HYPERSENSITIVE ABA RECEPTORS
20180265886 ยท 2018-09-20
Inventors
- Sean Cutler (Riverside, CA)
- Michael Nuccio (Research Triangle Park, NC)
- Quideng Que (Research Triangle Park, NC)
Cpc classification
C12N15/8243
CHEMISTRY; METALLURGY
A01H5/00
HUMAN NECESSITIES
C12N15/00
CHEMISTRY; METALLURGY
C12N15/8271
CHEMISTRY; METALLURGY
International classification
Abstract
Hypersensitive PYR/PYL polypeptides, compositions, and methods are provided.
Claims
1. An isolated nucleic acid comprising a polynucleotide encoding a mutated PYR/PYL receptor polypeptide comprising an amino acid substitution corresponding to the amino acid V81, 1110, E141, and A160 in PYR1 as set forth in SEQ ID NO:1, wherein the mutated PYR/PYL receptor has increased sensitivity to abscisic acid compared to a control PYR/PYL receptor lacking the substitution.
2. The isolated nucleic acid of claim 1, wherein the PYR/PYL receptor polypeptide comprises an amino acid substitution corresponding to the amino acid V81 and the amino acid substitution is selected from I and Y.
3. The isolated nucleic acid of claim 1, wherein the PYR/PYL receptor polypeptide comprises an amino acid substitution corresponding to the amino acid I110 and the amino acid substitution is selected from C and S.
4. The isolated nucleic acid of claim 1, wherein the PYR/PYL receptor polypeptide comprises an amino acid substitution corresponding to the amino acid E141 and the amino acid substitution is selected from C, I, L, M, N, T, V, W, and Y.
5. The isolated nucleic acid of claim 4, wherein the mutated PYR/PYL receptor polypeptide comprises an amino acid sequence at least 95% identical to SEQ ID NO:153.
6. The isolated nucleic acid of claim 4, wherein the mutated PYR/PYL receptor polypeptide comprises SEQ ID NO: 389, 390, 391, or 392.
7. The isolated nucleic acid of claim 1, wherein the PYR/PYL receptor polypeptide comprises an amino acid substitution corresponding to the amino acid A160 and the amino acid substitution is selected from C and I.
8. The isolated nucleic acid of claim 1, wherein the mutated PYR/PYL receptor polypeptide is substantially identical to any of SEQ ID NOs:1-119 or SEQ ID NOs:155-361 or comprises any of SEQ ID NOs: 120-123.
9. The isolated nucleic acid of claim 1, wherein the polynucleotide encodes a fusion protein, the fusion protein comprising the mutated PYR/PYL receptor polypeptide and a fusion partner protein.
10. The isolated nucleic acid of claim 9, wherein the fusion partner protein is a transcriptional activation or modulation domain.
11. The isolated nucleic acid of claim 10, wherein the transcriptional activator is VP16 or VP64.
12. The isolated nucleic acid of claim 9, wherein the fusion protein further comprises a nuclear localization signal sequence.
13. A plant comprising the polynucleotide of claim 1.
14. The plant of claim 13, wherein the polynucleotide is an in situ mutated endogenous polynucleotide.
15. A method of producing a plant having increased sensitivity to abscisic acid, the method comprising: introducing a mutation into a polynucleotide encoding a PYR/PYL polypeptide, wherein the mutation results in the polynucleotide of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
DETAILED DESCRIPTION OF THE INVENTION
I. Introduction
[0079] To identify mutations causing increased receptor ABA sensitivity, we screened for mutants that lower the concentration of ABA required to induce a detectable interaction between PYR1 and HAB1 using a collection of PYR1 mutants that contain all possible single amino acid substitutions residues located in close proximity to ABA. Based on these results, we describe mutations in highly-conserved residues that substantially increase receptor ABA sensitivity.
[0080] Mutations in PYR/PYL receptor polypeptides have been discovered that result in hypersensitive forms of the PYR/PYL receptor, i.e., the mutated receptors are more responsive to the ABA compared to a corresponding wildtype PYR/PYL polypeptide.
[0081] Expression in a plant of one or more hypersensitive mutant PYR/PYl receptor polypeptides as described here will result in a plant with increased ABA-sensitivity, and in some embodiments, higher stress tolerance or other phenotypes associated with ABA-responsiveness.
[0082] Also provided herein are methods and reagents for producing a plant (e.g., a maize plant) having increased sensitivity to abscisic acid, the method includes introducing a mutation into a polynucleotide encoding a PYR/PYL polypeptide, where the mutation is introduced in situ in the genome of the plant using RNA directed genome modification methods.
II. Hypersensitive PYR/PYL Receptor Polypeptides
[0083] A wide variety of wild-type (naturally occurring) PYR/PYL polypeptide sequences are known in the art. Although PYR1 was originally identified as an abscisic acid (ABA) receptor in Arabidopsis, in fact PYR1 is a member of a group of at least 14 proteins (PYR/PYL proteins) in the same protein family in Arabidopsis that also mediate ABA signaling. This protein family is also present in other plants (see, e.g., SEQUENCE LISTING) and is characterized in part by the presence of one or more or all of a polyketide cyclase domain 2 (PF10604), a polyketide cyclase domain 1 (PF03364), and a Bet V I domain (PF03364). START/Bet v 1 superfamily domain are described in, for example, Radauer, BMC Evol. Biol. 8:286 (2008). In some embodiments, a wild-type PYR/PYL receptor polypeptide comprises any of SEQ ID NOs:1-119. In some embodiments, a wild-type PYR/PYL receptor polypeptide is substantially identical to (e.g., at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, or 99% identical to) any of SEQ ID NOs:1-119.
[0084] PYR/PYL receptor proteins have a conserved START-domain ligand-binding pocket flanked by two loops called the gate and the latch (Melcher, K. et al., Nature 462 (2009)). ABA binds to a PYR/PYL receptor protein at the ligand-binding pocket and ABA binding induces closure of the loops to seal ABA inside the ligand-binding pocket. The ligand-binding pocket of a PYR/PYL receptor polypeptide comprises amino acid residues that are in close proximity (e.g., within about 5 ) to a PYR/PYL ligand (e.g., ABA) or a ligand-contacting water molecule when the ligand is bound to the PYR/PYL receptor. There are 25 residues that make up the PYR1 ligand-binding pocket. The residues of the ligand-binding pocket are also highly conserved among other PYR/PYL family members.
[0085] PYR/PYL receptor proteins directly bind to type 2 protein phosphatases (PP2Cs) and thus also contain a PP2C binding interface. The PP2C binding interface of a PYR/PYL receptor polypeptide comprises amino acid residues that are in close proximity (e.g., within about 5A) to PP2C when PP2C, the PYR/PYL receptor, and ABA are all bound together in a ternary complex. There are 25 residues that make up the PYR1 PP2C binding interface. The residues of the PP2C binding interface are also highly conserved among other PYR/PYL family members.
[0086] Hypersensitive PYR/PYL receptor polypeptides are non-naturally-occurring variants from naturally occurring (i.e., wild-type) PYR/PYL receptor polypeptides, wherein the variant (mutant) PYR/PYL receptor polypeptide is able to bind to and/or inhibit the activity of a PP2C in the presence of abscisic acid to a greater extent than a control PYR/PYL receptor polypeptide in the presence of the same concentration of ABA. Hypersensitive active PYR/PYL receptor polypeptides as described herein comprise one or more amino acid substitutions compared to a wild type PYR/PYL receptor polypeptide. In some embodiments, a hypersensitive PYR/PYL receptor polypeptide is substantially identical to (e.g., at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, or 99% identical to) any of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, or 119 and comprises 1, 2, 3, 4, or more mutations (e.g., amino acid substitutions) as described herein. In some embodiments, a hypersensitive PYR/PYL receptor polypeptide comprises SEQ ID NO:120, 121, 122, or 123 and comprises 1, 2, 3, 4, or more mutations (e.g., amino acid substitutions) as described herein:
TABLE-US-00001 (SEQIDNO:120) CxSxxxxxxxAPxxxxWxxxxxFxxPxxxxxFxxxC (SEQIDNO:121) GxxRxVxxxSxxPAxxSxExLxxxD (SEQIDNO:122) GGxHRLxNYxS (SEQIDNO:123) ESxxVDxPxGxxxxxTxxFxxxxxxxNLxxL.
[0087] As shown in the Examples, it has been discovered that mutations can be made at any of several positions in PYR/PYL receptor polypeptides result in hypersensitivity to ABA. These positions are (corresponding to their position in Arabidopsis PYR1 (SEQ ID NO:1)): F61, V81, I110, E141, and A160. In some embodiments, a mutated PYR/PYL receptor polypeptide comprises one or more (e.g., one, two, three, or four) amino acid substitutions corresponding to these positions. For example, in some embodiments, the mutated PYR/PYL receptor polypeptide comprises at least the following corresponding mutations:
F61L and A160C;
F61M and A160V;
F61M, I110S, and A160V; or
F61L, V81I, I110C and A160V.
[0088]
TABLE-US-00002 SEQIDNO:1;ArabidopsiswildtypePYR1 MetProSerGluLeuThrProGluGluArgSerGluLeuLysAsnSer 151015 IleAlaGluPheHisThrTyrGlnLeuAspProGlySerCysSerSer 202530 LeuHisAlaGlnArgIleHisAlaProProGluLeuValTrpSerIle 354045 ValArgArgPheAspLysProGlnThrTyrLysHisPheIleLysSer 505560 CysSerValGluGlnAsnPheGluMetArgValGlyCysThrArgAsp 65707580 ValIleValIleSerGlyLeuProAlaAsnThrSerThrGluArgLeu 859095 AspIleLeuAspAspGluArgArgValThrGlyPheSerIleIleGly 100105110 GlyGluHisArgLeuThrAsnTyrLysSerValThrThrValHisArg 115120125 PheGluLysGluAsnArgIleTrpThrValValLeuGluSerTyrVal 130135140 ValAspMetProGluGlyAsnSerGluAspAspThrArgMetPheAla 145150155160 AspThrValValLysLeuAsnLeuGlnLysLeuAlaThrValAlaGlu 165170175 AlaMetAlaArgAsnSerGlyAspGlySerGlySerGlnValThr 180185190
[0089] For position F61 (corresponding to the position in SEQ ID NO:1), hypersensitive mutations will include F61L or F61M. For position V81 (corresponding to the position in SEQ ID NO:1), hypersensitive mutations will include V81I or V81Y. For position I110 (corresponding to the position in SEQ ID NO:1), hypersensitive mutations will include I110C or I110S. As some native PYR/PYL polypeptides have a valine at the position corresponding to I110 of SEQ ID NO:1, in some embodiments where position I110 is mutated, the native amino acid will be valine, subsequently mutated to C or S. For position E141 (corresponding to the position in SEQ ID NO:1), hypersensitive mutations will include E141C, E141I, E141L, E141M, E141N, E141T, E141V, E141W, or E141Y. For position A160 (corresponding to the position in SEQ ID NO:1), hypersensitive mutations will include A160C, A160I or A160V. As some native PYR/PYL polypeptides have a valine at the position corresponding to A160 of SEQ ID NO:1, in some embodiments where position A160 is mutated, the native amino acid will be valine, subsequently mutated to C or I.
[0090] Any of the mutations described herein can be made in any wildtype PYR/PYL polypeptide, for example, in the polypeptides of any of SEQ ID NOs:1-119 or in polypeptides substantially identical to any of SEQ ID NOs:1-119 or comprising any of SEQ ID NOs: 120-123. Analogous amino acid substitutions can be made, for example, in PYR/PYL receptors other than PYR1 by aligning the PYR/PYL receptor polypeptide sequence to be mutated with the PYR1 receptor polypeptide sequence as set forth in SEQ ID NO:1. As a non-limiting example, an amino acid substitution in PYL2 that is analogous to the amino acid substitution V81I in PYR1 as set forth in SEQ ID NO:1 can be determined by aligning the amino acid sequences of PYL2 (SEQ ID NO:3) and PYR1 (SEQ ID NO:1) and identifying position V85 in PYL2 as aligning with amino acid position V81 of PYR1 (SEQ ID NO:1). Analogous amino acid positions in PYR/PYL receptors are shown in
[0091] The extent to which one or more amino acid substitutions in the PYR/PYL receptor activity renders the receptor hypersensitive to ABA can be quantitatively measured, for example by assaying phosphatase activity in the presence of ABA and the PYR/PYL receptor comprising one or more amino acid substitutions and comparing the phosphatase activity to that of a control PYR/PYL receptor. A control PYR/PYL receptor will typically be the wildtype PYR/PYL polypeptide most similar to the mutated a PYR/PYL polypeptide. In some embodiments, e.g., when the starting protein is not a wildtype PYR/PYL polypeptide, the control PYR/PYL polypeptide can be substantially identical (e.g., at least 90, 95, or 98% identical) to the test PYR/PYL polypeptide (i.e., suspected of being hypersensitive) and having the wildtype amino acid at the corresponding position. For example, if the mutant PYR/PYL receptor has a mutation of F61X, where X is any non-F amino acid, the control would have F61 at the same position but would otherwise be identical to the mutant PYR/PYL receptor. If the mutant PYR/PYL receptor has a mutation of V81X, where X is any non-V amino acid, the control would have V81 at the same position but would otherwise be identical to the mutant PYR/PYL receptor. If the mutant PYR/PYL receptor has a mutation of I110X, where X is any non-I, non-V amino acid, the control would have I110 or V at the same position but would otherwise be identical to the mutant PYR/PYL receptor. If the mutant PYR/PYL receptor has a mutation of E141X, where X is any non-E amino acid, the control would have E141 at the same position but would otherwise be identical to the mutant PYR/PYL receptor. If the mutant PYR/PYL receptor has a mutation of A160X, where X is any non-A, non-V amino acid, the control would have A160 or valine at the same position but would otherwise be identical to the mutant PYR/PYL receptor.
[0092] In some embodiments, a mutated PYR/PYL receptor polypeptide comprises two or more amino acid substitutions as described herein. In some embodiments, the two or more amino acid substitutions corresponding to, F61X, V81X, I110X, E141X, and A160X, in PYR1 as set forth in SEQ ID NO:1, where X is the amino acid indicated herein as resulting in hypersensitivity.
[0093] Embodiments of the present invention provide for use of the above proteins and/or nucleic acid sequences, encoding such polypeptides, in the methods and compositions (e.g., expression cassettes, transgenic plants, plants with in situ PYR/PYL modifications, etc.) of the present invention. The isolation of a polynucleotide sequence encoding a plant wild-type PYR/PYL receptor (e.g., from plants where PYR/PYL sequences have not yet been identified) may be accomplished by a number of techniques. For instance, oligonucleotide probes based on the PYR/PYL coding sequences disclosed (e.g., as listed in the SEQUENCE LISTING) here can be used to identify the desired wild-type PYR/PYL gene in a cDNA or genomic DNA library. To construct genomic libraries, large segments of genomic DNA are generated by random fragmentation, e.g., using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector. To prepare a cDNA library, mRNA is isolated from the desired tissue, such as a leaf from a particular plant species, and a cDNA library containing the gene transcript of interest is prepared from the mRNA. Alternatively, cDNA may be prepared from mRNA extracted from other tissues in which PYR/PYL gene is expressed.
[0094] The cDNA or genomic library can then be screened using a probe based upon the sequence of a PYR/PYL gene disclosed here. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species. Alternatively, antibodies raised against a polypeptide can be used to screen an mRNA expression library.
[0095] Alternatively, the nucleic acids encoding PYR/PYL can be amplified from nucleic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology can be used to amplify the coding sequences of PYR/PYL directly from genomic DNA, from cDNA, from genomic libraries or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone polynucleotide sequences encoding PYR/PYL to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes. For a general overview of PCR see PCR Protocols: A Guide to Methods and Applications (Innis, M., Gelfand, D., Sninsky, J. and White, T., eds.), Academic Press, San Diego (1990). Appropriate primers and probes for identifying sequences from plant tissues are generated from comparisons of the sequences provided here with other related genes.
[0096] In some embodiments, the partial or entire genome of a number of plants has been sequenced and open reading frames identified. By a BLAST search, one can identify the coding sequence for wild-type PYR/PYL in various plants.
III. Methods of Making Hypersensitive PYR/PYL Receptor Polypeptides
[0097] In another aspect, the present invention provides for methods of making ABA hypersensitive PYR/PYL receptor polypeptides comprising one or more amino acid substitutions. In some embodiments, the method comprises mutagenizing a wild-type PYR/PYL receptor and determining whether the mutagenized PYR/PYL receptor is hypersensitive to ABA.
[0098] Mutated PYR/PYL receptor polypeptides can be constructed by mutating the DNA sequences that encode the corresponding wild-type PYR/PYL receptor polypeptide (e.g., a wild-type PYR/PYL polypeptide of any of SEQ ID NOs:1-119, having any of SEQ ID NO:s 120-123, or a corresponding variant from which the mutant PYR/PYL receptor polypeptide of the invention is derived), such as by using site-directed or random mutagenesis. Nucleic acid molecules encoding the wild-type PYR/PYL receptor polypeptide can be mutated by a variety of polymerase chain reaction (PCR) techniques well-known to one of ordinary skill in the art. (See, e.g., PCR Strategies (M. A. Innis, D. H. Gelfand, and J. J. Sninsky eds., 1995, Academic Press, San Diego, Calif.) at Chapter 14; PCR Protocols: A Guide to Methods and Applications (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White eds., Academic Press, N Y, 1990).
[0099] As a non-limiting example, mutagenesis may be accomplished using site-directed mutagenesis, in which point mutations, insertions, or deletions are made to a DNA template. Kits for site-directed mutagenesis are commercially available, such as the QuikChange Site-Directed Mutagenesis Kit (Stratagene). Briefly, a DNA template to be mutagenized is amplified by PCR according to the manufacturer's instructions using a high-fidelity DNA polymerase (e.g., Pfu Turbo) and oligonucleotide primers containing the desired mutation. Incorporation of the oligonucleotides generates a mutated plasmid, which can then be transformed into suitable cells (e.g., bacterial or yeast cells) for subsequent screening to confirm mutagenesis of the DNA.
[0100] As another non-limiting example, mutagenesis may be accomplished by means of error-prone PCR amplification (ePCR), which modifies PCR reaction conditions (e.g., using error-prone polymerases, varying magnesium or manganese concentration, or providing unbalanced dNTP ratios) in order to promote increased rates of error in DNA replication. Kits for ePCR mutagenesis are commercially available, such as the GeneMorph PCR Mutagenesis kit (Stratagene) and Diversify PCR Random Mutagenesis Kit (Clontech). Briefly, DNA polymerase (e.g., Taq polymerase), salt (e.g., MgCl2, MgSO4, or MnSO4), dNTPs in unbalanced ratios, reaction buffer, and DNA template are combined and subjected to standard PCR amplification according to manufacturer's instructions. Following ePCR amplification, the reaction products are cloned into a suitable vector to construct a mutagenized library, which can then be transformed into suitable cells (e.g., yeast cells) for subsequent screening (e.g., via a two-hybrid screen) as described below.
[0101] Alternatively, mutagenesis can be accomplished by recombination (i.e. DNA shuffling). Briefly, a shuffled mutant library is generated through DNA shuffling using in vitro homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations. Methods of performing DNA shuffling are known in the art (see, e.g., Stebel, S. C. et al., Methods Mol Biol 352:167-190 (2007)).
[0102] Optionally, multiple rounds of mutagenesis may be performed in order to improve the efficiency of mutant proteins isolated. Thus, in some embodiments, PYR/PYL mutants isolated from ePCR and subsequent screening may be pooled and used as templates for later rounds of mutagenesis.
[0103] In some embodiments, the variants are generated by exposing a plant of plant seeds or cells to a mutagen selecting the plant or cell carrying a hypersensitive PYR/PYL polypeptide as described herein by phenotype or genotype. Examples of mutagens include, e.g., chemical mutagens (e.g., EMS) or radiological mutagens. Variants having a desired mutation can be selected based on phenotype of genotype (e.g., by using TILLING techniques).
[0104] In some embodiments, the method comprises mutagenizing a wild-type PYR/PYL receptor in situ and determining whether the mutagenized PYR/PYL receptor is hypersensitive to ABA. Mutated PYR/PYL receptor polypeptides can be constructed by mutating the DNA sequences that encode the corresponding wild-type PYR/PYL receptor polypeptide (e.g., a wild-type PYR/PYL polypeptide of any of SEQ ID NOs:1-119, having any of SEQ ID NO:s 120-123, or a corresponding variant from which the mutant PYR/PYL receptor polypeptide of the invention is derived), such as by using site-directed or random mutagenesis.
IV. Screening for Hypersensitive PYR/PYL Receptor Polypeptides
[0105] The hypersensitivity of the mutant PYR/PYL receptors described herein can be measured in several alternative ways. When expressed in yeast, most wild-type PYR/PYL receptors will only bind to the type 2 protein phosphatase (PP2C) HAB1 (or other PP2Cs) when the appropriate yeast cells are grown in the presence of ABA. Thus, in some embodiments, hypersensitivity can be measured by determining the ability of a PYR/PYL mutant receptor, expressed in yeast, to bind to and inactivate PP2C in yeast to a greater extent than a control PYR/PYL receptor expressed in yeast. In some embodiments, the hypersensitive mutant PYR/PYL receptor comprises mutations that result in the mutated receptor inhibiting the activity of the PP2C in a phosphatase assay in the presence of ABA at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% or more as compared to a wild-type or other control PYR/PYL receptor in the presence of the same concentration of ABA. Several test concentrations ranging from low nM to low M could be conducted to infer IC.sub.50 values and the IC.sub.50 values of hypersensitive mutants are substantially lower than appropriate wild type controls.
[0106] Alternatively, cell-based or plant-based methods of screening can be used. For example, cells that naturally express a wild-type PYR/PYL receptor polypeptide or that recombinantly express a wild-type or mutated PYR/PYL receptor polypeptide can be used. In some embodiments, the cells used are plant cells, animal cells, bacterial cells, fungal cells, including but not limited to yeast cells, insect cells, or mammalian cells. In general terms, the screening methods involve comparing the activity of a mutated PYR/PYL receptor polypeptide to the activity of a wild-type PYR/PYL receptor polypeptide in the presence of ABA, e.g., by comparing ABA-regulated gene expression in the wild-type and mutant PYR/PYL receptor-expressing cells or plants.
[0107] One exemplary assay involves testing whether a mutated PYR/PYL receptor can bind to a type 2 protein phosphatase (PP2C) (e.g., Homology to ABI1 (HAB1)) in the presence of ABA. Binding assays can involve contacting a mutated PYR/PY1 receptor polypeptide with a PP2C and allowing sufficient time for the PYR/PYL receptor and PP2C to form a binding complex. Any binding complexes formed can be detected using any of a number of established analytical techniques. Protein binding assays include, but are not limited to, methods that measure co-precipitation or co-migration on non-denaturing SDS-polyacrylamide gels, and co-migration on Western blots (see, e.g., Bennet, J. P. and Yamamura, H. I. (1985) Neurotransmitter, Hormone or Drug Receptor Binding Methods, in Neurotransmitter Receptor Binding (Yamamura, H. I., et al., eds.), pp. 61-89. Other binding assays involve the use of mass spectrometry or NMR techniques to identify molecules bound to the PYR/PYL polypeptide. The PYR/PYL polypeptide protein utilized in such assays can be naturally expressed, cloned or synthesized.
[0108] In some embodiments, mammalian or yeast two-hybrid approaches (see, e.g., Bartel, P. L. et. al. Methods Enzymol, 254:241 (1995)) can be used to identify polypeptides or other molecules that interact or bind when expressed together in a cell. In some embodiments, a hypersensitive PYR/PYL polypeptide is identified in a two-hybrid assay between a PYR/PYL polypeptide and a PP2C polypeptide, wherein the PYR/PYL polypeptide and the PP2C bind in the presence of ABA.
[0109] In another exemplary assay, the level of basal activity of a mutated PYR/PYL receptor polypeptide (i.e., level of activity in the absence of ABA) can be determined using an enzymatic phosphatase assay, in which the PYR/PYL receptor and PP2C are incubated in the presence of ABA. In this type of assay, a decrease in phosphatase activity in the presence of ABA to a greater extent than occurred for a control PYR/PYL receptor is indicative of hypersensitive PYR/PYL receptor. A decrease in phosphatase activity can be determined and quantified using any detection reagent known in the art, e.g., a colorimetric detection reagent such as para-nitrophenylphosphate.
[0110] Hypersensitive PYR/PYL receptor polypeptides that are initially identified by any of the foregoing screening methods can be further tested to validate the apparent activity and/or determine other biological effects of the hypersensitive PYR/PYL receptor polypeptide. In some cases, the PYR/PYL receptor polypeptide is tested for the ability to affect plant stress (e.g., drought tolerance and/or high salt tolerance), seed germination, or another phenotype affected by ABA. A number of such assays and phenotypes are known in the art and can be employed according to the methods of the invention.
V. Recombinant Expression Vectors
[0111] Once a polynucleotide encoding a mutated PYR/PYL receptor polypeptide is obtained, it can also be used to prepare an expression cassette for expressing the mutated PYR/PYL receptor polypeptide in a transgenic plant, directed by a heterologous promoter. Increased expression of mutated PYR/PYL polynucleotide is useful, for example, to produce plants that selectively activate PYR/PYL receptors, thus enhancing stress tolerance.
[0112] Any of a number of means well known in the art can be used to drive mutated PYR/PYL activity or expression in plants. Any organ can be targeted, such as shoot vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit. Alternatively, the mutated PYR/PYL polynucleotide can be expressed specifically in certain cell and/or tissue types within one or more organs (e.g., guard cells in leaves using a guard cell-specific promoter). Alternatively, the mutated PYR/PYL polynucleotide can be expressed constitutively (e.g., using the CaMV 35S promoter).
[0113] To use a polynucleotide sequence for a mutated PYR/PYL receptor polypeptide in the above techniques, recombinant DNA vectors suitable for transformation of plant cells are prepared. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, e.g., Weising et al. Ann. Rev. Genet. 22:421-477 (1988). A DNA sequence coding for the mutated PYR/PYL receptor polypeptide preferably will be combined with transcriptional and translational initiation regulatory sequences which will direct the transcription of the sequence from the gene in the intended tissues of the transformed plant.
[0114] For example, a plant promoter fragment may be employed to direct expression of the mutated PYR/PYL polynucleotide in all tissues of a regenerated plant. Such promoters are referred to herein as constitutive promoters and are active under most environmental conditions and states of development or cell differentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1- or 2-promoter derived from T-DNA of Agrobacterium tumafaciens, and other transcription initiation regions from various plant genes known to those of skill.
[0115] Alternatively, the plant promoter may direct expression of the mutated PYR/PYL receptor protein in a specific tissue (tissue-specific promoters) or may be otherwise under more precise environmental control (inducible promoters). Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only in certain tissues, such as leaves or guard cells (including but not limited to those described in WO 2005/085449; U.S. Pat. No. 6,653,535; Li et al., Sci China C Life Sci. 2005 April; 48(2):181-6; Husebye, et al., Plant Physiol, April 2002, Vol. 128, pp. 1180-1188; and Plesch, et al., Gene, Volume 249, Number 1, 16 May 2000, pp. 83-89(7)). Examples of environmental conditions that may affect transcription by inducible promoters include anaerobic conditions, elevated temperature, or the presence of light.
[0116] If proper protein expression is desired, a polyadenylation region at the 3-end of the coding region should be included. The polyadenylation region can be derived from a naturally occurring PYR/PYL gene, from a variety of other plant genes, or from T-DNA.
[0117] The vector comprising the sequences (e.g., promoters or PYR/PYL coding regions) will typically comprise a marker gene that confers a selectable phenotype on plant cells. For example, the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosluforon or Basta.
[0118] In some embodiments, the mutated PYR/PYL nucleic acid sequence is expressed recombinantly in plant cells. A variety of different expression constructs, such as expression cassettes and vectors suitable for transformation of plant cells, can be prepared. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, e.g., Weising et al. Ann. Rev. Genet. 22:421-477 (1988). A DNA sequence coding for a PYR/PYL protein can be combined with cis-acting (promoter) and trans-acting (enhancer) transcriptional regulatory sequences to direct the timing, tissue type and levels of transcription in the intended tissues of the transformed plant. Translational control elements can also be used.
[0119] Embodiments of the present invention also provide for a mutated PYR/PYL nucleic acid operably linked to a promoter which, in some embodiments, is capable of driving the transcription of the PYR/PYL coding sequence in plants. The promoter can be, e.g., derived from plant or viral sources. The promoter can be, e.g., constitutively active, inducible, or tissue specific. In construction of recombinant expression cassettes, vectors, transgenics, of the invention, a different promoters can be chosen and employed to differentially direct gene expression, e.g., in some or all tissues of a plant or animal.
Constitutive Promoters
[0120] A fragment can be employed to direct expression of a mutated PYR/PYL nucleic acid in all transformed cells or tissues, e.g., as those of a regenerated plant. The term constitutive regulatory element means a regulatory element that confers a level of expression upon an operatively linked nucleic molecule that is relatively independent of the cell or tissue type in which the constitutive regulatory element is expressed. A constitutive regulatory element that is expressed in a plant generally is widely expressed in a large number of cell and tissue types. Promoters that drive expression continuously under physiological conditions are referred to as constitutive promoters and are active under most environmental conditions and states of development or cell differentiation.
[0121] A variety of constitutive regulatory elements useful for ectopic expression in a transgenic plant are well known in the art. The cauliflower mosaic virus 35S (CaMV 35S) promoter, for example, is a well-characterized constitutive regulatory element that produces a high level of expression in all plant tissues (Odell et al., Nature 313:810-812 (1985)). The CaMV 35S promoter can be particularly useful due to its activity in numerous diverse plant species (Benfey and Chua, Science 250:959-966 (1990); Futterer et al., Physiol. Plant 79:154 (1990); Odell et al., supra, 1985). A tandem 35S promoter, in which the intrinsic promoter element has been duplicated, confers higher expression levels in comparison to the unmodified 35S promoter (Kay et al., Science 236:1299 (1987)). Other useful constitutive regulatory elements include, for example, the cauliflower mosaic virus 19S promoter; the Figwort mosaic virus promoter; and the nopaline synthase (nos) gene promoter (Singer et al., Plant Mol. Biol. 14:433 (1990); An, Plant Physiol. 81:86 (1986)).
[0122] Additional constitutive regulatory elements including those for efficient expression in monocots also are known in the art, for example, the pEmu promoter and promoters based on the rice Actin-1 5 region (Last et al., Theor. Appl. Genet. 81:581 (1991); Mcelroy et al., Mol. Gen. Genet. 231:150 (1991); Mcelroy et al., Plant Cell 2:163 (1990)). Chimeric regulatory elements, which combine elements from different genes, also can be useful for ectopically expressing a nucleic acid molecule encoding a mutated PYR/PYL receptor protein (Comai et al., Plant Mol. Biol. 15:373 (1990)).
[0123] Other examples of constitutive promoters include the 1- or 2-promoter derived from T-DNA of Agrobacterium tumafaciens (see, e.g., Mengiste (1997) supra; O'Grady (1995) Plant Mol. Biol. 29:99-108); actin promoters, such as the Arabidopsis actin gene promoter (see, e.g., Huang (1997) Plant Mol. Biol. 1997 33:125-139); alcohol dehydrogenase (Adh) gene promoters (see, e.g., Millar (1996) Plant Mol. Biol. 31:897-904); ACT11 from Arabidopsis (Huang et al. Plant Mol. Biol. 33:125-139 (1996)), Cat3 from Arabidopsis (GenBank No. U43147, Zhong et al., Mol. Gen. Genet. 251:196-203 (1996)), the gene encoding stearoyl-acyl carrier protein desaturase from Brassica napus (Genbank No. X74782, Solocombe et al. Plant Physiol. 104:1167-1176 (1994)), GPc1 from maize (GenBank No. X15596, Martinez et al. J. Mol. Biol 208:551-565 (1989)), Gpc2 from maize (GenBank No. U45855, Manjunath et al., Plant Mol. Biol. 33:97-112 (1997)), other transcription initiation regions from various plant genes known to those of skill. See also Holtorf Plant Mol. Biol. 29:637-646 (1995).
Inducible Promoters
[0124] Alternatively, a plant promoter may direct expression of the mutated PYR/PYL polynucleotide under the influence of changing environmental conditions or developmental conditions. Examples of environmental conditions that may affect transcription by inducible promoters include anaerobic conditions, elevated temperature, drought, or the presence of light. Such promoters are referred to herein as inducible promoters. In some embodiments, an inducible promoter is one that is induced by one or more environmental stressors, including but not limited to, drought, freezing cold, and high salt. For example, the invention can incorporate a drought-specific promoter such as a drought-inducible promoter of maize (e.g., the maize rab17 drought-inducible promoter (Vilardell et al. (1991) Plant Mol. Biol. 17:985-993; Vilardell et al. (1994) Plant Mol. Biol. 24:561-569)); or alternatively a cold, drought, and high salt inducible promoter from potato (Kirch (1997) Plant Mol. Biol. 33:897-909) or from Arabidopsis (e.g., the rd29A promoter (Kasuga et al. (1999) Nature Biotechnology 17:287-291). Other environmental stress-inducible promoters include promoters from the following genes: Rab21, Wsi18, Lea3, Uge1, Dip1, and R1G1B in rice (Yi et al. (2010) Planta 232:743-754).
[0125] In some embodiments, a plant promoter is a stress-inducible promoter (e.g., a drought-, cold-, or salt-inducible promoter) that comprises a dehydration-responsive element (DRE) and/or an ABA-responsive element (ABRE), including but not limited to the rd29A promoter.
[0126] Alternatively, plant promoters which are inducible upon exposure to plant hormones, such as auxins, are used to express the mutated PYR/PYL polynucleotide. For example, the invention can use the auxin-response elements E1 promoter fragment (AuxREs) in the soybean (Glycine max L.) (Liu (1997) Plant Physiol. 115:397-407); the auxin-responsive Arabidopsis GST6 promoter (also responsive to salicylic acid and hydrogen peroxide) (Chen (1996) Plant J. 10: 955-966); the auxin-inducible parC promoter from tobacco (Sakai (1996) 37:906-913); a plant biotin response element (Streit (1997) Mol. Plant Microbe Interact. 10:933-937); and, the promoter responsive to the stress hormone abscisic acid (Sheen (1996) Science 274:1900-1902).
[0127] Plant promoters inducible upon exposure to chemicals reagents that may be applied to the plant, such as herbicides or antibiotics, are also useful for expressing the mutated PYR/PYL polynucleotide. For example, the maize In2-2 promoter, activated by benzenesulfonamide herbicide safeners, can be used (De Veylder (1997) Plant Cell Physiol. 38:568-577); application of different herbicide safeners induces distinct gene expression patterns, including expression in the root, hydathodes, and the shoot apical meristem. A PYR/PYL coding sequence can also be under the control of, e.g., a tetracycline-inducible promoter, e.g., as described with transgenic tobacco plants containing the Avena sativa L. (oat) arginine decarboxylase gene (Masgrau (1997) Plant J. 11:465-473); or, a salicylic acid-responsive element (Stange (1997) Plant 11:1315-1324; Uknes et al., Plant Cell 5:159-169 (1993); Bi et al., Plant J. 8:235-245 (1995)).
[0128] Examples of useful inducible regulatory elements include copper-inducible regulatory elements (Mett et al., Proc. Natl. Acad. Sci. USA 90:4567-4571 (1993); Furst et al., Cell 55:705-717 (1988)); tetracycline and chlor-tetracycline-inducible regulatory elements (Gatz et al., Plant J. 2:397-404 (1992); Roder et al., Mol. Gen. Genet. 243:32-38 (1994); Gatz, Meth. Cell Biol. 50:411-424 (1995)); ecdysone inducible regulatory elements (Christopherson et al., Proc. Natl. Acad. Sci. USA 89:6314-6318 (1992); Kreutzweiser et al., Ecotoxicol. Environ. Safety 28:14-24 (1994)); heat shock inducible regulatory elements (Takahashi et al., Plant Physiol. 99:383-390 (1992); Yabe et al., Plant Cell Physiol. 35:1207-1219 (1994); Ueda et al., Mol. Gen. Genet. 250:533-539 (1996)); and lac operon elements, which are used in combination with a constitutively expressed lac repressor to confer, for example, IPTG-inducible expression (Wilde et al., EMBO J. 11:1251-1259 (1992)). An inducible regulatory element useful in the transgenic plants of the invention also can be, for example, a nitrate-inducible promoter derived from the spinach nitrite reductase gene (Back et al., Plant Mol. Biol. 17:9 (1991)) or a light-inducible promoter, such as that associated with the small subunit of RuBP carboxylase or the LHCP gene families (Feinbaum et al., Mol. Gen. Genet. 226:449 (1991); Lam and Chua, Science 248:471 (1990)).
Tissue-Specific Promoters
[0129] Alternatively, the plant promoter may direct expression of the mutated PYR/PYL polynucleotide in a specific tissue (tissue-specific promoters). Tissue specific promoters are transcriptional control elements that are only active in particular cells or tissues at specific times during plant development, such as in vegetative tissues or reproductive tissues.
[0130] Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only (or primarily only) in certain tissues, such as vegetative tissues, e.g., roots or leaves, or reproductive tissues, such as fruit, ovules, seeds, pollen, pistols, flowers, or any embryonic tissue, or epidermis or mesophyll. Reproductive tissue-specific promoters may be, e.g., ovule-specific, embryo-specific, endosperm-specific, integument-specific, seed and seed coat-specific, pollen-specific, petal-specific, sepal-specific, or some combination thereof. In some embodiments, the promoter is cell-type specific, e.g., guard cell-specific.
[0131] Epidermal-specific promoters include, for example, the Arabidopsis LTP1 promoter (Thoma et al. (1994) Plant Physiol. 105(1):35-45), the CER1 promoter (Aarts et al. (1995) Plant Cell 7:2115-27), and the CER6 promoter (Hooker et al. (2002) Plant Physiol 129:1568-80), and the orthologous tomato LeCER6 (Vogg et al. (2004) J. Exp Bot. 55:1401-10).
[0132] Guard cell-specific promoters include, for example, the DGP1 promoter (Li et al. (2005) Science China C Life Sci. 48:181-186).
[0133] Other tissue-specific promoters include seed promoters. Suitable seed-specific promoters are derived from the following genes: MAC1 from maize (Sheridan (1996) Genetics 142:1009-1020); Cat3 from maize (GenBank No. L05934, Abler (1993) Plant Mol. Biol. 22:10131-1038); vivparous-1 from Arabidopsis (Genbank No. U93215); atmyc1 from Arabidopsis (Urao (1996) Plant Mol. Biol. 32:571-57; Conceicao (1994) Plant 5:493-505); napA from Brassica napus (GenBank No. J02798, Josefsson (1987) JBL 26:12196-1301); and the napin gene family from Brassica napus (Sjodahl (1995) Planta 197:264-271).
[0134] A variety of promoters specifically active in vegetative tissues, such as leaves, stems, roots and tubers, can also be used to express polynucleotides encoding mutated PYR/PYL receptor polypeptides. For example, promoters controlling patatin, the major storage protein of the potato tuber, can be used, see, e.g., Kim (1994) Plant Mol. Biol. 26:603-615; Martin (1997) Plant J. 11:53-62. The ORF13 promoter from Agrobacterium rhizogenes that exhibits high activity in roots can also be used (Hansen (1997) Mol. Gen. Genet. 254:337-343. Other useful vegetative tissue-specific promoters include: the tarin promoter of the gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (Bezerra (1995) Plant Mol. Biol. 28:137-144); the curculin promoter active during taro corm development (de Castro (1992) Plant Cell 4:1549-1559) and the promoter for the tobacco root-specific gene TobRB7, whose expression is localized to root meristem and immature central cylinder regions (Yamamoto (1991) Plant Cell 3:371-382).
[0135] Leaf-specific promoters, such as the ribulose biphosphate carboxylase (RBCS) promoters, can also be used. For example, the tomato RBCS1, RBCS2 and RBCS3A genes are expressed in leaves and light-grown seedlings, only RBCS1 and RBCS2 are expressed in developing tomato fruits (Meier (1997) FEBS Lett. 415:91-95). A ribulose bisphosphate carboxylase promoters expressed almost exclusively in mesophyll cells in leaf blades and leaf sheaths at high levels, described by Matsuoka (1994) Plant J. 6:311-319, can be used. Another leaf-specific promoter is the light harvesting chlorophyll a/b binding protein gene promoter, see, e.g., Shiina (1997) Plant Physiol. 115:477-483; Casal (1998) Plant Physiol. 116:1533-1538. The Arabidopsis thaliana myb-related gene promoter (Atmyb5) described by Li (1996) FEBS Lett. 379:117-121, is leaf-specific. The Atmyb5 promoter is expressed in developing leaf trichomes, stipules, and epidermal cells on the margins of young rosette and cauline leaves, and in immature seeds. Atmyb5 mRNA appears between fertilization and the 16 cell stage of embryo development and persists beyond the heart stage. A leaf promoter identified in maize by Busk (1997) Plant J. 11:1285-1295, can also be used.
[0136] Another class of useful vegetative tissue-specific promoters are meristematic (root tip and shoot apex) promoters. For example, the SHOOTMERISTEMLESS and SCARECROW promoters, which are active in the developing shoot or root apical meristems, described by Di Laurenzio (1996) Cell 86:423-433; and, Long (1996) Nature 379:66-69; can be used. Another useful promoter is that which controls the expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase HMG2 gene, whose expression is restricted to meristematic and floral (secretory zone of the stigma, mature pollen grains, gynoecium vascular tissue, and fertilized ovules) tissues (see, e.g., Enjuto (1995) Plant Cell. 7:517-527). Also useful are kn1-related genes from maize and other species which show meristem-specific expression, see, e.g., Granger (1996) Plant Mol. Biol. 31:373-378; Kerstetter (1994) Plant Cell 6:1877-1887; Hake (1995) Philos. Trans. R. Soc. Lond. B. Biol. Sci. 350:45-51. For example, the Arabidopsis thaliana KNAT1 promoter (see, e.g., Lincoln (1994) Plant Cell 6:1859-1876).
[0137] One of skill will recognize that a tissue-specific promoter may drive expression of operably linked sequences in tissues other than the target tissue. Thus, as used herein a tissue-specific promoter is one that drives expression preferentially in the target tissue, but may also lead to some expression in other tissues as well.
[0138] In another embodiment, the mutated PYR/PYL polynucleotide is expressed through a transposable element. This allows for constitutive, yet periodic and infrequent expression of the constitutively active polypeptide. The invention also provides for use of tissue-specific promoters derived from viruses including, e.g., the tobamovirus subgenomic promoter (Kumagai (1995) Proc. Natl. Acad. Sci. USA 92:1679-1683; the rice tungro bacilliform virus (RTBV), which replicates only in phloem cells in infected rice plants, with its promoter which drives strong phloem-specific reporter gene expression; the cassava vein mosaic virus (CVMV) promoter, with highest activity in vascular elements, in leaf mesophyll cells, and in root tips (Verdaguer (1996) Plant Mol. Biol. 31:1129-1139).
VI. Production of Plants Comprising Hypersensitive Mutations
[0139] In another aspect, the present invention provides for transgenic plants comprising recombinant expression cassettes for expressing a hypersensitive PYR/PYL receptor protein as described herein in a plant. In some embodiments, a transgenic plant is generated that contains a complete or partial sequence of a polynucleotide that is derived from a species other than the species of the transgenic plant. It should be recognized that transgenic plants encompass the plant or plant cell in which the expression cassette is introduced as well as progeny of such plants or plant cells that contain the expression cassette, including the progeny that have the expression cassette stably integrated in a chromosome.
[0140] A recombinant expression vector comprising a PYR/PYL coding sequence driven by a heterologous promoter may be introduced into the genome of the desired plant host by a variety of conventional techniques. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA construct can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. Alternatively, the DNA construct may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. While transient expression of the constitutively active PYR/PYL receptor is encompassed by the invention, generally expression of construction of the invention will be from insertion of expression cassettes into the plant genome, e.g., such that at least some plant offspring also contain the integrated expression cassette.
[0141] Microinjection techniques are also useful for this purpose. These techniques are well known in the art and thoroughly described in the literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al. EMBO 1 3:2717-2722 (1984). Electroporation techniques are described in Fromm et al. Proc. Natl. Acad. Sci. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein et al. Nature 327:70-73 (1987).
[0142] Agrobacterium tumefaciens-mediated transformation techniques, including disarming and use of binary vectors, are well described in the scientific literature. See, for example, Horsch et al. Science 233:496-498 (1984), and Fraley et al. Proc. Natl. Acad. Sci. USA 80:4803 (1983).
[0143] Transformed plant cells derived by any of the above transformation techniques can be cultured to regenerate a whole plant that possesses the transformed genotype and thus the desired phenotype such as enhanced abiotic stress resistance. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee et al. Ann. Rev. of Plant Phys. 38:467-486 (1987).
[0144] One of skill will recognize that after the expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
[0145] The expression cassettes of the invention can be used to confer abiotic stress resistance on essentially any plant. Thus, the invention has use over a broad range of plants, including species from the genera Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panieum, Pannesetum, Persea, Pisum, Pyrus, Prunus, Raphanus, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vitis, Vigna, and, Zea. In some embodiments, the plant is selected from the group consisting of rice, maize, wheat, soybeans, cotton, canola, turfgrass, and alfalfa. In some embodiments, the plant is an ornamental plant. In some embodiment, the plant is a vegetable- or fruit-producing plant.
[0146] Those of skill will recognize that a number of plant species can be used as models to predict the phenotypic effects of transgene expression in other plants. For example, it is well recognized that both tobacco (Nicotiana) and Arabidopsis plants are useful models of transgene expression, particularly in other dicots.
[0147] In some embodiments, the plants of the invention have enhanced ABA-mediated phenotypes, for example enhanced seed dormancy, as compared to plants that are otherwise identical except for expression of the hypersensitive PYR/PYL receptor polypeptide. Those of skill in the art will recognize that ABA is a well-studied plant hormone and that ABA mediates many changes in characteristics, any of which can be monitored to determine changes in phenotype. In some embodiments, an enhanced ABA-mediated phenotype is manifested by altered timing of seed germination or altered stress (e.g., drought, freezing cold, and/or salt) tolerance.
[0148] Abiotic stress resistance can be assayed according to any of a number of well-known techniques. For example, for drought tolerance, plants can be grown under conditions in which less than optimum water is provided to the plant. Drought resistance can be determined by any of a number of standard measures including turgor pressure, growth, yield, and the like. In some embodiments, a transgenic plant expressing a mutated PYR/PYL receptor as described herein has enhanced drought tolerance if the loss of turgor in the transgenic plant is reduced by at least about 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more as compared to a non-transgenic control plant over a defined period of time (e.g., over the course of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, e.g., 3, 4, 5 weeks or more).
[0149] In some embodiments, the enhanced ABA-mediated phenotype is enhanced tolerance to moderate or high salinity. Salinity tolerance can be determined by any of a number of standard measures, including germination, growth, yield, or plant survival, leaf injury, premature loss of chlorophyll, and the like. In some embodiments, transgenic plants expressing a mutated PYR/PYL receptor as described herein have enhanced salt tolerance if the survival of the transgenic plants under moderate-salt or high-salt conditions (e.g., about 50 mM, 100 mM, 150 mM, 200 mM, 250 mM, 300 mM NaCl or higher) is increased by at least about 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more as compared to a non-transgenic control plant over a defined period of time (e.g., over the course of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, e.g., 3, 4, 5 weeks or more).
[0150] Plant gene manipulations can now be precisely tailored in non-transgenic organisms using the CRISPR/Cas9 genome editing method. In this bacterial antiviral and transcriptional regulatory system, a complex of two small RNAsthe CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA)directs the nuclease (Cas9) to a specific DNA sequence complementary to the crRNA (Jinek, M., et al. Science 337, 816-821 (2012)). Binding of these RNAs to Cas9 involves specific sequences and secondary structures in the RNA. The two RNA components can be simplified into a single element, the single guide-RNA (sgRNA), which is transcribed from a cassette containing a target sequence defined by the user (Jinek, M., et al. Science 337, 816-821 (2012)). This system has been used for genome editing in humans, zebrafish, Drosophila, mice, nematodes, bacteria, yeast, and plants (Hsu, P. D., et al., Cell 157, 1262-1278 (2014)). In this system the nuclease creates double stranded breaks at the target region programmed by the sgRNA. These can be repaired by non-homologous recombination, which often yields inactivating mutations. The breaks can also be repaired by homologous recombination, which enables the system to be used for gene targeted gene replacement (Li, J.-F., et al. Nat. Biotechnol. 31, 688-691, 2013; Shan, Q., et al. Nat. Biotechnol. 31, 686-688, 2013). The hypersensitive mutations described in this application can be introduced into plants using the CAS9/CRISPR system.
[0151] Accordingly, in some embodiments, instead of generating a transgenic plant, a native PYR/PYR coding sequence in a plant or plant cell can be altered in situ to generate a plant or plant cell carrying a polynucleotide encoding a hypersensitive PYR/PYL polypeptide as described herein. For example, in some embodiments, CRISPR technology is used to introduce one or more nucleotide changes into a PYR/PYL coding sequence in situ to change the appropriate codon to make a change corresponding to F61X, V81X, I110X, or V163X of SEQ ID NO:1. The CRISPR/Cas system has been modified for use in prokaryotic and eukaryotic systems for genome editing and transcriptional regulation. The CRISPR/Cas system refers to a widespread class of bacterial systems for defense against foreign nucleic acid. CRISPR/Cas systems are found in a wide range of eubacterial and archaeal organisms. CRISPR/Cas systems include type I, II, and III sub-types. Wild-type type II CRISPR/Cas systems utilize the RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid. Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726-737; Nat. Rev. Microbiol. 2011 June; 9(6): 467-477; Hou, et al., Proc Natl Acad Sci USA. 2013 Sep. 24; 110(39):15644-9; Sampson et al., Nature. 2013 May 9; 497(7448):254-7; and Jinek, et al., Science. 2012 Aug. 17; 337(6096):816-21.
[0152] Accordingly, in one aspect, a method is provided of using CRISPR/CAS9 to introduce at least one of the mutation described herein into a plant cell is performed. In some embodiments, a method of altering a (e.g., native) nucleic acid encoding PYR/PYL polypeptide in a plant is provided. In some embodiments, the method comprises introducing into the plant cell containing and expressing a DNA molecule having a target nucleic acid encoding PYR/PYL polypeptide an engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system. In some embodiments, the CRISPR-Cas system comprises one or more vectors comprising: a) a first regulatory element operable in a plant cell operably linked to at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes with the target sequence, and b) a second regulatory element operable in a plant cell operably linked to a nucleotide sequence encoding a Type-II Cas9 protein, wherein components (a) and (b) are located on same or different vectors of the system, whereby the guide RNA targets the target sequence and the Cas9 protein cleaves the DNA molecule, whereby at least one of the hypersensitive mutations described herein is introduced into the target nucleic acid encoding the PYR/PYL polypeptide. In some embodiments, the PRY/PYL polypeptide is selected from any of SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, or 119 or a substantially identical polypeptide. In some embodiments, the plant is from a genus selected from Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lycopersicon, Malta, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panieum, Pannesetum, Persea, Pisum, Pyrus, Prunus, Raphanus, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vitis, Vigna, and, Zea. In some embodiments, the plant is selected from the group consisting of rice, maize, wheat, and soybean. In some embodiments, the hypersensitive mutation introduced to the target nucleic acid is (corresponding to their position in Arabidopsis PYR1 (SEQ ID NO:1)): F61, V81, I110, E141, or A160 or a combination thereof. In some embodiments, no other mutations are introduced into the target nucleic acid. Also provided as a plant or plant cell resulting from the above-described method. Such a plant will contain a non-naturally-occurring nucleic acid sequence encoding the hypersensitive PYR/PYL polypeptide.
VII. PYR/PYL Fusion Proteins
[0153] In some embodiments, the hypersensitive PYR/PYL polypeptides described herein are provided as fusion proteins, i.e., translational fusions with one or more fusion partner. In some embodiments, a hypersensitive PYR/PYL polypeptide is fused with a transcriptional activation or modulation domain. A non-limiting example of such a domain is VP16 or VP64. The fusion proteins can further comprise a nuclear localization signal sequence such that the fusion protein, when translated in a eukaryotic host cell, is localized to the cell nucleus. Also provided are polynucleotides encoding such fusion proteins as well as host cells comprising and expressing such polynucleotides. The polynucleotides in such instances will be heterologous to the host cell, i.e., will not be naturally occurring, for example transformed into the cell.
[0154] Such fusion proteins are useful, for example, in controlling eukaryotic gene expression in the cell when co-expressed with a sequence-specific DNA binding domain fused with) ABA INSENSITIVE 1 (ABI1) or other proteins having specific binding affinity for PYR/PYL proteins binding ABA. Exemplary sequence-specific DNA binding domains include, but are not limited to zinc-finger proteins, TALENS, transcription factor DNA binding domains, and RNA-guided DNA-binding domains of inactive Cas9 (dCas9). When both fusion proteins are co-expressed in the cell in the presence of ABA, the two fusion proteins will co-localized due to the binding of ABA1 to the ABA-binding PYR/PYL protein, thereby bringing the transcriptional activation or modulation domain in proximity to the target promoter, thereby regulating gene expression. Examples of systems and their use in gene regulation, are described in, e.g., Konermann et al., Nature 500:472-476 (2013) and Liang et al., Science Vol. 4 Issue 164 (2011).
RNA Directed Genome Modification
[0155] In one aspect provided herein is a method for introducing a mutation in situ at a PYR/PYL mutation target site in a plant cell genome, as described herein. For example, in some embodiments, the PYR/PYL mutation target site comprises a nucleic acid that encodes for V89 of PYL-E or E149 of PYL. In certain embodiments the method comprises introducing into the plant cell: 1) a CRISPR ribonucleic acid (crRNA) that includes a sequence substantially identical to SEQ ID NOS: 363, 364, 365, 366, 367 or 369; 2) a transacting ribonucleic acid (tracRNA); 3) a nuclease (e.g., Cas9); and 4) a repair nucleic acid that can undergo homologous recombination that contains the mutation. According to the subject method, the crRNA and tracRNA directs the nuclease to the PYR/PYL mutation target site in a plant cell genome. Upon its recruitment, the nuclease (e.g., Cas9) creates a double strand break at the PYR/PYL mutation target site. The double strand break at the PYR/PYL mutation target site facilitates homologous recombination of the repair nucleic acid containing the mutation with a region of the plant cell genome that includes the PYR/PYL mutation target site, thereby introducing the mutation at the PYR/PYL mutation target site.
[0156] Mutations can be introduced into any suitable plant cell using the subject method. In some embodiments, the plant cell is a plant embryo. In certain embodiments, the plant cell is a maize plant cell.
[0157] Each component of the method can be introduced into the plant cell using any suitable method known in the art. In certain embodiments, the crRNA and tracRNA are introduced into the cell as an expression cassette containing a polynucleotide (i.e., DNA) encoding the crRNA and/or traRNA. In some embodiments, the expression cassette includes an RNA polymerase promoter operably linked to the polynucleotide encoding the crRNA and/or traRNA, thereby allowing transcription of the crRNA and/or traRNA. In some embodiments, the Cas9 is introduced into the cell as an expression vector containing a promoter operably linked to a polynucleotide encoding Cas9. Any suitable promoter can be used, including but not limited to, the promoters described herein. In certain embodiments, the promoter is a ubiquitin-1 promoter (e.g., prUbi-10). DNA construct (e.g., the expression cassettes and vectors described herein) can be introduced directly to plant tissue, for example, using ballistic methods, such as DNA particle bombardment.
[0158] Each of the crRNA, and the tracRNA, nuclease can be introduced separately or together as part of one expression vector into the cell of interest (e.g., a maize plant cell). In certain embodiments, the crRNA and the tracRNA are fused together to create a guide ribonucleic acid (gRNA). In some embodiments, the gRNA includes, from 5 to 3, a crNA linked to a tracRNA. In certain embodiments the crRNA, tracRNA, and nuclease (e.g., Cas9) are introduced together as nucleic acid cassettes included in one expression vector. Each component of the subject method is discussed in detail below.
Guide RNA
[0159] In one aspect provided, provided herein is a guide RNA (gRNA) comprising a CRISPR ribonucleic acid (crRNA) and a transacting RNA (tracRNA).
[0160] The crRNA of the subject gRNA comprises a nucleotide sequence that is complementary to a sequence in a PYR/PYL mutation target site and includes a sequence that is substantially identical to SEQ ID NOS: 363, 364, 365, 366, 367 or 369. In certain embodiments, the crRNA has a sequence that is substantially identical to SEQ ID NOS: 363, 364, 365, 366, 367 or 369. The subject crRNAs provided herein are particularly useful for creating mutations at a PYR/PYL mutation target site that includes a nucleic acid encoding for an amino acid corresponding to V89 (SEQ ID NOS: 363, 364, 365, 366, 367) and E149 (SEQ ID NO:369) of PYL-E. As used herein, a PYR/PYL mutation target site refers to a region of a polynucleotide encoding for a PYR/PYL receptor that includes the site where a mutation is introduced by the subject method. The crRNA interacts with the PYR/PYL mutation target site in a sequence-specific manner by hybridization to a sequence in the PYR/PYL mutation target site (e.g., the complementary strand of the PYR/PYL mutation target site) and, together with the tracRNA of the gRNA, recruits Cas9 endonuclease to the PYR/PYL mutation target site. Cas9 endonuclease recruited by the gRNA to the PYR/PYL mutation target site introduces a double strand break in the PYR/PYL mutation target site. Any of the mutations described herein can be made in any wildtype PYR/PYL polypeptide. Analogous amino acid substitutions can be made, for example, in PYR/PYL receptors other than PYL-E by aligning the PYR/PYL receptor polypeptide sequence to be mutated with the PYL-E receptor polypeptide sequence. Analogous amino acid positions in PYR/PYL receptors are shown in
[0161] In some embodiments, the PYR/PYL mutation target site has the sequence of SEQ ID NO: 362, which includes a nucleic acid encoding for V89 of PYL-E. In some embodiments, the PYR/PYL mutation target site has the sequence of SEQ ID NO:368, which includes a nucleic acid encoding for E149 of PYL-E.
[0162] In some embodiments, a crRNA has a length of 10 nucleotides (nt) to 100 nucleotides (nt). In some embodiments, the crRNA has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nt and includes a sequence that is substantially identical to SEQ ID NOS: 362, 363, 364, 365, 366 or 368. In some embodiments, the crRNA has a length of at least 17 nt. In some embodiments, the crRNA has a length of 17 nt to 18 nt, 17 nt to 19 nt, 17 nt to 20 nt, 17 nt to 21 nt, 17 nt to 22 nt, 17 nt to 23 nt, 17 nt to 24 nt, 17 nt to 25 nt, 17 nt to 30 nt, 17 nt to 35 nt, 17 nt to 40 nt, 17 nt to 45 nt, 17 nt to 50 nt, 17 nt to 55 nt, 17 nt to 60 nt, 17 nt to 65 nt, 17 nt to 70 nt, 17 nt to 75 nt, 17 nt to 80 nt, 17 nt to 85 nt, 17 nt to 90 nt, 17 nt to 95 nt, or 17 nt to 100 nt. In some embodiments, the crRNA has a length of 12 nt to 25 nt, 13 nt to 25 nt, 14 nt to 25 nt, 15 nt to 25 nt, 16 nt to 25 nt, 17 nt to 25 nt, 18 nt to 25 nt, 19 nt to 25 nt, 20 nt to 25 nt, 21 nt to 25 nt, or 22 nt to 25 nt.
[0163] In some embodiments, the crRNA is 17 nt in length, In some embodiments, the crRNA is 18 nt in length. In some embodiments, the crRNA is 19 nt in length. In some embodiments, the crRNA is 20 nt in length. In some embodiments, the crRNA is 21 nt in length. In some embodiments the crRNA is 22 nt in length. In some embodiments, the crRNA is 23 nt in length. In some embodiments, the crRNA is 24 nt in length. In some embodiments, the crRNA is 25 nt in length.
[0164] In some embodiments, the crRNA is at least 17 nt in length, In some embodiments, the crRNA is at least 18 nt in length. In some embodiments, the crRNA is at least 19 nt in length. In some embodiments, the crRNA is at least 20 nt in length. In some embodiments, the crRNA is at least 21 nt in length. In some embodiments the crRNA is at least 22 nt in length. In some embodiments, the crRNA is at least 23 nt in length. In some embodiments, the crRNA is at least 24 nt in length. In some embodiments, the crRNA is at least 25 nt in length.
[0165] In some embodiments, the guideRNA (gRNA) includes a transacting RNA (tracRNA). Transacting RNA of the subject guideRNA interacts with the crRNA to recruit a nuclease to the site of a PYR/PYL mutation target site. Upon its recruitment to the PYR/PYL mutation target site, the nuclease creates a double strand break (DSB) in the PYR/PYL mutation target site. Any suitable tracRNA capable of recruiting a Cas9 to a PYR/PYL mutation target site can be used with the subject gRNA. In some embodiments, the tracRNA is encoded by a nucleotide having a sequence that is substantially identical to SEQ ID NO: 370. In certain embodiments of the subject method, the tracRNA and the crRNA are introduced into the plant cells separately (e.g., on different expression vectors). In some embodiments, the tracRNA is linked to the crRNA and introduced into the plant cell as a guideRNA (gRNA).
[0166] In another aspect, provided herein is a nucleic acid that includes a polynucleotide encoding any of the subject gRNAs described herein.
[0167] In another aspect, provided herein is an expression cassette that includes an RNA polymerase promoter operably linked to any of the subject gRNAs described herein. Any suitable RNA polymerase promoter capable of driving transcription of the nucleic acid encoding the subject gRNA can be used. In some embodiments, the promoter is an inducible promoter, including, but not limited, to any of the inducible promoters described herein. In other embodiments, the promoter is a constitutive promoter, including, but not limited to any of the constitutive promoters described herein. In yet other embodiments, the promoter is a tissue-specific promoter, including, but not limited to, any of the tissue-specific promoters described herein. In certain embodiments, the RNA polymerase promoter is an RNA polymerase III (polIII) promoter. In particular embodiments, the polIII promoter is a U3 promoter or a U6 promoter. In certain embodiment, the expression cassette has the sequence of any one of SEQ ID NOS; 371-373.
Expression Vectors Including gRNA and Cas9 Nuclease
[0168] In another aspect, provided herein is an expression vector that includes one or more of the guide RNA (gRNA) expression cassettes provided herein and an expression cassette including a promoter operably linked to a polynucleotide encoding a CRISPR-associated endonuclease 9 (Cas9). In some embodiments, the promoter operably linked to the Cas9 is a ubiquitin-1 promoter (prUbi-10). In some embodiments, the expression includes an expression cassette containing a polynucleotide encoding a gRNA having a crRNA that is substantially identical to SEQ ID NOS: 363, 364, 365, 366, 367 (see, e.g.,
Methods of Producing PYR/PYL Variant Plants Using RNA Directed Genome Modification
[0169] Expression vectors disclosed herein are useful, for example, for introducing a mutation in a plant in situ at a genomic PYR/PYL mutation target site. Thus, in another aspect, provided herein is a method for of producing a plant having a mutation at a genomic PYR/PYL mutation target site. In some embodiments, the method includes introducing into plant cells an expression vector encoding for a gRNA and Cas9 as disclosed herein and at least one repair nucleic acid comprising the mutation of interest. According to the subject method, the crRNA and tracRNA directs the nuclease to the PYR/PYL mutation target site in a plant cell genome. Upon its recruitment, the nuclease (e.g., Cas9) creates a double strand break at the PYR/PYL mutation target site. The double strand break at the PYR/PYL mutation target site facilitates homologous recombination of the repair nucleic acid containing the mutation of interest with a region of the plant cell genome that includes the PYR/PYL mutation target site, thereby introducing the mutation at the PYR/PYL mutation target site. In certain embodiments, the repair nucleic acid has a sequence that is substantially identical to any one of the sequence of SEQ ID NOS:374 to 378. In other embodiments, the repair nucleic acid has a sequence that is complementary to a sequence that is substantially identical to any one of the sequences of SEQ ID NOS:374 to 386. In specific embodiments, the repair nucleic acid has a sequence that is substantially identical to SEQ ID NO:376. In other embodiments, the repair nucleic acid has a sequence that is complementary to a sequence that is substantially identical to SEQ ID NO:376. In another embodiment, the repair nucleic acid has a sequence that is substantially identical to SEQ ID NO:378. In other embodiments, the repair nucleic acid has a sequence that is complementary to a sequence that is substantially identical to SEQ ID NO:378. In yet another embodiment of the method, two repair nucleic acids are introduced, where the repair nucleic acids have sequences that are substantially identical to SEQ ID NO:376 and SEQ ID NO:378. In another embodiment of the method, two repair nucleic acids are introduced, where the repair nucleic acids have sequences are complementary to sequences that are substantially identical to SEQ ID NO:376 and SEQ ID NO:378.
[0170] In certain embodiments, the method further includes the step of selecting plant cells having the mutation. Selection for mutation can be performed by any useful technique known in the art, including, but not limited PCR amplification followed by sequencing, capillary electrophoresis and Nuclease Serveyer assay. In some embodiments, the method is for the production of a maize plant.
[0171] In yet another aspect, provided herein is a kit for producing a plant having a mutation in a PYR/PYL nucleic acid as described herein. In some embodiments, the kit includes any one of the subject expression vectors disclosed herein and at least one repair nucleic acid, wherein the repair nucleic acid comprises a PYL-E mutation and is capable of introducing the PYL-E mutation in situ in a plant cell genome by homologous recombination upon a Cas9 cleavage event. In certain embodiments, the kit includes a repair nucleic acid that has a sequence that is substantially identical to SEQ ID NOS:374 to 386.
EXAMPLES
[0172] The following examples are offered to illustrate, but not to limit the claimed invention.
[0173] The affinity of a receptor for a target ligand is typically determined by non-covalent interactions between ligand-binding residues and the ligand. Mutations in such residues can have negative, positive or neutral effects on the strength of the receptor-ligand interaction. The affinity of a receptor-ligand interaction is intrinsically correlated with the concentration of ligand required to elicit biological effects, with high affinity ligands requiring lower concentrations relative to low affinity ligands. A mutant receptor with increased affinity for a ligand can in some cases elicit greater biological effect relative to a wild type receptor, when both are activated under identical conditions by the same concentration of activating ligand. Thus, mutations that make a receptor hypersensitive to a ligand can be useful for engineering organisms that elicit stronger responses to the ligand relative to wild type. Furthermore, ABA hypersensitive plants possess enhanced ABA responses and improved drought tolerance (Wang, Y., et al. Plant J. 43, 413-424 (2005)). Based on these considerations, we set out to systematically establish specific ABA receptor mutations that increase ABA responsiveness. This was done by testing a collection of PYR1 variants with all possible single amino acid substitution mutations in ligand binding residues. Thus we conducted site-saturated mutagenesis of ABA-contacting residues, which we define as those that are within 5 or ABA or ABA-contacting water residues in available X-ray coordinates. This collection of mutants was constructed previously, as described in PCT Application No. PCT/US2012/043121 and Mosquna et al., Proc Natl Acad Sci USA 108: 20838-20843 (2011). This collection of mutants was made by mutagenizing a previously described pBD GAL-PYR1 template (Park, S.-Y., et al. Science 324, 1068-1071 (2011)). In response to ABA, this particular plasmid encodes a fusion protein that binds to a co-expressed GAL4 activation domain-HAB1 fusion protein, encoded by the plasmid pACT-HAB1. This binding reconstitutes a functional GAL4 transcriptional activator and subsequent transcription of a -galactosidase reporter gene, which in turn enables colorimetric based detection of agonist promoted receptor-PP2C interaction when lysed cells are exposed to the substrate X-gal. The mutant clones were individually transformed into S. cerevisiae strain Y190 containing pACT-HAB1. Yeast transformants were selected for the presence of plasmids on synthetic dextrose (SD) agar plates lacking Leu and Trp (SD-LT) and examined for PP2C interactions by using X-gal staining to monitor -gal reporter gene expression levels. Individual clones were arrayed into 96 well plates and then spotted onto SD-LT lawn (i.e. one-well) plates containing 0, 0.5 or 5.0 M (+)-ABA. Each assay plate contained 95 mutant clones and one wild type PYR1 positive control clone. The spotted cells were cultured at 30 C. for 48 hours after which they were lysed by chloroform and stained with an X-gal solution, as previously described (Park, S.-Y., et al. (2009) Science 324, 1068-1071). Positive were defined as those mutants that displayed staining on 0.5 M (+)-ABA but no staining on plates lacking (+)-ABA. After this initial screening exercise, all positives clones were retested on plates containing 0. 0.25, 0.5 and 1 (+)-ABA and stained for galactosidase activity as described above. Mutant clones showing detectable staining on 0.5 M (+)-ABA or lower were scored as hypersensitive mutants.
TABLE-US-00003 Minimal conc. For ABA Mutant SEQ ID NO: Residue WT AA Mutant response (M) WT 1 1 F61L 124 61 F L 0.25 F61M 125 61 F M 0.25 V81I 126 81 V I 0.25 V81Y 127 81 V Y 0.25 I110C 128 110 I C 0.25 I110S 129 110 I S 0.5 E141C 130 141 E C 0.5 E141I 131 141 E I 0.25 E141L 132 141 E L 0.25 E141M 133 141 E M 0.25 E141N 134 141 E N 0.5 E141T 135 141 E T 0.5 E141V 136 141 E V 0.5 E141W 137 141 E W 0.5 E141Y 138 141 E Y 0.25 A160C 139 160 A C 0.25 A160I 140 160 A I 0.25 A160V 141 160 A V 0.25
[0174] Highly Hypersensitive ABA Receptors Constructed by Combinatorial Mutagenesis
[0175] Additive or synergistic interactions between the single hypersensitive mutations identified can increase a receptor's sensitivity to ABA. To identify potentially beneficial combinations, we used combinatorial mutagenesis to construct receptors that contain combinations of subsets of the best single mutants identified and then screened these to identify receptors with increased sensitivity. Mutagenic primers complementary to the appropriate regions of PYR1 coding sequence were designed to enable the following mutations to be incorporated into a PYR1 template DNA: F61L, F61M, V81I, V81Y, I110C, I110S, E141I, E141L, E141M, E141Y, A160C, A160I, A160V. Equimolar concentrations of these primers were combined with a mixture of wild type primers for each target site (4 mol percent relative to the mutant primer pool) and the primer mix utilized with the QuickChange Lightning Multi Site-Directed PCR Mutagenesis kit (Agilent, USA) using the pBD-PYR1 template DNA. The use of wild type primers in the reaction mixtures enabled, in principle, all double, triple, quadruple and pentuple mutant combinations to be synthesized in the mutagenesis reaction. The reaction products were transformed into competent E. coli cells to yield a pool of 10,000 clones, which was then used to prepare plasmid DNA for the mutant library. The pool of mutant plasmids was subsequently introduced into the previously described pAD-HAB1 MAV99 reporter strain (Peterson, F. C., et al. (2010) Nature Structural & Molecular Biology 17, 1109-1113). In this reporter strain, a GAL4 promoter drives expression of a URA3 reporter gene in a genetic background where the endogenous URA3 gene is disrupted, which enables positive selections using uracil deficient media. Thus, mutant clones that encode receptors that can interact with HAB1 can be positively selected using this system. The transformed yeast cells containing the mutant receptor library were next plated onto growth medium lacking uracil and containing 50 nM ABA, a concentration of ABA that is too low to enable growth of control strains. 26 colonies with uracil-independent growth were identified, which were isolated and re-tested on medium lacking ABA to eliminate cones enabling ligand-independent (i.e. constitutive) interactions of receptor with HAB1. Plasmids from yeast cells containing non-constitutive receptors were isolated and sequenced, which revealed that the following 4 highly hypersensitive combination mutants had been isolated:
PYR1F61L, A160C,
PYR1F61M, A160V,
PYR1F61M, I110S, A160V,
PYR1F61L, V81I, I110C, A160V.
[0176] The plasmids for each of these mutants and their corresponding single mutations were transformed into the previously described yeast reporter strain, Y190 pAD-HAB1 (Park, S.-Y., et al. (2009) Science 324, 1068-1071). The transformed yeast cells were grown on selective media containing a range of ABA concentrations and cells lysed and stained to reveal -galactosidase activity, as shown in
[0177] Increased Affinity of a Mutant Hypersensitive Receptor
[0178] The ligand sensitivity of PYR1 and HAB1 yeast two hybrid strains generally correlates with receptor affinity. To examine if this was the case for the hypersensitive mutations identified by our functional screens, we conducted isothermal titration calorimetry (ITC) to measure the heat produced by a mutant receptor-ABA binding reaction and infer the ligand binding dissociation constant (Kd). The affinity of wild type PYR1 has been previously measured using ITC and estimated to be 9736 M (Dupeux et al. 2010). The PYR1-A160V mutant receptor was expressed in E. coli BL21(DE3) as a fusion to the small ubiquitin like protein SUMO, using the vector pSUMO (LifeSensors, USA), which improves the solubility of proteins in E. coli and contains an NH2-terminal hexa-histidine tag that facilitates purification using immobilized metal affinity chromatography (IMAC). PYR1 A160V was cloned into pSUMO by using PCR product generated from a pBD-PYR1(A160V) yeast two hybrid construct as template, and sequence validated. A short flexible linker and tobacco etch virus (TEV) protease cleavage site (sequence NH2-GGGSQFGSGGGGGSGSENLYFQS-COOH; SEQ ID NO:411) was incorporated in between the SUMO tag and the receptor to enable cleavage of the recombinant protein by TEV protease, which yields PYR1(A160V) plus an NH2-terminal QS appendage. Recombinant SUMO-TEV-PYR1 (A160V) protein was produced in E. coli and purified by immobilized metal affinity chromatography as previously described (Okamoto et al., Proceedings of the National Academy of Sciences of the United States of America 110, no. 29 (2013): 12132-12137). The purified fusion protein was digested with recombinant TEV protease according to established protocols, and the cleaved protein subsequently separated from both the SUMO tag and uncleaved protein by passing the cleavage reaction over an IMAC column, which does not retain the cleaved PYR1(A160V) product. The cleaved protein was purified by gel filtration using a Superdex column (GE Healthcare, USA) and concentrated by centrifugal concentration using Amicon filters (EMD, USA), as previously described (Dupeux et al, The EMBO Journal 30, no. 20 (2011): 4171-4184). The concentrated protein was utilized for ITC experiments, using a TA instruments Nano ITC Low Volume instrument, repeatedly injecting 2.5 L of a 600 M (+)-ABA solution into a reaction cell containing 60 M PYR1(A160V) every 300 seconds for 200 minutes. Both the ABA and protein were dissolved in a buffer containing PBS, 1 mM 2-mercaptoethanol and 0.012% DMSO. The thermograms generated were processed using the instrument's software to a normalized fit single binding site model, which yielded a Kd of 1.5 M and a binding stoichiometry of 1.068. These data demonstrate that the A160V mutation possesses increased ABA affinity relative to wild type PYR1, consistent with the increased sensitivity indicated by yeast two hybrid assays.
Targeted Genome Modification
[0179] Non-transgenic plants harboring induced mutations in specific genes can be obtained in multiple ways. Chemical mutagenesis of an organism can be used to create random genome-wide mutations and populations of mutagenized individuals can be scanned using high-throughput mutation detection methods to identify individuals harboring specific mutations in genes of interest. For example, TILLING (Targeting Induced Local Lesions in Genomes) enables an investigator to identify non-naturally occurring induced-mutations in a gene by using PCR to amplify a gene of interest from 1000s of mutagenized individuals and use hetero-duplex specific nucleases, such as celery nuclease CEL1, to identify plants harboring a mutation in the PCR amplified region (McCallum, C. M., et al. (2000). Nat. Biotechnol. 18, 455-457). Many technologies are available for polymorphism identification in addition to endonucleases, including direct sequencing of PCR products obtained from mutagenized individuals.
[0180] To identify maize plants containing ABA receptors with increased sensitivity an EMS mutagenized population is created and from this population all ABA receptor genes are PCR amplified from 1000s of mutagenized plants. The amplified products are scanned for polymorphisms using TILLING methodology and polymorphic fragments identified are sequenced to define the specific mutations present. From this, individuals harboring mutations corresponding to the polymorphisms described in this application are identified.
[0181] The most likely mutants to be obtained using this strategy are those that can be encoded by a single nucleotide substitution, which can be established by examining the codon table. For example, receptors with mutations homologous to F61L or F61M in PYR1 can be obtained in receptor homologs by screening for different single nucleotide substitutions depending on the gene sequence, such as UUU->CUU, or UUC->CUC. The same is true for A160V (GCN->GUN), V81I (GUU->AUU, GUC->AUC, GUA->AUA), V81Y (GUU->UUU, GUC->UUC). In principle, any single mutation can be isolated by chemical mutagenesis TILLING, but in practice the subset of changes that can arise by a single nucleotide substitution are most likely to be obtained. The examples provided above are representative, not exhaustive, and other single nucleotide substitutions enabling desired mutations, such as E141V and I110S, are also possible.
[0182] Other mutation induction systems can be used to target mutations in specific genes, such as genome editing methods, which have the advantages of increasing the frequency of single and multiple mutations at a defined target site (Lozano-Juste, J., and Cutler, S. R. (2014) Trends in Plant Science 19, 284-287). The sequence-specific introduction of a double stranded DNA break (DSB) in a genome leads to the recruitment of DNA repair factors at the breakage site, which then repair lesion by either the error-prone non-homologous end joining (NHEJ) or homologous recombination (HR) pathways. NHEJ repairs the breaks, but is imprecise and often creates diverse mutations at and around the DSB. In cells in which the HR machinery repairs the DSB, sequences with homology flanking the DSB, including exogenously supplied sequences, can be incorporated at the region of the DSB. DSBs can therefore be leveraged by geneticists to increase the frequency of mutations at defined sites, however intrinsic differences between the relative roles of HR and NHEJ can affect the mutation types at a targets locus. A number of technologies have been developed to create DSBs at specific sites including synthetic zinc finger nucleases (ZFNs), transcription activator-like endonucleases (TALENs) and most recently the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system. This system is based on a bacterial immune system against invading bacteriophages in which a complex of 2 small RNAs, the CRISPR-RNA (crRNA) and the trans-activating crRNA (tracrRNA) directs a nuclease (Cas9) to a specific DNA sequence complementary to the crRNA. Using any of these systems, an investigator can create DSBs at pre-determined sites in cells expressing the genome editing constructs. In order for homologous recombination to occur, a DNA cassette homologous to the targeted site must be provided, preferably at a high concentration so that HR is favored or NHEJ. Multiple strategies are conceivable for realizing this, including template delivery using agrobacterium mediated transformation or particle bombardment of DNA templates, and one recently described method uses a modified viral genome to provide the double stranded DNA template. For example, Baltes et al. 2014 (Baltes, N. J., et al. (2014) Plant Cell 26, 151-163) recently demonstrated that an engineered geminivirus that was introduced into plant cells using Agrobacterium mediated transformation could be engineered to produce DNA recombination templates in cells where a ZFN was co-expressed.
[0183] In some aspects, once DSBs have been created using any number of technologies, such sites can be exploited to facilitate isolation of targeted genetic changes by either homologous recombination of nucleotide substitutions, deletions or insertions. For example, ABA receptor genes can be targeted using genome editing technologies and progeny plants of the mutagenized plants be screened using the methods outlined above to identify mutations at sites that increase ABA sensitivity. Delivery of genome editing constructs into organisms can involve both unstable transient expression constructs or stable integration of constructs into genomes delivered by Agrobacterium mediated transformation. In the latter case, stable transgenic plants can be used to express genome-editing constructs in plants to increase mutation frequencies at the target site. Once the desired mutants are isolated through polymorphism scans (analogous to those used in TILLING), individuals can be back crossed wild type lines to segregate away transgenic insertion events.
[0184] Conceptually, these methods are analogous to TILLING and the methods for identifying defined mutations would be similar, however because of the targeted nature of these methods, the frequency of mutations at defined sites will be higher and mutations involving changes of more than a single base pair can be identified more readily.
Targeted Amino Acid Modification of Maize ABA Receptors Mediated by CRISPR-Cas9
1. Maize ABA Receptor (ZmPYL) Target Gene Modification
[0185] In vivo modification of plant ABA receptors is described using maize ZmPYL genes as an example. Maize genome contains more than 10 ABA receptors (ZmPYL-A to ZmPYL-P) that share several highly conserved amino acids with AtPYL1. To obtain ABA hypersensitive mutations in the endogenous ZmPYL-E (GRMZM2G165567) gene, two amino acids (V89 and E149) are chosen as targets for sequence-specific mutagenesis into desired mutant amino acids, alanine and leucine (V89A and E149L), respectively, using homology-directed gene repair mediated by sequence-specific nucleases and donor DNA template. Currently, there are several technology platforms for making sequence-specific nucleases, including for example zinc-finger nuclease, TALE nuclease, CRISPR-Cas9 and engineered meganuclease (Puchta and Fauser (2014), Synthetic nucleases for genome engineering in plants: prospects for a bright future. Plant Journal 78:727-741; Chen and Gao (2014) Targeted genome modification technologies and their applications in crop improvements. Plant Cell Rep. 33:575-583), any of which can be used to produce a plant comprising an in situ hypersensitive mutation in a genomic coding sequence PYR/PYL polypeptide as described herein.
[0186] The following examples describe the use of CRISPR-Cas9 system for making targeted gene modification in endogenous ZmPYL-E gene. CRISPR-Cas9-mediated gene modification requires these components: Cas9 nuclease, crRNA (CRISPR RNA) recognizing the mutagenesis target, tracRNA (transactivating RNA) and repair donor DNA template molecule. For easiness of use, crRNA and tracRNA are fused and delivered as a single guide RNA molecule (gRNA or sgRNA) [Sander and Joung (2014) CRISPR-Cas systems for editing, regulating and targeting genomes. 32:347-355].
2. Optimization of Cas9 and its Expression in Maize Cells
[0187] In order to achieve good expression in maize cells, Type II Cas9 gene from Streptococcus pyogenes SF370 is optimized with maize-preferred codons. Nuclear localization signal is also incorporated into the C-terminus of Cas9 to improve its targeting to nucleus. Below is the optimized Cas9 sequence (cBCas9Nu-01, aka, cCas9-01). To express Cas9 in maize cells, the maize-optimized Cas9 gene (cBCas9Nu-01) is placed under the control of maize ubiquitin-1 promoter (prUbi1-10) and is followed by a terminator sequences (tNOS) (
3. gRNA Design and Expression
3.1 gRNAs for Mediating V89A Modification: Structure and its Expression
[0188] For targeted V89A modification, crRNAs of at least 17 nucleotides (nt) long are designed against the maize ZmPYL-E genomic target sequence (5-CGCGA CGTCA ACGTC AAGAC-3) (SEQ ID NO:362) preceding the 5-CGG-3 PAM (protospacer adjacent motif) sequence for Cas9-mediated target recognition. For example, gRNAs of 17-nt (5-GA CGUCA ACGUC AAGAC-3) (SEQ ID NO:363), 18-nt (5-CGA CGUCA ACGUC AAGAC-3) (SEQ ID NO:364), 19-nt (5-GCGA CGUCA ACGUC AAGAC-3) (SEQ ID NO:365), 20-nt (5-CGCGA CGUCA ACGUC AAGAC-3) (SEQ ID NO:366) or 21-nt (5-G CGCGA CGUCA ACGUC AAGAC-3) (SEQ ID NO:367) can be used to guide Cas9 cleavage of the ZmPYL-E target. crRNA is co-delivered with tracRNA and Cas9 protein or mRNA to mediate target site cleavage. Preferably, crRNA molecule is fused with tracRNA molecule covalently into a single guide RNA (gRNA). gRNAs can be synthesized chemically or produced by in vitro transcription. In vitro produced gRNAs can be used directly for physical delivery such as biolistic bombardment with Cas9 RNA or protein to mediate target cleavage and homology-directed target modification if repair donor oligonucleotide is co-delivered. More preferably, gRNA is produced in planta from DNA expression cassette comprising RNA polymerase III (PolIII) promoter such as plant U3 and U6 promoters such as rice U3 and U6 promoters (prOsU3 and prOsU6). For prOsU3, the transcription start begins with nucleotide A, whereas for prOsU6, the transcription starts with nucleotide G (Shan et al. (2013) Nature Biotechnology 31: 686-688; Xie and Yang (2013) Molecular Plant 6:1975-1983). For example, to produce gRNA targeting the endogenous ZmPYKL-E sequence (5-CGCGA CGTCA ACGTC AAGAC-3) (SEQ ID NO:362), 19-nt DNA oligonucleotides (5-GCGA CGTCA ACGTC AAGAC-3) (SEQ ID NO:365) or 21-nt oligonucleotides (5-G CGCGA CGTCA ACGTC AAGAC-3) (SEQ ID NO:367) is fused to the DNA sequences encoding tracRNA scaffold ((5-GTTTT AGAGC TAGAA ATAGC AAGTT AAAAT AAGGC TAGTC CGTTA TCAAC TTGAA AAAGT GGCAC CGAGT CGGTG C-3) (SEQ ID NO: 370) and PolIII termination sequences (5-GTTTT AGAGC TAGAA ATAGC AAGTT AAAAT AAGGC TAGTC CGTTA TCAAC TTGAA AAAGT GGCAC CGAGT CGGTG CTTTT TTTTT-3(SEQ ID NO:413), Mali et al. (2013) Science 339:823-826) and placed under the control of rice polymerase III promoter U3 (prOsU3) or U6 (prOsU6). Below is the sequence (SEQ ID NO:371) of the expression cassette comprising of prOsU3 and coding sequences for the gRNA comprising the 19-nt V89A crRNA (underlined) fused with tracRNA. This sequence is cloned into biolistic transformation vector along with the Cas9 expression cassette to form vector pZmPYLE-V89A (
TABLE-US-00004 (SEQIDNO:371) 5-GGGATCTTTAAACATACGAACAGATCACTTAAAGTTCTTCTGAAGCAACTTAAAGTTATC AGGCATGCATGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGCACAGGACAGGCGTCT TCTACTGGTGCTACCAGCAAATGCTGGAAGCCGGGAACACTGGGTACGTTGGAAACCACGTGATG TGGAGTAAGATAAACTGTAGGAGAAAAGCATTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGT ATTGCAGTATGGGCCGGCCCATTACGCAATTGGACGACAACAAAGACTAGTATTAGTACCACCTC GGCTATCCACATAGATCAAAGCTGGTTTAAAAGAGTTGTGCAGATGATCCGTGGCAGCGACGTCA ACGTCAAGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGCTTTTTTTTT-3
[0189] The sequence example below (SEQ ID NO:372) describes the expression cassette comprising of prOsU6 promoter and coding sequences for a gRNA comprising the 21-nt V89A crRNA (underlined) and tracRNA.
TABLE-US-00005 (SEQIDNO:372) 5-TTTGTGAAAGTTGAATTACGGCATAGCCGAAGGAATAACAGAATCGTTTCACACTTTCGT AACAAAGGTCTTCTTATCATGTTTCAGACGATGGAGGCAAGGCTGATCAAAGTGATCAAGCACAT AAACGCATTTTTTTACCATGTTTCACTCCATAAGCGTCTGAGATTATCACAAGTCACGTCTAGTA GTTTGATGGTACACTAGTGACAATCAGTTCGTGCAGACAGAGCTCATACTTGACTACTTGAGCGA TTACAGGCGAAAGTGTGAAACGCATGTGATGTGGGCTGGGAGGAGGAGAATATATACTAATGGGC CGTATCCTGATTTGGGCTGCGTCGGAAGGTGCAGCCCACGCGCGCCGTACCGCGCGGGTGGCGCT GCTACCCACTTTAGTCCGTTGGATGGGGATCCGATGGTTTGCGCGGTGGCGTTGCGGGGGATGTT TAGTACCACATCGGAAACCGAAAGACGATGGAACCAGCTTATAAACCCGCGCGCTGTAGTCAGCT TGCGCGACGTCAACGTCAAGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTT-3
3.2 gRNA for Mediating E149L Modification: Structure and its Expression
[0190] For targeted E149L modification of the maize ZmPYL-E, the two underlined bases in the maize genomic target sequence (5-GCACC CTGGT GATCG AGTCG TTCGT GGTCG-3) (SEQ ID NO:368) needs to be converted into CT to form mutant sequence (5-GCACC CTGGT GATCC TGTCG TTCGT GGTCG-3 (SEQ ID NO:412)). In order to achieve that, an expression cassette for a sequence coding for the 20-nt guide RNA (5-CCTGG TGATC CTGTC GTTCG-3, xZmPYLE-E149L) (SEQ ID NO:369), tracRNA scaffold and PolIII termination sequences (5-GTTTT AGAGC TAGAA ATAGC AAGTT AAAAT AAGGC TAGTC CGTTA TCAAC TTGAA AAAGT GGCAC CGAGT CGGTG CTTTT TTTTT-3 (SEQ ID NO:413), Mali et al. (2013) Science 339:823-826) was placed under the control of rice polymerase III promoter U6 (prOsU6) as shown in
TABLE-US-00006 (SEQIDNO:373) 5-TTTGTGAAAGTTGAATTACGGCATAGCCGAAGGAATAACAGAATCGTTTCACACTTTCGT AACAAAGGTCTTCTTATCATGTTTCAGACGATGGAGGCAAGGCTGATCAAAGTGATCAAGCACAT AAACGCATTTTTTTACCATGTTTCACTCCATAAGCGTCTGAGATTATCACAAGTCACGTCTAGTA GTTTGATGGTACACTAGTGACAATCAGTTCGTGCAGACAGAGCTCATACTTGACTACTTGAGCGA TTACAGGCGAAAGTGTGAAACGCATGTGATGTGGGCTGGGAGGAGGAGAATATATACTAATGGGC CGTATCCTGATTTGGGCTGCGTCGGAAGGTGCAGCCCACGCGCGCCGTACCGCGCGGGTGGCGCT GCTACCCACTTTAGTCCGTTGGATGGGGATCCGATGGTTTGCGCGGTGGCGTTGCGGGGGATGTT TAGTACCACATCGGAAACCGAAAGACGATGGAACCAGCTTATAAACCCGCGCGCTGTAGTCAGCT TGCCTGGTGATCGAGTCGTTCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTT-3
[0191] Alternatively, the guide RNA can also be expressed from a different polymerase III promoter like rice U3 promoter (prOsU3) which initiates tracription after nucleotide A. The prOsU3-E149L gRNA expression cassette has the following sequences (SEQ ID NO:374) with the 20 bp targeting guide sequence (xZmPYLE-E149L or xZmPYLe, SEQ ID NO: 369) underlined. This prOsU3-E149L gRNA expression cassette along with PMI selectable marker gene cassette and prSoUbi4 driven Cas9 gene expression cassette are inserted into binary vector backbone to form transformation vector 23190 (
TABLE-US-00007 (SEQIDNO:374) 5-GGGATCTTTAAACATACGAACAGATCACTTAAAGTTCTTCTGAAGCAACTTAAAG TTATCAGGCATGCATGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGC ACAGGACAGGCGTCTTCTACTGGTGCTACCAGCAAATGCTGGAAGCCGGGAACAC TGGGTACGTTGGAAACCACGTGATGTGGAGTAAGATAAACTGTAGGAGAAAAGCA TTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGTATTGCAGTATGGGCCGGCCC ATTACGCAATTGGACGACAACAAAGACTAGTATTAGTACCACCTCGGCTATCCAC ATAGATCAAAGCTGGTTTAAAAGAGTTGTGCAGATGATCCGTGGCACCTGGTGAT CGAGTCGTTCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTT-3
4. Generation of Mutants with Targeted Genomic Sequence Modification in ZmPYL-E Gene
4.1 Generation of Targeted Mutation V89A in ZmPYL-E Gene with Biolistic Bombardment
[0192] For target gene sequence modification mediated by homology-directed repair, donor DNA molecule needs to be co-delivered with Cas9 and gRNA. DNA molecule with at least 15 nucleotides flanking the Cas9 cleavage site and containing the intended mutant nucleotide(s) is used as repair donor. For modification of the target sequence 5-CGCGA CGTCA ACGTC AA/GAC-3 to result in V89A mutation, the single underlined residue T needs to be converted to C so valine at position 89 (V89, GTC) is changed to alanine (A89, GCC). Since the intended Cas9 cleavage site (indicated by /) is 9 nucleotides downstream, preferably, the repair DNA molecule should contain sequences at least 15-nt upstream of TCA and 15-nt downstream of the underlined A in AA/GAC as in this sequence (5-GCAGCCT GCGCGACGCC AACGTCAA/GA CCGGCCTGCC GGC-3) (SEQ ID NO:375). More preferably, the repair DNA molecule should contain sequences with at least 20-nt upstream of TCA and at least 20-nt downstream of the underlined A in AA/GAC as outlined in this sequence (5-GG TCGGCAGCCT GCGCGACGCC AACGTCAA/GA CCGGCCTGCC GGCGACGA-3) (SEQ ID NO:376). More preferably, the repair DNA molecule should contain sequences with more than 30-nt upstream of TCA and more than 30-nt downstream of the underlined A in AA/GAC as outlined in this sequence (5-AC CAGCTC GAGG TCGGCAGCCT GCGCGACGCC AACGTCAA/GA CCGGCCTGCC GGCGACGACC AGAACCGA-3) (SEQ ID NO:377). Most preferably, the repair DNA molecule should contain sequences with more than 50-nt upstream of TCA and more than 50-nt downstream of the underlined A in AA/GAC as indicated in this sequence (5-GA ACTGCGTCGT GCGCGGGGAC CAGCTC GAGG TCGGCAGCCT GCGCGACGCC AACGTCAA/GA CCGGCCTGCC GGCGACGACC AGAACCGAGC GCCTCGAGCA GCTCGACGA-3) (SEQ ID NO:378). It should be noted that oligonucleotides with sequences corresponding to the opposite strand of SEQ ID NO:375 to SEQ ID NO:378 can also be used for mediating targeted V89A mutation.
[0193] To generate plants carrying V89A mutation, the above described repair donor DNA oligonucleotide (5-AC CAGCTC GAGG TCGGCAGCCT GCGCGACGCC AACGTCAA/GA CCGGCCTGCC GGCGACGACC AGAACCGA-3) (SEQ ID NO:377) that comprise sequences 30-nt upstream of TCA and 30-nt downstream of the underlined A in AA/GAC is co-precipitated with pZmPYLE-V89A vector (
[0194] ZmPYLE-V89A vector carries the gRNA and Cas9 expression cassettes can also be delivered into maize cells using other physical delivery method such as protoplast transformation and silicon carbide whisker-mediated transformation. The repair donor DNA molecule can also be delivered into cells in the form of single- or double-stranded molecule that is present as part of a recombinant DNA molecule such as restriction fragment or plasmid or T-DNA or viral replicon for generation of transformed cells using methodologies known in the art. Alternatively, gRNA and Cas9 expression vectors and repair donor vector can be transformed into maize cells with Agrobacterium-mediated transformation. It should be noted that for targeted modification, no integration of Cas9 or gRNA expression vector is required or even preferred. Therefore, these vectors can be delivered transiently by biolistic transformation or Agrobacterium-mediated transformation.
4.2 Generation of Targeted Mutation E149L in ZmPYL-E Gene with Biolistic and Agrobacterium-Mediated Transformation
[0195] Similar to the above example (Section 4.1) for generating ZmPYLE-V89A mutation, targeted E149L mutation (Table 1) can be introduced into ZmPYL-E gene using biolistic bombardment using DNA vectors carrying Cas9 and gRNA expression cassettes such as these shown in
[0196] Targeted mutation E149L in ZmPYL-E gene can also be generated with DNA molecules delivered via Agrobacterium. Agrobacterium-mediated transformation methods have been described elsewhere (Ishida et al. (1996). High efficiency transformation of maize (Zea mays L.) mediated by Agrobacterium tumefaciens. Nat. Biotechnol. 14, 745-750; Negrotto et al. (2000). Theuse of phosphomannose-isomerase as a selectable marker to recover transgenic maize plants (Zea mays L.) via Agrobacterium transformation. Plant Cell Rep. 19, 798-803.). Briefly, the prOsU6-E149L (SEQ ID NO:373) or prOsU3-E148L (SEQ ID NO:374) gRNA expression cassette is cloned into a binary vector carrying PMI selectable marker cassette and also an expression cassette for Cas9 with maize preferred codons forming transformation vector pZmPYLE-E149L and 23190 (
4.3 Generation of Multiple Amino Acid Modifications in ZmPYL-E Gene Simultaneously
[0197] It should be noted that more than one target can be modified at the same time if gRNAs and repair donors for multiple target sequences are present at the same time. For example, both V89A and E149L mutations can be obtained by co-bombarding vector pZmPYLE-V89A-E149L containing expression cassettes for Cas9 and two gRNAs (
[0198] As described for generating plants with single mutations, bombarded embryos are then incubated in callus induction media and then moved onto regeneration media to induce shoot formation. Shoots are then moved to rooting media. PMI marker can be used to select for transgenic plants with integrated Cas9 or gRNA expression cassette. However, it should be noted again that stable transformation of transformation vectors is not essential or even preferred for generating desired mutations as long as enough plants are screened to identify plants with desired mutations since transient expression of Cas9 and gRNA is sufficient to result in cleavage of the chromosomal target sequence to induce DNA repair. Samples are then harvested from regenerated plants for genotyping to identify plants containing the desired V89A and E149L mutations in the ZmPYL-E gene. Genotyping can be done with one or more of the standard mutation detection methods such as PCR amplification followed by sequencing, capillary electrophoresis and Nuclease Surveyer assay.
4.4 Generation of Additional Targeted Mutations at V89 Position in ZmPYL-E Gene
[0199] Alternate site-directed changes can be introduced at the V89 position of the ZmPYL-E to obtain ABA hypersensitive mutations by using similar method described above for creating V89A mutation except that repair donor oligonucleotide sequences need to be changed to introduce the corresponding mutations. For example, V89I and V89Y mutations can be introduced by using the same gRNAs (SEQ ID NOS: 363 to 367) to guide Cas9 cleavage of the ZmPYL-E target. Expressing cassettes for gRNA and Cas9 can be delivered into maize cells simultaneously by any physical or biological methods such as biolistic bombardment or Agrobacterium-mediated transformation. For introduction of V89I mutation, the single underlined residue G in the ZmPYL-E genomic target sequence 5-CGCGA CGTCA ACGTC AA/GAC-3 needs to be converted to A, so valine at position 89 (V89, GTC) is changed to isoleucine (189, ATC). Since the intended Cas9 cleavage site (indicated by /) is 9 nucleotides downstream, preferably, the repair DNA molecule should contain sequences at least 15-nt upstream of GTC and 15-nt downstream of the underlined A in AA/GAC as in this sequence (5-GGCAGCCT GCGCGACATC AACGTCAAGA CCGGCCTGCC GGC-3) (SEQ ID NO:381). More preferably, the repair DNA molecule should contain sequences with at least 20-nt upstream of ATC and at least 20-nt downstream of the underlined A in AAGAC as outlined in this sequence (5-AGG TCGGCAGCCT GCGCGACATC AACGTCAAGA CCGGCCTGCC GGCGACGA-3) (SEQ ID NO:382). More preferably, the repair DNA molecule should contain sequences with more than 30-nt upstream of ATC and more than 30-nt downstream of the underlined A in AAGAC as outlined in this sequence (5-GAC CAGCTC GAGG TCGGCAGCCT GCGCGACATC AACGTCAAGA CCGGCCTGCC GGCGACGACC AGAACCGA-3) (SEQ ID NO:383). Most preferably, the repair DNA molecule should contain sequences with more than 50-nt upstream of ATC and more than 50-nt downstream of the underlined A in AAGAC as indicated in this sequence (5-GGA ACTGCGTCGT GCGCGGGGAC CAGCTC GAGG TCGGCAGCCT GCGCGACATC AACGTCAAGA CCGGCCTGCC GGCGACGACC AGAACCGAGC GCCTCGAGCA GCTCGACGA-3) (SEQ ID NO:384).
[0200] For introduction of V89Y mutation, the two underlined residues GT in the maize genomic target sequence 5-CGCGA CGTCA ACGTC AA/GAC-3 need to be converted to TA, so the valine residue at position 89 (V89, GTC) is changed to tyrosine (Y89, TAC). Since the intended Cas9 cleavage site (indicated by /) is 9 nucleotides downstream, preferably, the repair DNA molecule should contain sequences at least 15-nt upstream of GTC and 15-nt downstream of the underlined A in AA/GAC as in this sequence (5-GGCAGCCT GCGCGACTAC AACGTCAAGA CCGGCCTGCC GGC-3) (SEQ ID NO:385). More preferably, the repair DNA molecule should contain sequences with at least 20-nt upstream of TAC and at least 20-nt downstream of the underlined A in AAGAC as outlined in this sequence (5-AGG TCGGCAGCCT GCGCGACTAC AACGTCAAGA CCGGCCTGCC GGCGACGA-3) (SEQ ID NO:386). More preferably, the repair DNA molecule should contain sequences with more than 30-nt upstream of TAC and more than 30-nt downstream of the underlined A in AAGAC as outlined in this sequence (5-GAC CAGCTC GAGG TCGGCAGCCT GCGCGACTAC AACGTCAAGA CCGGCCTGCC GGCGACGACC AGAACCGA-3) (SEQ ID NO:387). Most preferably, the repair DNA molecule should contain sequences with more than 50-nt upstream of TAC and more than 50-nt downstream of the underlined A in AA/GAC as indicated in this sequence (5-GGA ACTGCGTCGT GCGCGGGGAC CAGCTC GAGG TCGGCAGCCT GCGCGACTAC AACGTCAAGA CCGGCCTGCC GGCGACGACC AGAACCGAGC GCCTCGAGCA GCTCGACGA-3) (SEQ ID NO:388).
[0201] Similarly, double mutants containing V89I (or V89Y) and E149L (see, e.g., SEQ ID NOS:390, 391 and 392) can be obtained by transforming maize cells with vectors containing expression cassettes for Cas9 and two gRNAs along with oligonucleotides to introduce corresponding mutations (E149L, V89I or V89Y) as described above in section 4.3.
5. Generation of Targeted E169L Genomic Sequence Modification in Additional ZmPYL Gene Family Members, ZmPYL-D, ZmPYL-F and ZmPYL-J
[0202] 5.1 Mutagenesis Targets and gRNA Design
[0203] Similar to examples described above for endogenous ZmPYL-E gene (Example 4 and Table 1), additional ZmPYL gene family members were also chosen for targeted genome editing to replace specific nucleotides so the amino acid residue corresponding to E.sup.169 in the ABA receptors (ZmPYL-D, ZmPYL-F and ZmPYL-J) is changed to a hypersensitive form L.sup.169. These intended changes are summarized in Table 1. These experiments aimed to modify the corresponding conserved amino acid residue E (glutamic acid) into L (Leucine) in homologous ZmPYL genes.
TABLE-US-00008 TABLE1 ZmPYLmutationsandgRNAsequencesandtransformationvectors Desired WTmaize mutant Trans- ZmPYL protein protein gRNAtargetsequenceintransformation formation gene sequence sequence vector(SEQ.ID.NO.andnotes) vectorname ZmPYL-E LVIE.sup.149SFV LVIL.sup.149SFV 5-cctggtgatcgagtcgttcg-3 (SEQ.ID. 23190 (GRMZM2G16 NO:369;targetsiteincodingstrand,base 5567_P02) replacement5bpawayfromtheCas9 cleavagesite) ZmPYL-D TLVIE.sup.169SFV TLVIL.sup.169SFV 5-gtcggggacgtcgacgacga-3 (SEQ.ID. 23136 (GRMZM2G04 NO:393;targetsiteintemplatestrand, 8733_P02) basereplacement8bpawayfromthe Cas9cleavagesite) ZmPYL-D LVIE.sup.169SFV LVIL.sup.169SFV 5-gaggtcatcgacggccggcc-3 (SEQ.ID. 23189 (GRMZM2G04 NO:394;targetsiteincodingstrand,base 8733_P02) replacement19bpawayfromtheCas9 cleavagesite) ZmPYL-F LVIE.sup.164SFV LVIL.sup.164SFV 5-gctcgtgatcgagtccttcgtgg-3 (SEQ. 22981 (GRMZM2G05 ID.NO:395;longertargetingguide 3882_P01) sequence(23bp),targetsiteincoding strand,basereplacement8bpawayfrom theCas9cleavagesite) ZmPYL-F LVIE.sup.164SFV LVIL.sup.164SFV 5-gctcgtgatcgagtccttcg-3 (SEQ.ID. 23191 (GRMZM2G05 NO:396;shortertargetingguidesequence 3882_P01) (20bp),targetsiteincodingstrand,base replacement5bpawayfromtheCas9 cleavagesite) ZmPYL-J VVLE.sup.148SYV VVLE.sup.148SYV 5-cgtcgacgacgtaggactcg-3 (SEQ.ID. 23192 (GRMZM2G15 NO:397;targetsiteintemplatestrand, 4987_P01) basereplacementattheCas9cleavage site)
5.2 Constructions of Vectors for Expression of gRNAs Targeting ZmPYL-D, ZmPYL-F and ZmPYL-J Genes
[0204] Similar to examples described above for constructing 23190 for expressing gRNA for endogenous ZmPYL-E gene (Example 4), transformation vectors expressing Cas9 and different gRNAs (Table 1) for ZmPYL-D (23136 and 23189), ZmPYL-F (22981 and 23191) and ZmPYL-J (23192) genes were constructed (
5.3 Generation of Genome Edited Novel Alleles (Targeted Mutagenesis and Allele Replacement Mutants) Mediated CRISPR-Cas in ZmPYL-D, ZmPYL-F and ZmPYL-J Genes
[0205] Novel alleles including targeted mutagenesis and allele replacement mutants can be generated via CRISPR-Cas system in the presense of repair donor DNA by Agrobacterium-mediated transformation or particle bomdbarment as described in Example 4 for ZmPYL-E. Here specific examples are provided for targeted nutations in ZmPYL-D, ZmPYL-F and ZmPYL-J genes using biolistic co-delivery of transformation vectors (Table 1 and
TABLE-US-00009 TABLE 2 Repair donor DNA oligonucleotide sequences Cas9 and gRNA expression Oligodeoxynucleotide Length ZmPYL gene vector(s) (ODN) (nt) Notes Seq. ID. No. ZmPYL-D 23136 ODN-ZmPYL-Dc 75 PAM #1 and target site in template strand, Seq. ID. No. 398 base replacement 8 bp away from the Cas9 cleavage site ZmPYL-D 23136 ODN- ZmPYL-Dd-NT 75 PAM#1 and target site in template strand, base Seq. ID. No. 399 replacement 8 bp away from the Cas9 cleavage site; PAM in donor ODN removed ZmPYL-D 23136 ODN- ZmPYL-Dd-NT-PM 75 PAM#1 and target site in coding strand, base Seq. ID. No. 400 replacement 8 bp away from the Cas9 cleavage site; PAM in donor ODN removed; ODN with phosphorothioate linkage modification ZmPYL-D 23189 ODN-ZmPYL-Db 88 PAM #2 and target site in coding strand, base Seq. ID. No. 401 replacement 19 bp away from the Cas9 cleavage site; PAM in donor ODN removed; ZmPYL-E 23190 ODN- ZmPYL-Eb 60 Target site in coding strand, base replacement Seq. ID. No. 379 5 bp away from the Cas9 cleavage site; ODN in non-coding strand; PAM in donor ODN removed ZmPYL-E 23190 ODN- ZmPYL-Ec-NT-PM 72 Target site in coding strand, base replacement Seq. ID. No. 380 5 bp away from the Cas9 cleavage site; ODN with phosphorothioate linkage modification; PAM in donor ODN removed ZmPYL-F 22981, 23191 ODN-ZmPYL-Fa 60 Target site in coding strand, base replacement Seq. ID. No. 402 5 or 8 bp away from the Cas9 cleavage site; PAM in donor ODN not removed ZmPYL-F 22981, 23191 ODN- ZmPYL-Fb 60 Target site in coding strand, base replacement Seq. ID. No. 403 5 or 8 bp away from the Cas9 cleavage site; PAM in donor ODN removed ZmPYL-F 22981, 23191 ODN- ZmPYL-Fc 77 Target site in coding strand, base replacement Seq. ID. No. 404 5 or 8 bp away from the Cas9 cleavage site; PAM in donor ODN removed ZmPYL-F 22981, 23191 ODN- ZmPYL-Fd-NT 77 Target site in coding strand, base replacement Seq. ID. No. 405 5 or 8 bp away from the Cas9 cleavage site; PAM in donor ODN removed ZmPYL-F 22981, 23191 ODN- ZmPYL-Fd-NT-PM 77 Target site in coding strand, base replacement Seq. ID. No. 406 5 or 8 bp away from the Cas9 cleavage site; PAM in donor ODN removed; ODN with phosphorothioate linkage modification ZmPYL-J 23192 ODN-ZmPYL-Jc short 68 Target site in template strand, base Seq. ID. No. 407 replacement at the Cas9 cleavage site; ODN in coding strand sequence ZmPYL-J 23192 ODN--ZmPYL-Jc-NT 68 Target site in template strand, base Seq. ID. No. 408 replacement at the Cas9 cleavage site; ODN in non-coding strand sequence ZmPYL-J 23192 ODN--ZmPYL-Jc-NT-PM 68 Target site in template strand, base Seq. ID. No. 409 replacement at the Cas9 cleavage site; ODN in non-coding strand sequence and with phosphorothioate linkage modification ZmPYL-J 23192 ODN--ZmPYL-Jc-long 88 Target site in template strand, base Seq. ID. No. 410 replacement at the Cas9 cleavage site; ODN in coding strand sequence
[0206] More specifically, the above described transformation vector (Table 2) expressing Cas9 and gRNA is mixed with its corresponding repair donor DNA oligonucleotides (SEQ ID NO:398 to 410) and then precipitated onto gold particles. The coated gold particles are then used to bombard immature maize embryos of elite inbred transformation variety NP2222 (DeFramond A J, et al (2013) Corn Event 5307. U.S. Pat. No. 8,466,346). Other maize genotype such as A188 and Hill can be used as bombardment target tissue source. Methods for maize immature embryo bombardment, callus induction tissue regeneration and rooting methods have been described previously except here no mannose selection is required (Wright et al., 2001, Efficient biolistic transformation of maize (Zea mays L.) and wheat (Triticum aestivum L.) using the phosphomannose isomerase gene, pmi, as the selectable marker. Plant Cell Reports 20:429-436). For example, for mutagenesis of ZmPYL-F gene mediated by CRISP-Cas9, immature embryos are isolated from harvested immature ears at about 9-12 days after pollination and pre-cultured for 3 to 5 days on osmoticum media. Pre-cultured embryos are then bombarded with DNA vector 22981 along with one of the oligonucleotides [ODN-ZmPYL-Fa, ODN-ZmPYL-Fb, ODN-ZmPYL-Fc, ODN-ZmPYL-Fd-NT or ODN-ZmPYL-Fd-NT-PM (Seq. ID. NO:402 to 406)] using BioRad PDS-1000 Biolistic particle delivery system. Bombarded embryos are then incubated in callus induction media and then moved onto mannose selection media. Selected calli are moved onto regeneration media to induce shoot formation. Shoots are then moved to rooting media. Samples are then harvested from regenerated plants for genotyping to identify plants containing the desired genomic sequence mutation that results in E164L amino acid change in the ZmPYL-F gene. Table 3 lists different experiments for targeted mutagenesis and allele replacement of different ZmPYL genes. In some experiments, gRNA and Cas9 expression vector was co-transformed with ZsGreen fluorescent protein vector 12672 for assessing gene delivery efficiency. In some other experiments, two or more gRNA expression vectors were co-delivered with two or more repair donor oligodeoxynucleotides to mutate two or ZmPYL genes simultaneously (Table 3). Table 3 shows that ZmPYL-F in a high percentage of PMI positive events (transformants) contain mutations at the intended sequences (SEQ ID NO:431: 5-GCTCG TGATC GAGTC CTTCG/TGGTG GACGT-3, / indicated predicted Cas9 cleavage position) targeted by gRNA-Cas9.
TABLE-US-00010 TABLE 3 Targeted mutagenesis and allele replacement experiments of different ZmPYL genes Number of Number of Total Total events with putative ODN(s) used for number of number of mutation(s) events with ZmPYL Transformation generating targeted Number of immature PMI positive at the target desired allele target gene vector(s) mutation (s) experiments embryos events site* change ZmPYL-D 23136 ODN-ZmPYL-Dc 5 7914 279 132 3 ZmPYL-D 23136, ODN-ZmPYL-Dc 2 2102 TBD TBD TBD 12672 ZmPYL-D 23189 ODN-ZmPYL-Db 1 1750 TBD TBD TBD ZmPYL-E 23190 ODN-ZmPYL-Eb 2 2238 60** 15 1 and TBD and TBD ZmPYL-F 22981 ODN- ZmPYL-Fb 6 5460 80 13 TBD and TBD and TBD ZmPYL-F 22981, ODN- ZmPYL-Fb 5 7225 346 171 6 with other and TBD and TBD and TBD (22980, 22978, 22982)** ZmPYL-F 22981 ODN- ZmPYL-Fc 1 810 TBD TBD TBD ZmPYL-J 23192 ODN- ZmPYL-Jc short 1 855 TBD TBD TBD ZmPYL-J 23192 ODN-ZmPYL-Jc long 1 1605 TBD TBD TBD ZmPYL-E, 23190, ODN-ZmPYL-Eb, 1 1785 TBD TBD TBD ZmPYL-F 23191 ODN-ZmPYL-Fc ZmPYL-F, 23191 + ODN-ZmPYL-Jd-S-NT, 1 1970 TBD TBD TBD ZmPYL-J 23192 ODN-ZmPYL-Fd-NT ZmPYL-F, 23191 + ODN-ZmPYL-Jd-S-NT-PM, 1 1505 TBD TBD TBD ZmPYL-J 23192 ODN-ZmPYL-Fd-NT-PM Note: *Event with both monoallelic and/or biallelic mutations; **These vectors (22980, 22978 or 22982) carry cassettes for expression of control gRNAs (including NGG sequence) for testing specificity of gRNA for ZmPYL genes. # TBD, to be determined; experiments are in progress and no data is available at the moment.
[0207] Sequencing of ZmPYL-F target region in selected mutants confirmed qPCR results.
5.4 Molecular Characterization of Edited ZmPYL Mutants
[0208] Leaf samples are harvested from regenerated plants in root vessels for molecular analysis or genotyping to identify plants containing mutations at the target sequence and also containing desired sequence mutations that results in desired amino acid change in the ZmPYL genes. Targeted mutants can be identified using one of the following methods: (1) PCR amplification of the target region followed by restriction enzyme digestion and gel electrophoresis if the mutated sequence contains a restriction site (Lloyd A et al. 2005. Proc. Natl. Acad. Sci. USA 102:2232-37; Zhang F, et al. 2010. Proc. Natl. Acad. Sci. USA 107:12028-33). This method is simple, but requires the presence of suitable restriction site, thus cannot be used for most targets. (2) PCR amplification of the target region followed by Sanger sequencing or deep sequencing (Gross, E. et al. 1999. Hum. Genet. 105, 72-78. Shukla V K, et al. 2009. Nature 459:437-41. Townsend J A, et al. 2009. Nature 459:442-45.); Sequencing approach is definitive and sensitive, but takes longer time and throughput can be limited by capacity. (3) PCR amplification of the target region followed by denaturation, annealing and capillary electrophoresis (Li-Sucholeik X C, et al. 1999. Electrophoresis 20, 1224-1232; Larsen L A, et al. 1999. Hum. Mutat. 13, 318-327) or denaturing high-performance liquid chromatography to detect base pair changes by heteroduplex analysis (McCallum C M, et al. 2000. Nature Biotechnology 18, 455-457); these methods are limited by throughput and the identified mutations need to be further verified by sequencing. (4) PCR amplification of the target region followed by denaturation, heteroduplex formation/strand annealing, digestion with mismatch-specific nuclease (such as CEL1 and T7 endonuclease) and gel electrophoresis (Oleykowski, C. A. et al. 1998. Nucleic Acids Res. 26, 4597-4602. Colbert et al. 2001. Plant Physiol. 126:480-484; Lombardo A, et al. 2007. Nat. Biotechnol. 25:1298-306), for example using the commercially available Surveyer nuclease assay kit (Transgenomic, Gaithersburg, Md., USA; Qiu, P., et al. 2004. BioTechniques 36, 702-707). However, the gel-based assays are not as sensitive as high-throughput DNA sequencing and can only detect mutation with frequency of 1% or more. All of the above 4 approaches of identifying a potential mutant in a target site are based on the presence of a new signal in a qualitative fashion, either a new band in a gel or a new peak in a chromatogram that is different from the wild type reference sequence.
[0209] We have developed an alternative high throughput assay method for identification of plants with any site-directed mutation at the targeted sequences based on qPCR (Syngenta Provisional Patent Application #9207-137PR, case 80484). The method measures the reduction of the wild type target site sequence in cells or tissues that have been treated with a site-directed nuclease in a quantitative fashion in comparison with a reference sample. Typically, a Taqman-based assay is used for quantification of the target sequence copy numbers. For detecting potential events with desired allele replacement, an additional high throughput end-point assay is designed and performed. In this end point assay, signals from two MGB probes are used to determine the presence of WT or expected mutant allele as shown in
TABLE-US-00011 TABLE 4 qPCR and end point assay results of regenerated maize events Assay s for genomic target sequence Assays for transgene vector ZmPYL-F cCas9-01 cPMI-09 cutting site ZmPYL-F Assay name (qPCR) (qPCR) (qPCR) E164L (Type) Copy Copy Copy (End point) Candidate Plant ID Construct ID number number number Null/Het/Hom event MZET151104A015A 22981 1 1 0 Null MZET151104A017A 22981 1 1 1 Null MZET151104A019A 22981 >2 >2 0 or 1 Null MZET151104A021A 22981 1 1 1 Null MZET151104A125A 22981 >2 2 1 Het Yes MZET151104A126A 22981 >2 >2 1 Null MZET151104A132A 22981 1 1 or 2 1 or 2 Null MZET151104A138A 22981 1 1 0 Null MZET151104A141A 22981 1 or 2 1 0 Null MZET151104A158A 22981 >2 2 1 Null MZET151104A174A 22981 >2 >2 1 Het Yes MZET151104A178A 22981 >2 1 1 Null MZET151104A180A 22981 >2 1 1 Het Yes MZET151104A186A 22981 >2 >2 0 or 1 Null MZET151104A195A 22981 >2 >2 0 Null MZET151104A201A 22981 0 0 1 Null
5.5 Evaluation of ZmPYL Gene Edited Mutants
[0210] ZmPYL gene edited mutants are tested as described for transgenic T6PP maize plants (Nuccio et al., 2015, Nature Biotechnology, doi:10.1038/nbt.3277) with managed stress environment (MSE) trials. Mutant lines that show improved plant response to water deficit are further tested in multiple location agronomic equivalency (Ag Eq) trials with mutant lines grown alongside control plants and using a checkerboard plot layout.
TABLE-US-00012 PYL-EV89A (SEQIDNO:389) MetValGlyLeuValGlyGlySerThrAlaArgAlaGluHisValVal 151015 AlaAsnAlaGlyGlyGluAlaGluTyrValArgArgMetHisArgHis 202530 AlaProThrGluHisGlnCysThrSerThrLeuValLysHisIleLys 354045 AlaProValHisLeuValTrpGluLeuValArgArgPheAspGlnPro 505560 GlnArgTyrLysProPheValArgAsnCysValValArgGlyAspGln 65707580 LeuGluValGlySerLeuArgAspAlaAsnValLysThrGlyLeuPro 859095 AlaThrThrSerThrGluArgLeuGluGlnLeuAspAspAspLeuHis 100105110 IleLeuGlyValLysPheValGlyGlyAspHisArgLeuGlnAsnTyr 115120125 SerSerIleIleThrValHisProGluSerIleAspGlyArgProGly 130135140 ThrLeuValIleGluSerPheValValAspValProAspGlyAsnThr 145150155160 LysAspGluThrCysTyrPheValGluAlaValIleLysCysAsnLeu 165170175 AsnSerLeuAlaGluValSerGluGlnLeuAlaValGluSerProThr 180185190 SerLeuIleAspGln 195 PYL-EV89AE149L (SEQIDNO:390) MetValGlyLeuValGlyGlySerThrAlaArgAlaGluHisValVal 151015 AlaAsnAlaGlyGlyGluAlaGluTyrValArgArgMetHisArgHis 202530 AlaProThrGluHisGlnCysThrSerThrLeuValLysHisIleLys 354045 AlaProValHisLeuValTrpGluLeuValArgArgPheAspGlnPro 505560 GlnArgTyrLysProPheValArgAsnCysValValArgGlyAspGln 65707580 LeuGluValGlySerLeuArgAspAlaAsnValLysThrGlyLeuPro 859095 AlaThrThrSerThrGluArgLeuGluGlnLeuAspAspAspLeuHis 100105110 IleLeuGlyValLysPheValGlyGlyAspHisArgLeuGlnAsnTyr 115120125 SerSerIleIleThrValHisProGluSerIleAspGlyArgProGly 130135140 ThrLeuValIleLeuSerPheValValAspValProAspGlyAsnThr 145150155160 LysAspGluThrCysTyrPheValGluAlaValIleLysCysAsnLeu 165170175 AsnSerLeuAlaGluValSerGluGlnLeuAlaValGluSerProThr 180185190 SerLeuIleAspGln 195 PYL-EV89IE149L (SEQIDNO:391) MetValGlyLeuValGlyGlySerThrAlaArgAlaGluHisValVal 151015 AlaAsnAlaGlyGlyGluAlaGluTyrValArgArgMetHisArgHis 202530 AlaProThrGluHisGlnCysThrSerThrLeuValLysHisIleLys 354045 AlaProValHisLeuValTrpGluLeuValArgArgPheAspGlnPro 505560 GlnArgTyrLysProPheValArgAsnCysValValArgGlyAspGln 65707580 LeuGluValGlySerLeuArgAspIleAsnValLysThrGlyLeuPro 859095 AlaThrThrSerThrGluArgLeuGluGlnLeuAspAspAspLeuHis 100105110 IleLeuGlyValLysPheValGlyGlyAspHisArgLeuGlnAsnTyr 115120125 SerSerIleIleThrValHisProGluSerIleAspGlyArgProGly 130135140 ThrLeuValIleLeuSerPheValValAspValProAspGlyAsnThr 145150155160 LysAspGluThrCysTyrPheValGluAlaValIleLysCysAsnLeu 165170175 AsnSerLeuAlaGluValSerGluGlnLeuAlaValGluSerProThr 180185190 SerLeuIleAspGln 195 PYL-EV89YE149L (SEQIDNO:392) MetValGlyLeuValGlyGlySerThrAlaArgAlaGluHisValVal 151015 AlaAsnAlaGlyGlyGluAlaGluTyrValArgArgMetHisArgHis 202530 AlaProThrGluHisGlnCysThrSerThrLeuValLysHisIleLys 354045 AlaProValHisLeuValTrpGluLeuValArgArgPheAspGlnPro 505560 GlnArgTyrLysProPheValArgAsnCysValValArgGlyAspGln 65707580 LeuGluValGlySerLeuArgAspTyrAsnValLysThrGlyLeuPro 859095 AlaThrThrSerThrGluArgLeuGluGlnLeuAspAspAspLeuHis 100105110 IleLeuGlyValLysPheValGlyGlyAspHisArgLeuGlnAsnTyr 115120125 SerSerIleIleThrValHisProGluSerIleAspGlyArgProGly 130135140 ThrLeuValIleLeuSerPheValValAspValProAspGlyAsnThr 145150155160 LysAspGluThrCysTyrPheValGluAlaValIleLysCysAsnLeu 165170175 AsnSerLeuAlaGluValSerGluGlnLeuAlaValGluSerProThr 180185190 SerLeuIleAspGln 195 ODN-ZmPYL-Dc (SEQIDNO:398) AGGTCATCGACGGCCGGCCAGGGACGCTCGTCATCCTGTCATTCGTCGTCGACGTCCCCGACGGC AACACCAAGG ODN-ZmPYL-Dd-NT (SEQIDNO:399) CCTTGGTGTTGCCGTCGGGGACGTCGACGACGAATGACAGGATGACGAGCGTCCCTGGCCGGCCG TCGATGACCT ODN-ZmPYL-Dd-NT-PM *denotesphosphorothioatemodification (SEQIDNO:400) C*C*T*TGGTGTTGCCGTCGGGGACGTCGACGACGAATGACAGGATGACGAGCGTCCCTGGC CGGCCGTCGATGA*C*C*T ODN-ZmPYL-Db (SEQIDNO:401) CCATCCTCACCGTCCACCCGGAGGTCATCGACGGCCGACCAGGGACGCTCGTCATCCTGTCCTTC GTCGTCGACGTCCCCGACGGCAA ODN-ZmPYL-Fa (SEQIDNO:402) CGACGGCCGACCGGGGACGCTCGTGATCCTGTCCTTCGTGGTGGACGTCCCCGACGGCAA ODN-ZmPYL-Fb (SEQIDNO:403) CGACGGCCGACCGGGGACGCTCGTGATCCTGTCCTTCGTAGTGGACGTCCCCGACGGCAA ODN-ZmPYL-Fc (SEQIDNO:404) AGGTCATCGACGGCCGACCGGGGACGCTCGTGATCCTGTCCTTCGTAGTGGACGTCCCCGACGGC AACACCAAGGAC ODN-ZmPYL-Fd-NT (SEQIDNO:405) GTCCTTGGTGTTGCCGTCGGGGACGTCCACTACGAAGGACAGGATCACGAGCGTCCCCGGTCGGC CGTCGATGACCT ODN-ZmPYL-Fd-NT-PM *denotesphosphorothioatemodification (SEQIDNO:406) G*T*C*CTTGGTGTTGCCGTCGGGGACGTCCACTACGAAGGACAGGATCACGAGCGTCCCCGG TCGGCCGTCGATGA*C*C*T ODN-ZmPYL-Jcshort (SEQIDNO:407) CACCGAGTTCCAGCCGGGCCCCTACTGCGTCGTGCTCCTGTCCTACGTCGTCGACGTCCCCGACG GCA ODN-ZmPYL-Jcshort-NT (SEQIDNO:408) TGCCGTCGGGGACGTCGACGACGTAGGACAGGAGCACGACGCAGTAGGGGCCCGGCTGGAACTCG GTG ODN-ZmPYL-Jcshort-NT-PM *denotesphosphorothioatemodification (SEQIDNO:409) T*G*C*CGTCGGGGACGTCGACGACGTAGGACAGGAGCACGACGCAGTAGGGGCCCGGCTGGA ACTCG*G*T*G ODN-ZmPYL-Jclong (SEQIDNO:410) TCACCTCCGTCACCGAGTTCCAGCCGGGCCCCTACTGCGTCGTGCTCCTGTCCTACGTCGTCGAC GTCCCCGACGGCAACACCGAGGA
[0211] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.