MODIFIED 3' REGION EXTRACTION AND DEEP SEQUENCING OF POLYDENYLATION SITES AND POLY(A) TAIL LENGTH ANALYSIS
20180265912 ยท 2018-09-20
Inventors
Cpc classification
C12N9/22
CHEMISTRY; METALLURGY
C12Q2600/166
CHEMISTRY; METALLURGY
C40B50/00
CHEMISTRY; METALLURGY
G16B30/00
PHYSICS
C12Q2525/173
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12Q2525/173
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12Q1/6806
CHEMISTRY; METALLURGY
C40B50/00
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
Abstract
The present invention relates to modified 3 region extraction and deep sequencing of polyadenylated RNA to identify a poly(A) site in a reference, as well as to calculate poly(A) tail length.
Claims
1. A chimeric oligonucleotide (CO) consisting of a protection region (PR) and a digestion region (DR); wherein the PR is between 5 and 15 nucleotides in length, the first 5-nucleotide of the PR is an antisense oligonucleotide which is capable of binding to the poly(A) tail of poly(A)+ RNA, at least one of every three consecutive nucleotides in the PR is an antisense oligonucleotide which is capable of binding to the poly(A) tail of poly(A)+ RNA and protecting the bound poly(A) tail from digestion by RNase H, and the remaining nucleotides in the PR consist of deoxythymidine; wherein the DR consists of between 5 to 50 deoxythymidines; and wherein the overall orientation of the CO is 5-DR-PR-3.
2. The chimeric oligonucleotide of claim 1, wherein the antisense oligonucleotide comprises at least one of uridine monophosphate, a locked nucleic acid, 2-O-methyl RNA (OMe), 2-O-methoxy-ethyl RNA (MOE), N3-P5 phosphoramidate (NP), cyclohexene nucleic acid (CeNA), 2-fluoro-arabino nucleic acid (FANA), phosphoroamidate morpholino (PMO), tricyclo-DNA, peptide nucleic acid (PNA), and combinations thereof.
3. The chimeric oligonucleotide of claim 1, wherein the antisense oligonucleotide comprises a locked nucleic acid, and the locked nucleic acid comprises locked deoxythymidine (+T).
4. A kit comprising the chimeric oligonucleotide of claim 1.
5. The use of a kit of claim 4 for one or more of the following: a) identification of one or more poly(A) sites in a sample; and b) identification of the 3 end of a poly(A)+ RNA
6. Use of the kit of claim 4 for analyzing gene expression.
7. A method of identifying a poly(A) site in a reference comprising: (i) obtaining a sample comprising poly(A)+ RNA; (ii) contacting the sample with capture oligonucleotide to create isolated poly(A)+ RNA; (iii) fragmenting the isolated poly(A)+ RNA to create fragmented poly(A)+ RNA; (iv) eluting the fragmented poly(A)+ RNA from the capture oligonucleotide to create free poly(A)+ RNA; (v) ligating the free poly(A)+ RNA to a 5-adapter to create 5-adapter ligated poly(A)+ RNA; (vi) contacting the 5-adapter ligated poly(A)+ RNA with a chimeric oligonucleotide (CO) to create CO-bound 5-adapter ligated poly(A)+ RNA, wherein the CO consists of a protection region (PR) and a digestion region (DR), wherein the PR is between 5 and 15 nucleotides in length, the first 5-nucleotide of the PR is an antisense oligonucleotide which is capable of binding to the poly(A) tail of poly(A)+ RNA, at least one of every three consecutive nucleotides in the PR is an antisense oligonucleotide which is capable of binding to the poly(A) tail of the poly(A)+ RNA and protecting the bound poly(A) tail from digestion by RNase H, and the remaining nucleotides in the PR consist of deoxythymidine, wherein the DR consists of 5 to 50 deoxythymidines, and wherein the orientation of the CO is 5-DR-PR-3; (vii) incubating the CO-bound 5-adapter ligated poly(A)+ RNA with RNase H to partially remove the poly(A) tail of the poly(A)+ RNA to create bound 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates; (viii) eluting the bound 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates from CO to isolate free 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates; (ix) ligating the free 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates to a 3-adapter to create fully ligated poly(A)+ RNA sequencing candidates; (x) reverse transcribing the fully ligated poly(A)+ RNA sequencing candidates to create corresponding single-stranded (ss) DNA sequences; (xi) creating a cDNA library from the corresponding ss DNA sequences; and (xii) aligning at least one sequence from the cDNA library to a reference, wherein positive alignment against the reference gene or genome and existence of more than or equal to two unaligned terminal nucleotides indicates a poly(A) site in the reference; and optionally a step of (xiii) calculating the relative abundance of the poly(A)+ RNA to determine a gene expression profile.
8. The method of claim 7, wherein the antisense oligonucleotide comprises at least one of uridine monophosphate, a locked nucleic acid, 2-O-m20hyl RNA (OMe), 2-O-methoxy-ethyl RNA (MOE), N3-P5 phosphoramidate (NP), cyclohexene nucleic acid (CeNA), 2-fluoro-arabino nucleic acid (FANA), phosphoroamidate morpholino (PMO), tricyclo-DNA, peptide nucleic acid (PNA), and combinations thereof.
9. The method of claim 7, wherein the antisense oligonucleotide comprises a locked nucleic acid, and the locked nucleic acid comprises locked deoxythymidine (+T).
10. The method of claim 7, wherein the poly(A) site identifies the 3 end of the poly(A)+ RNA in the reference.
11. The method of claim 7, wherein the protection region (PR) of the chimeric oligonucleotide (CO) consists of alternating locked/unlocked deoxythymidines.
12. A method of calculating poly(A) tail length comprising: (i) obtaining a sample comprising poly(A)+ RNA; (ii) adding a predetermined amount of RNA having identical sequences but with variable poly(A) tail lengths to the sample; (iii) contacting the sample with a capture oligonucleotide to create isolated poly(A)+ RNA; (iv) eluting the poly(A)+ containing RNA from the capture oligonucleotide by one of a mild wash or a stringent wash to create free poly(A)+ RNA; (v) ligating the free poly(A)+ RNA to a 5-adapter to create 5-adapter ligated poly(A)+ RNA; (vi) contacting the 5-adapter ligated poly(A)+ RNA with a chimeric oligonucleotide (CO) to create CO-bound 5-adapter ligated poly(A)+ RNA, wherein the CO consists of a protection region (PR) and a digestion region (DR), wherein the PR is between 5 and 15 nucleotides in length, the first 5-nucleotide of the PR is an antisense oligonucleotide which is capable of binding to a poly(A) tail of poly(A)+ RNA, at least one of every three consecutive nucleotides in the PR is an antisense oligonucleotide which is capable of binding to the poly(A) tail of the poly(A)+ RNA and protecting the bound poly(A) tail from digestion by RNase H, and the remaining nucleotides in the PR consist of deoxythymidine, wherein the DR consists of 5 to 50 deoxythymidines, and wherein the orientation of the CO is 5-DR-PR-3; (vii) incubating the CO-bound 5-adapter ligated poly(A)+ RNA with RNase H to partially remove the poly(A) tail of the poly(A)+ RNA to create bound 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates; (viii) eluting the bound 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates from CO to isolate free 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates; (ix) ligating the free 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates to a 3-adapter to create fully ligated poly(A)+ RNA sequencing candidates, wherein the ligating occurs in the presence of a crowding agent; (x) reverse transcribing the fully ligated poly(A)+ RNA sequencing candidates to create corresponding single-stranded (ss) DNA sequences; (xi) amplifying the corresponding ss DNA sequences to create a cDNA library; (xii) aligning at least one sequence from the cDNA library to a reference, wherein positive alignment against the reference gene or genome and existence of more than or equal to two unaligned terminal nucleotides indicates a poly(A) site in the reference; and (xiii) calculating poly(A) tail length of the poly(A)+ RNA sequencing candidates, and optionally a step of (xiv) calculating the relative abundance of the poly(A)+ RNA to determine a gene expression profile.
13. The method of claim 12, wherein the antisense oligonucleotide comprises at least one of a uridine monophosphate, locked nucleic acid, 2-O-methyl RNA (OMe), 2-O-methoxy-ethyl RNA (MOE), N3-P5 phosphoramidate (NP), cyclohexene nucleic acid (CeNA), 2-fluoro-arabino nucleic acid (FANA), phosphoroamidate morpholino (PMO), tricyclo-DNA, peptide nucleic acid (PNA), and combinations thereof.
14. The method of claim 12, wherein the antisense oligonucleotide comprises a locked nucleic acid, and the locked nucleic acid comprises locked deoxythymidine (+T).
15. The method of claim 12, wherein the poly(A) site identifies the 3 end of the poly(A)+ RNA in the reference.
16. The method of claim 12 wherein the protection region (PR) of the chimeric oligonucleotide (CO) consists of alternating locked/unlocked deoxythymidines.
17. A method to analyze gene expression, the method comprising: a. obtaining a solution of nucleic acids containing poly(A) sequences; b. fragmenting said nucleic acids to provide a solution of fragmented nucleic acids; c. reacting said solution of fragmented nucleic acids with a chimeric oligonucleotide to provide a solution of nucleic acids annealed to the chimeric oligonucleotide and nucleic acids that are not annealed to the chimeric oligonucleotide, wherein the chimeric oligonucleotide consists of a protection region (PR) and a digestion region (DR); wherein the PR is between 5 and 15 nucleotides in length, the first 5-nucleotide of the PR is an antisense oligonucleotide which is capable of binding to the poly(A) tail of poly(A)+ RNA, at least one of every three consecutive nucleotides in the PR is an antisense oligonucleotide which is capable of binding to the poly(A) tail of poly(A)+ RNA and protecting the bound poly(A) tail from digestion by RNase H, and the remaining nucleotides in the PR consist of deoxythymidine; wherein the DR consists of between 5 to 50 deoxythymidines; and wherein the overall orientation of the CO is 5-DR-PR-3; d. removing nucleic acids having short poly (A) sequences with a stringent wash to provide a solution of nucleic acids having long poly (A) sequences annealed to the oligonucleotide; e. contacting said solution of nucleic acids annealed to said oligonucleotide with an enzyme, wherein said enzyme releases nucleic acids from said oligonucleotide; f. separating said released nucleic acids to provide a solution of isolated nucleic acids; g. contacting said solution of purified nucleic acids with a kinase to provide a solution of 5 phosphorylated nucleic acids; h. contacting said solution of 5 phosphorylated nucleic acids with a 3 adapter, a 5 adapter, and ligases suitable for ligating said adapters to the 3 and 5 ends of the nucleic acids to provide a solution of ligated nucleic acids; i. contacting said solution with a reverse transcriptase to provide cDNA corresponding to said ligated nucleic acids; j. amplifying said cDNA corresponding to said ligated nucleic acids by polymerase chain reaction to provide amplified nucleic acids; k. sequencing said amplified nucleic acids; l. comparing the sequences of said nucleic acids to the sequence of a reference gene; m. determining polyadenylation sites in the gene; and n. calculating the relative abundance of the poly(A)+ RNA to determine a gene expression profile.
18. The method of claim 17, further comprising recording in a computer-readable form detection data indicative of detection of poly (A) sites in a gene.
19. The method of claim 17, wherein said at least one nucleic acid containing a long poly (A) sequence has more than 15 contiguous adenine nucleotides.
20. The method of claim 17, wherein said fragmenting said nucleic acids step comprises fragmenting said nucleic acids with a metal base or a metal ion solution or RNase III, or a combination thereof.
Description
VI. BRIEF DESCRIPTION OF THE FIGURES
[0015]
[0016]
[0017]
[0018]
[0019]
VII. DETAILED DESCRIPTION OF THE INVENTION
[0020] The present invention covers methods for identifying (e.g. mapping) poly(A) sites in a given reference, such as a reference gene, genome, or database, methods for analyzing poly(A) tail length, and compositions and kits for performing such methods. The methods for identifying polyadenylation sites in a reference may be referred to as 3READS+, which stands for modified 3 region extraction and deep sequencing. The methods for calculating poly(A) tail length may be referred to as 3READS+PAT, which is a modification/extension of the core 3READS+ method as described herein, but particularly adapted to calculate poly(A) tail length (PAT).
[0021] 3READS+ may be conceptually divided into a first module and a second module. The first module is modified for 3READS+PAT, but the second module is generally consistent between 3READS+ and 3READS+PAT, except for the addition of a step at the end of the method to calculate poly(A) tail length, discussed in greater detail infra. The first module of 3READS+ may be thought of containing steps directed to steps directed to obtaining a sample, isolating poly(A)+ RNA from the sample, fragmenting the poly(A)+ RNA sample, and then elution/recovery of the free poly(A)+ RNA sample. The second module of 3READS+ contains steps directed to ligating the free poly(A)+ RNA sample with a 5 adapter, contacting the ligated poly(A)+ RNA with a chimeric oligonucleotide (CO) containing locked deoxythymidine as described herein, incubating/partially digesting the bound poly(A)+ RNA with RNase H, eluting the partially digested poly(A)+ RNA from the chimeric oligonucleotide, ligating the poly(A)+ RNA with a 3 adapter, optionally in the presence of a crowding agent, reverse transcribing the fully ligated poly(A)+ RNA into single stranged (ss) DNA, amplifying the ssDNA to create a cDNA library, and then aligning the cDNA to a reference (e.g. gene, genome, or genomic database) to identify the poly(A) sites in the reference.
[0022] 3READS+ is examined in Example 1,
[0023] After recovery of the free poly(A)+ RNA, the free poly(A)+ RNA undergoes a first ligation step to a 5-adapter, e.g. a heat-denatured 5-adapter to create 5-adapter ligated poly(A)+ RNA. This first ligation step may utilize a T4 RNA ligase, e.g. T4 RNA ligase 1. Next, the 5-adapter ligated poly(A)+ RNA is bound to a chimeric oligonucleotide (CO) that serves to protect the poly(A) tail of the poly(A)+ RNA from complete digestion by RNase H, creating CO-bound 5-adapter ligated poly(A)+ RNA. The CO is comprised of two primary components, a first region that directly protects the poly(A) tail from digestion by RNase H detailed herein as the protection region (PR), and a second region that is subjection to cleavage and digestion by RNase H, detailed herein as the digestion region (DR). The CO is organized as 5-DR-PR-3. The PR of the CO in an exemplary embodiment includes an alternating sequence of locked (+T) and unlocked (T) deoxythymidines, however it is not limited as such. For example, any of the following antisense oligonucleotides would be acceptable: a locked nucleic acid (e.g. locked deoxythymidine (+T)), 2-O-methyl RNA (OMe), 2-O-methoxy-ethyl RNA (MOE), N3-P5 phosphoramidate (NP), cyclohexene nucleic acid (CeNA), 2-fluoro-arabino nucleic acid (FANA), phosphoroamidate morpholino (PMO), tricyclo-DNA, peptide nucleic acid (PNA), and combinations thereof. These antisense oligonucleotides are examined in more detail in Chan et al. (2006) Clin Exp Pharmacol Physiol.; 33(5-6):533-40, hereby incorporated by reference in its entirety.
[0024] The primary functional limitation is that the antisense oligonucleotides must be capable of binding to the poly(A) tail of poly(A)+ RNA. This is because RNase H is capable of digesting a bond between deoxythymidine (T) and adenosine (A), but not capable of digesting the bond formed between an antisense oligonucleotide, for example, a locked nucleic acid such as locked deoxythymidine (+T) and adenosine (A). Example 1 infra utilizes (+TT).sub.5 (SEQ ID NO: 1) as an exemplary embodiment of a PR. However, this particular PR is only exemplary as others may be designed and utilized for this purpose. For example, a PR that has an antisense oligonucleotide, e.g. locked deoxythymidine (+T) appearing only every three nucleotides as opposed to alternating locked/unlocked deoxythymidine, e.g. (+TTT+T).sub.3 (SEQ ID NO: 4) or (+TTT+T).sub.2(T+T).sub.3 (SEQ ID NO: 5) or even (+T).sub.10 (SEQ ID NO: 6) would be suitable for the invention. While not wishing to be bound by theory, this is because RNase H needs at least three consecutive non-locked nucleotides for digestion. Thus, introducing an antisense oligonucleotide, such as locked deoxythymidine (+T), at least once every three nucleotides in the PR allows the PR to effectively prevent digestion by RNase H. One of ordinary skill in the art will thus understand that there are many possible PR sequences of various lengths that are within the scope of this invention. Notwithstanding the foregoing description, for quality control issues, the total length of the PR should be between 5 to 15 (inclusive) nucleotides total in length, and preferably although explicitly not necessarily is around 10 nucleotides in length. Second, by definition the PR must always begin with an antisense oligonucleotide, e.g. locked deoxythymidine (+T), as the introduction of such into the CO is what separates the PR from the DR, although after introduction of the first antisense oligonucleotide, as previously noted, the requirement is only that there be one antisense oligonucleotide per every three nucleotides in the PR.
[0025] As discussed herein, the total length of the PR is largely what determines the length of the resultant bound 5-adapter ligated poly(A)+ RNA sequencing candidates after digestion with RNase H (discussed infra). Although while not wishing to be bound by theory, ultimately the resultant poly(A)+ RNA sequence will have a few additional nucleotides beyond that of the PR in length presumably due to structural hindrance. As opposed to the PR, which may vary in composition as detailed herein, the DR consists of a string of deoxythymidine (T). As further opposed to the PR, the length of the DR is much more variable, and can be between, for example, 5 and 50 (inclusive) nucleotides in length. Example 1 infra utilizes (T).sub.15 as an exemplary DR, however other lengths as described may be utilized and still be within the scope of this invention. The chimeric oligonucleotide may be linked to a secondary molecule, e.g. in exemplary embodiments, the chimeric oligonucleotide is linked to biotin and is subsequently able to be immobilized by streptavidin (such as in streptavidin-coated beads or a coasted substrate), although such is not necessary and only serves to enhance the method.
[0026] After binding of the 5-adapter ligated poly(A)+ RNA to the CO to create CO-bound 5-adapter ligated poly(A)+ RNA, the CO-bound 5-adapter ligated poly(A)+ RNA is preferably washed with a buffer, and is incubated with RNase H, preferably in presence of RNase H buffer. Exemplary conditions include those in Example 1 infra, e.g. 37 C. for 30 min. with Tris-Cl, NaCl, MgCl.sub.2, and/or DTT. As detailed herein, the RNase H serves to digest an unprotected region of the CO-bound 5-adapter ligated poly(A)+ RNA, i.e. the region (if any) of the poly(A)+ RNA bound to the DR of the PO, thus leaving behind only 5-adapter ligated poly(A)+ RNA that is bound to the PR (plus potentially 2-3 additional nucleotides that are not digested by RNase H, if any). This step thus creates bound 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates. Next, the bound 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates are eluted from the CO by an elution buffer, e.g. NaCl, EDTA, and/or TWEEN 20, although the elution may occur by other methods known to one of skill in the art, and recovered, e.g. by precipitation, thus creating free 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates. Precipitation may be accomplished by means known in the art, e.g. by ethanol.
[0027] Once recovered, the free 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates are then ligated for a second time, this time to a 3-adapter, e.g. a 5-adenylated 3-blocked 3-adapter, which is preferably but not necessarily a heat-denatured adapter. This creates fully ligated poly(A)+ RNA sequencing candidates. This second ligation may utilize, for example, truncated T4 RNA ligase 2. The second ligation step utilizes a crowding agent, preferably polyethylene glycol (PEG), although one of ordinary skill in the art will appreciate there are a wide variety of crowding agents that could be used. Some non-limiting examples that are considered within the scope of the invention include, but are explicitly not limited to, Ficoll, Dextran, Hexamine cobalt chloride, ovalbumin, hemoglobin, bovine serum albumin, and other such compounds. Surprisingly, utilization of a crowding agent such as PEG greatly increases ligation efficiency of the free 5-adapter ligated partially digested poly(A)+ RNA sequencing candidates to the 3-adapters, although it has been further discovered that utilization of a crowding agent such as PEG results in inter-molecular ligation of the free poly(A)+ RNAs. Thus, the present disclosure has split the ligation steps into a first ligation step to a 5-adapter prior to digestion by RNase H, and then into a second ligation step to a 3-adapter that is in the presence of a crowding agent, e.g. PEG, post digestion by RNase H. Such methodology greatly increases yield and quality of the resultant fully ligated poly(A)+ RNA sequencing candidates over prior methods that ligated free poly(A)+ fragments to 5 and 3-adapters after digestion by RNase H, without the presence of a crowding agent. After formation of the fully ligated poly(A)+ RNA sequencing candidates, the fully ligated poly(A)+ RNA sequencing candidates may be precipitated and recovered.
[0028] The fully ligated poly(A)+ RNA sequencing candidates are then reverse transcribed to create corresponding single-stranded (ss) DNA sequences, and then subjected to amplification, e.g. by PCR, to create a double-stranded cDNA library. One of ordinary skill in the art will be familiar with the creation of a cDNA library, see Example 1 infra for a working example. After creation of the cDNA library, DNA sequences from the cDNA library may undergo sequence alignment against a known or mapped reference, e.g. by BLAST alignment, although other such local alignment tools exist and are known to one of ordinary skill in the art, such as Bowtie, Bowtie 2.0, and similar programs. Alignment hits against the mapped reference, e.g. a reference genome, reference database, reference gene, etc., and existence of more than or equal to two (2) unaligned terminal nucleotides from poly(A) indicate a polyadenylation site in the known or mapped reference. The requirement of existence of more than or equal to two (2) unaligned terminal nucleotides from poly(A) is an additional quality control element, i.e. data filtering, as mere alignment by itself does not guarantee identification of a poly(A) site. Alignment plus existence of more than or equal two (2) unaligned terminal nucleotides from poly(A) is sufficient to indicate a polyadenylation site in the known or mapped reference.
[0029] The present invention additionally embodies 3-READS+PAT, which as previously discussed employs an additional poly(A) tail analysis after performing a modified version of 3-READS+. READS+PAT takes advantage of differential affinities of RNAs with different poly(A) tail lengths to the capture oligonucleotide (e.g. oligo(dT)) molecules to separate RNAs with long and short poly(A) tails from one another. This is an improvement over the method disclosed in Meijer et al. (2007) Nucleic Acids Res 35, e132, hereby incorporated by reference in its entirety, as the present method is based on sequencing and is specific for each poly(A) site. 3READS+PAT primarily modifies the first module of 3READS+, with an additional step at the end of the second module of calculating poly(A) tail length.
[0030] 3READS+PAT is examined in Example 2,
[0031] 3READS+ offers significant advantages over the prior art, and they relate to several technical features discussed supra. These include, but are not limited to, utilization of antisense oligonucleotides, in particular locked nucleic acids, e.g. locked deoxythymidine (+T) in the PR of the PO, separation of the first ligation step (5 adapter) from the second ligation step (3adapter, e.g. 5 adenylated 3 adapter), and utilization of a crowding agent during the second ligation step (e.g. PEG). These technical features allow for more comprehensive capture of poly(A)+ RNA throughout the methodology of 3READS+, greatly improved ligation efficiency, and more thorough elimination of junk RNA leading to better data quality during sequence alignment.
[0032] Known methods may utilize DNA/RNA hybrid oligonucleotide containing deoxythymidines (Ts) and uridines (Us) for the chimeric oligonucleotide (CO) to remove the bulk of poly(A) tail by RNase H, leaving behind a few As that are annealed to the Us and are thus undigested by the enzyme. An exemplary oligonucleotide of such methods might contain 15-25 U's and 25-35 T's. The terminal A's that are un-alignable to the genome are considered as evidence of the poly(A) tail, allowing identification of genuine poly(A) sites. However, desirable poly(A) protection may be achieved with RNase H at 1/32 U/reaction (
[0033] While not wishing to be bound by theory, the lack of robustness in protection of As by Us is believed to be caused by interaction between the 14-20 remaining adenosines after the initial round of RNase H digestion and the deoxythymidines in the oligonucleotide, which initiates a second round of RNase H digestion, or indiscriminant digestion of RNA:RNA molecules corresponding to high RNase H concentration. As detailed throughout, one such solution of the present invention is to utilize locked nucleic acids, i.e. locked deoxythymidine instead of uracil or uracil analogs. The PRs of the present invention, particularly utilizing locked deoxythymidine, represent a surprisingly superior technical solution to preventing degradation by RNase H than uracil/uridine or uracil/uridine analogs. A representative LNA/DNA hybrid oligo was designed in Example 1 infra consisting of fifteen consecutive deoxythymidines (T) in the 5 region and five pairs of alternating locked (+T) and regular (T) deoxythymidines, thus eliminating the need for use of uracil or uracil analogs in the PO, e.g. 5-T.sub.15(+TT).sub.5-3 (SEQ ID NO: 3). The inventors discovered by using an oligonucleotide containing 50 Ts (T.sub.50) (SEQ ID NO: 7) as a control, that at 0.5 U RNase H/reaction, the highest concentration of RNase H tested, the T.sub.15(+TT).sub.5 (SEQ ID NO: 3) containing CO preserved 13 As, whereas the T.sub.50 (SEQ ID NO: 7) and T.sub.35U.sub.15 (SEQ ID NO: 2) oligos led to digestion of 60 As into 3-5 As, representing a substantial increase in quality in the use of locked deoxythymidine to uridines. This result indicated that the T.sub.15(+TT).sub.5 (SEQ ID NO: 3) CO is reliable for protection of the poly(A) RNA from RNase H digestion at surprisingly high RNase H concentration.
[0034] It has also discovered that separating the ligation into two distinct steps, a first ligation step and a second ligation step, along with utilization of a crowding agent during the 3 adapter ligation, greatly improves ligation efficiency and leads to more thorough elimination of junk RNA post digestion by RNase H. The efficiency is marked over known methods, such as having RNA fragments ligated to a 3 adapter with a truncated T4 RNA ligase II, and then to a 5 adapter by T4 RNA ligase I in the same reaction tube, an approach often used in small RNA sequencing. Furthermore, the first ligation step of the present invention occurs prior to digestion by RNase H, while the second ligation step occurs in the presence of a crowding agent and post digestion by RNase H.
[0035] The present invention embodies kits that may be utilized for modified 3 region extraction and deep sequencing of polyadenylated RNA to measure RNA abundance and identification of poly(A) site. The kits may contain a chimeric oligonucleotide (CO) as described according to any aspect of this invention, e.g. a CO having a protection region (PR) and a digestion region (DR). The kits may further contain RNase H, ligation adapters, one or more ligases, one or more crowding agents, buffers, reagents for extraction, reagents for precipitation and recovery, reagents for reverse transcription, and/or reagents for amplification (e.g. PCR), and combinations thereof. The kits may contain controls. The kits may contain instructions or directions for use. The kit may be comprised of one or more containers and may also include collection equipment, for example, bottles, bags (such as intravenous fluids bags), vials, syringes, and test tubes. Other components may include needles, diluents and buffers. Usefully, the kit may include at least one container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. Optionally, the kits of the invention further include software to expedite the generation, analysis and/or storage of data, and to facilitate access to databases. The software includes logical instructions, instructions sets, or suitable computer programs that can be used in the collection, storage and/or analysis of the data. Comparative and relational analysis of the data is possible using the software provided. The kit may be comprised of one or more containers and may also include collection equipment, for example, bottles, bags (such as intravenous fluids bags), vials, syringes, and test tubes. Other components may include needles, diluents and buffers. Usefully, the kit may include at least one container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. The kit may contain any or all of the following: assay reagents, buffers, probes and/or primers, and sterile saline or another pharmaceutically acceptable emulsion and suspension base. The kits may be used for methods according to the present disclosure, including, but not limited to, identifying poly(A) sites in a reference, e.g. a reference gene, genome, or genomic database, calculating poly(A) tail length, as well as identification of the 3 end of poly(A)+ RNA encoded in the reference, e.g. gene, genome, or genomic database as well as gene expression analysis, e.g. by determining relative abundance of poly(A) tail containing mRNA in a sample.
[0036] Attached or immobilized as used herein may refer to binding between a support (such as a solid substrate) and a molecule such as an oligonucleotide, or a binding interaction between a ligand and its target. The binding may be covalent or non-covalent. Covalent bonds may be formed directly between the probe and the solid support or may be formed by a cross linker or by inclusion of a specific reactive group on either the solid support or the probe or both molecules. Non-covalent binding may be one or more of electrostatic, hydrophilic, and hydrophobic interactions. Included in non-covalent binding is the covalent attachment of a molecule, such as streptavidin, to the support and the non-covalent binding of a biotinylated probe to the streptavidin. Immobilization may also involve a combination of covalent and non-covalent interactions.
[0037] A solid substrate may be in the form of beads, particles or sheets, a column, an array and may be permeable or impermeable, wherein the surface is coated with a suitable material enabling binding of a target molecule at high affinity. For example, a bead may be coated with strepavidin, and a target molecule bound to biotin will bind to the strepavidin bead with high affinity.
[0038] Array as used herein may refer to a solid support having a plurality of locations to attach a nucleotide sequence
[0039] Biological sample as used herein means a sample of biological tissue or fluid that comprises polypeptides and/or nucleic acids. Such samples include, but are not limited to, tissue isolated from animals. Biological samples may also include sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, blood, plasma, serum, sputum, saliva, stool, tears, mucus, hair, and skin. Biological samples also include explants and primary and/or transformed cell cultures derived from patient tissues. A biological sample may be provided by removing a sample of cells from an animal, but can also be accomplished by using previously isolated cells (e.g., isolated by another person, at another time, and/or for another purpose), or by performing the methods of the invention in vivo.
[0040] As used herein and in the appended claims, the singular forms a, and and the include plural references unless the context clearly dictates otherwise
[0041] The term about refers to a range of values which would not be considered by a person of ordinary skill in the art as substantially different from the baseline values. For example, the term about may refer to a value that is within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value, as well as values intervening such stated values.
[0042] Publications disclosed herein are provided solely for their disclosure prior to the filing date of the present invention.
[0043] Where a value of ranges is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges which may independently be included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either both of those included limits are also included in the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference in their entireties.
[0044] Each of the applications and patents cited in this text, as well as each document or reference, patent or non-patent literature, cited in each of the applications and patents (including during the prosecution of each issued patent; application cited documents), and each of the PCT and foreign applications or patents corresponding to and/or claiming priority from any of these applications and patents, and each of the documents cited or referenced in each of the application cited documents, are hereby expressly incorporated herein by reference in their entirety. More generally, documents or references are cited in this text, either in a Reference List before the claims; or in the text itself; and, each of these documents or references (herein-cited references), as well as each document or reference cited in each of the herein-cited references (including any manufacturer's specifications, instructions, etc.), is hereby expressly incorporated herein by reference.
[0045] The following non-limiting examples serve to further illustrate the present invention.
VIII. EXAMPLES
Example 13READS+
A. Methods and Materials
Cells and RNAs Utilized
[0046] Human HeLa cells were cultured in high glucose Dulbecco's Modification of Eagle's Medium (DMEM) with 10% fetal bovine serum (Atlanta Biologicals). Total cellular RNA was extracted using the TRIzol reagent (Life Technologies). RNA concentration was measured with NanoDrop 2000 (Thermo Scientific) and RNA quality was examined on an Agilent Bioanalyzer using the RNA 6000 pico kit.
In Vitro Synthesized RNAs
[0047] Plasmids expressing RNAs containing 15, 30, or 60 terminal As (A15, A30, or A60, respectively), named pALL-A15, pALL-A30 or pALL-A60, respectively, were obtained from Bio Scientific Co. Plasmids expressing RNAs containing 5, or 10 terminal As (A5 or A10, respectively) were made by subcloning sequences containing 5 and 10 As into the pALL-A60 plasmid using EcoRI and PvuII sites. All in vitro transcription products of these plasmids were the same except for the poly(A) length. Template for A0 was prepared by cutting the HindIII site right upstream of the A60 sequence in the pALL-A60 plasmid. Radioactively labeled RNAs were synthesized by in vitro transcription with SP6 RNA polymerase (Promega) and linearized plasmids. -P32 uridine 5-triphosphate (PerkinElmer) was used for labeling of RNA. RNAs were purified with Micro Bio-Spin P-30 gel columns (Bio-Rad).
RNase H Digestion Assay
[0048] Radioactive A60 RNA was first denatured by heat, captured by biotin-T.sub.35U.sub.15 (SEQ ID NO: 2) (IDT), biotin-T.sub.50 (IDT), or biotin-T.sub.15(+TT).sub.5 (SEQ ID NO: 3) (Exiqon) oligos attached to magnetic beads (Dynabeads MyOne Streptavidin Cl, Life Technologies) at room temperature for 30 min on a rotator, and digested with different concentrations of RNase H (Epicentre) at 37 C. for 30 min. The whole reaction was mixed with an equal volume of 2RNA loading buffer (95% formamide, 0.02% SDS, 0.02% bromophenol blue, 0.01% xylene cyanol and 20 mM EDTA), incubated at 70 C. for 5 min, and put on a magnetic stand. The supernatant was resolved on an 8% TBE-Urea-polyacrylamide gel. Radioactive signals were analyzed using a phosphor screen (Amersham) and a Typhoon 9400 scanner (Amersham). Image quantification and calculation of molecular weight using molecular size makers were carried out with the ImageJ software.
RNA Binding Assay
[0049] The A60 RNA was mixed with A15, A10, or A5 RNAs, followed by heat denaturation and incubation with the biotin-T.sub.15(+TT).sub.5 oligo attached to magnetic beads (Dynabeads MyOne Streptavidin Cl, Life Technologies) at room temperature for 30 min on a rotator. The beads were then washed three times with buffers containing different concentrations of NaCl and formamide, mixed with 1RNA loading buffer, heated at 70 C. for 5 min, and put on a magnetic stand. RNA in the supernatant was then analyzed by gel electrophoresis and by autoradiography as described above. The A10 and A15 signals were normalized to the A60 signal in the same lane.
Adapter Ligation Assays
[0050] In vitro transcribed radioactive A30 was captured using oligo(dT).sub.25 beads, dephosphorylated with calf intestinal alkaline phosphatase (NEB) at 37 C. for 45 min, and then phosphorylated with T4 polynucleotide kinase (NEB) at 37 C. for 45 min (on a rotator). RNA was then washed to remove free ATP, and eluted from the beads with nuclease-free H2O. Two types of ligation protocols were tested. In protocol A, a 5 adenylated 3 adapter made by the 5 DNA Adenylation Kit (NEB) was ligated to A30 using T4 RNA ligase II (truncated KQ version, NEB) with or without 15% polyethylene glycol (PEG) 8000 (NEB) at 22 C. for 1 hr. The reaction was then incubated in the same tube with a 5 adapter, 1 mM ATP and T4 RNA ligase I at 22 C. for 1 hr. In protocol B, A30 was ligated to the 5 adapter with T4 RNA ligase I (NEB) at 22 C. for 1 hr, in the presence of ATP. The RNA was then captured using oligo(dT).sub.25 magnetic beads (NEB) and eluted with H.sub.2O at 70 C. for 2 min, followed by ligation to the 5 adenylated 3 adapter by the T4 RNA ligase I in the presence of 15% PEG 8000. The RNAs in the reactions were then purified by phenol-chloroform extraction, precipitated in ethanol, and examined by gel electrophoresis and by autoradiography as described above.
3READS+
[0051] Poly(A)+ RNA in 0.1-15 g of total RNA was captured using 12 l of oligo(dT).sub.25 magnetic beads (NEB) in 200 l 1 binding buffer (10 mM Tris-Cl, pH7.5, 150 mM NaCl, 1 mM EDTA, and 0.05% TWEEN 20) and fragmented on the beads using 1.5 U of RNase III (NEB) in 30 l RNase III buffer (10 mM Tris-Cl pH8.3, 60 mM NaCl, 10 mM MgCl2, and 1 mM DTT) at 37 C. for 15 min. After washing away unbound RNA fragments with binding buffer, poly(A)+ fragments were eluted from the beads with TE buffer (10 mM Tris-Cl, 1 mM EDTA, pH 7.5) and precipitated with ethanol, followed by ligation to 3 pmol of heat-denatured 5 adapter (5-CCUUGGCACCCGAGAAUUCCANNNN, Sigma) (SEQ ID NO: 8) in the presence of 1 mM ATP, 0.1 l of SuperaseIn (Life Technologies), and 0.25 l of T4 RNA ligase 1 (NEB) in a 5 l reaction at 22 C. for 1 hr. The ligation products were captured by 10 pmol of biotin-T.sub.15-(+TT).sub.5 attached to 12 l of Dynabeads MyOne Streptavidin Cl (Life Technologies). After washing with washing buffer (10 mM Tris-Cl pH7.5, 1 mM NaCl, 1 mM EDTA, and 0.05% TWEEN 20), RNA fragments on the beads were incubated with 0.01 U/l of RNase H (Epicentre) at 37 C. for 30 min in 30 l of RNase H buffer (50 mM Tris-Cl pH 7.5, 5 mM NaCl, 10 mM MgCl2, and 10 mM DTT). After washing with RNase H buffer, RNA fragments were eluted from the beads in elution buffer (1 mM NaCl, 1 mM EDTA, and 0.05% TWEEN 20) at 50 C., precipitated with ethanol, and then ligated to 3 pmol of heat-denatured 5 adenylated 3 adapter (5-rApp/NNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) (SEQ ID NO: 9) with 0.25 l T4 RNA ligase 2 (truncated KQ version, NEB) at 22 C. for 1 hr in a 5 l reaction containing 15% PEG 8000 (NEB) and 0.2 l of SuperaseIn (Life Technologies). The ligation products were then precipitated and reverse transcribed using M-MLV reverse transcriptase (Promega), followed by PCR amplification using Phusion high-fidelity DNA polymerase (NEB) and bar-coded PCR primers for 12-18 cycles (12 cycles for 15 g input RNA, 13 cycles for 5 g input, 15 cycles for 1 g input, and 18 cycles for inputs below 1 g). RT primers and PCR primers with indexes are described in Table 1 below.
TABLE-US-00001 TABLE1 AdaptersandPrimersUtilized PCRPrimer AATGATACGGCGACCACCGAGATCTACA CGTTCAGAGTTCTACAGTCCGA (SEQIDNO:10) PCRPrimer CAAGCAGAAGACGGCATACGAGATCGTGA TGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA (SEQIDNO:11) RTForward CTAGCAGCCTGACATCTTGAGACTTG Primer (SEQIDNO:12) RTReverse GCCTTGGCACCCGAGAATTCCA Primer (SEQIDNO:13)
[0052] PCR products were size-selected twice with AMPure XP beads (Beckman Coulter), using 0.6 volumes of beads (relative to the PCR reaction volume) to remove large DNA molecules and an additional 0.4 volumes of beads to remove small DNA molecules. The eluted DNA was selected again with 1 volume of AMPure XP beads to further remove small DNA molecules. The size and quantity of the libraries eluted from the AMPure beads were examined using a high sensitivity DNA kit on an Agilent Bioanalyzer (Agilent). The library concentrations were further measured by qPCR using primers corresponding to 5 and 3 end regions of cDNAs. Libraries were sequenced on an Illumina HiSeq 2000 machine (150 bases). Raw read numbers are shown in Table 2 below.
TABLE-US-00002 TABLE 2 Read Statistics Samples No. of raw reads No. of PASS reads 100 ng HeLa cell total RNA 17,758,220 6,352,086 200 ng HeLa cell total RNA, 9,801,509 2,389,878 batch 1 200 ng HeLa cell total RNA, 17,966,592 4,764,266 batch 2 400 ng HeLa cell total RNA 19,670,102 5,717,973 1 g HeLa cell total RNA, 9,400,843 2,548,297 batch 1 1 g HeLa cell total RNA, 16,924,095 5,753,272 batch 2 5 g HeLa cell total RNA, 13,183,946 2,815,806 batch 1 5 g HeLa cell total RNA, 16,636,551 5,435,961 batch 2 15 g HeLa cell total RNA 16,338,443 6,126,184
Data Analysis
[0053] The sequence corresponding to 5 adapter was first removed from raw 3READS+ reads using the cutadapt program. The 5 random nucleotides and 5-Ts in the reads were trimmed before the reads were mapped to the human (hg19) genome using Bowtie 2.0 (global mode). Only reads with a mapping quality score (MAPQ) 10 were used for further analysis. The trimmed 5-Ts of each read were then compared to the genomic region downstream of the last aligned position of the read to identify aligned 5-Ts. The reads with 2 non-genomic 5Ts after this process were called polyA site supporting (PASS) reads. Cleavage sites within 24 nt of each other were clustered into polyA sites. UPM of a transcript with a given poly(A) site was calculated with unique PASS reads, based on 5 random nucleotides, number of 5 Ts, and cleavage site location. The 3READS data were the mouse mixed cell lines Tib75, CMT93, B16, F9, and C2C12. Sequencing quality scores were retrieved using the Biostrings package of Bioconductor.
B. Results
[0054] Efficient Ligation Steps Improve cDNA Yield and Data Quality
[0055] In an effort to improve ligations of 5 and 3 adapters separately, it was found that while PEG could significantly stimulate 3 adapter ligation efficiency by >10-fold
3READS+ is Sensitive and Robust
[0056] Based on the optimization experiments described above, a new protocol was designed. An exemplary but explicitly non-limiting flowchart of such protocol is illustrated in
[0057] The libraries were sequenced from the 3 adapter region (
[0058] The sequencing quality after the 5T region was examined using averaged Quality Score (QS) over 20 immediately downstream bases. It was found that sequencing up to fifteen 5-Ts had little effect on the quality of subsequent bases, with the average QS all >28, a value considered to be high quality (
[0059] The sensitivity and reproducibility of 3READS+ was tested using 100 ng, 200 ng, 400 ng, 1 g, 5 g and 15 g total RNAs from HeLa cells. Transcript expression levels were examined between the samples. Because RNA fragments can be over-amplified by PCR, leading to redundant reads, the random sequence (3Ns) derived from 3 adapter, the number of 5 Ts, and the cleavage site location, collectively called unique molecular identifier (UMI), were utilized to identify unique RNA fragments and quantify the expression level of each poly(A) site isoform (
3READS+ Identifies A-Stretch Poly(A) Sites
[0060] Poly(A) sites can be located within a stretch of As in the genome, making them difficult to identify. For simplicity, these poly(A) sites are called A-stretch poly(A) sites (illustrated in
APA in HeLa Cells.
[0061] With a total of 42 million (M) PASS reads generated by 3READS+ with HeLa cell RNAs during the development of the 3READS+ method (Table 2), it was asked what the APA frequency was for genes expressed in a given type of human cell, like HeLa, an important question that had not been addressed so far. Using random sampling of data from reads from different samples, the APA frequency was assessed with different abundance cutoffs for calling isoforms (
Example 23READS+PAT
[0062] RNA was first bound to a 25-mer consisting of deoxythymidine (oligo(dT)25) molecules immobilized on magnetic beads and then eluted using buffers with low or high stringency levels for DNA:RNA interactions, named Mild Wash (low stringency) and Stringent Wash (high stringency). The Mild Wash buffer comprised 150 mM NaCl, 10 mM Tris-Cl pH 7.5, 1 mM EDTA and 0.05% (v/v) TWEEN 20, and the Stringent Wash comprised 5% (v/v) formamide, 1 mM NaCl, 10 mM Tris-Cl pH 7.5, 1 mM EDTA and 0.05% (v/v) TWEEN 20. Eluted RNAs were then subject to 3READS+ processing as described in Example 1 supra, with modifications as discussed herein. This method is illustrated in
[0063] The foregoing examples and description of the preferred embodiments should be taken as illustrating, rather than as limiting the present invention as defined by the claims. As will be readily appreciated, numerous variations and combinations of the features set forth above can be utilized without departing from the present invention as set forth in the claims. Such variations are not regarded as a departure from the scope of the invention, and all such variations are intended to be included within the scope of the following claims. All references cited herein are incorporated by reference in their entireties.