invention can be practiced by using such nucleic acid molecules, and/or such modified capsid proteins, to produce mAAVs having novel and advantageous properties.
(12) It will be understood that this invention is not limited to the particular embodiments described herein, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular invention only, and is not intended to be limiting, since the scope of the present invention will be limited only by the claims.
(13) Before embodiments of the invention are described in greater detail, it should be understood that as used herein and in the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. For example, a nucleic acid molecule refers to one or more nucleic acid molecules. As such, the terms a, an, one or more and at least one can be used interchangeably. This statement is intended to serve as antecedent basis for use of such exclusive terminology as solely, only and the like in connection with the recitation of claim elements, or use of a negative limitation. Similarly, the terms comprising, including and having can be used interchangeably.
(14) Unless otherwise specified, the term about, when referring to a measurable value, such as the length of a polypeptide or nucleotide sequence, a dosage, a time, temperature, and the like, unless otherwise specified is meant to encompass variations of 20%, 15%, 10%, 5%, 1%, 0.5%, or even 0.1%, of the specified amount.
(15) The term parvovirus as used herein encompasses the family Parvoviridae, including autonomously replicating parvoviruses and dependoviruses. The autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iteravirus, and Contravirus. Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, H1 parvovirus, muscovy duck parvovirus, B19 virus, and any other autonomous parvovirus now known or later discovered. Other autonomous parvoviruses are known to those skilled in the art. See, e.g., Bernard N. Fields et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
(16) AAV is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or derivatives thereof. Unless otherwise indicated, the term covers all subtypes and both naturally occurring and recombinant forms. The term AAV (and adeno-associated virus), includes but is not limited to, all types of adeno-associated viruses, examples of which include AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (including types 3A and 3B) (AAV3 and AAV3B), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), AAV type 10 (AAV10), AAV type 11 (AAV11), avian AAV (AAAV), bovine AAV BAAV), canine AAV, equine AAV, ovine AAV, Clade F AAV and any other AAV now known or later discovered. See, e.g., Beranrd N. Fields of al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of relatively new AAV serotypes and clades which have been identified (see, e.g., Gao et al. (2004) J. Virology 78:6381-6388; Moris et al. (2004) Virology 33:375-383), are also encompassed herein.
(17) The term vector is used in various embodiments described and the meaning of such term may vary depending on the context in which it is used. The term AAV nucleic acid vector, AAV vector, and the like, refers to nucleic acid molecules comprising inverted terminal repeats (ITR) from an AAV, at least one such ITR comprising cis-acting genetic elements necessary for packaging (i.e., encapsulation) of the AAV nucleic acid vector by AAV capsid proteins. Examples of such cis-acting genetic elements include, but are not limited to, an AAV Rep binding site and a terminal resolution site (trs). In preferred embodiments, such AAV nucleic acid vectors contain all nucleic acid sequences and structures required for packaging within AAV capsid proteins. In some instances, AAV nucleic acid vectors comprise a promoter between the AAV ITRs. In further instances, the AAV nucleic acid vector can comprise a gene or ORF (either native or heterologous) functionally linked to a promoter, both the promoter and the gene or ORF being located between the AAV ITRs. Examples of such vectors are described, for example, in U.S. Pat. No. 8,927,269, which is incorporated herein by reference in its entirety.
(18) An AAV virus, AAV viral particle, AAV viral vector, AAV virion, and the like, refers to a viral particle composed of at least one AAV capsid protein (either wild-type or modified) and an encapsidated AAV nucleic acid vector. If the AAV nucleic acid vector is recombinant (e.g., comprises a heterologous polynucleotide or a genetically engineered AAV nucleic acid molecule), the particle carrying such recombinant AAV nucleic acid vector can be referred to as an rAAV particle, rAAV virion, rAAV vector particle or simply an rAAV vector. Thus, production of rAAV particle necessarily includes production of recombinant AAV nucleic acid vector. AAV virions made using modified capsid proteins of the present invention can be referred to as modified AAV virions.
(19) The term polynucleotide refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or combinations and analogs thereof. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
(20) As used herein, the terms isolated, isolating, purified, and the like, do not necessarily refer to the degree of purity of a cell or molecule of the present invention. Such terms instead refer to cells or molecules that have been separated from their natural milieu or from components of the environment in which they are produced. For example, a naturally occurring cell or molecule (e.g., a DNA molecule, a protein, etc.) present in a living animal, including humans, is not isolated. However, the same cell, or molecule, separated from some or all of the coexisting materials in the animal, is considered isolated. As a further example, according to the present invention, protein molecules that are present in a sample of blood obtained from an individual would be considered isolated. It should be appreciated that protein molecules obtained from such a blood sample using further purification steps would also be referred to as isolated, in accordance with the notion that isolated does not refer to the degree of purity of the protein. For example, depending on the intended use, an isolated protein may be enriched by at least 10-fold, 100-fold, 1,000-fold, 10,000-fold, or more, as compared with the starting material.
(21) It is to be appreciated that certain features of the invention, which are, for clarity, described in the context of separate invention, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein. Moreover, as used herein, the term and/or refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations, when interpreted in the alternative (e.g., or).
(22) It is to be further understood that the publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and materials for which the publications are cited.
(23) The present invention is based on the inventors surprising discovery that modification of specific amino acid sequences of AAV capsid protein can alter the properties of the capsid protein. Moreover, the inventors have further discovered that AAV particles comprising such modified capsid proteins, have altered, often beneficial, properties such as increased or reduced transduction efficiencies and increased resistance to binding by a neutralizing antibody. Thus, one embodiment of the present invention is a modified adeno-associated virus (AAV) capsid protein comprising at least one non-native amino acid at an amino acid sequence location known to be involved in binding of the capsid protein to a cell receptor.
(24) An AAV capsid protein (also referred to as an AAV coat protein) is an AAV protein capable of encapsulating an AAV nucleic acid vector, thereby forming an AAV virion. AAV capsid proteins are known to those skilled in the art and the sequences of such capsid proteins can be found in the scientific literature or in publicly available databases such as the National Institutes of Health (NIH) Protein Databank (PDB), the NIH GenBank Database and UniProtKB/Swis-Prot. Examples of useful AAV capsid proteins include AF063497.1 (AAV1), AF043303.1 (AAV2), U48704.1 (AAV3), AF028705.1 (AAV3B), U89790.1 (AAV4), AF085716.1 (AAV5), AF028704.1 (AAV6), AAS99264 (AAV9), ABI6639 (AAV12), EU285562 (AAV13; VR-942), NC_004828 (AAAV), AY388617 (BAAV), NC_006260 (AAV7) and PDB:3RAA_A (AAV8). Examples of AAV capsid protein amino acid sequences useful for creating modified capsid proteins of the present invention include SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:3B, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 SEQ ID NO:46 and SEQ ID NO:47. These sequences are described in the Table below.
(25) TABLE-US-00001 SEQ ID NO: Molecule Notes 1 Amino acid sequence of wild-type AAV1 capsid protein AF063497.1 2 Amino acid sequence of wild-type AAV2 capsid protein AF043303.1 3 Amino acid sequence of wild-type AAV3 capsid protein U48704.1 4 Amino acid sequence of wild-type AAV3B capsid protein AF028705.1 5 Amino acid sequence of wild-type AAV4 capsid protein U89790.1 6 Amino acid sequence of wild-type AAV5 capsid protein AF085716.1 7 Amino acid sequence of wild-type AAV6 capsid protein AF028704.1 8 Amino acid sequence of wild-type AAV9 capsid protein AAS99264 9 Amino acid sequence of wild-type AAV12 capsid protein ABI16639 10 Amino acid sequence of wild-type AAV VR-942 capsid protein EU285562 11 Amino acid sequence of wild-type AAAV capsid protein NC_004828 12 Amino acid sequence of wild-type BAAV capsid protein AY388617 13 Nucleotide sequence of modified capsid protein M569V AAV5-A site mutant 14 Amino acid sequence encoded by SEQ ID NO: 13 15 Complement of 13 16 Nucleotide sequence of modified capsid protein Y585V AAV5-A site mutant 17 Amino acid sequence encoded by SEQ ID NO: 16 18 Complement of 16 19 Nucleotide sequence of modified capsid protein L587T AAV5-A site mutant 20 Amino acid sequence encoded by SEQ ID NO: 19 21 Complement of 19 22 Nucleotide sequence of modified capsid protein Y585V/L587T AAV5-A site mutant 23 Amino acid sequence encoded by SEQ ID NO: 22 24 Complement of 22 25 Nucleotide sequence of modified capsid protein D652A AAV5-B site mutant 26 Amino acid sequence encoded by SEQ ID NO: 25 27 Complement of 25 28 Nucleotide sequence of modified capsid protein T362M AAV5-B site mutant 29 Amino acid sequence encoded by SEQ ID NO: 28 30 Complement of 28 31 Nucleotide sequence of modified capsid protein Q359D AAV5-B site mutant 32 Amino acid sequence encoded by SEQ ID NO: 31 33 Complement of 31 34 Nucleotide sequence of modified capsid protein E350Q AAV5-B site mutant 35 Amino acid sequence encoded by SEQ ID NO: 34 36 Complement of 34 37 Nucleotide sequence of modified capsid protein P533S AAV5-B site mutant 38 Amino acid sequence encoded by SEQ ID NO: 37 39 Complement of 37 40 Nucleotide sequence of modified capsid protein P533G AAV5-B site mutant 41 Amino acid sequence encoded by SEQ ID NO: 40 42 Complement of 40 43 Nucleotide sequence of modified capsid protein loop VII AAV5-mutation in loop VII 44 Amino acid sequence encoded by SEQ ID NO: 43 45 Complement of 40 46 Amino acid sequence of wild-type AAV7 capsid protein NC_006260 47 Amino acid sequence of wild-type AAV8 capsid protein PDB:3RAA_A
(26) As used herein, a modified AAV capsid protein is an AAV capsid protein in which one or more sequence locations in an AAV capsid protein have been altered relative to the corresponding sequence location(s) in a native capsid protein from the same type of AAV. According to the present invention, a native capsid protein is defined based on comparison with the amino acid sequence of a capsid protein from an AAV found in nature (i.e., wt AAV capsid sequence). One example of a wt AAV capsid protein is represented by SEQ ID NO: 6 (AAV5 capsid protein). In particular, a native AAV capsid protein is any AAV capsid protein having an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt capsid protein, wherein the amino acid residue present in at least one location being altered in the native protein, is the same type of amino acid present at the corresponding location in the wild-type AAV capsid protein. Examples of representative, wild-type AAV capsid proteins include SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:3B, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 SEQ ID NO:46 and SEQ ID NO:47. From this definition, it should be clear to one skilled in the art that a native AAV capsid protein and a wt AVV capsid protein, can, but need not, be identical over their entire sequences. The following example, which is simply for clarification purposes and is not meant to limit the claimed invention, will further illustrate what is meant by native and modified AAV5 capsid proteins. To create a modified AAV5 capsid protein having a modification at amino acid position 277 of the AAV5 capsid protein, one skilled in the art could start with a native, AAV5 capsid protein, the sequence of which is represented by SEQ ID NO:6. The amino acid at position 277 of SEQ ID NO:6 is an arginine. Thus, in this example, a native AAV5 capsid protein is any AAV capsid protein comprising an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to SEQ ID NO:6, wherein the amino acid at position 277 is an arginine. Alteration of the arginine at position 277 of the native AAV5 capsid protein, with any amino acid other than arginine, result in the creation of a modified AAV5 capsid protein. It should be understood that if alterations are to be made at multiple locations of the AAV5 capsid protein, the starting protein (which is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of an AAV5 protein such as SEQ ID NO:6) need only have the same type of amino acid as the wt AAV5 capsid protein sequence at a single corresponding location to be altered, in order to be considered a native AAV 5 capsid. For example, if one skilled in the art intends to alter positions 287 and 587 of an AAV5 capsid protein, the staring (native) protein need only have the same type amino acid as the wt AAV5 capsid protein (e.g., SEQ ID NO:6) at one position (i.e., either position 277 or position 587). Examples of modified AAV5 capsid protein are represented by SEQ ID NOs: 17, 20 and 41, which have been modified at positions 585, 587 and 533, respectively, relative to wt AAV5 capsid protein (e.g., SEQ ID NO:6).
(27) As used herein, a native amino acid is an amino acid found at a specified location in a native, AAV capsid protein. It should be understood that, native amino acid residues will usually be identified by their position relative to the amino acid sequence of a native AAV capsid protein. For example, using SEQ ID NO:6 as the sequence of a native AAV5 capsid protein, the native amino acid at position 277 is arginine. Accordingly, as used herein, a non-native amino acid is any amino acid other than the native amino acid found at a specified location in a native AAV capsid protein. Thus, continuing with the example above, if the AAV5 capsid protein were modified by replacing the arginine at position 277 with, for example, an alanine, then the alanine would be considered a non-native amino acid.
(28) Amino acid sequence alterations suitable for producing modified AAV capsid proteins of the present invention include substitutions, insertions or deletions of one of more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) amino acid residues at a designated location. As used herein, the terms alterations, changes, modifications, mutations, and the like, can be used interchangeably. In a preferred embodiment, the amino acid sequence alterations are intentional alterations. According to the present invention, the term intentional alterations, intentionally altered, and the like, refer to changes to the capsid protein amino acid sequences created by the hand of man. Such changes can be targeted changes, meaning the altered locations were deliberately chosen, or they may random changes, meaning that the modified capsid protein was created using techniques (e.g., mismatch PCR, mutagenic chemicals) known to result in alterations of amino acid sequences. Such mutagenic techniques are known to those skilled in the art.
(29) As noted above, intentional alterations include substitutions, deletions and insertions at specific locations in an AAV capsid protein. While any type of intentional alteration in sequence can be used to practice the present invention, a preferred intentional alteration is a substitution mutation. Thus, in one embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more, amino acids can be substituted into specific amino acid positions to create the modified protein. In one embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more, amino acids are substituted with the corresponding 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more, amino acids from a capsid protein from the same, or different, type of AAV. A preferred alteration to make is a substitution mutation in which a single amino acid in the native AAV capsid protein, the native amino acid being known to interact with a cell receptor, is replaced with a non-native amino acid. It should be understood that modified proteins of the present invention can comprise one or more of such single, substitution mutations.
(30) A preferred location at which to alter the sequence of an AAV capsid protein is at an amino acid location in the native protein known to be involved in binding of the capsid protein to a receptor protein. As has been described previously, many viruses use utilize various carbohydrates as initial cell attachment receptors. The carbohydrate moieties mediating these interactions are modified proteins or lipids in the form of glycoproteins and glycosphingolipids, respectively, or they exist as glycosaminoglycan (GAG) chains attached to proteins in the form of proteoglycans. Side chains on specific amino acids of the AAV capsid protein interact with atoms located on the carbohydrate portion of the receptor, resulting in binding of the AAV to the cell. Viruses in the genus Dependoparvoviruses, which includes AAVs, use a diverse group of cell surface carbohydrates for attachment, entry, and cellular transduction. For example, AAV2, AAV3B, AAV6, and AAV13 bind to heparin sulfate proteoglycans (HSPGs), whereas AAV1, AAV4, AAV5, and AAV6 all use different forms of sialic acid (SIA). While both AAV4 and AAV5 require the 2-3 form of SIA, AAV4 preferentially attached to an 2-3 SIA present on an O-linked carbohydrate core, whereas AAV5 preferentially to the N-linked carbohydrate). AAV1 and AAV6 both use either 2,3-linked or 2,6-linked SIA when transducing numerous cell types and the use of SIA supersedes the use of HS in controlling AAV6 transduction. Similarly, an AAV isolate found as a contaminate in a stock of bovine adenovirus (BAAV) also requires cell surface SIA for transduction and internalization. However, the terminal SIA groups must be linked to a glycoshingolipid core of a ganglioside. While the AAV capsid protein used to create a modified AAV capsid protein can be from any AAV, preferred capsid proteins to use are those from sialic acid-binding AAVs. Thus, in one embodiment, the modified capsid protein is made using a native capsid protein from an AAV that binds sialic acid. In one embodiment, the modified capsid protein is made using a native capsid protein from AAV1, AAV4, AAV5 or AAV6. In one embodiment, the modified capsid protein is made using a native capsid protein comprising an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, wherein the type amino acid present in at least one location being modified in the native protein is the same as the type of amino acid present at the corresponding location in the wt AAV capsid protein. In one embodiment, the modified capsid protein is made using a native capsid protein comprising an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.
(31) In one embodiment, modification of the amino acid sequence of an AAV capsid protein is made in the A-site or the B-site of a capsid protein from a sialic acid-binding AAV. As described herein, the A-site and B-site are structurally mapped regions of positive electron density located at the threefold axis and underneath the H1 loop, respectively. Thus, in one embodiment, one or more modifications are made in the A-site of an AAV capsid protein. Any location within the A-site can be altered to create a modified AAV capsid protein of the invention. Preferred locations at which to alter the amino acid sequence are those amino acids in the A-site known to interact (e.g., ionically bond) with the cell receptor. Particularly preferred locations at which to modify the amino acid sequence are those amino acids in the A-site known to interact with sialic acid. In a further embodiment, modifications are made at a location corresponding to an AAV5 capsid protein location selected from the group consisting of M569, A570, T571, G583, T584, Y585, N586 and L587.
(32) In one embodiment, one or more alterations are made in the B-site of an AAV capsid protein. Any location within the B-site can be altered to create a modified AAV capsid protein of the invention. Preferred locations at which to alter the amino acid sequence are those amino acids in the B-site known to interact with the cell receptor. Particularly preferred locations at which to alter the amino acid sequence are those amino acids in the B-site known to interact with sialic acid. In a further embodiment, alterations are made at a location corresponding to an AAV5 capsid protein location selected from the group consisting of R277, H279, S280, E350, G351, C352, L353, P354, Q359, F361, T362, P553, F650, S651, D652, F529, N530, S531, L548, Q604 and T711.
(33) In a further embodiment, modifications are made at a location corresponding to loop VII of an AAV5 capsid protein. Such modifications can comprise a single sequence modification in loop VII or more than one sequence modifications. In one embodiment, the entire sequence of loop VII is replaced.
(34) While any non-native amino acid can be substituted into a native, sialic acid-biding, AAV capsid protein to produce a modified AAV capsid protein of the present invention, in preferred embodiments, the non-native amino acids are limited to a specific subset of amino acids, the composition of which is dependent on the position of the amino acid being altered. Specifically, preferred non-native amino acids to substitute into the native, sialic acid-binding AAV capsid protein are amino acids that are not present in corresponding locations in non-sialic acid-binding AAV capsid proteins. For example, to make a modified AAV5 capsid protein which is modified at position 587, the first thing to note is that position 587 of the AAV5 capsid protein contains a leucine. Thus, to make a modified AAV5 capsid protein modified at position 587, the leucine at that position could be substituted at with any amino acid other than leucine, as long as the amino acid replacing the leucine is not present at the corresponding location in a non-sialic acid-binding AAV capsid protein. Thus, to determine which amino acids can be used, a person skilled in the art only need to look at the amino acids present at the position corresponding to amino acid 587 in capsid proteins of non-sialic binding AAVs. Any amino acid present at such location would not be used to create the modified capsid protein. To further illustrate this aspect of the invention,
(35) In one embodiment, a modified AAV capsid protein of the present invention comprises an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein comprises at least one alteration at a location known to interact with a cell receptor. In one embodiment, a modified AAV capsid protein of the present invention comprises an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein has at least one intentional alteration at a location known to interact with sialic acid. In one embodiment, a modified AAV capsid protein of the present invention comprises an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein has at least one intentional alteration in the A-site or the B-site. In one embodiment, a modified AAV capsid protein of the present invention comprises an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein comprises at least one intentional alteration at a location corresponding to a location in the AAV5 capsid protein selected from the group consisting of R277, H279, S280, E350, G351, C352, L353, P354, Q359, F361, T362, P553, F650, S651, D652, F529, N530, S531, L548, Q604, T711 and loop VII. In one embodiment, a modified AAV capsid protein of the present invention comprises an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV1, AAV4, AAV5 or AAV6 capsid protein, wherein the modified capsid protein has at least one intentional alteration at a location corresponding to a location in the AAV5 capsid protein selected from the group consisting of R277, H279, S280, E350, G351, C352, L353, P354, Q359, F361, T362, P553, F650, S651, D652, F529, N530, S531, L548, Q604, T711 and loop VII. In one embodiment, a modified capsid protein of the present invention comprises an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO: 6 or SEQ ID NO:7, wherein the modified capsid protein comprises at least one non-native amino acid at a location corresponding to a location in the AAV5 capsid protein selected from the group consisting of R277, H279, S280, E350, G351, C352, L353, P354, Q359, F361, T362, P553, F650, S651, D652, F529, N530, S531, L548, Q604, T711 and loop VII. In one embodiment, a modified capsid protein of the present invention comprises an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to a sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:41 and SEQ ID NO:44, wherein the modified capsid protein has a non-native amino acid in at least one location corresponding to a location in the AAV5 capsid protein selected from the group consisting of R277, H279, S280, E350, G351, C352, L353, P354, Q359, F361, T362, P553, F650, S651, D652, F529, N530, S531, L548, Q604, T711 and loop VII. In one embodiment, a modified capsid protein of the present invention comprises an amino acid sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:41 and SEQ ID NO:44.
(36) Modified capsid proteins of the present invention are encoded by nucleic acid molecules of the present invention. In addition, modified capsid proteins are expressed by nucleic acid constructs of the present invention. Thus, such nucleic acid molecules and sequences are useful for producing modified AAV virions, as described below. Nucleic acid molecules include, but are not limited to, nucleic acid vectors and nucleic acid expression vectors (both of which can be referred to as nucleic acid constructs). As used herein, a nucleic acid vector refers to a nucleic acid molecule comprising a nucleic acid molecule of the present invention, such as a nucleic acid molecule encoding a wt or modified AAV capsid protein. Such vectors are useful for producing, for example, ORFs encoding capsid proteins of the present invention. A recombinant expression vector refers to a nucleic acid molecule encoding a protein, wherein the nucleic acid molecule can express the encoded protein. Examples of both such vectors include plasmids, nucleic acid viral vectors and viral genomes (including both DNA and RNA genomes). Such vectors can be used to transport the nucleic acid molecules of the invention into a cell within an environment, such as, but not limited to, an organism, tissue, or cell culture. Nucleic acid construct of the present disclosure are produced by the hand of man. A nucleic acid molecule of the present invention can be DNA, RNA or variants thereof. Methods for the construction of nucleic acid constructs of the present disclosure are well known. See, for example, Molecular Cloning: a Laboratory Manual, 3rd edition, Sambrook et al. 2001 Cold Spring Harbor Laboratory Press, and Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley & Sons, 1994.
(37) In one embodiment, a nucleic acid molecule of the present invention comprises a nucleic acid sequence encoding a modified AAV capsid protein of the present invention. A nucleic acid molecule can be produced recombinantly, synthetically, or by a combination of recombinant and synthetic procedures. A nucleic acid molecule of the disclosure can have a wild-type nucleic acid sequence or a codon-modified nucleic acid sequence to, for example, incorporate codons better recognized by the human translation system. In one embodiment, a nucleic acid molecule can be genetically-engineered to introduce, or eliminate, codons encoding different amino acids, such as to introduce codons that encode an N-linked glycosylation site. It is to be appreciated that a nucleic acid construct can comprise one nucleic acid molecule or more than one nucleic acid molecule. It is also to be appreciated that a nucleic acid molecule can encode one protein or more than one protein.
(38) Preferred nucleic acid molecules are those that encode a modified AAV capsid protein of the present invention. Thus, one embodiment of the present invention is a nucleic acid molecule comprising a nucleic acid sequence encoding a modified AAV capsid protein comprising at least one non-native amino acid residue in an amino acid sequence known to be involved in binding of the capsid protein to a cell receptor. In one embodiment, a nucleic acid molecule of the invention comprises a nucleic acid sequence encoding one or more of AAV capsid proteins, wherein the nucleic acid sequence has been altered such that the one or more encoded AAV capsid protein(s) comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more sequence alterations. Such sequence alterations include insertion mutations, deletion mutations and substitution. A preferred alteration to make is a substitution mutation. Thus, in one embodiment, a nucleic acid molecule of the invention comprises a nucleic acid sequence encoding one or more AAAV capsid proteins, wherein the nucleic acid sequence has been altered such that the encoded one or more AAV capsid proteins comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acid substitutions compared to a native AAV capsid protein.
(39) In one embodiment, a nucleic acid molecule of the present inventions comprises a nucleic aid sequence encoding a modified AAV capsid protein of the present invention comprising an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein comprises at least one intentional alteration at a location known to interact with a cell receptor. In one embodiment, a nucleic acid molecule of the present invention comprises a nucleic aid sequence encoding a modified AAV capsid protein of the present invention comprising an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein comprises at least one intentional alteration at a location known to interact with sialic acid. In one embodiment, a nucleic acid molecule of the present inventions comprises a nucleic aid sequence encoding a modified AAV capsid protein of the present invention comprising an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein comprises at least one intentional alteration in the A-site or the B-site. In one embodiment, a nucleic acid molecule of the present inventions comprises a nucleic aid sequence encoding a modified AAV capsid protein of the present invention comprising an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein comprises at least one intentional alteration in a location corresponding to a location in an AAV5 capsid protein selected from the group consisting of R277, H279, S280, E350, G351, C352, L353, P354, Q359, F361, T362, P553, F650, S651, D652, F529, N530, S531, L548, Q604, T711 and loop VII. In one embodiment, a nucleic acid molecule of the present inventions comprises a nucleic aid sequence encoding a modified AAV capsid protein of the present invention comprising an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to the amino acid sequence of a wt AAV capsid protein, wherein the modified capsid protein comprises at least one alteration in a location corresponding to a location in the AAV5 capsid protein selected from the group consisting of R277, H279, S280, E350, G351, C352, L353, P354, Q359, F361, T362, P553, F650, S651, D652, F529, N530, S531, L548, Q604, T711 and loop VII. In one embodiment, a nucleic acid molecule of the present inventions comprises a nucleic aid sequence encoding a modified capsid protein of the present invention comprises an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO: 6 or SEQ ID NO:7, wherein the modified capsid protein comprises at least one intentional alteration in a location corresponding to a location in the AAV5 capsid protein selected from the group consisting of R277, H279, S280, E350, G351, C352, L353, P354, Q359, F361, T362, P553, F650, S651, D652, F529, N530, S531, L548, Q604, T711 and loop VII. In one embodiment, a nucleic acid molecule of the present inventions comprises a nucleic aid sequence encoding a modified capsid protein of the present invention comprising an amino acid sequence at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical or at least 97% identical to a sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:41 and SEQ ID NO:44, wherein the variations in the amino acid sequence are at locations other than the location which was altered. In one embodiment, a nucleic acid molecule of the present inventions comprises a nucleic aid sequence encoding a modified capsid protein of the present invention comprising an amino acid sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:26, SEQ ID NO:29, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:41 and SEQ ID NO:44.
(40) One embodiment of the present invention is a nucleic acid molecule at least 90% identical, at least 95% identical, or at least 97% identical to a sequence selected from the group consisting of SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:37, SEQ ID NO:40 and SEQ ID NO:43, wherein the variations in nucleotide sequence are in locations other than the codons encoding amino acids at locations being altered. One embodiment of the present invention is a nucleic acid molecule comprising a nucleic acid sequence at least 90% identical, at least 95% identical, or at least 97% identical to a sequence selected from the group consisting of SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:37, SEQ ID NO:40 and SEQ ID NO:43. One embodiment of the present invention is a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:13, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:37, SEQ ID NO:40 and SEQ ID NO:43.
(41) The present invention also encompasses expression systems for producing modified AAV capsid proteins of the present invention. In one embodiment, nucleic acid molecules of the present invention are operationally linked to a promoter. As used herein, operationally linked means that proteins encoded by the linked nucleic acid molecules can be expressed when the linked promoter is activated. Promoters useful for practicing the present invention are known to those skilled in the art. One embodiment of the present invention is a recombinant cell comprising a nucleic acid molecule of the present invention. One embodiment of the present invention is a recombinant virus comprising a nucleic acid molecule of the present invention.
(42) As discussed above, the inventors have discovered that altering the amino acid sequence at specific locations of an AAV capsid protein can alter the properties of the capsid protein. Further, by virtue of possessing one or more modified capsid proteins of the present invention, AAV virions exhibit altered properties compared to the properties of an AAV virion possessing capsid proteins lacking the herein described modifications (e.g., wt AAV virions). According to the present invention, AAV virions, AAV viruses, AAV capsids, and the like, can be used interchangeably, although in some instances AAV capsids may refer to capsids that lack genetic material. Moreover, AAV virions comprising modified AAV capsid proteins of the invention are referred to as modified AAV (mAAV) virions. The present invention encompasses modified AAV virions comprising one or more modified capsid proteins of the present invention. That is, a modified AAV virion can comprise modified capsid proteins from single type of AVV (e.g., AAV5) or more than one type of AAV (e.g., AAV 4 and AAV5).
(43) As noted previously, modified AAV virions of the invention have altered properties, such as, for example, increased or decreased cell transduction efficiency, altered receptor binding, altered affinity for a cell type, reduced immunogenicity and reduced binding by neutralizing antibodies. The properties of modified AAV virions of the present invention are compared to a corresponding parental AAV. As used herein, a parental AAV refers to an AAV comprising capsid proteins of the same type of AAV (e.g., AAV4) used to produce the modified AAV capsid protein. For example, the properties of a modified AAV comprising a modified AAV5 capsid protein would be compared to an AAV having a wt, or native, AAV5 capsid protein.
(44) As used herein, transduction efficiency refers to the number of AAV virions being delivered to the cytoplasm of a cell compared to a control virus, such as, for example, a wild-type virus of the same AAV type (e.g., AAV5). Thus, an AAV virion having increased transduction efficiency is able to deliver a larger number of virions to the cytoplasm of a cell compared to a control virus, such as a wild-type AAV. One skilled in the art will understand that AAVs having a higher transduction will result in a larger number of molecules such viruses are carrying (e.g., heterogeneous protein or nucleic acid molecule). In one embodiment, a modified AAV virion of the invention has a transduction efficiency at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500% greater than the transduction efficiency of a parental AAV virion. In one embodiment, a modified AAV virion of the invention has a transduction efficiency at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, higher than the transduction efficiency of a parental AAV. In one embodiment, a modified AAV virion of the invention has a transduction efficiency at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500% less than the transduction efficiency of a parental AAV. In one embodiment, a modified AAV virion of the invention has a transduction efficiency at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, lower than the transduction efficiency of a parental AAV. The increased or decreased transduction efficiency can be in cells in culture and/or in vivo (e.g., in a body).
(45) Modified AAV virions of the invention can also have altered affinity i.e., increased or decreased) for receptors present on the surface of cells. As used herein, affinity refers to the strength of the binding interaction between a capsid protein, modified capsid protein, AAV virion or modified AAV and another molecule such as, for example, a cell receptor or a carbohydrate molecule. Thus, modified capsid proteins and modified AAV virions can have increased or decreased affinity for specific cellular receptors. Methods of determining binding affinity are known to those skilled in the art. Moreover, because different parts of cellular receptors interact with different amino acid residues in the capsid protein, different alterations to the sequence may affect some receptor interactions but not others. Thus, alterations to the sequence may alter the preference of a capsid protein for a receptor. That is, modified capsid proteins, and modified AAV virions, may preferentially bind a receptor other than the receptor preferentially bound by the parental capsid protein or AAV virion. As used herein, preferential binding of a receptor means the capsid protein, of AAV virion, including n=modified versions thereof), bind a receptor with an affinity that is higher than the affinity of the capsid protein, or AAV virion, to a different receptor. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of receptor is increased by at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500%, compared to the affinity of a parental AAV virion for the same type of receptor. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of receptor is at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, higher than the affinity of a parental AAV for the same type of receptor. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of receptor is decreased by at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500%, compared to the affinity of a parental AAV virion for the same type of receptor. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of receptor is at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, lower than the affinity of a parental AAV for the same type of receptor.
(46) As has been discussed, binding of AAV virions to cellular receptors is known to involve carbohydrates present on cellular receptors. Thus, in one embodiment, a modified AAV virion of the invention has an altered carbohydrate affinity. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of carbohydrate is increased by at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500%, compared to the affinity of a parental AAV virion for the same type of carbohydrate. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of carbohydrate is at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, higher than the affinity of a parental AAV for the same type of carbohydrate. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of carbohydrate is decreased by at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500%, compared to the affinity of a parental AAV virion for the same type of carbohydrate. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of carbohydrate is at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, lower than the affinity of a parental AAV for the same type of carbohydrate.
(47) A specific type of carbohydrate used by some AAVS is sialic acid. In various embodiments, alterations of the capsid sequence can alter the affinity of a modified capsid protein, or a modified AAV, for sialic acid. In one embodiment, the affinity of a modified AAV virion of the invention for a specific sialic acid is increased by at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500%, compared to the affinity of a parental AAV virion for the same type of sialic acid. In one embodiment, the affinity of a modified AAV virion of the invention for a specific sialic acid is at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, higher than the affinity of a parental AAV for the same type of sialic acid. In one embodiment, the affinity of a modified AAV virion of the invention for a specific sialic acid is decreased by at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500%, compared to the affinity of a parental AAV virion for the same type of sialic acid. In one embodiment, the affinity of a modified AAV virion of the invention for a specific sialic acid is at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, lower than the affinity of a parental AAV for the same type of sialic acid.
(48) Because the expression of receptors may be more abundant, or be increased or decreased, on specific cell types, modified AAVs can have altered affinity for specific types of cells. For example, a modified AAV virion can have an increased or decreased specificity for cells. Examples of such cells include, but are not limited to, lung cells, liver cells, brain cells, capillary epithelial cells, salivary gland cells, muscle cells, cells of the eye including retinal pigment epithelium cells, and tumor cells. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of cell is increased by at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500%, compared to the affinity of a parental AAV virion for the same type of cell. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of cell is increased by at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, higher than the transduction efficiency of a parental AAV for the same type of cell. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of cell is increased by at least 30%, at least 35%, at least 40%, at least about 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, at least 175% at least 200%, at least 250%, at least 300%, at least 350%, at least 400% or at least 500%, compared to the affinity of a parental AAV virion for the same type of cell. In one embodiment, the affinity of a modified AAV virion of the invention for a specific type of cell is increased by at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 50 fold, at least 75-fold, or at least 100-fold or more, lower than the transduction efficiency of a parental AAV for the same type of cell. In one embodiment, the cell type is selected from the group consisting of lung cells, liver cells, brain cells, capillary endothelial cells, salivary gland cells, muscle cells, cells of the eye, and tumor cells. Exemplary cell types from these tissues include hepatocytes, kupffer cells, and endothelial cells in the liver; neurons, astrocytes, oligodendrocytes, and microglia in the CNS; macrophages, epithelial, alveolar and bronchial ductal cells in the lung; and retinal pigment epithelium cells in the eye.
(49) The inventors have also discovered that alteration of the capsid protein of an AAV alters the antigenic profile of the virus. Specifically, mutations at particular locations in the virus capsid results in a modified AAV having an increased resistance to neutralizing antibody compared to the ability of a parental virus to be neutralized by the same antibody. In one embodiment, a modified AAV of the invention has at least a 2-fold, at least a 3-fold, at least a 4-fold, at least a 5-fold, at least a 6-fold, at least an 8-fold, at least a 10-fold, at least a 20-fold, at least a 50-fold, at least a 100-fold, at least a 500-fold, or at least a 1000-fold greater resistance to neutralization compared to a parental AAV (or wt AAV). For example, according to the present invention, a 2-fold higher resistance to neutralization refers to a virus that is able to infect, or transduce, a cell at twice the level of a parental, or wt, virus, when the both viruses are incubated with the same amount of the same neutralizing antibody. Methods of measuring neutralization are known to those skilled in the art and are also disclosed herein.
(50) Due to their unique properties, modified AAVs of the invention are useful for practicing gene therapy (i.e., delivery of heterologous nucleic acid molecules to a cell.) For example, modified AAVs can carry AAV nucleic acid vectors of the invention. As has been described, such molecules comprise all the required cis-acting molecules necessary for packaging of the AAV nucleic acid vector. Thus, any heterologous nucleic acid molecules associated with the AAV nucleic acid vector will also be packaged. Thus, one embodiment of the present invention is a modified AAV virion comprising an AAV nucleic acid vector. One embodiment of the present invention is a modified AAV virion comprising a heterologous nucleic acid molecule. As used herein, heterologous nucleic acid molecules are nucleic acid molecules from an organism unrelated to AAVs. Those skilled in the art are able to determine if an organism is unrelated to an AAV. One embodiment of the present invention is a modified AAV virion comprising an AAV nucleic acid vector that comprises a heterologous nucleic acid molecule. In one embodiment, the heterologous nucleic acid is operably linked to a promoter. The heterologous nucleic acid molecule can be any nucleic acid molecule capable of achieving a desired purpose for which the nucleic acid constructs and modified AAV are being designed. For example, the heterologous nucleic acid molecule can encode a therapeutic agent. As used herein, a therapeutic agent is a molecule (e.g., protein), the intended use of which is to treat or eliminate a disease or condition in an individual. For example, a mAAV of the present invention comprising an AAV nucleic acid vector encoding a therapeutic agent can be used for treating a condition arising from a missing or mutated gene. In an alternative example, a mAAV of the present invention comprising an AAV nucleic acid vector encoding a therapeutic agent can be used for treating cancer. One example of a therapeutic agent is functional copy of a protein to be delivered to an individual lacking functional copies of the protein. Examples of such proteins include, but are not limited to, immunoregulatory proteins (e.g., cytokines), transcription factors, structural proteins (e.g., sodium channels), hormones, suicide molecules (e.g., ricin) and the like. Therapeutic agents include therapeutic RNAs such as, for example, anti-sense RNA, siRNA, RNAi, and the like.
(51) The present invention also encompasses methods of making modified AAVs of the invention. One embodiment of the present invention is a method of producing a mAAV of the invention, the method comprising providing to a cell: (a) an AAV nucleic acid vector comprising at least one ITR sequence, and (b) AAV sequences sufficient for replication of the nucleic acid template and encapsidation into modified AAV capsids (e.g., AAV rep sequences and AAV cap sequences encoding the AAV Rep and capsid proteins). In one embodiment, the AAV nucleic acid vector further comprises at least one heterologous nucleic acid sequence. In particular embodiments, the AAV nucleic acid vector comprises two AAV ITR sequences, which are located 5 and 3 to the heterologous nucleic acid sequence (if present), although they need not be directly contiguous thereto. The AAV nucleic acid vector and AAV rep and cap sequences are provided under conditions such that virus vector comprising the nucleic acid template packaged within the AAV capsid is produced in the cell. The method can further comprise the step of collecting the virus vector from the cell. The virus vector can be collected from the medium and/or by lysing the cells. The cell can be a cell that is permissive for AAV viral replication. Any suitable cell known in the art may be employed. In particular embodiments, the cell is a mammalian cell. As another option, the cell can be a trans-complementing packaging cell line that provides functions deleted from a replication-defective helper virus. e.g., 293 cells or other E1a trans-complementing cells.
(52) The AAV replication and capsid sequences may be provided by any method known in the art. Current protocols typically express the AAV rep/cap genes on a single plasmid. However, the AAV replication and packaging sequences need not be provided together, although it may be convenient to do so. The AAV rep and/or cap sequences may be provided by any viral or non-viral vector. As a further alternative, the rep/cap sequences may be stab incorporated into a cell.
(53) To enhance virus titers, helper virus functions (e.g., adenovirus or herpesvirus) that promote a productive AAV infection can be provided to the cell. Helper virus sequences necessary for AAV replication are known in the art. Typically, these sequences will be provided by a helper adenovirus or herpesvirus vector. Alternatively, the adenovirus or herpesvirus sequences can be provided by another non-viral or viral vector, e.g., as a non-infectious adenovirus miniplasmid that carries all of the helper genes that promote efficient AAV production as described by Ferrari et al. (1997) Nature Med. 3:1295; and U.S. Pat. Nos. 6,040,183 and 6,093,570. Further, the helper virus functions may be provided by a packaging cell with the helper sequences embedded in the chromosome or maintained as a stable extrachromosomal element. Those skilled in the art will appreciate that it may be advantageous to provide the AAV replication and capsid sequences and the helper virus sequences (e.g., adenovirus sequences) on a single helper construct. This helper construct may be a non-viral or viral construct. As a further alternative, the virus vectors of the invention can be produced in insect cells using baculovirus vectors to deliver the rep/cap genes and rAAV template as described, for example, in Urabe et al. (2002) Human Gene Therapy 13:1935-43.
(54) As noted, mAAV virions of the invention are useful for treating conditions or diseases. Thus, one embodiment of the invention is a method to treat a patient for a disease or condition, the method comprising administering to the patient a mAAV of this invention, wherein the mAAV comprises a heterologous nucleic acid molecule encoding a therapeutic agent for treating the disease or condition. In certain embodiments of the inventive treatment methods, administration of the AAV constructs of this invention proceeds via any one of a variety of routes, including intravenous (IV), intramuscular (IM), intra-arterial, intramedullary, intrathecal, subcutaneous (SQ), intraventricular, transdermal, interdermal, intradermal, by intratracheal instillation, bronchial instillation, and/or inhalation; as a nasal spray, and/or as an aerosol. In certain embodiments, intravenous injection, or infusion directly to a specifically targeted tissue may be used. Any appropriate site of administration may be used. For example, the inventive composition may be administered locally and directly at the site where action is required or may be attached or otherwise associated, e.g. conjugated, with entities, which will facilitate the targeting to an appropriate location in the body. Specific delivery routes include intravitreal injection, and/or subretinal injection to the eye; aerosol delivery of the AAV vectors to the lung; oral gavage; portal vein, peripheral vein, superficial temporal vein, hepatic infusion, and/or intrahepatic injection to the liver.
(55) One embodiment of the invention is a composition comprising a mAAV of the present embodiments. Such compositions can also include an aqueous solution, such as a physiologically compatible buffer. Examples of excipients include water, saline, Ringer's solution, and other aqueous physiologically balanced salt solutions. In some embodiments, excipients are added to, for example, maintain particle stability or to prevent aggregation. Examples of such excipients include, but are not limited to, magnesium to maintain particle stability, pluronic acid to reduce sticking, mannitol to reduce aggregation, and the like, known to those skilled in the art.
(56) A composition of the embodiments is conveniently formulated in a form suitable for administration to a subject. Techniques to formulate such compositions are known to those skilled in the art. For example, a mAAV virion of the embodiments can be combined with saline or other pharmaceutically acceptable solution; in some embodiments excipients are also added. In another embodiment, a composition comprising a mAAV virion is dried, and a saline solution or other pharmaceutically acceptable solution can be added to the composition prior to administration.
(57) One embodiment of the invention is a kit for practicing embodiments of the present invention. Kits of the present invention can comprise any reagent necessary to produce and use mAAV virions of the present invention. Thus, kits can comprise, for example, nucleic acid molecules, proteins and/or mAAVS of the present invention. Kits can an also include, for example, tubes, buffers, instructions for use, etc.
(58) The disclosure now being generally described will be more readily understood by reference to the following examples, which are included merely for the purposes of illustration of certain aspects of the embodiments of the present disclosure. The examples are not intended to limit the disclosure, as one of skill in the art would recognize from the above teachings and the following examples that other techniques and methods can satisfy the claims and can be employed without departing from the scope of the claimed disclosure.
EXAMPLES
Example 1: Mutagenesis of the Sialic Acid Binding Regions of AAV5 Results in Elimination or Alteration in Sialic Acid-Dependent Transduction
(59) As a genus, the dependoviruses use a diverse group of cell surface carbohydrates for attachment and entry. Despite the fact that a majority of adeno-associated viruses (AAVs) utilize sialic acid (SIA) for binding and transduction, this virus-carbohydrate interaction is poorly understood. Utilizing X-ray crystallography, two SIA binding regions were mapped for AAV5. The first site mapped to the depression in the center of the 3-fold axis of symmetry, while the second site was located under the HI loop close to the 5-fold axis. Mutagenesis of amino acids 569 and 585 or 587 within the 3-fold depression resulted in elimination or alteration in SIA-dependent transduction, respectively. This change in SIA binding was confirmed using glycan microarrays. Mutagenesis of the second site identified a role in transduction that was SIA independent. Further studies of the mutants at the 3-fold site demonstrated a change in transduction activity and cell tropism in vivo as well as resistance to neutralization by a polyclonal antibody raised against the wild-type virus.
(60) IMPORTANCE: Despite the fact that a majority of AAVs utilize sialic acid for binding and transduction, this virus-carbohydrate interaction is poorly understood. Utilizing X-ray crystallography, the sialic acid binding regions of AAV5 were identified and studied using a variety of approaches. Mutagenesis of this region resulted in elimination or alteration in sialic acid-dependent transduction in cell lines. This change in sialic acid glycan binding was confirmed using glycan arrays. Further study also demonstrated a change in transduction and activity and cell tropism in vivo as well as resistance to neutralization by antibodies raised against the wild-type virus.
(61) MATERIALS AND METHODS: Cell cultures: African green monkey kidney COS cells (The American Type Culture Collection [ATCC], Manassas, Va.) and 293T cells (human embryonic kidney cells) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, Utah), 2 mM 1-glutamine, 100 U of penicillin/ml, and 0.1 mg of streptomycin/ml (Invitrogen, Carlsbad, Calif.). The human tumor cell lines IGROV-1 and SF-268 were maintained in RPMI 1640 medium (Biosource, Camarillo, Calif.) supplemented with 10% FBS and 2 mM 1-glutamine (15). Cells were maintained at 37 C. under a 5% CO.sub.2 humidified atmosphere. In the transduction and binding experiments, cells transduced with the recombinant AAVs were placed in medium supplemented with 5% FBS (HyClone).
(62) Crystallographic analysis of the AAV5-SIA complex: The expression, purification, and crystallographic studies of AAV5 virus-like particles (VLPs) have been previously described (16). To study the interaction of AAV5 with SIA, crystals grown in 20 mM Tris-HCl (pH 7.5), 350 mM NaCl, 10 mM MgCl.sub.2, and 1.5% polyethylene glycol (PEG) 8000 at room temperature (RT) using the hanging-drop vapor diffusion method were soaked with 1 mM SIA (Sigma) for about 48 h prior to X-ray diffraction data collection (17). Crystals were soaked for 30 sec in cryoprotectant solution consisting of the crystallization buffer with 10% PEG 8000 and 30% glycerol and flash cooled in liquid nitrogen vapor prior to X-ray diffraction data collection. A total of 199 diffraction images were collected from 4 crystals at two different synchrotron beam lines: F1 at the Cornell High Energy Synchrotron Source (CHESS, Cornell University, Ithaca, N.Y.) at a crystal-to-detector distance of 400 mm, oscillation angle of 0.3 per image, and exposure time of 45 s per image at a wavelength () of 0.9799 ; and X29 at the National Synchrotron Light Source (NSLS) at the Brookhaven National Laboratory with a crystal-to-detector distance of 400 mm, an oscillation angle of 0.3 per image, and an exposure time of 30 sec per image at a , of 1.10 .
(63) The reflections were indexed and integrated with the HKL2000 suite of programs and scaled and merged with Scalepack (18). The crystals diffracted X-rays to 3.5- resolution, and the R.sub.merge and completeness for this data set were 14.9% and 59.4%, respectively. The data processing statistics are given in Table 1. The crystals belong to the orthorhombic space group P2.sub.12.sub.12.sub.1 with unit cell dimensions as follows: a=264.7 , b=447.9 , and c=629.7 . This is isomorphous with the published AAV5 VLP structure (PDB accession no. 3NTT) (19). Thus, a difference map, F.sub.o-F.sub.c (where F.sub.o and F.sub.c are the observed and calculated structure factor amplitudes, respectively), was calculated to localize the potential binding site for SIA using the CNS program (20).
(64) TABLE-US-00002 TABLE 1 Data collection, processing, and refinement statistics of AAV5-SIA Parameter (unit) AAV5-SIA.sup.a Wavelength (, ) 0.9799 (CHESS)/1.10 (NSLS, BNL) No. of films 199 Space group P2.sub.12.sub.12.sub.1 Unit cell parameters () a = 264.7, b = 447.9, c = 629.7 Resolution () 50.00-3.50 (3.63-3.50) Total no. of reflections 4,035,746 No. of unique reflections 551,907 (29,433) R.sub.merge.sup.b (%) 14.9 (23.2) Completeness (%) 59.4 (31.9) I/ 5.7 (2.2) R.sub.factor.sup.c/R.sub.free.sup.d (%) 21.6/21.8 RMSD.sup.e of bonds () and angles 0.009, 1.49 () .sup.aValues in parentheses are for the highest-resolution shell. .sup.bR.sub.merge = (|I <I> |/ <I>) 100, where I is the intensity of an individual reflection with indices h, k, and l and <I> is the average intensity of all symmetry equivalent measurements of that reflection; the summation is over all intensities. .sup.cR.sub.factor = (|F.sub.o| |F.sub.c|/ |F.sub.o|) 100, where F.sub.o and F.sub.c are the observed and calculated structure factor amplitudes, respectively. .sup.dR.sub.free is calculated in the same way as R.sub.factor, except that it uses 5% of the reflection data partitioned from the refinement process. .sup.eRMSD, root mean square deviation.
(65) The averaged F.sub.o-F.sub.c electron density map, when contoured at a threshold of 2.0, revealed positive electron densities at the 3-fold axis and under the HI loop, defined as sites A and B, respectively, which could be interpreted as an SIA molecule. To enable modeling and refinement of the SIA molecules, the coordinate files for SIA were obtained from the HIC-Up server (21) and the geometry restraints and dictionary files were generated using the phenix elbow subroutine in the Phenix program (22). The SIA molecules were docked into F.sub.o-F.sub.c densities using interactive rigid-body rotations and translations in the Coot program (23). The fit of the docked molecules was refined against the F.sub.o-F.sub.c difference map using the Real_Space refinement option in Coot. The amino acids constituting the SIA binding sites were predicted based on the list of amino acid residues with interactions within 3.6 of the docked SIA molecules. The figures were generated using the Pymol program (24).
(66) Construction of mutant capsid plasmids: Mutations, predicted to abrogate A- and B-site SIA interactions by switching the AAV5 residue types (that differ to AAV2 at the structurally mapped sites) to those present at the structurally equivalent positions in AAV2, were introduced into the AAV5 capsid gene using QuikChange site-directed mutagenesis (Stratagene, San Diego, Calif.) per the manufacturer's instructions. For each AAV5 mutant, two complementary PCR primers were used to introduce changes into a pAAV5 RepCap plasmid (Table 2). The A-site mutants include M569V, Y585V, and L587T mutants. A double mutant was also made, Y585V/L587T mutant. The B-site mutants include D652F, T362M, Q359D, E350Q, P533S, P533G, and AAV5 Loop VII mutants, a VR-VII (19) substitution mutant. All mutations were confirmed by sequencing the final plasmid.
(67) TABLE-US-00003 TABLE2 Oligonucleotideprimersusedtomakethedifferent A-siteandB-siteAAV5capmutants Siteand mutation(s) Sense Sequence(5 to3) Asite M569V Forward GTCGGCGGGCAGGTGGCCACCAACAAC Reverse GTTGTTGGTGGCCACCTGCCCGCCGAC Y585V Forward GCGACCGGCACGGTCAACCTCCAGGAAATC Reverse GATTTCCTGGAGGTTGACCGTGCCGGTCGC L587T Forward CCGGCACGTACAACACCCAGGAAATCGTGCCC Reverse GGGCACGATTTCCTGGGTGTTGTACGTGCCGG Y585V/L587T Forward CGCGACCGGCACGGTCAACACCCAGGAAATCGTGCCC Reverse GGGCACGATTTCCTGGGTGTTGACCGTGCCGGTCGCG Bsite D652F Forward ACCAGCTTCTCGGCCGTGCCCGTCAGCAG Reverse TGCTGACGGGCACGGCCGAGAAGCTGGTG T362M Forward CGTCCAAGTGTTTATGGACGACGACTACCAG Reverse TGGTAGTCGTCGTCCATAAACACTTGGACGG Q359D Forward AACCTCACCTCCACCGTCGATGTGTTTACGGACGACGAC Reverse TCGTCGTCCGTAAACACATCGACGGTGGAGGTGAGGTTG E350Q Forward GCAACGGGACCCAGGGATGCCTGC Reverse CAGGCATCCCTGGGTCCCGTTGCC P533S Forward TTCAACAGCCAGTCGGCGAACCCGGG Reverse CCGGGTTCGCCGACTGGCTGTTGAAG P533G Forward ATCTTCAACAGCCAGGGGGCGAACCCGGGCAC Reverse TGCCCGGGTTCGCCCCCTGGCTGTTGAAGATC AAV5loop Forward GGAGAACACTATGATCTTCGGGAAGCAAGGCTCAGAGAAAAC VII AAATGTGGACATTGAAAAGGTCATGATCACCAGCGAGAGCGAG Reverse CTCGCTCTCGCTGGTGATCATGACCTTTTCAATGTCCACATTTGT TTTCTCTGAGCCTTGCTTCCCGAAGATCATAGTGTTCTCC
(68) Generation of recombinant virus: Wild-type AAV5 and capsid mutant vectors expressing a nuclear localized green fluorescent protein (GFP) were produced as previously described (25). Briefly, 293T cells were cotransfected with pAAV5-NLS-GFP, pAAV5 RepCap mutants, and the Ad helper plasmid 449B (26). Recombinant (rAAV-GFP) vectors were purified by CsCl gradient centrifugation. DNase-resistant genome copy numbers for the vectors were determined by quantitative real-time PCR using the TaqMan system (Applied Biosystems) with probes specific to the cytomegalovirus (CMV) promoter contained within the packaged genome.
(69) Cellular transduction following digestion of cell surface SIA: Exponentially growing COS, IGROV-1, and SF-268 cells were plated at a density of 510.sup.3 cells/well in a flat-bottom 96-well plate. Twenty-four hours after seeding, cells were incubated for 45 min with 1 mU of the broad-spectrum neuraminidase (NA) from Vibrio cholerae (Calbiochem, La Jolla, Calif.) or Glyko sialidase A (SA; recombinant from Arthrobacter ureafaciens; Prozyme, San Leandro, Calif.) to remove SIA. Cells were then washed with medium and transduced with 110.sup.9 particles of rAAV-GFP vectors. GFP expression, which serves as a surrogate marker for transduction, was detected 42 h later with a fluorescent cell counter (BD FACSArray Bioanalyzer; BD Biosciences, San Jose, Calif.).
(70) Cell surface vector binding assay: COS cells were seeded at 210.sup.4 cells/well in a flat-bottom 96-well plate. Twenty-four hours after seeding, cells were incubated for 45 min with 1 mU of NA or SA and incubated for 45 min at 37 C. Cells were then chilled for 5 min at 4 C. and incubated for 30 min at 4 C. with 310.sup.9 rAAV-GFP particles. After this incubation, cells were washed twice with cold medium, once with phosphate-buffered saline (PBS), and lysed in 50 l buffer P1 from the Qiaprep Miniprep kit (Qiagen, Germany). Copy numbers of cell-associated vector genomes in the cell lysates were determined by quantitative real-time PCR using the TaqMan system (Applied Biosystems) with probes specific to the CMV promoter.
(71) Antibody neutralization assay: COS cells were seeded at a density of 510.sup.3 cells/well in a flat-bottom 96-well plate 1 day before infection with 210.sup.7 rAAV-GFP vectors, which had been preincubated with serial dilutions of a polyclonal serum, raised against AAV5, in medium for 1 h at RT. Cells were incubated at 37 C. for 1 h and then washed with medium. Twenty-four hours after infection, cells were analyzed for GFP expression by flow cytometry (BD FACSArray Bioanalyzer).
(72) Glycan microarray analysis of AAV5 glycan interactions: The glycan binding profiles for WT AAV5 VLPs and rAAV5-GFP particles were characterized using glycan microarrays produced by the Consortium for Functional Glycomics (CFG). (functionalglycomics.org/static/consortium/resources/resourcecoreh). The screening was conducted several times on different microarrays with different biological replicates (PA Ver 2 to Ver 4.1). The microarrays contained 262 to 371 sialylated and nonsialylated glycans with different linkages and modifications (functionalglycomics.org/glycomics/publicdata/selectedScreens.jsp). Purified AAV5 VLPs or rAAV5-GFP (at a concentration of 100 to 200 g/ml) used to probe the array was detected using the ADK5a anti-AAV5 capsid antibody and by goat anti-mouse secondary IgG with a fluorescein isothiocyanate (FITC) label; alternatively, VLPs were directly labeled with an Alexa Fluor 488 label for detection. A similar approach was used for profiling the glycan binding properties of two AAV5 SIA binding mutants, M569V and L587T mutants, following confirmation of reduced cell binding and infectivity phenotypes using binding and transduction assays. These mutants, produced in 293T cells, were screened on array PA v3.1 and detected with ADK5a and the Alexa Fluor 488 goat anti-mouse secondary antibody.
(73) In vivo study of transgene expression: All mouse studies were conducted in an AAALAC-accredited facility under the Institutional Animal Care and Use Committee Protocol approval (NIDCR). Vector particles (110.sup.10) of WT AAV5 or L587T mutant vectors encoding luciferase were injected into male BALB/c mice (27) by three different routes, the submandibular salivary glands, the hind limb, or lungs (110.sup.11 viral particles). Transduction was visualized by photon imaging of the whole animal using a Xenogen camera (IVIS Lumina; PerkinElmer) at 7 months postinfection.
(74) RESULTS: Structural studies of AAV5-SIA interactions: SIA was observed in two separate sites in AAV5 using an averaged F.sub.o-F.sub.c difference density map contoured at a threshold of 2.0. The A site is located in the depression centered at the icosahedral 3-fold symmetry axis, and the B site is located under the HI loop, which sits above a 5-fold symmetry-related VP monomer and is also adjacent to the glycerol molecule (GOL) observed in the previously reported crystal structure of AAV5 (
(75) The A site but not the B site is important in SIA-dependent transduction: The biological significance of the A-site and B-site AAV5-SIA interactions was studied by making point mutations at AAV5 contact residues that differed with respect to AAV2 (a non-SIA-binding AAV) and have side chain interactions, and their transduction activity was tested. Very little difference in vector particle yields or physical properties was observed between preparations of WT AAV5 and the mutants (data not shown). All mutants were tested on three diverse cell lines, COS, SF-268, and IGROV-1. For the A-site mutants, in the COS cells, although transduction activity for the M569V mutant was almost completely abolished, L587T, Y585V, and Y585V/L587T mutants all showed approximately 7-fold-lower transduction activity than that of WT AAV5 (
(76) TABLE-US-00004 TABLE 3 SIA-VP interactions in AAV5 capsid.sup.a Amino acid residue for AAV serotype (receptor type).sup.b: A- or B-site or GOL interactions 2 3 4 5 6 AAV5 VP1 SIA or GOL VP 1 (SIA) (HS) (HS) (SIA) (SIA) (SIA/HS) atom atom.sup.b monomer A-site interactions V V V L M.sup.c V M569 (CG) O1B REF A S A P A A A570 (O) O4 V T N G T V T571 (CG2) C3 G A R D G G G583 (O) O1B D D T R T D T584 (O) O1A V V V L Y V Y585 (N) O1A A T D A L V L587 (CD2) O9 D D T R T D T584 (O) O1 3F V V V L Y V Y585 (CA) C11 H N N T N H N586 (ND2) O4 A T D A L V L587 (CD2) C11 B-site interactions R R R R R R R277 (NE) O1 REF H H H H H H H279 (NE2) O1 C C C C S C S280 (OG) C11 Q Q Q E E Q E350 (C) O7 G G G G G G G351 (CA) C7 C C C S C C C352 (CB) C11 L L L L L L L353 (O) C11 P P P P P P P354 (CA) O1B D D D D Q D Q359 (NE2) O1B F F F F F F F361 (CD1) O8 M M M M T M T362 (O) O9 S G G Q P S P533 (CG) O1A F F F F F F F650 (CE2) C9 5F S S S S S S S651 (O) O9 A A P S D A D652 (OD2) C3 Glycerol interactions R R R R R R R277 (NH2) O1 REF F F F F F F F529 (CB) O2 G G G A N G N530 (O) C3 K K K G S K S531 (O) C3 M M M I L M L548 (CD2) O3 Q Q Q Q Q Q Q604 (CG) O3 E E E E T E T711 (OG1) O3 .sup.aInteraction distance within 3.6 . .sup.bReceptor type for the particular AAV serotype in parentheses. .sup.cAmino acid residues mutated in this study are in boldface and underlined.
(77) Similar to the A-site mutants, all of the B-site mutants displayed a significant decrease in transduction activity on all cell types, suggesting that this region is also important in AAV5 transduction (
(78) A-site mutations change SIA-dependent cell attachment: To confirm if the change in transduction activity was associated with disruption in cell surface SIA interaction, mutant vector binding to cells was compared to that of WT AAV5 with or without pretreatment of the target cells with neuraminidase on COS cells (
(79) Specificity of carbohydrate binding by A-site mutants on a glycan microarray: Among the A-site mutations, two phenotypes of transduction were observed, complete inhibition of transduction on all cells as seen with M569V or cell type-dependent neuraminidase-sensitive transduction with Y585V and L587T. Based on these data, we hypothesized that M569V completely abolished SIA binding while L587T and to a lesser extent Y585V altered SIA specificity. To test this hypothesis WT, M569V, and L587TrAAV-GFP vectors were used to probe glycan microarrays developed by the CFG. WT AAV5 reproducibly bound a subset of SIA-containing glycans on the array (Table 4;
(80) TABLE-US-00005 TABLE 4 WT AAV5 and AAV5 M569V and L587T mutant capsid glycan specificity on glycan arrays.sup.a AAV5 and glycan no. Glycan name RFU SD SEM % CV Wild-type AAV5 45/46.sup.b NeuAc2-3[6OSO3]Gal1-4GlcNAc-Sp8 38,621 2,164 1,082 6 206/208.sup.b Neu5Ac2-3(6-O-Su)Gal1-4(Fuc1-3)GlcNAc-Sp8 34,986 4,816 2,408 14 141/143.sup.b Neu5Ac2-3Gal1-4GlcNAc1-2Man1- 29,649 9,158 4,579 31 3(Neu5Ac2-3Gal1-4GlcNAc1-2Man1-6)Man1- 4GlcNAc1-4GlcNAc-Sp12 316/318.sup.b Neu5Ac2-3Gal1-4GlcNAc1-2Man1- 22,531 6,079 3,040 27 3(Neu5Ac2-6Gal1-4GlcNAc1-2Man1-6)Man1- 4GlcNAc1-4GlcNAc-Sp12 M569V mutant 265 [3OSO3]Galb1-4[Fuca1-3][6OSO3]GlcNAc-Sp8 9,148 1,045 523 11 284 [3OSO3]Galb1-4[6OSO3]GlcNAcb-Sp0 7,875 565 282 7 16 b-d-Gal-Sp8 7,179 1,267 634 18 34 [3OSO3]Galb1-4[6OSO3]GlcNAcb-Sp8 7,174 604 302 8 L587T mutant 47 9NAcNeu5Aca-Sp8 1,092 411 205 38 337 GlcNAca1-4Galb1-4GlcNAcb1-3Galb1-4(Fuca1- 929 682 341 73 3)GlcNAcb1-3Galb1-4(Fuca1-3)GlcNAcb-Sp0 260 Neu5Gca2-6GalNAca-Sp0 929 762 381 82 375 GalNAcb1-4GlcNAcb1-2Mana1-6(GalNAcb1- 908 422 211 46 4GlcNAcb1-2Mana1-6)Manb1-4GlcNAcb1-4GlcNAc- Sp12 .sup.aThe top four glycans with the highest relative fluorescence units (RFU) for each vector are listed. .sup.bNumbers are based on PA Ver. 3.1/3.0.
(81) Unlike the data for the WT AAV5, the M569V mutant showed nonspecific binding to most of the glycans on the microarray. The top hits, with acceptable percent coefficient of variation (% CV) values, did not contain terminal SIA, and most of them were sulfated (
(82) The glycan microarray observations for the mutant viruses are consistent with the reduced binding in COS cells compared to WT AAV5 and the lack of significant difference in binding to cells without/with neuraminidase treatment (
(83) Mutation of L587 alters SIA binding for AAV5. Previous research had demonstrated robust transgene expression following WT AAV5 vector delivery to lung or salivary gland epithelia (30, 31). Thus, to test if the altered SIA binding specificity by L587T also alters tropism in vivo, gene expression was monitored in mice for WT AAV5 or L587T vectors encoding luciferase. In agreement with the change in in vitro carbohydrate binding and cell tropism, the L587T mutant also demonstrated a change in transduction activity in vivo (see
(84) AAV5 SIA binding residues map to an antigenic region: We hypothesized that alteration of a critical region for transduction could alter the antigenic profile of the vector and thus its neutralization by serum antibodies. The antigenic profiles of selected A-site and B-site mutants were explored in comparison to that of WT AAV5 (
(85) In summary, we have identified a region used for SIA binding by AAV5, an essential interaction for successful infection. The binding site conserves the general features observed in other virus-capsid interactions. Further analysis of the SIA binding pocket in AAV5 and characterization of other SIA-dependent AAVs will be necessary to identify the interplay between the bound glycans and the receptors required for internalization. The data so far clearly point to the icosahedral 3-fold axis as being important in cell binding by multiple isolates of AAV, while versatility in capsid interactions shows that the 2-fold region of the autonomous parvovirus capsid is also suitable for SIA receptor attachment. Since structure is more conserved than sequence, information on all receptor-interacting regions can inform vector-retargeting developments. Manipulation of these regions, given knowledge of their functions, will lead to improvements in the development of the AAV gene transfer system.
Example 2: Delivery and Expression of Nucleic Acid of Interest in Subretinal Tissue of the Eye Vector Production
(86) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Wild-type AAV5 and recombinant virus comprising the capsid mutant vectors expressing luciferase are produced as described in Example 1.
(87) Injections: The in vivo study of transgene expression is conducted as described in Example 1. Vector particles (310.sup.12 vg/ml viral particles) of WT AAV5 or recombinant vectors encoding luciferase are injected into mice by subretinal injection.
(88) Subretinal Injection Technique
(89) To study retinal cell transduction in rats, Adult Wistar rats (375-425 g) are anesthetized with intraperitoneal ketamine (50 mg/kg) and xylazine (5 mg/kg) and topical 1% proparacaine eye drops and pupils are dilated with 1% tropicamide and 2.5% phenylephrine eye drops. A superotemporal conjunctival incision is made using a surgical microscope so that the sclera posterior to the lens is exposed. Using a 30-G needle to facilitate penetration of the underlying sclera, choroid, and retina, a fine hole is opened. After formation of the partial-thickness scleral pilot hole, a fine glass micropipette with a tip diameter of 30 lm and a tip length of 1.5 mm is directed more obliquely than for intravitreal injection, into the space between the RPE and the neuroretina. Correct cannula placement can be verified by observation of a bullous retinal detachment following subretinal injection without evidence of a retinal hole or tear. Injection of a volume of 2-3 ll is usually sufficient to cause a subretinal bleb involving 30-40% of the fundus.
(90) Histochemistry
(91) Approximately one month after injection, mice are sacrificed and the eyes are removed and processed to identify luciferase expressing cells. For each mouse, the number of expressing cells in tissue of the eye is counted and summed to provide quantitative extent of transduction. Depending on the transgene, transduction can be visualized by photon imaging of the eye using a Xenogen camera (IVIS Lumina; PerkinElmer) or, if the transgene is GFP, by fluorescences.
(92) To test if the altered SIA binding specificity by L587T also alters tropism in vivo, gene expression is monitored in mice encoding GFP. In agreement with the change in in vitro carbohydrate binding and cell tropism, the L587T mutant demonstrates a change in transduction activity in vivo.
(93) These experiments will explore the use of the recombinant AAV5 vectors of this disclosure as a vector for nucleic acid transfer to the eye. The recombinant AAV5-L587T will demonstrate a distinct affinity for transduction of the tissues of the eye.
Example 3: Delivery and Expression of Nucleic Acid of Interest in Intravitreal Space in the Eye Vector Production
(94) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Recombinant virus comprising the capsid mutant vectors expressing a transgene are produced as described in Example 1.
(95) Injections
(96) The in vivo study of transgene expression is conducted as described in Example 1. Vector particles (310.sup.12 vg/ml viral particles) of recombinant vectors encoding luciferase are injected into mice by intravitreal injection.
(97) Intravitreal Injection Technique
(98) To study retinal cell transduction in rats, Adult Wistar rats (375-425 g) are anesthetized with intraperitoneal ketamine (50 mg/kg) and xylazine (5 mg/kg) and topical 1% proparacaine eye drops and pupils are dilated with 1% tropicamide and 2.5% phenylephrine eye drops. A superotemporal conjunctival incision is made using a surgical microscope so that the sclera posterior to the lens is exposed. Using a 30-G needle to facilitate penetration of the underlying sclera, choroid, and retina, a fine hole is opened and a fine glass micropipette with a tip diameter of 30 um and a tip length of 2.5 mm is connected to a glass syringe by polyethylene tubing prefilled with light mineral oil, prior to drawing up the virus stock. The targeted injection site is located about 3 mm posterior to the superotemporal limbus. Injections are given slowly over 1 minute to allow diffusion of the virus stock. After each injection, the injection site is visualized with a standard indirect ophthalmoscope using a 90-diopter condensing lens (Volk Optical, Mentor, Ohio).
(99) Histochemistry
(100) Approximately 1 month after injection mice are sacrificed and the eyes are removed and processed to identify transgene expressing cells. For each mouse, the number of expressing cells in tissue of the eye is counted and summed to provide quantitative value of the extent of transduction. In agreement with the change in in vitro carbohydrate binding and cell tropism, the AAV5 mutants will demonstrate a change in transduction activity in tissues of the eye in vivo.
Example 4: Delivery and Expression of Nucleic Acid of Interest in Tissues of the Lung Vector Production
(101) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Recombinant virus comprising the capsid mutant vectors expressing luciferase are produced as described in Example 1.
(102) Injections
(103) The in vivo study of transgene expression is conducted as described in Example 1. Vector particles (310.sup.12 vg/ml viral particles) encoding luciferase are administered to mice by aerosol delivery to the lung.
(104) Aerosol Delivery of AAV Vectors to the Lung
(105) Up to 50 l of sterile saline will be placed at the end of each nostril so that the droplets are inhaled. Prior to i.n. vector delivery, mice will be anesthetized either with isoflurane gas or with an i.m. injection of ketamine [60-80 mg/kg] and xylazine [8-10 mg/kg]). Animals are allowed to recover on heating pads and returned to their cages, grouped according to their experimental treatment. Animals, however, will not be returned to their cages until they have recovered the ability to ambulate and change posture, which also indicates an ability to again regulate their body temperature. Using a fine tipped 10-l Eppendorf pipette tip and alternating drops between both nostrils, a drop will be placed gently at the tip of the nostril, with a maximum volume of 7 l per drop. This procedure will be repeated three times for a total of 8 drops (4 drops/nostril) administered during a 15-min period (maximum volume, 56 l).
(106) Histochemistry
(107) Approximately 1 month after injection, mice are sacrificed and the lungs are removed and processed to identify expressing cells. For each mouse, the number of expressing cells in tissues of the lung (including macrophages, epithelial, alveolar and bronchiol ductal cells) is counted and summed to provide quantitative extent of transduction. In agreement with the change in in vitro carbohydrate binding and cell tropism, the AAV5 mutants will demonstrate a change in transduction activity in tissues of the lung in vivo.
Example 5: Delivery and Expression of Nucleic Acid of Interest in Tissues of the Liver Vector Production
(108) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Wild-type AAV5 and recombinant virus comprising the capsid mutant vectors expressing luciferase are produced as described in Example 1.
(109) Injections
(110) The in vivo study of transgene expression is conducted as described in Example 1. Vector particles (310.sup.12 vg/ml viral particles) encoding a transgene such as luciferase are administered to mice by injection for targeted delivery to the liver.
(111) Targeted Delivery of AAV Vectors to the Liver
(112) Several routes of delivery to the liver are used, including the portal vein, peripheral vein, superficial temporal vein, and hepatic infusion.
(113) Vector will be delivered via the portal vein by anesthetizing a mouse and then making a midline incision in the abdomen to expose the portal vein connecting the intestine with the liver. Using a 30G needle, up to 0.2 ml of vector in isotonic media is slowly injected over a 1 min period. Following needle removal, gauze is used to control bleeding and the abdomen is sutured.
(114) For peripheral vein infusion, a 20 or 22-gauge intravenous catheter is inserted into the saphenous vein of an anesthetized macaque. Alternatively, a 30-gauge needle is used in a mouse. The vector is diluted in isotonic buffer to a final volume that is less than 10 mL/kg of the total body weight of the macaque or mouse, and then infused through the catheter/needle over 30 minutes while monitoring the animal's vital signs and oxygen saturation.
(115) For administration via the superficial temporal vein, the superficial temporal vein that extends from behind the eye into the neck is exposed. A 30-gauge needle affixed to a 1 cc syringe is inserted under the skin next to the vein starting at the direction of the head down until the vein is pierced. The viral suspension is slowly injected over 1 min.
(116) Intrahepatic injection is accomplished by creating a midline incision in the abdomen in an anesthetized animal. This will be retracted to expose the liver. Using a 30G needle, virion suspension will be slowly infused into the liver at multiple sites in an animal. Following infusion, the abdomen will be closed by suture.
(117) Histochemistry
(118) Approximately 1 month after injection, mice are sacrificed and the liver is removed and processed to identify expressing cells. For each mouse, the number of expressing cells in tissues of the liver (including hepatocytes, kupffer cells, and endothelial cells) is counted and summed to provide quantitative extent of transduction. In agreement with the change in in vitro carbohydrate binding and cell tropism, the AAV5 mutants will demonstrate a change in transduction activity in tissues of the liver in vivo.
Example 6: Delivery and Expression of Nucleic Acid of Interest in Tissues of the Brain Vector Production
(119) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Wild-type AAV5 and recombinant virus comprising the capsid mutant vectors expressing luciferase are produced as described in Example 1.
(120) Injections
(121) The in vivo study of transgene expression is conducted as described in Example 1. Vector particles (310.sup.12 vg/ml viral particles) encoding a transgene such as luciferase are administered to mice by injection for targeted delivery to the brain.
(122) Targeted Delivery of AAV Vectors to the Brain
(123) Six to 8-week old adult male C57BL/6 mice are anaesthetized and vectors are stereotactically injected into either the right lateral ventricle or the right striatum, using a 26 gauge Hamilton syringe driven by a microinjector (Micro 1, World Precision Instruments, Sarasota, Fla.) at 0.5 l per minute. For ventricular injections, 10 l volumes are injected at coordinates 0.4 mm rostral and 1.0 mm lateral to bregma, and at a 2 mm depth. For striatal injections, 5 l volumes are injected at coordinates 0.4 mm rostral and 2 mm lateral to bregma, and at a 3 mm depth. A minimum of two independent experiments are done for each virion and injection site.
(124) Histochemistry: Three or 15 weeks after injection, groups of mice are perfused with 2% paraformaldehyde; the brains were removed and 10 m thick coronal sections are cut at 100 m intervals and quantification performed to identify expressing cells. For each mouse, the number of positive cells in every fourth section, spanning 1.3 mm of tissue rostral and 1.3 mm caudal to the injection site, will be counted and summed. These sums allow quantitative comparisons among the virions, although they do not reflect the total number of transduced cells in vivo.
Immunofluorescent Staining
(125) Ten micrometer coronal cryosections of brains harvested 15 weeks after intrastriatal injection of the recombinant virions will be dual stained for the transgene and either neuronal or astrocytic markers. The primary antibodies used are as follows: rabbit IgG specific for the transgene; mouse monoclonal IgG specific for NeuN (Chemicon International, Inc., Temecula, Calif.), which strongly stains neuronal cell nuclei with lighter staining of the cytoplasm; and a Cy5 conjugated mouse monoclonal specific for glial fibrillary acidic protein (GFAP) (Sigma Immunocytochemicals, St. Louis, Mo.), an intermediate filament of astrocytes. Secondary antibodies used are ALEXA 488 goat anti-rabbit IgG (Molecular Probes, Eugene, Oreg.) and lissamine-rhodamine goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, West Grove, Pa.). Sections are blocked for 2 h at room temperature in phosphate-buffered saline (PBS) with 3% bovine serum albumin, 10% normal goat serum and 0.1% Triton X-100. Sections were incubated overnight with primary antibodies diluted in PBS with 3% bovine serum albumin and 0.1% Triton X-100 at 4 C., then washed and incubated with secondary antibodies in PBS with 1% normal goat serum and 0.1% Triton X-100 for 2 hours at room temperature. Confocal laser microscopy will be performed using 63 and 40 oil-immersion objectives on a Zeiss LSM 510 and associated software. Z-series images (0.3 to 1.0 m wide slices) are captured and analyzed for cellular co-localization of antigens. Colocalization of luciferase and either NeuN or GFAP will be represented in 2-color merged images from single slices within the series.
(126) To test if the altered SIA binding specificity by L587T also alters tropism in vivo, gene expression is monitored in mice for L587T vectors encoding luciferase. In agreement with the change in in vitro carbohydrate binding and cell tropism, the L587T mutant will demonstrate a change in transduction activity in tissues of the brain in vivo.
Example 7: Ex Vivo Transduction and Expression of Nucleic Acid of Interest in Myoblasts Vector Production
(127) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Wild-type AAV5 and recombinant virus comprising the capsid mutant vectors expressing luciferase are produced as described in Example 1.
(128) Transduction of Myoblasts
(129) Chicken myoblasts are cultured and plated as previously described (Rhodes & Yamada 1995 NAR Vol 23 (12) 2305-13). Cells are allowed to fuse and are then transduced with a similar number of particles of recombinant AAV vectors containing a transgene such as luciferase. The cells are assayed for luciferase activity and the transduction quantified. The data will show that alteration in glycan recognition affects vector activity in vivo. These experiments will also explore the use of the recombinant AAV5 vectors of this disclosure as a vector for nucleic acid transfer to muscle tissue. The recombinant AAV5-luciferase will demonstrate a distinct affinity for transduction of muscle tissue.
Example 8: Delivery and Expression of Nucleic Acid of Interest in Salivary Glands Vector Production
(130) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Wild-type AAV5 and recombinant virus comprising the capsid mutant vectors expressing luciferase are produced as described in Example 1.
(131) Injections
(132) The in vivo study of transgene expression is conducted as described in Example 1. Vector particles encoding luciferase are administered to mice by injection for targeted delivery to salivary glands.
(133) Delivery of AAV Vectors to Salivary Glands
(134) Vectors are delivered into the submandibular glands by retrograde instillation. Briefly, mild anesthesia is induced by ketamine (100 mg/mL, 1 mL/kg body weight) and xylazine (20 mg/mL, 0.7 mL/kg body weight) solution given intramuscularly (IM). Ten minutes after IM injection of atropine (0.5 mg/kg body weight), mice at the age of 30 weeks are administered 50 l vector into both submandibular glands by retrograde ductal instillation using a thin cannula (Intermedic PE10, Clay Adams). The vector dose is chosen based on previously published results, which showed detectable transgene activity. The mouse salivary glands are collected, their RNAs extracted, and changes in nucleic acid expression identified by microarray analysis. Histochemistry: Approximately 1 month after injection, mice are sacrificed and the salivary glands are processed to identify expressing cells. For each mouse, the number of expressing cells in salivary glands are counted and summed to provide quantitative value for the extent of transduction.
(135) To test if the altered SIA binding specificity by L587T also alters tropism in vivo, gene expression is monitored in mice encoding luciferase. In agreement with the change in in vitro carbohydrate binding and cell tropism, the L587T mutant will demonstrate a change in transduction activity in vivo. The data will show that alteration in glycan recognition affects vector activity in vivo. These experiments will also explore the use of the recombinant AAV5 vectors of this disclosure as a vector for nucleic acid transfer to salivary glands. The recombinant AAV5-luciferase will demonstrate a distinct affinity for transduction of the salivary gland.
Example 9: Delivery and Expression of Nucleic Acid of Interest to Capillary Epithelial Cells Vector Production
(136) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Wild-type AAV5 and recombinant virus comprising the capsid mutant vectors expressing luciferase are produced as described in Example 1.
(137) Injections
(138) The in vivo study of transgene expression is conducted as described in Example 1. Vector particles (310.sup.12 vg/ml viral particles) encoding a transgene such as luciferase are administered to mice by injection for targeted delivery to capillary epithelial cells by intravenous injection of virion suspension into mice.
(139) Histochemistry: Approximately 1 month after injection mice are sacrificed; capillary epithelial cells are processed to identify expressing cells. For each mouse, the number of luciferase-expressing cells in the collected capillary epithelial cells are counted and summed to provide quantitative value for the extent of transduction.
(140) These experiments will explore the use of the recombinant AAV5 vectors of this disclosure as a vector for nucleic acid transfer to epithelial cells. The recombinant AAV5-luciferase will demonstrate a distinct affinity for transduction of epithelial cells.
Example 10: Ex Vivo Transduction and Expression of Nucleic Acid of Interest in Tumor Cells Vector Production
(141) Mutant capsid plasmids of this invention, including capsids having the A-site mutants M569V, Y585V, and L587T mutants, and the double mutant Y585V/L587T, and the B-site mutants D652F, T362M, Q359D, E350Q, P533S, P533G, are prepared as described in Example 1. Wild-type AAV5 and recombinant virus comprising the capsid mutant vectors expressing luciferase are produced as described in Example 1.
(142) Tumor cells are cultured and treated with varying concentrations of the recombinant AAV virions of this invention, expressing luciferase or another transgene such as GFP. The results of this analysis will indicate that different dosages of these recombinant virions induce different response patterns of the transgene expression. The expression changes will be verified by Quantitative-PCR.
(143) These experiments will explore the use of the recombinant AAV5 vectors of this disclosure as a vector for nucleic acid transfer to tumor cells. The recombinant AAV5-luciferase will demonstrate a distinct affinity for transduction of tumor cells.
REFERENCES
(144) 1. Rabinowitz J E, Rolling F, Li C, Conrath H, Xiao W, Xiao X, Samulski R J. 2002. Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. Journal of virology 76:791-801. 2. Schmidt M, Govindasamy L, Afione S, Kaludov N, Agbandje-McKenna M, Chiorini J A. 2008. Molecular characterization of the heparin-dependent transduction domain on the capsid of a novel adeno-associated virus isolate, AAV (VR-942). Journal of virology 82:8911-8916. 3. Halbert C L, Allen J M, Miller A D. 2001. Adeno-associated virus type 6 (AAV6) vectors mediate efficient transduction of airway epithelial cells in mouse lungs compared to that of AAV2 vectors. Journal of virology 75:6615-6624. 4. Handa A, Muramatsu S, Qiu J, Mizukami H, Brown K E. 2000. Adeno-associated virus (AAV)-3-based vectors transduce haematopoietic cells not susceptible to transduction with AAV-2-based vectors. The Journal of general virology 81:2077-2084. 5. Seiler M P, Miller A D, Zabner J, Halbert C L. 2006. Adeno-associated virus types 5 and 6 use distinct receptors for cell entry. Human gene therapy 17:10-19. 6. Summerford C, Samulski R J. 1998. Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. Journal of virology 72:1438-1445. 7. Wu Z, Miller E, Agbandje-McKenna M, Samulski R J. 2006. Alpha2,3 and alpha2,6 N-linked sialic acids facilitate efficient binding and transduction by adeno-associated virus types 1 and 6. Journal of virology 80:9093-9103. 8. Kaludov N, Brown K E, Walters R W, Zabner J, Chiorini J A. 2001. Adeno-associated virus serotype 4 (AAV4) and AAV5 both require sialic acid binding for hemagglutination and efficient transduction but differ in sialic acid linkage specificity. Journal of virology 75:6884-6893. 9. Walters R W, Pilewski J M, Chiorini J A, Zabner J. 2002. Secreted and transmembrane mucins inhibit gene transfer with AAV4 more efficiently than AAV5. The Journal of biological chemistry 277:23709-23713. 10. Wu Z, Asokan A, Grieger J C, Govindasamy L, Agbandje-McKenna M, Samulski R J. 2006. Single amino acid changes can influence titer, heparin binding, and tissue tropism in different adeno-associated virus serotypes. Journal of virology 80:11393-11397. 11. Schmidt M, Chiorini J A. 2006. Gangliosides are essential for bovine adeno-associated virus entry. Journal of virology 80:5516-5522. 12. Rooney C P, Denning G M, Davis B P, Flaherty D M, Chiorini J A, Zabner J. 2002. Bronchoalveolar fluid is not a major hindrance to virus-mediated gene therapy in cystic fibrosis. Journal of virology 76:10437-10443. 13. Kern A, Schmidt K, Leder C, Muller O J, Wobus C E, Bettinger K, Von der Lieth C W, King J A, Kleinschmidt J A. 2003. Identification of a heparin-binding motif on adeno-associated virus type 2 capsids. Journal of virology 77:11072-11081. 14. Opie S R, Warrington K H, Jr., Agbandje-McKenna M, Zolotukhin S, Muzyczka N. 2003. Identification of amino acid residues in the capsid proteins of adeno-associated virus type 2 that contribute to heparan sulfate proteoglycan binding. Journal of virology 77:6995-7006. 15. Di Pasquale G, Davidson B L, Stein C S, Martins I, Scudiero D, Monks A, Chiorini J A. 2003. Identification of PDGFR as a receptor for AAV-5 transduction. Nature medicine 9:1306-1312. 16. DiMattia M, Govindasamy L, Levy H C, Gurda-Whitaker B, Kalina A, Kohlbrenner E, Chiorini J A, McKenna R, Muzyczka N, Zolotukhin S, Agbandje-McKenna M. 2005. Production, purification, crystallization and preliminary X-ray structural studies of adeno-associated virus serotype 5. Acta crystallographica. Section F, Structural biology and crystallization communications 61:917-921. 17. McPherson. 1982. Preparation and Analysis of Protein Crystals, 1 ed. New York: Wiley. 18. Otwinowski Z, Minor W. 1997. Processing of X-ray Diffraction data in oscillation mode. p. 307-326, Methods in Enzymology, vol. 276. 19. Govindasamy L, DiMattia M A, Gurda B L, Halder S, McKenna R, Chiorini J A, Muzyczka N, Zolotukhin S, Agbandje-McKenna M. 2013. Structural insights into adeno-associated virus serotype 5. Journal of virology 87:11187-11199. 20. Brunger A T, Adams P D, Clore G M, DeLano W L, Gros P, Grosse-Kunstleve R W, Jiang J S, Kuszewski J, Nilges M, Pannu N S, Read R J, Rice L M, Simonson T, Warren G L. 1998. Crystallography & NMR system: A new software suite for Macromolecular structure determination. Acta crystallographica. Section D, Biological crystallography 54:905-921. 21. Kleywegt G J. 2007. Crystallographic refinement of ligand complexes. Acta crystallographica. Section D, Biological crystallography 63:94-100. 22. Adams P D, Afonine P V, Bunkoczi G, Chen V B, Davis I W, Echols N, Headd J J, Hung L W, Kapral G J, Grosse-Kunstleve R W, McCoy A J, Moriarty N W, Oeffner R, Read R J, Richardson D C, Richardson J S, Terwilliger T C, Zwart P H. 2010. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta crystallographica. Section D, Biological crystallography 66:213-221. 23. Emsley P, Lohkamp B, Scott W G, Cowtan K. 2010. Features and development of Coot. Acta crystallographica. Section D, Biological crystallography 66:486-501. 24. DeLano W L 2002, posting date. The PyMOL Molecular Graphics System DeLano Scientific, San Carlos, Calif., USA. [Online.] 25. Kaludov N, Handelman B, Chiorini J A. 2002. Scalable purification of adeno-associated virus type 2, 4, or 5 using ion-exchange chromatography. Human gene therapy 13:1235-1243. 26. Smith R H, Afione S A, Kotin R M. 2002. Transposase-mediated construction of an integrated adeno-associated virus type 5 helper plasmid. BioTechniques 33:204-206, 208, 210-201. 27. Quinn K, Quirion M R, Lo C Y, Misplon J A, Epstein S L, Chiorini J A. 2011. Intranasal administration of adeno-associated virus type 12 (AAV12) leads to transduction of the nasal epithelia and can initiate transgene-specific immune response. Molecular therapy: the journal of the American Society of Gene Therapy 19:1990-1998. 28. Mietzsch M, Broecker F, Reinhardt A, Seeberger P H, Heilbronn R. 2014. Differential adeno-associated virus serotype-specific interaction patterns with synthetic heparins and other glycans. Journal of virology 88:2991-3003. 29. Ritter G, Boosfeld E, Markstein E, Yu R K, Ren S L, Stallcup W B, Oettgen H F, Old L J, Livingston P O. 1990. Biochemical and serological characteristics of natural 9-O-acetyl GD3 from human melanoma and bovine buttermilk and chemically 0-acetylated GD3. Cancer research 50:1403-1410. 30. Katano H, Kok M R, Cotrim A P, Yamano S, Schmidt M, Afione S, Baum B J, Chiorini J A. 2006. Enhanced transduction of mouse salivary glands with AAV5-based vectors. Gene therapy 13:594-601. 31. Zabner J, Seiler M, Walters R, Kotin R M, Fulgeras W, Davidson B L, Chiorini J A. 2000. Adeno-associated virus type 5 (AAV5) but not AAV2 binds to the apical surfaces of airway epithelia and facilitates gene transfer. Journal of virology 74:3852-3858. 32. Huang L Y, Halder S, Agbandje-McKenna M. 2014. Parvovirus glycan interactions. Current opinion in virology 7C:108-118. 33. Girod A, Ried M, Wobus C, Lahm H, Leike K, Kleinschmidt J, Deleage G, Hallek M. 1999. Genetic capsid modifications allow efficient re-targeting of adeno-associated virus type 2. Nature medicine 5:1052-1056. 34. Harbison C E, Weichert W S, Gurda B L, Chiorini J A, Agbandje-McKenna M, Parrish C R. 2012. Examining the cross-reactivity and neutralization mechanisms of a panel of mAbs against adeno-associated virus serotypes 1 and 5. The Journal of general virology 93:347-355. 35. Kuck D, Kern A, Kleinschmidt J A. 2007. Development of AAV serotype-specific ELISAs using novel monoclonal antibodies. Journal of virological methods 140:17-24. 36. Coker S F, Lloyd A J, Mitchell E, Lewis G R, Coker A R, Shoolingin-Jordan P M. 2010. The high-resolution structure of pig heart succinyl-CoA:3-oxoacid coenzyme A transferase. Acta crystallographica. Section D, Biological crystallography 66:797-805. 37. Eisen M B, Sabesan S, Skehel J J, Wiley D C. 1997. Binding of the influenza A virus to cell-surface receptors: structures of five hemagglutinin-sialyloligosaccharide complexes determined by X-ray crystallography. Virology 232:19-31. 38. Lopez-Bueno A, Rubio M P, Bryant N, McKenna R, Agbandje-McKenna M, Almendral J M. 2006. Host-selected amino acid changes at the sialic acid binding pocket of the parvovirus capsid modulate cell binding affinity and determine virulence. Journal of virology 80:1563-1573. 39. Shen S, Troupes A N, Pulicherla N, Asokan A. 2013. Multiple roles for sialylated glycans in determining the cardiopulmonary tropism of adeno-associated virus 4. Journal of virology 87:13206-13213. 40. Thacker T C, Johnson F B. 1998. Binding of bovine parvovirus to erythrocyte membrane sialylglycoproteins. The Journal of general virology 79 (Pt 9):2163-2169. 41. Barbis D P, Chang S F, Parrish C R. 1992. Mutations adjacent to the dimple of the canine parvovirus capsid structure affect sialic acid binding. Virology 191:301-308. 42. Allaume X, El-Andaloussi N, Leuchs B, Bonifati S, Kulkarni A, Marttila T, Kaufmann J K, Nettelbeck D M, Kleinschmidt J, Rommelaere J, Marchini A. 2012. Retargeting of rat parvovirus H-1PV to cancer cells through genetic engineering of the viral capsid. Journal of virology 86:3452-3465. 43. Boisvert M, Fernandes S, Tijssen P. 2010. Multiple pathways involved in porcine parvovirus cellular entry and trafficking toward the nucleus. Journal of virology 84:7782-7792. 44. Palermo L M, Hafenstein S L, Parrish C R. 2006. Purified feline and canine transferrin receptors reveal complex interactions with the capsids of canine and feline parvoviruses that correspond to their host ranges. Journal of virology 80:8482-8492. 45. Xiao C, Rossmann M G. 2007. Interpretation of electron density with stereographic roadmap projections. Journal of structural biology 158:182-187.
(145) The foregoing examples of the present disclosure have been presented for purposes of illustration and description. Furthermore, these examples are not intended to limit the disclosure to the form disclosed herein. Consequently, variations and modifications commensurate with the teachings of the description of the disclosure, and the skill or knowledge of the relevant art, are within the scope of the present disclosure. The specific embodiments described in the examples provided herein are intended to further explain the best mode known for practicing the disclosure and to enable others skilled in the art to utilize the disclosure in such, or other, embodiments and with various modifications required by the particular applications or uses of the present disclosure. It is intended that the appended claims be construed to include alternative embodiments to the extent permitted by the prior art.