METHOD AND MEDIUM FOR NEURAL DIFFERENTIATION OF PLURIPOTENT CELLS

Abstract

The invention relates to a culture medium comprising an inhibitor of the BMP signaling pathway; and an inhibitor of the TGF/activin/nodal signaling pathway and to a method for obtaining a population of neural precursors using said culture medium.

Claims

1-14. (canceled)

15. A method for producing a population of neural precursors, comprising: a. culturing pluripotent cells and inhibiting in said pluripotent cells the Bone Morphogenetic Protein (BMP) signaling pathway and the Transforming Growth Factor (TGF)/activin/nodal signaling pathway, during at least 5 days to allow the differentiation of said pluripotent cells into neural precursors; b. obtaining a homogenous population of neural precursors having a purity of at least 95%.

16. The method according to claim 15, wherein pluripotent cells are cultivated in adherent monolayer.

17. The method according to claim 15, wherein pluripotent cells are cultivated in a medium comprising a) an inhibitor of the Bone Morphogenetic Protein (BMP) signaling pathway; and b) an inhibitor of the Transforming Growth Factor (TGF)/activin/nodal signaling pathway.

18. The method according to claim 17, wherein said inhibitor of the BMP signalling pathway is selected from the group consisting of noggin, chordin, and follistatin, and variants and fragments thereof which inhibit the BMP signalling pathway, and said inhibitor of the TGF/activing/nodal signalling pathway is selected from the group consisting of SB431542, Lefty-A and Cerberus and variants and fragments of Lefty-A and Cerberus which inhibit the TGF/activing/nodal signalling pathway.

19. The method according to claim 17, wherein said inhibitor of the BMP signalling pathway is selected from the group consisting of dorsomorphin and LDN 193189 and variants and fragments thereof which inhibit the BMP signalling pathway, and said inhibitor of the TGF/activing/nodal signalling pathway is selected from the group consisting of SB431542, Lefty-A and Cerberus and variants and fragments of Lefty-A and Cerberus which inhibit the TGF/activing/nodal signalling pathway.

20. The method according to claim 15, wherein culturing pluripotent cells is carried out in serum-free and free of serum extract conditions or free of animal-derived substances conditions.

21. The method according to claim 15, wherein culturing pluripotent cells is carried out in the presence of feeder cells.

22. The method according to claim 15, wherein culturing pluripotent cells is carried out without the presence of feeder cells.

23. The method according to claim 15 wherein said pluripotent cells are human pluripotent cells.

24. The method according to claim 15 wherein said pluripotent cells are stem cells.

25. The method according to claim 15 wherein said stem cells are embryonic stem cells.

26. The method according to claim 15 wherein said pluripotent cells are induced pluripotent cells (IPS).

27. A method for producing a population of neural precursors, comprising: a. culturing pluripotent cells in the presence of feeder cells b. obtaining clusters of pluripotent cells c. preparing said clusters; d. culturing said clusters in low attachment dishes in the absence of feeder cells between 4 and 10 hours, in order to starve said pluripotent cells from the influence of the feeder cells and inhibiting in said pluripotent cells the Bone Morphogenetic Protein (BMP) signaling pathway and the Transforming Growth Factor (TGF)/activin/nodal signaling pathway, during at least 5 days to allow the differentiation of said pluripotent cells into neural precursors; e. plating the suspension of pluripotent cells in dishes coated with poly-ornithin and laminin, in the presence of a Rock inhibitor, an inhibitor of the BMP signaling pathway and an inhibitor of the TGF/activin/nodal signaling pathway; f. obtaining a stable and homogenous population of neural precursors having a purity of at least 95%.

28. The method according to claim 27, wherein the step c. is carried out in the presence of a Rock inhibitor.

29. A method for obtaining a population of neurons wherein said method comprises the steps of: a. producing a population of neural precursors according to claim 15; b. differentiating said population of neural precursors into neurons.

30. A method for screening compounds having a neuroprotective and/or neurotoxic effect wherein said methods comprises the steps of: a. producing a population of neural precursors according to claim 15; b. culturing said population of neural precursors in the presence of a test compound; c. comparing the survival of the cells of step a) to that of a population of neural precursors as defined above cultured in the absence of said test compound.

31. A method for treating a neurodegenerative disease or brain injury comprising the steps of: a. producing a population of neural precursors according to claim 15; b. administering through intracerebral route, a pharmaceutically effective amount of said population of neural precursors, to a patient in need thereof.

Description

FIGURES

[0097] FIG. 1: Neural differentiation in N2B27 only

AFACS analyses of the efficiency of neural conversion obtained after 8 days in N2B27 for 4 representative hES cell lines.
BFACS analyses of the composition of the whole culture after 8 days of differentiation for two representative hES cell lines H9 and Hues 24.
CCharacterization of the population committed to different fates by qPCR quantification of the levels of transcript of known markers of extra-embryonic tissues, mesoderm and endoderm primitive embryonic layers.

[0098] FIG. 2: Effect of Noggin and SB431542 on neural differentiation of hES cells

AFACS analyses of the composition of the whole culture after 8 days of differentiation in N2B27 alone or completed with Noggin, SB431542 or both (NFS).
BQPCR quantification of transcript specific of ES cells (Oct4 and Nanog) and early neural precursors (PAX6 and SOX1) for each condition of differentiation.

[0099] FIG. 3: Robustness of the efficiency of the NFS medium on neural differentiation of hES cells

AComparison of the efficiency of N2B27 and NFS media on neural differentiation by FACS analyses (analyses line by line).
BSummary of the hES line on which NFS medium has been successfully used (average of the four lines).

[0100] FIG. 4: Derivation, amplification and terminal differentiation of neural stem cells from neural tube-like structure obtained after differentiation of hES cells in NFS medium

ASummary of the protocol of derivation of the stable and homogeneous population of Neural Stem Cells
B to DTypical morphologies that can be observed after the transfer of neural precursor cells (NEP cells) obtained by differentiation in NFS medium in a neural stem cells (NSC) amplification medium. BAfter 2 days, NSC start to migrate from the neural tube-like structures (rosettes). Chomogeneous population of NSC obtained after a couple of passage. Dpost mitotic neurons obtained after 2 weeks of starvation of NSC from EGF and FGF mitogenic activities.

[0101] FIG. 5: Differentiation of Induced Pluripotent Stem Cells (iPS) into neural stem cells (NCS) in NFS medium

Left panel: iPS treated for 10 days with NFS medium lead to neural-like structures and neural stem cells (NSC).
Right panel: Morphology of iPS-derived NSC at passage 1.

EXAMPLE

Material and Methods

Media and Cytokines

[0102] N2B27 medium was described in Ying et al., 2003. N2B27 was a mixture of DMEM-F12/Neurobasal 1:1, N2 supplement (1:100), B27 supplement (1:50) both obtained from Invitrogen. NFS was composed of N2B27, Noggin (range of concentration between 200 ng and 500 ng/ml, from RD Systems or Preprotech.), SB431542 (between 10 and 20 M, from Tocris), 5 ng/ml FGF2 (Preprotech.). Rock inhibitor Y27632 was from Calbiochem, EGF and BDNF were from RD systems.

[0103] Human ES Cell Culture

[0104] Human ES cells (Hues 24, XY, and H9, XX, WiCell Research Institute) were maintained on a layer of inactivated mouse fibroblasts (STO line from ATCC). The hES cells were cultured in DMEM/F12/Glutamax supplemented with 20% knockout serum replacement (KSR), 1 mM nonessential amino acids, 0.55 mM 2-mercaptoethanol, and 10 ng/ml recombinant human FGF2 (all from Invitrogen). Cultures were fed daily and manually passaged every 5-7 days. The cells were used between passages 40 and 60.

[0105] iPS Cell Culture

[0106] Induced pluripotent stem cell line GMO3862 was obtained in the laboratory according to the reprogramming technique described in Takahashi et al. 2007. Briefly, fibroblasts were transduced with retroviral vectors expressing c-myc, Oct-4, Sox2 and Klf4.

[0107] Neural Induction Using NFS Medium

[0108] Human ES cell cultures or IFS cultures reaching 70-80% confluence were used to perform neural induction using NFS medium. Colonies were cut in pieces and manually detached in N2B27 or NFS medium completed with the Rock-inhibitor Y27632 (10 M, Calbiochem). Clusters were transferred for 6 h in a low attachment Petri dish in order to completely starve them from the influence of the feeders. Finally, the hES or IFS suspension was plated in the same medium at a 1:1 ratio in culture dishes pre-coated with poly-ornithin and laminin (2 g/ml, Sigma). The day after and then every other day, the medium was changed for NFS medium without Y27632.

[0109] Neural Stem Cells Derivation and Terminal Differentiation into Neurons

[0110] Ten days after the induction in NFS medium, neural precursors were transferred in an amplification medium composed of N2B27, EGF/FGF2 (10 ng/ml) and BDNF (Brain-derived Neurotrophic Factor, 20 ng/ml) without passaging, in order to allow the neural stem cells (NSC) to migrate outside the neuro-epithelial structures. When the NSC culture was at full confluence, the cells were passaged using trypsin and replated on poly-ornithin/laminin at a ratio of 1:2 in EGF/FGF2/BDNF medium. Terminal differentiation into neurons was induced by platting the NSC on poly-ornithin/laminin at a density of 50,000 cells/cm.sup.2 in N2B27+BDNF (without EGF and FGF2). Analyses were performed 2 weeks after the terminal differentiation.

[0111] FACS Analysis

[0112] Cells were collected using trypsin and fixed with 2% PFA for 15 min at 4 C. Permeabilization was performed using a PBS/0.1% saponin solution 10 min at RT. The same solution was then used to dilute primary antibodies as followed: mouse monoclonal OCT4 antibody linked to phycoerythrin (oct4-PE, 1:10, BD Biosciences) and polyclonal rabbit anti-SOX2 antibody (1:500, Chemicon). Cells were exposed to the mixture of primary antibodies 45 min at RT. An additional incubation with anti-rabbit secondary antibodies linked to AlexaFluo 488 was performed during 30 min at RT in order to detect SOX2 unconjugated antibodies. FACS analysis was performed using a Becton Dickinson FACScalibur flow cytometer.

[0113] Immuno-Cytochemistry (ICC)

[0114] Cells were fixed with 4% PFA for 15 min at 4 C. then permeabilized using a PBS/0.3% Triton X100 solution, 10 min at RT. Incubation with primary antibodies was performed as followed, overnight at 4 C. in PBS/TX100: rabbit polyclonal anti-PAX6 (1:800, Covance), rabbit polyclonal anti-SOX2 (1:1000), mouse monoclonal anti-OCT4 (1:200, Santa-cruz biotech.), mouse monoclonal anti-CytoKeratin 18 (1:50, Abcam), mouse monoclonal anti-PAX3 (1:50, RD Systems), mouse monoclonal anti-TUJ1 and mouse monoclonal anti-MAP2 (1:1000, both from Covance). AlexaFluor secondary antibodies and DAPI counterstaining were applied for 1 h at room temperature. Detection was performed using a Zeiss Inverted microscope.

[0115] Real-Time qPCR.

[0116] Total RNA was isolated using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. A total of 500 ng of RNA were reverse transcribed into cDNA with SuperScript III (Invitrogen) using random primers. Real-time Q-PCR was performed with SYBR Green as a probe on a LC480 Real-Time system (Roche). Quantification was performed at a threshold detection line (Ct value). The Ct of each target gene was normalized against that of the cyclophilin as a housekeeping gene. The 2-Ct method was used to determine the relative level of expression of each gene. Data were expressed as meanSEM. Primer sequences are listed in follow.

TABLE-US-00003 NANOGF ctccatgaacatgcaacctg (SEQIDNo:1) NANOGR ctcgctgattaggctccaac (SEQIDNo:2) 0ct4F cttgctgcagaagtgggtggaggaa (SEQIDNo:3) 0ct4R ctgcagtgtgggtttcgggca (SEQIDNo:4) Sox1F gatgcacaactcggagatca (SEQIDNo:5) Sox1R gtccttcttgagcagcgtct (SEQIDNo:6) Pax6F gccagcaacacacctagtca (SEQIDNo:7) Pax6R tgtgagggctgtgtctgttc (SEQIDNo:8)

[0117] Results

Efficiency of Neural Differentiation in N2B27 is Highly Variable Depending of the hES Cells Line Used.

[0118] We first monitored the efficiency of neural differentiation obtained only by removing from the culture medium any known instructive signals for alternative cell fates. We used N2B27 medium, a defined medium previously developed to induce neural differentiation of both mouse and human embryonic stem cells in an adherent monolayer culture system (Ying et al., 2003; Lowell et al., 2006). In order to analyzed consistently differentiation of several nave hES cell lines, we have develop a protocol of systematic counting where cells were stained using antibodies against OCT4 and SOX2 transcription factors and then, analysed using FACS technology. Cells expressing both OCT4 and SOX2 were considered as embryonic stem cells whereas cells expressing only SOX2 were counted as neural cells. Cells totally negative or expressing only OCT4 were designated as differentiated into other type of tissues or layers. FACS analysis was performed on 4 hES cell lines (Hues 24, H9, VUB01, SA01), 8 days after platting on laminin in N2B27. Neural differentiation was obtained with all cell lines, but the efficiency of differentiation appeared highly variable depending of the cell line used, ranging from 33.84% for SA01 line to 82.33% for VUB01 line (FIG. 1-A). This indicated that the simple removal of instructive factors from the culture medium of monolayer cultures of ES cells is not sufficiency to optimally induce commitment to the neural lineage.

[0119] We then decided to further characterize the culture obtained after 8 days of differentiation in N2B27 medium. FACS quantification and immuno-cytochemistry analyses were performed on two representative cell lines H9 and Hues 24 (FIG. 1 B). These lines were chosen because their potential of differentiation was in the middle range and because they were representative of each sex, H9 being a female line and Hues 24 being a male line. For each cell line, next to neural cells (Oct4-/SOX2+/PAX6+), ES cells resistant to differentiation (OCT4+/SOX2+/PAX6) were detected (22.56% for H9 line and 18.43% for Hues24 line). In addition, significant portion of the culture consist of cells committed to alternative fates (30.05% for H9 line, 13.95% for Hues24 line). In order to characterize these alternative types of differentiation, expression of markers of the three primitive germ layers and of extra-embryonic tissue were quantified by qPCR (FIG. 1 C). Markers of primitive endoderm (SOX17 and FOXA1) or primitive mesoderm (Brachyury and FLK1) were not detected, indicating that cells were not committed toward other primitive embryonic layers. In contrast, strong levels of transcripts of 2 markers of extra-embryonic tissues, CDX2 and Eomes, were present. Taken together, qualitative and quantitative analyses shown that the final population of cells obtained after differentiation of hES as an adherent monolayer in N2B27 is composed of a mixture of neural precursors, undifferentiated ES cells and cells of extra-embryonic origin.

BMP and TGFbeta Inhibitors (Noggin and SB431542) have Non Redundant, Complementary Effects on the Induction of Neural Differentiation from hES Cells.

[0120] In order to explain this heterogeneity, we hypothesised that, despite the absence of instructive signals coming from the medium, autocrin or paracrin stimulations of intra-cellular pathways may exist in the small clumps/colonies of ES cells that are sufficient to maintain self renewing or induce extra-embryonic differentiation. Because the concomitant presence of undifferentiated ES cells and extra-embryonic tissue can be a typical signature of persistent SMAD activation, we focused on the two pathways known to induce such activations: the TGF beta pathway, also known as Activin/Nodal pathway, and the BMP pathway.

[0121] We first investigated the consequence of a pharmacological inhibition of the TGF beta pathway by SB 431542, a chemical known to specifically block the Activin/Nodal receptor-dependant SMAD activation. This molecule has been shown to increase the expression of neurectoderm makers like Nestin and NCAM in a system based on the formation of embryonic bodies. A eight days treatment of the adherent monolayer of cells with SB431542 in N2B27 didn't increase robustly the expression of early neural markers like PAX6 and SOX1 when mesured by qPCR or the proportion of neural cells (Oct4-/PAX6+) when quantified by FACS (FIG. 2). However this treatment induced a drastic differentiation of ES into an alternative fate which was not due to an increased induction of extra-embryonic tissues, as shown by qPCR analyses of CDX2 and Eomes transcripts, or a de novo commitment into one of the other primitive embryonic layers since expression of the 2 mesoderm markers FLK1 and Brachyury and of 2 endoderm markers SOX17 and FOXA1 were not detected. In contrast, cells commited to the two other kind of progeny deriving from the primitive ectoderm, namely neural crest cells (PAX3+/SOX10+) and keratinocytes (expressing Cytokeratins 8 and 18), were detected both by analysing the levels of each transcript by qPCR or checking the expression of PAX3 and CK18 by ICC. This indicated that SB431542, and more generally inhibition of TGF beta pathway, didn't promote specifically neural differentiation but is necessary to induce the differentiation of ES cells and to promote their entry into primitive ectoderm lineage.

[0122] In parallel, we investigate the impact of the inhibition of the BMP pathway by its natural inhibitor Noggin (FIG. 2). If an 8 days treatment of the adherent monolayer with Noggin induced a slight increased of the expression of neural markers (qPCR) and of the percentage of neural cells (FACS analyses), the main effect of this cytokine was a complete blockage of the differentiation of hES cells into an alternative fate that the neural lineage. As a result, next to the neural cells, a large number of ES cells expressing Oct4 and NANOG transcription factors remained in the culture after 8 days of treatment. Cells differentiated into extra-embryonic tissues, mesoderm, endoderm, keratinocytes or neural crest cells were not detected nor by qPCR analyses or ICC. Since the single blockage of BMP pathway appeared to act mainly as a blocker of non-neural fate but it's not sufficient by itself to trigger hES differentiation, we decided to combine this restrictive effect with the differentiated effect of SB431542

[0123] When the two inhibitors were combined (FIG. 2), we observed a robust and synchronized neural differentiation of hES cells since over 90% of cells committed to neural lineage were detected by FACS (Oct4/SOX2+). Qualitative analyses by ICC have shown that the culture was homogeneously organized into neural tube-like structures or rosettes composed of cells expressing the neural plate marker PAX6. In agreement with these qualitative observations, the combined treatment induced the highest expression of transcripts the two neural commitment markers PAX6 and SOX1 as measured by qPCR. Minimal levels of commitment markers for alternative fates deriving from the primitive ectoderm were detected. Taken together, these results indicated that the combination of the two inhibitors (NFS medium) was necessary to induce a synchronized and efficient differentiation of ES cells into neural precursors. To date, NFS medium was tested on a total of 10 hES lines, including lines naturally bearing monogenic diseases causal mutations with the same efficiency i.e. over 90% of neural cells after 8-10 days of differentiation.

This Synchronization Allows the Direct Derivation of Neural Stem Cells without the Need of Sorting or Selection

[0124] Once the neural precursor cells (PAX6+/SOX1+/SOX2+) were obtained (after 8-10 days of differentiation), the neural tube-like structures were transferred into another defined medium more appropriated to start their amplification and further stabilization as neural stem cells (NSC, FIG. 4A). This medium was described previously (Conti et al., 2005) and its amplification properties were based on the used of a combination of two mitogens namely EGF (Epidermal Growth factor) and FGF2 (Fibroblast Growth factor 2) and the optional addition of the survival factor BDNF (Brain-derived Growth Factor). After a couple of day, neural stem cells started to migrate from the rosette structures and started to be morphologically identifiable (FIG. 1B). When reaching confluence, the culture was passed using trypsin to detach the cells and re-seed on poly-ornithin/laminin substrates at a ratio of 1 in 2. After 2 or 3 passages, a stable and homogeneous population of neural stem cells was obtained. These cells expressed the same markers than the ones described in the literature for hES cells-derived neural stem cells obtained using alternative methods or radial glia-like cells derived from foetuses, like SOX2, Nestin and Blbp. In order to test their potential to give rise to neurons, NSC were platted at low density (usually between 50,000 and 100,000 cells/cm.sup.2) on poly-ornithin/laminin substrates in N2B27 medium+20 ng/ml of BDNF. Neurites outgrowth starts within the first 24 hours following proliferation factors withdrawal, and neurons are clearly identifiable after 4 days. The highest rate of differentiation is obtained after about 10 days (over 60% of the entire population). The resulting culture is composed of a mixture of inhibitory GABAergic and excitatory glutamatergic neurons without defined regional identity. We have also observed the spontaneous differentiation of NSC into GFAP positive astrocytes, demonstrating that neural stem cells were multipotent.

[0125] As shown in FIG. 5, NSC were also obtained after differentiation of iPS cells in NFS medium.

REFERENCES

[0126] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. [0127] Amit M, Carpenter M K, Inokuma M S, Chiu C P, Harris C P, Waknitz M A, Itskovitz-Eldor J, Thomson J A. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol. 2000 November 15; 227(2):271-8. [0128] Conti L, Pollard S M, Gorba T, Reitano E, Toselli M, Biella G, Sun Y, Sanzone S, Ying Q L, Cattaneo E, Smith A. Niche-independent symmetrical self-renewal of a mammalian tissue stem cell. PLoS Biol. 2005 September; 3(9):e283. [0129] Gazzerro E, Minetti C. Potential drug targets within bone morphogenetic protein signaling pathways. Curr Opin Pharmacol. 2007 June; 7(3):325-33. [0130] International Stem Cell Initiative. Characterization of human embryonic stem cell lines by the International Stem Cell Initiative. Nat Biotechnol. 2007 July; 25(7):803-16. [0131] Liu Y, Song Z, Zhao Y, Qin H, Cai J, Zhang H, Yu T, Jiang S, Wang G, Ding M, Deng H. A novel chemical-defined medium with bFGF and N2B27 supplements supports undifferentiated growth in human embryonic stem cells. Biochem Biophys Res Commun. 2006 Jul. 21; 346(1):131-9. [0132] Lowell S, Benchoua A, Heavey B, Smith A G. Notch promotes neural lineage entry by pluripotent embryonic stem cells. PLoS Biol. 2006 May; 4(5) [0133] Shi Y, Massagu J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell. 2003 June 13; 113(6):685-700. [0134] Sun Y, Pollard S, Conti L, Toselli M, Biella G, Parkin G, Willatt L, Falk A, Cattaneo E, Smith A. Long-term tripotent differentiation capacity of human neural stem (NS) cells in adherent culture. Mol Cell Neurosci. 2008 June; 38(2):245-58 [0135] Tabar V, Panagiotakos G, Greenberg E D, Chan B K, Sadelain M, Gutin P H, Studer L. Migration and differentiation of neural precursors derived from human embryonic stem cells in the rat brain. Nat Biotechnol. 2005 May; 23(5):601-6. [0136] Takahashi K. and Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006 Aug. 25; 126(4):663-76 [0137] Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Cell. 2007 November 30; 131(5):861-72. [0138] Ying Q L, Stavridis M, Griffiths D, Li M, Smith A. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol. 2003 February; 21(2):183-6. [0139] Yu J, Vodyanik M A, Smuga-Otto K, Antosiewicz-Bourget J, Frane J L, Tian S, Nie J, Jonsdottir G A, Ruotti V, Stewart R, Slukvin I I, Thomson J A. Induced pluripotent stem cell lines derived from human somatic cells. Science. 2007 December 21; 318(5858):1917-20.