Arogenate dehydrogenase polynucleotides, polypeptides and methods of using the same
20180265880 ยท 2018-09-20
Assignee
Inventors
Cpc classification
C12P19/60
CHEMISTRY; METALLURGY
C12N15/8243
CHEMISTRY; METALLURGY
C12N15/8222
CHEMISTRY; METALLURGY
C12N15/8251
CHEMISTRY; METALLURGY
C12P13/22
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The invention generally relates to arogenate dehydrogenase polynucleotides and methods of using the same. More specifically, the invention relates in part to compositions including arogenate dehydrogenase polynucleotides from beet varieties and other Caryophyllales species and methods of using the same.
Claims
1. A cDNA polynucleotide encoding a polypeptide having at least 90% sequence identity to a polypeptide selected from the group consisting of any one of SEQ ID NOS: 1-20, 43, 45, or 47 and functional fragments of any one of SEQ ID NOS: 1-20, 43, 45, or 47.
2. (canceled)
3. The cDNA polynucleotide of claim 1, wherein the cDNA polynucleotide is codon-optimized for expression in a cell.
4. The cDNA polynucleotide of claim 3, wherein the cell is a plant cell, bacterial cell, or fungal cell.
5. (canceled)
6. The cDNA of claim 1, wherein the polypeptide maintains at least 50% of its ADH activity in the presence of 10 M tyrosine.
7. A construct comprising a heterologous promoter operably linked to a polynucleotide encoding a polypeptide having at least 90% sequence identity to a polypeptide selected from the group consisting of any one of SEQ ID NOS: 1-20, 43, 45, or 47 and functional fragments of any one of SEQ ID NOS: 1-20, 43, 45, or 47.
8. The construct of claim 7, wherein the heterologous promoter is a plant promoter.
9. The construct of claim 7, wherein the heterologous promoter is an inducible promoter or a tissue-specific promoter.
10. A vector comprising the construct of claim 7.
11. The vector of claim 10, wherein the vector comprises a plasmid.
12. A cell comprising the construct of claim 7.
13. The cell of claim 12, wherein the cell is a plant cell.
14. The cell of claim 13, wherein the plant cell is selected from a soybean plant cell, a mung bean plant cell, an opium poppy plant cell, a quinoa plant cell, an alfalfa plant cell, a rice plant cell, a wheat plant cell, a corn plant cell, a sorghum plant cell, a barley plant cell, a millet plant cell, an oat plant cell, a rye plant cell, a rapeseed plant cell, a beet plant cell, and a miscanthus plant cell.
15. (canceled)
16. A seed comprising the construct of claim 7.
17. (canceled)
18. A plant comprising the construct of claim 7.
19. The plant of claim 18, wherein the plant is selected from a beet plant, a soybean plant, a mung bean plant, an opium poppy plant, a quinoa plant, an alfalfa plant, a rice plant, a wheat plant, a corn plant, a sorghum plant, a barley plant, a millet plant, an oat plant, a rye plant, a rapeseed plant, and a miscanthus plant.
20. (canceled)
21. A method for increasing production of at least one product of the tyrosine or HPP pathways in a cell comprising introducing the construct of claim 7 into the cell.
22. The method of claim 21, wherein the cell is a plant cell.
23. The method of claim 22, wherein the plant cell is selected from a soybean plant cell, a mung bean plant cell, an opium poppy plant cell, a quinoa plant cell, an alfalfa plant cell, a rice plant cell, a wheat plant cell, a corn plant cell, a sorghum plant cell, a barley plant cell, a millet plant cell, an oat plant cell, a rye plant cell, a rapeseed plant cell, a beet plant cell, and a miscanthus plant cell.
24. (canceled)
25. The method of claim 21, wherein the product is selected from vitamin E, plastoquinone, a cyanogenic glycoside, a benzylisoquinoline alkaloid, rosmarinic acid, betalains, suberin, mescaline, morphine, salidroside, a phenylpropanoid compound, dhurrin, a tocochromanol, ubiquinone, lignin, a catecholamine, melanin, an isoquinoline alkaloid, hydroxycinnamic acid amide (HCAA), an amaryllidaceae alkaloid, hordenine, hydroxycinnamate, hydroxylstyrene, or tyrosine.
26. The method of claim 21, further comprising purifying the product from the cell.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0014] This patent or application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and the payment of the necessary fee.
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DETAILED DESCRIPTION
[0033] The present inventors investigated the Tyr biosynthetic pathway and its regulation in table beet (Beta vulgaris L.), which produces high levels of betalains. Using comparative genomics, biochemical, and cellular analyses, they found that B. vulgaris possesses two paralogous genes encoding two ADH enzymes, which they named ADH and ADH. Interestingly, ADH but not ADH exhibited relaxed sensitivity to Tyr inhibition. Although the present inventors recently reported that legume PDH enzymes are also Tyr insensitive, BvADH and legume PDHs have two major differences. First, legume PDHs are localized in the cytosol, whereas BvADH (and BvADH) was targeted to the plastids. Second, legume PDHs completely lost Tyr sensitivity but BvADH was still inhibited by Tyr at higher concentrations.
[0034] Other insensitive ADH/PDH enzymes have been previously found in microorganisms and the structural analyses of Tyr sensitive and insensitive enzymes identified histidine 217 as a possible residue responsible for its Tyr sensitivity. However, the corresponding histidine residue was still present in BvADH, suggesting that different mechanisms, and as yet unidentified residues, are involved in the relaxed Tyr sensitivity of BvADH. The identified BvADH and other Caryophyllales ADH enzymes may be introduced into various types of cells to deregulate Tyr biosynthesis and redirect carbon flow from Phe to Tyr, to improve the production of Tyr-derived products (e.g., vitamin E, isoquinoline alkaloids including morphine).
[0035] ADH polynucleotides encoding ADH polypeptides are provided. The polynucleotides may encode a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to any one of the polypeptides of SEQ ID NOS: 1-20, 43, 45, or 47. SEQ ID NOS: 1-20, 43, 45, or 47 are polypeptide sequences of ADH and ADH polypeptides identified in W357B red beet variety, Big Buck sugar beet variety, Touch Stone yellow beet variety, Blankoma white beet variety, Sea beet PI562585 variety, and other Caryophyllales species.
[0036] As used herein, the terms polynucleotide, polynucleotide sequence, nucleic acid and nucleic acid sequence refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of natural or synthetic origin (which may be single-stranded or double-stranded and may represent the sense or the antisense strand). The polynucleotides may be cDNA or genomic DNA.
[0037] In some embodiments, the polynucleotides of the present invention may include any one of the polynucleotide sequences of SEQ ID NOS: 21-40, 44, 46, or 48 or a polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to any one of the polynucleotide sequences of SEQ ID NOs: 21-40, 44, 46, or 48. SEQ ID NOS: 21-40, 44, 46, or 48 are polynucleotide sequences of ADH and ADH polynucleotides that encode the ADH and ADH polypeptides of SEQ ID NOS: 1-20, 43, 45, or 47 and identified in W357B red beet variety, Big Buck sugar beet variety, Touch Stone yellow beet variety, Blankoma white beet variety, Sea beet PI562585 variety, and other plant species. The polynucleotide sequences of SEQ ID NO: 21-40, 44, 46, or 48 are cDNA sequences.
[0038] Polynucleotides homologous to the polynucleotides described herein are also provided. Those of skill in the art understand the degeneracy of the genetic code and that a variety of polynucleotides can encode the same polypeptide. In some embodiments, the polynucleotides (i.e., polynucleotides encoding the ADH polypeptides) may be codon-optimized for expression in a particular cell including, without limitation, a plant cell, bacterial cell, or fungal cell. While particular polynucleotide sequences which are found in plants are disclosed herein any polynucleotide sequences may be used which encode a desired form of the polypeptides described herein. Thus, non-naturally occurring sequences may be used. These may be desirable, for example, to enhance expression in heterologous expression systems of polypeptides or proteins. Computer programs for generating degenerate coding sequences are available and can be used for this purpose. Pencil, paper, the genetic code, and a human hand can also be used to generate degenerate coding sequences.
[0039] Regarding ADH polypeptides, the phrases % sequence identity, percent identity, or % identity refer to the percentage of residue matches between at least two amino acid sequences aligned using a standardized algorithm. Methods of amino acid sequence alignment are well-known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail below, generally preserve the charge and hydrophobicity at the site of substitution, thus preserving the structure (and therefore function) of the polypeptide. Percent identity for amino acid sequences may be determined as understood in the art. (See, e.g., U.S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including blastp, that is used to align a known amino acid sequence with other amino acids sequences from a variety of databases.
[0040] Polypeptide sequence identity may be measured over the length of an entire defined polypeptide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 150 contiguous residues. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures or Sequence Listing, may be used to describe a length over which percentage identity may be measured.
[0041] Suitably, the polypeptides encoded by the polynucleotides provided herein are not sensitive to tyrosine inhibition. The polypeptide is considered to not be sensitive, i.e. to lack sensitivity to tyrosine feedback inhibition, if at least 50% of the activity in the absence of tyrosine is maintained in the presence of 1-100 M (or any range therein) tyrosine. The polypeptide is considered to lack tyrosine feedback sensitivity if at least 40% of the activity in the absence of tyrosine is maintained in the presence of 1 mM tyrosine.
[0042] The ADH polypeptides disclosed herein may include variant polypeptides, mutants, and derivatives thereof. As used herein the term wild-type is a term of the art understood by skilled persons and means the typical form of a polypeptide as it occurs in nature as distinguished from variant or mutant forms. As used herein, a variant, mutant, or derivative refers to a polypeptide molecule having an amino acid sequence that differs from a reference protein or polypeptide molecule. A variant or mutant may have one or more insertions, deletions, or substitutions of an amino acid residue relative to a reference molecule. For example, a ADH polypeptide mutant or variant may have one or more insertions, deletions, or substitution of at least one amino acid residue relative to the ADH wild-type polypeptides disclosed herein. The polypeptide sequences of the wild-type ADH polypeptides from beets and other plant species are presented in SEQ ID NOS: 1-20, 43, 45, or 47. These sequences may be used as reference sequences.
[0043] The ADH polypeptides provided herein may be full-length polypeptides or may be fragments of the full-length polypeptide. As used herein, a fragment is a portion of an amino acid sequence which is identical in sequence to but shorter in length than a reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous amino acid residues of a reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous amino acid residues of a reference polypeptide. Fragments may be preferentially selected from certain regions of a molecule. The term at least a fragment encompasses the full length polypeptide. A fragment of an ADH polypeptide may comprise or consist essentially of a contiguous portion of an amino acid sequence of the full-length ADH polypeptide (See SEQ ID NOS: 1-20, 43, 45, or 47). A fragment may include an N-terminal truncation, a C-terminal truncation, or both truncations relative to the full-length ADH polypeptide.
[0044] A deletion in an ADH polypeptide refers to a change in the amino acid sequence resulting in the absence of one or more amino acid residues. A deletion may remove at least 1, 2, 3, 4, 5, 10, 20, 50, 100, 200, or more amino acids residues. A deletion may include an internal deletion and/or a terminal deletion (e.g., an N-terminal truncation, a C-terminal truncation or both of a reference polypeptide).
[0045] Insertions and additions in an ADH polypeptide refer to changes in an amino acid sequence resulting in the addition of one or more amino acid residues. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, or more amino acid residues. A variant of an ADH polypeptide may have N-terminal insertions, C-terminal insertions, internal insertions, or any combination of N-terminal insertions, C-terminal insertions, and internal insertions.
[0046] The amino acid sequences of the ADH polypeptide variants, mutants, derivatives, or fragments as contemplated herein may include conservative amino acid substitutions relative to a reference amino acid sequence. For example, a variant, mutant, derivative, or fragment polypeptide may include conservative amino acid substitutions relative to a reference molecule. Conservative amino acid substitutions are those substitutions that are a substitution of an amino acid for a different amino acid where the substitution is predicted to interfere least with the properties of the reference polypeptide. In other words, conservative amino acid substitutions substantially conserve the structure and the function of the reference polypeptide. Conservative amino acid substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a beta sheet or alpha helical conformation, (b) the charge or hydrophobicity of the molecule at the site of the substitution, and/or (c) the bulk of the side chain.
[0047] The disclosed variant and fragment ADH polypeptides described herein may have one or more functional or biological activities exhibited by a reference polypeptide (e.g., one or more functional or biological activities exhibited by wild-type ADH polypeptides (i.e, SEQ ID NOS: 1-20, 43, 45, or 47). Suitably, the disclosed variant or fragment ADH polypeptides retain at least 20%, 40%, 60%, 80%, or 100% of the arogenate dehydrogenase activity of the reference polypeptide (i.e., SEQ ID NOS: 1-20, 43, 45, or 47). As used herein, a functional fragment of an ADH polypeptide is a fragment of, for example, one of the polypeptides of SEQ ID NOS: 1-20 that retains at least 20%, 40%, 60%, 80%, or 100% of the arogenate dehydrogenase activity of the full-length ADH polypeptide. Exemplary functional fragments of the ADH polypeptides disclosed herein may include, for example, fragment ADH polypeptides of the polypeptides of SEQ ID NOS: 1-20 that lack the N-terminal plastid transit peptide within these sequences. The N-terminal plastid transit peptide (identified by SEQ ID NO: 41 for BvADH and SEQ ID NO: 42 for BvADH) functions to localize the ADH polypeptides of SEQ ID NOS: 1-20, 43, 45, or 47 to the plastid in plant cells. This function is not necessarily required for the ADH polypeptides arogenate dehydrogenase activity and thus may be removed from SEQ ID NOS: 1-20, 43, 45, or 47.
[0048]
[0049] In another aspect of the present invention, constructs are provided. As used herein, the term construct refers to recombinant polynucleotides including, without limitation, DNA and RNA, which may be single-stranded or double-stranded and may represent the sense or the antisense strand. Recombinant polynucleotides are polynucleotides formed by laboratory methods that include polynucleotide sequences derived from at least two different natural sources or they may be synthetic. Constructs thus may include new modifications to endogenous genes introduced by, for example, genome editing technologies. Constructs may also include recombinant polynucleotides created using, for example, recombinant DNA methodologies.
[0050] The constructs provided herein may be prepared by methods available to those of skill in the art. Notably each of the constructs claimed are recombinant molecules and as such do not occur in nature. Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, and recombinant DNA techniques that are well known and commonly employed in the art. Standard techniques available to those skilled in the art may be used for cloning, DNA and RNA isolation, amplification and purification. Such techniques are thoroughly explained in the literature.
[0051] The constructs provided herein may include a heterologous promoter operably linked to any one of the polynucleotides described herein. As used herein, the terms heterologous promoter, promoter, promoter region, or promoter sequence refer generally to transcriptional regulatory regions of a gene, which may be found at the 5 or 3 side of the ADH polynucleotides described herein, or within the coding region of the ADH polynucleotides, or within introns in the ADH polynucleotides. Typically, a promoter is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3 direction) coding sequence. The typical 5 promoter sequence is bounded at its 3 terminus by the transcription initiation site and extends upstream (5 direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence is a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
[0052] In some embodiments, the disclosed ADH polynucleotides are operably connected to the heterologous promoter. As used herein, a polynucleotide is operably connected or operably linked when it is placed into a functional relationship with a second polynucleotide sequence. For instance, a promoter is operably linked to an ADH polynucleotide if the promoter is connected to the ADH polynucleotide such that it may affect transcription of the ADH polynucleotides. In various embodiments, the ADH polynucleotides may be operably linked to at least 1, at least 2, at least 3, at least 4, at least 5, or at least 10 promoters.
[0053] Heterologous promoters useful in the practice of the present invention include, but are not limited to, constitutive, inducible, temporally-regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters. The heterologous promoter may be a plant, animal, bacterial, fungal, or synthetic promoter. Suitable promoters for expression in plants include, without limitation, the 35S promoter of the cauliflower mosaic virus, ubiquitine, tCUP cryptic constitutive promoter, the Rsyn7 promoter, pathogen-inducible promoters, the maize In2-2 promoter, the tobacco PR-1a promoter, glucocorticoid-inducible promoters, estrogen-inducible promoters, tetracycline-inducible promoters, tetracycline-repressible promoters, and promoters for monocots like actin. Other promoters include the T3, T7 and SP6 promoter sequences, which are often used for in vitro transcription of RNA. In mammalian cells, typical promoters include, without limitation, promoters for Rous sarcoma virus (RSV), human immunodeficiency virus (HIV-1), cytomegalovirus (CMV), SV40 virus, and the like as well as the translational elongation factor EF-1 promoter or ubiquitin promoter. Those of skill in the art are familiar with a wide variety of additional promoters for use in various cell types. In some embodiments, the heterologous promoter includes a plant promoter, either endogenous to the plant host or heterologous.
[0054] Vectors including any of the constructs or polynucleotides described herein are provided. The term vector is intended to refer to a polynucleotide capable of transporting another polynucleotide to which it has been linked. In some embodiments, the vector may be a plasmid, which refers to a circular double-stranded DNA loop into which additional DNA segments may be ligated. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome, such as some viral vectors or transposons. Plant mini-chromosomes are also included as vectors. Vectors may carry genetic elements, such as those that confer resistance to certain drugs or chemicals.
[0055] Cells including any of the polynucleotides, constructs, or vectors described herein are provided. Suitable cells that may be used in accordance with the present invention include eukaryotic or prokaryotic cells. Suitable eukaryotic cells include, without limitation, plant cells, fungal cells, and animal cells. Suitable prokaryotic cells include, without limitation, gram-negative and gram-positive bacterial species. In some embodiments, the cell is a plant cell such as, without limitation, a soybean plant cell, a mung bean plant cell, an opium poppy plant cell, a quinoa plant cell, an alfalfa plant cell, a rice plant cell, a wheat plant cell, a corn plant cell, a sorghum plant cell, a barley plant cell, a millet plant cell, an oat plant cell, a rye plant cell, a rapeseed plant cell, a beet plant cell, and a miscanthus plant cell. In some embodiments, the cell is a bacterial or fungal cell.
[0056] Plants including any of the polynucleotides, constructs, vectors, or cells described herein are also provided. Suitable plants may include, without limitation, a beet plant, a soybean plant, a mung bean plant, an opium poppy plant, a quinoa plant, an alfalfa plant, a rice plant, a wheat plant, a corn plant, a sorghum plant, a barley plant, a millet plant, an oat plant, a rye plant, and a rapeseed plant as well as perennial grasses such as a miscanthus plant. For example, ADH polynucleotides encoding any one of the ADH polypeptides of SEQ ID NOS: 1-20, 43, 45, or 47 may be used to generate transgenic plants.
[0057] Portions or parts of these plants are also useful and provided. Portions and parts of plants includes, without limitation, plant cells, plant tissue, plant progeny, plant asexual propagates, plant seeds. The plant may be grown from a seed comprising transgenic cells or may be grown by any other means available to those of skill in the art. Chimeric plants comprising transgenic cells are also provided and encompassed.
[0058] As used herein, a plant includes any portion of the plant including, without limitation, a whole plant, a portion of a plant such as a part of a root, leaf, stem, seed, pod, flower, cell, tissue plant germplasm, asexual propagate, or any progeny thereof. Germplasm refers to genetic material from an individual or group of individuals or a clone derived from a line, cultivar, variety or culture. Plant refers to whole plants or portions thereof including, without limitation, plant cells, plant protoplasts, plant tissue culture cells or calli. For example, a beet plant refers to whole beet plant or portions thereof including, without limitation, beet plant cells, beet plant protoplasts, beet plant tissue culture cells or calli. A plant cell refers to cells harvested or derived from any portion of the plant or plant tissue culture cells or calli.
[0059] Methods for increasing production of at least one product of the tyrosine or HPP pathways in a cell are provided. The methods may include introducing any of the polynucleotides, constructs, or vectors described herein into the cell. Suitable products of the tyrosine or HPP pathways include, without limitation, vitamin E, plastoquinone, a cyanogenic glycoside, a benzylisoquinoline alkaloid, rosmarinic acid, betalains, suberin, mescaline, morphine, salidroside, a phenylpropanoid compound, dhurrin, a tocochromanol, ubiquinone, lignin, a catecholamine such as epinephrine (adrenaline) or dopamine (i.e., L-dihydroxyphenylalanine (L-DOPA)), melanin, an isoquinoline alkaloid, hydroxycinnamic acid amide (HCAA), an amaryllidaceae alkaloid, hordenine, hydroxycinnamate, hydroxylstyrene, or tyrosine. Phenylpropanoid compounds (i.e., lignin, tannins, flavonoids, stilbene) may be produced from tyrosine, for example, by combining the polypeptides disclosed herein with a tyrosine-ammonia lyase (TAL) or by using cells that naturally have a TAL such as grass cells.
[0060] As used herein, introducing describes a process by which exogenous polynucleotides (e.g., DNA or RNA) are introduced into a recipient cell. Methods of introducing polynucleotides into a cell are known in the art and may include, without limitation, microinjection, transformation, and transfection methods. Transformation or transfection may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of foreign nucleic acid sequences into a host cell. The method for transformation or transfection is selected based on the type of host cell being transformed and may include, but is not limited to, the floral dip method, Agrobacterium-mediated transformation, bacteriophage or viral infection, electroporation, heat shock, lipofection, and particle bombardment. Microinjection of polynucleotides may also be used to introduce polynucleotides into cells.
[0061] In some embodiments, the present methods may further include purifying the product of the tyrosine or HPP pathways from the cells. As used herein, the term purifying is used to refer to the process of ensuring that the product of the tyrosine or HPP pathways is substantially or essentially free from cellular components and other impurities. Purification of products of the tyrosine or HPP pathways is typically performed using analytical chemistry techniques such as high performance liquid chromatography (HPLC) and other chromatographic techniques. Methods of purifying such products are well known to those skilled in the art. A purified product of the tyrosine or HPP pathways means that the product is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure.
[0062] The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and/or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. Ordinal indicators, such as first, second, and third, as used in the description and the claims to refer to various structures or method steps, are not meant to be construed to indicate any specific structures or steps, or any particular order or configuration to such structures or steps. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless otherwise claimed. No language in the specification, and no structures shown in the drawings, should be construed as indicating that any non-claimed element is essential to the practice of the disclosed subject matter. The use herein of the terms including, comprising, or having, and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof, as well as additional elements. Embodiments recited as including, comprising, or having certain elements are also contemplated as consisting essentially of and consisting of those certain elements.
[0063] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word about to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount are included in that amount, such as values that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in forming measurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise.
[0064] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference in their entirety, unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and/or description found in the cited references.
[0065] Unless otherwise specified or indicated by context, the terms a, an, and the mean one or more. For example, a protein or an RNA should be interpreted to mean one or more proteins or one or more RNAs, respectively.
[0066] The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims.
EXAMPLES
Example 1Relaxation of Tyrosine Pathway Regulation Underlies the Evolution of Betalain Pigmentation in Caryophyllales
[0067] This Example is based on data reported in Lopez-Nieves et al., Relaxation of Tyrosine Pathway Regulation Underlies the Evolution of Betalain Pigmentation in Caryophyllales, New Phytologist, 217(2):896-908 (2018), the contents of which (including all supplemental data, figures, and associated materials) is incorporated herein by reference.
SUMMARY
[0068] Diverse natural products are synthesized in plants by specialized metabolic enzymes, which are often lineage-specific and derived from gene duplication followed by functional divergence. However, little is known about the contribution of primary metabolism to the evolution of specialized metabolic pathways. [0069] Betalain pigments, uniquely found in the plant order Caryophyllales, are synthesized from the aromatic amino acid L-tyrosine (Tyr) and replaced the otherwise ubiquitous phenylalanine-derived anthocyanins. This study combined biochemical, molecular and phylogenetic analyses and uncovered coordinated evolution of Tyr and betalain biosynthetic pathways in Caryophyllales. [0070] We found that Beta vulgaris, which produces high levels of betalains, synthesizes Tyr via plastidic arogenate dehydrogenases (TyrA.sub.a/ADH) encoded by two ADH genes (BvADH and BvADH). Unlike BvADH and other plant ADHs that are strongly inhibited by Tyr, BvADH exhibited relaxed sensitivity to Tyr. Also, Tyr-insensitive BvADH orthologs arose during the evolution of betalain pigmentation in the core Caryophyllales and later experienced relaxed selection and gene loss in lineages that reverted from betalain to anthocyanin pigmentation, such as Caryophyllaceae. [0071] These results suggest that relaxation of Tyr pathway regulation increased Tyr production and contributed to the evolution of betalain pigmentation, highlighting the significance of upstream primary metabolic regulation for the diversification of specialized plant metabolism.
INTRODUCTION
[0072] Plants synthesize numerous specialized metabolites (also known as secondary metabolites), which play crucial roles in plant adaptation. In contrast to well-documented diversification of plant enzymes directly involved in specialized metabolism (Chen et al., 2011; Mizutani & Ohta, 2010; Moghe & Last, 2015; Pichersky & Lewinsohn, 2011; Weng, 2014), relatively little is known about the evolution of primary metabolic enzymes that provide precursors to the production of various specialized metabolites.
[0073] L-Tyrosine (Tyr) is an essential aromatic amino acid required for protein biosynthesis in all organisms; however, it is synthesized de novo only in bacteria, fungi, and plants, but not in animals. Consequently, animals have to consume Tyr or L-phenylalanine (Phe) that can be hydroxylated to Tyr (Pencharz et al., 2007). Besides protein biosynthesis, plants also use Tyr to produce a diverse array of specialized metabolites that are important for defense (e.g. dhurrin, Gleadow & Mller, 2014), stress tolerance (e.g. tocopherols, Mene-Saffrane et al., 2010), and pollinator attraction (e.g., betalains, Tanaka et al., 2008). Notably, humans have a long history of utilizing Tyr-derived specialized metabolites, such as the psychedelic alkaloid mescaline derived from the cactus Lophophora williamsii (Ibarra-Laclette et al., 2015) and the analgesic morphine derived from Papaver somniferum (opium poppy, Beaudoin & Facchini, 2014; Millgate et al., 2004).
[0074] Tyr is synthesized from prephenate, which is converted from the final product of the shikimate pathway, chorismate (Maeda & Dudareva, 2012; Siehl, 1999; Tzin, V. & Galili, 2010). In most bacteria and fungi, prephenate is oxidatively decarboxylated by prephenate dehydrogenase (TyrA.sub.p/PDH, hereafter referred only as PDH; EC 1.3.1.12) to 4-hydroxyphenylpyruvate (HPP), which is transaminated to Tyr (Bentley, 1990,
[0075] Betalains are a class of Tyr-derived pigments that, within the flowering plants, occur exclusively in the order Caryophyllales where they replace the otherwise ubiquitous anthocyanins (Mabry, 1964; Tanaka et al., 2008). Within Caryophyllales, the majority of families are betalain pigmented. In two families, Molluginaceae and Caryophyllaceae, however, evolutionary reversions from betalain to anthocyanin pigmentation have occurred (Brockington et al., 2015), highlighting the fact that these two classes of water-soluble pigments have never been found in the same organism (Bate-Smith, 1962; Brockington et al., 2011; Clement & Mabry, 1996; Mabry, 1964). Betalains and anthocyanins are synthesized from Tyr and Phe, respectively, but have similar physiological functions in pollinator attraction and stress tolerance (Tanaka et al., 2008). Betalains are also used as a natural food dye (E162) and have anticancer and antidiabetic properties (Khan, 2015; Lee et al., 2014; Neelwarne & Halagur, 2012). Furthermore, intermediates in the betalain pathway are important pharmaceuticals [e.g. L-dihydroxyphenylalanine (L-DOPA) for the treatment of Parkinson's disease] or are substrates for other pharmaceutical agents (e.g. the production of dopamine and isoquinoline alkaloids such as morphine). Consequently, understanding the coordinated regulation of Tyr and betalain biosynthesis has the potential to enhance the production of Tyr, and the yield of Tyr-derived plant natural products important for human health and nutrition.
[0076] Betalain biosynthesis starts with hydroxylation of Tyr to L-DOPA by at least three closely related cytochrome P450 enzymes (CYP76AD1, CYP76AD5, and CYP76AD6,
[0077] Here we first investigated the Tyr biosynthetic pathway and its regulation in table beet (Beta vulgaris L.), which produces high levels of betalains (Goldman, 1996). Using comparative genomics, biochemical, and cellular analyses, we found plastidic ADH enzymes from B. vulgaris that exhibit relaxed sensitivity to Tyr inhibition in vitro and in vivo. Phylogenetic analysis combined with recombinant enzyme characterization further demonstrated that de-regulated ADH enzymes emerged during the evolution of betalain pigmentations in the core Caryophyllales, and were lost or downregulated following disappearance of betalains. Furthermore, transient expression of the de-regulated ADH in Nicotiana benthamiana led to high accumulation of Tyr in planta. The results revealed the important contribution of primary Tyr pathway regulation to the unique evolution of a plant specialized metabolic pathway, betalain biosynthesis.
Materials and Methods
[0078] Plant Source and Growth Conditions B. vulgaris varieties, red beet (W357B), yellow beet (Touch Stone), and white beet (Blankoma), were provided by Dr. Irwin Goldman from the University of Wisconsin-Madison, Department of Horticulture (Goldman, 1996), whereas sugar beet (Big Buck) and sea beet (PI 562585) were commercial sugar beets obtained from the Heirloom Seeds (West Finley, Pa., USA) and the National Plant Germplasm System (NPGS), respectively. Spinach (Spinacia oleraceae), Pigeonberry (Rivina humilis), four o'clock (Mirabilis jalapa), and common purslane (Portulaca oleracea) were grown from seed with a growing mix soil (Fafard, Agawam, Mass., USA) in a growth chamber under 12 hr light (100 E), 22 C. and 60% humidity. After one month of growth, their leaves were harvested for RNA extraction.
Identification and Cloning of ADH Homologs from Caryophyllales
[0079] BLASTP searches were performed using the protein sequences of ADH and PDH enzymes from A. thaliana (AtADH1/At5g34930, NP_173023; AtADH2/At1g15710, NP_198343), Glycine max (GmPDH, KM507071), Synechocystis sp. PCC6803 (SyADH, WP_010872597), Escherichia coli (EcPDH, WP_052912694), Aquifex aeolicus (AaPDH, WP_010881139) as queries against the sugar beet genome (Beta vulgaris http://bvseq.molgen.mpg.de/) (
[0080] Genomic DNA was extracted using Tris-sodium chloride-EDTA/sodium dodecyl sulfate buffer and precipitated with isopropanol and 200 mM ammonium acetate. For RNA isolation, the method described by Wang et al (2011) was used with some modifications. The tissues were ground in a mortar with liquid nitrogen and powder polyvinylpyrrolidone (PVP). After addition of 700 L fresh pre-warmed lysis buffer (2% CTAB, 2 M NaCl, 100 mM Tris-HCl pH 8, 25 mM EDTA and 5% -mercaptoethanol), the samples were shaken vigorously for 2 min and incubated in a water bath at 65 C. for 5 min. The RNA was converted into complementary DNA (cDNA) using the High-Capacity cDNA Reverse Transcription Kit (Applied Biotechnology, USA) and SuperScript IV Reverse Transcriptase with oligo dT.sub.20 primer or random primers (Invitrogen, USA).
[0081] Cloning primers were designed with the Invitrogen primer design (http://tools.lifetechnologies.com/content.cfm?pageid=9716) and the PCR In-Fusion primers designing program (http://bioinfo.clontech.com/infusion/convertPcrPrimersInit.do, Clontech, Mount View, Calif.). All ADH candidate genes, except for PoADH (see below), were PCR amplified from cDNA using gene-specific primers (Table 1) and Phusion DNA polymerase (Thermo, Waltham, Mass.) with the following conditions: initial denaturation at 95 C. for 5 min, 35 cycles of amplification at 95 C. for 30 s, 58 C. for 30 s, 72 C. for 30 s, with a final extension at 72 C. for 10 min. The PCR fragments were purified using QIAquick gel extraction kit (Qiagen, Valencia, Calif.) and were inserted into the pGEX-2T vector (GE Healthcare) at EcoRI and BamHI sites using the In-Fusion cloning method (Clontech). PoADH was gene synthesized (Biomatik, Cambridge, Ontario, Canada) and directly cloned into the same pGEX-2T vector. For generation of His-tagged proteins, the cloned PCR fragments were inserted into the pET28a vector (Novagen, Madison Wis., USA) at NdeI and EcoRI site.
TABLE-US-00001 TABLE1 Primersusedasindicatedinthedescriptionandmethods Purp Species(gene) ose Primername Primersequence5 to3 Betavulgaris RT- pHM0290SLN GGTTCCGCGTGGATCCCTAACAATTC (BvADH) PCR BvADHF GCAGCAT(SEQIDNO:49) Betavulgaris RT- pHM0291SLN AATTCGGAGACAAATTGAGAATTCAT (BvADH) PCR RBvADHR CGTGACTG(SEQIDNO:50) Betavulgaris RT- pHM0372SLN CTGGTTCCGCGTGGATCCTGCGGTGG (BvADH) PCR BvADHF AGGTGGTTCG(SEQIDNO:51) Betavulgaris RT- pHM0373SLN GTTAATGGTACTAGATAGGAATTCAT (BvADH) PCR BvADHR CGTGACTGA(SEQIDNO:52) Arabidopsisthaliana Cloning pHM0384SLN CTGGTTCCGCGTGGATCCGCAATCGA (AtADH2) AtADHF CGCCGCCCAA(SEQIDNO:53) Arabidopsisthaliana Cloning pHM0385SLN TCATCATCATCATCTTAAGAATTCATC (AtADH2) AtADHR GTGACTGA(SEQIDNO:54) Spinaceaoleracea Cloning pHM0582SoA CTGGTTCCGCGTGGATCCGCCGCTAC (SoADH) DHF CAATACCTCC(SEQIDNO:55) Spinaceaoleracea Cloning pHM0583SoA AATTCAGAGATCAATTGAGAATTCAT (SoADH) DHR CGTGACTGA(SEQIDNO:56) Spinaceaoleracea Cloning pHM0584SoA CTGGTTCCGCGTGGATCCTGCGCCGC (SoADH) DHF CTCTGACTCC(SEQIDNO:57) Spinaceaoleracea Cloning pHM0585SoA TGGTAATAATTCTAGATAGGAATTCA (SoADH) DHR TCGTGACTGA(SEQIDNO:58) Nepenthesalata Cloning pHM0603SLN CTGGTTCCGCGTGGATCCGCCGCGCT (NaADH) NaADHF GCCAAACGACT(SEQIDNO:59) Nepenthesalata Cloning pHM0604SLN AAATGTTGAGAGAAATTGAGAATTCA (NaADH) NaADHR TCGTGACTGA(SEQIDNO:60) Portulaca RT- pHM0609SLN CTGGTTCCGCGTGGATCCTGCTCATCA oleracea(PoADH) PCR PoADHAF TCATCATCAT(SEQIDNO:61) Portulaca RT- pHM0610SLN CGTCAACGATAGATCATAGGAATTCA oleracea(PoADH) PCR PoADHAR TCGTGACTGA(SEQIDNO:62) Mirabilis Cloning pHM0624SLN CTGGTTCCGCGTGGATCCATAGCGAT jalapa(MjADH) MjADHAF AGTTGGGTTTG(SEQIDNO:63) Mirabilis Cloning pHM0625SLN TATCAATGGTCGTCGATAGGAATTCA jalapa(MjADH) MjADHAR TCGTGACTGA(SEQIDNO:64) Rivina Cloning pHM0647SLN CTGGTTCCGCGTGGATCCTGCACGGC hurndis(RhADH) RhADHF CTTCACTAAAAC(SEQIDNO:65) Rivina Cloning pHM0648SLN TCAATGGATCAAAGCGGTAGGAATTC humilis(RhADH) RhADHR ATCGTGACTGA(SEQIDNO:66) Betavulgaris RT- BvADH_q_F TCAAGCTGAGGTTACTTTTGACA(SEQ (BvADH) PCR IDNO:67) Betavulgaris RT- BvADH_q_R AAGAAGCATGATTTAGTGGTGGT(SEQ (BvADH) PCR IDNO:68) Betavulgaris RT- BvADH_q_F TGCAGCGACTTAAACGATCG(SEQID (BvADH) PCR NO:69) Betavulgaris RT- BvADH_q_R TTGGGGAAGTTTGCCGTTTG(SEQID (BvADH) PCR NO:70) Betavulgaris RT- pHM0793SLN AGTTCCCTCTGCTGATATG(SEQID (BvADH) PCR BvADHF NO:71) Betavulgaris RT- pHM0794SLN GTGGTTAATGGTACTAGATAG(SEQ (BvADH) PCR BvADHR IDNO:72) Betavulgaris qPCR pHM0791SLN GCGAAGGAGATCAAATTTCT(SEQID (BvADH) BvADHF NO:73) Betavulgaris qPCR pHM0792SLN TCAATTTGTCTCCGAATTTGC(SEQID (BvADH) BvADHR NO:74) Betavulgaris qPCR BvADH_F ATGATTTCACTCTCTTCTTTTCATCC (BvADH) (SEQIDNO:75) Betavulgaris qPCR BvADH_R GATTTAGTGGTGGTTAATGGTACTAG (BvADH) ATAG(SEQIDNO:76) Betavulgaris qPCR BvADH_F ATGCTTTCTCTCTCCTCCAC(SEQID (BvADH) NO:77) Betavulgaris qPCR BvADH_R CAAATTCGGAGACAAATTGA(SEQID (BvADH) NO:78) Betavulgaris qPCR pHM0001HM TCTATCCTTGCATCTCTCAG(SEQID (BvActin) BvACT NO:79) Betavulgaris qPCR pHM0002HM TCTCCAAGGGCGAGTATGAT(SEQID (BvActin) BvACT NO:80) Betavulgaris qPCR pHM0003HM CATTGGTTCAGGAAGTGCAA(SEQID (BvDODA) BvDODA NO:81) Betavulgaris qPCR pHM0004HM CCTTTGATTCATGGCTTCGT(SEQID (BvDODA) BvDODA NO:82) Betavulgaris qPCR pHM057613vM TATCAAACGAGGGCACTTC(SEQID (BvMYB1) YB1F NO:83) Betavulgaris qPCR pHM0577BvM GATGGTCTTTGATAGCAGC(SEQID (BvMYB1) YB1R NO:84) Betavulgaris qPCR pHM0005HM CTTTTCAGTGGAATTAGCCCACC(SEQ (BvCYP76AD1) BvCYP76AD1 IDNO:85) Betavulgaris qPCR pHM0006HM TGGAACATTATGGAAGATATTGGG (BvCYP76AD1) BvCYP76AD1 (SEQIDNO:86) GFP qPCR tGFP_q_F GGCTGGAAGAGTGATCGGAG(SEQID NO:87) GFP qPCR tGFP_q_R ACGCTACTGTTGAGCATCTTCA(SEQ IDNO:88) GeneRaceroligoT RT- GeneRacer GCTGTCAACGATACGCTACGTAACGGCA PCR OligoT TGACAGTG(T)20(SEQIDNO:89) Eukaryotic qPCR EF1_q_F AGCTTTACCTCCCAAGTCATC(SEQID translational NO:90) elongationfactor1 Eukaryotic EF1_q_R CCAAGATTGACAGGCGTTCT(SEQID translational NO:91) elongationfactor1 qPCR
Recombinant Enzyme Expression and Purification
[0082] The His-tagged recombinant protein expression was carried out as we described previously (Dornfeld et al., 2014). For GST-tagged recombinant protein expression, the cloned pGEX-2T vectors were introduced into Rosetta-2 E. coli competent cells (Novagen, Madison Wis., USA) and cultured overnight at 37 C., 200 r.p.m. in 10 mL LB medium containing Ampicillin (100 g/mL). The ten milliliters of the overnight culture were transferred to 1 L LB medium with Ampicillin (100 g/mL and further incubated at 37 C. and 200 r.p.m. until the OD.sub.600 reached 0.3. The temperature was then changed to 18 C. and, after 1 hr, isopropyl 13-D-1-thiogalactopyranoside (IPTG, 400 mM final concentration) was added to induce recombinant protein expression. After overnight incubation at 18 C. under constant shaking at 200 r.p.m., cultures were harvested by centrifugation at 2,000 g for 10 min at 4 C., and the pellet was washed with 0.9% NaCl solution. The samples were harvested and resuspended in 25 mL of lysis buffer [phosphate-buffered saline (PBS) pH 7.4, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol (DTT) and plant proteases inhibitor cocktail (Amresco, Solon, Ohio, USA)]. The resuspended cells were sonicated for periods of 20 s for 5 min. The cell lysate was centrifuged at 10,000 g for 30 min at 4 C., and the supernatant was applied to Fast Protein Liquid Chromatography (FPLC, AKTApure25 FPLC system, GE Healthcare) equipped with GSTtrapFF (GE Healthcare, USA). Prior and after injection, the column was washed with five times bed volume wash buffer A (PBS, pH 7.6) followed by five times bed volume of wash buffer B (10 mM glutathione, 1.54 g of reduced glutathione dissolved in 500 mL of 50 mM Tris-HCl, pH 8). The recombinant enzymes containing GST-tag were eluted with ten-bed volumes of the elution buffer B and collected into Eppendorf tubes containing 500 Recombinant enzymes eluted in the fraction five and six, which were combined and desalted using a gel filtration column (Sephadex G50-80 resin, Sigma-Aldrich, St Louis, Mo., USA) in the reaction buffer [200 mM HEPES (pH 7.6), 50 mM KCl, 10% ethylene glycol]. Enzyme concentrations were measured using Bradford assay (Bio-Rad, Des Plaines, Ill., USA) and the enzyme purity was estimated by running on SDS-PAGE gel and analyzing with ImageJ (http://imagej.nih.gov/ij/).
ADH and PDH Activity Assays In Vitro
[0083] ADH and PDH activity from beet tissues (
[0084] For detection of Tyr product from the ADH assays, 10 L of the reaction mixture was first derivatized with the equal volume of the 40.26 mM OPA solution [5.4 mg OPA (Sigma-Aldrich, St. Louis, Mo., USA) mixed in 100 L methanol, 5 L 2-mercaptoethanol and 900 L 0.4M boric acid) for 3 min, injected to high pressure liquid chromatography (HPLC, Agilent 1260) equipped with the Eclipse XDH-C18 column (5 m, 3.0150 mm, Agilent, USA), and separated by a 30 min linear gradient from 20-45% methanol in 0.1% ammonium acetate at a flow rate of 0.8 ml/min. The substrate and product of ADH assays (Tyr and arogenate, respectively) were detected by a fluorescence detector (Agilent, USA) with excitation at 360 nm and emission of 455 nm. For PDH assays, the reactions were stopped by addition of NaBH.sub.4, which converts the reaction product HPP into hydroxyphenyllactic acid (HPLA), followed by neutralization with 100 l of 6 N HCl as described by Schenck et al. 2015. The HPLC was equipped with ZORBAX SB-C18 column (Agilent, USA) using a 6 min isocratic elution at 25% methanol in 0.1% phosphoric acid, followed by a 20 min linear gradient of 25-60% methanol at a flow rate of 1.0 mL/min. The HPLA were monitored by absorption at 270 nm.
[0085] To test the electron donor and substrate preferences of purified recombinant enzymes, the ADH and PDH reactions were performed as described above, except for 12 min with 400 M L-arogenate and 1 mM cofactor (NAD.sup.+ or NADP.sup.+). The reaction was stopped by placing the tubes on ice and immediately measured for the production of the reduced cofactor, NAD(P)H, at 340 nm by spectrophotometer (NanoDrop 2000, Thermo Scientific, USA). The quantification was based on the standard curve of authentic NADPH.
[0086] To examine Tyr sensitivity of the purified recombinant enzymes, ADH assay was performed as described previously (Schenck et al., 2015) but in the presence or absence of different concentrations of L-Tyr. Tyr was first dissolved in 0.025 N NaOH at 100 mM (as the water solubility of Tyr is very low, <2 mM), which was diluted to 4 mM to 10 M final concentration in 0.0025 N NaOH. The reactions contained 500 mM HEPES (pH 7.6) to maintain the final pH at 7.6. The production of reduced cofactor (NADPH) was monitored at 340 nm using a spectrophotometer every two minutes for 10 min. In addition, other effectors (L-Phe, L-Trp, and betanin) were used to test possible inhibition of the enzyme ADH activity at a final concentration of 1 mM. All of the reactions were performed under non-saturated condition, where activity increased linearly depending on reaction times and enzyme concentrations.
Transient Expression of BvADH and BvADH in Nicotiana benthamiana
[0087] ADH and ADH sequences used for N. benthamiana agroinfiltration were amplified from Beta vulgaris var. vulgaris variety Boltardy (Chiltern Seeds, UK) swollen hypocotyl and leaf tissue cDNA libraries respectively, which were prepared using BioScript Reverse Transcriptase (Bioline Reagents, London, UK). Transcripts were amplified by PCR using gene specific primers (Table S1) and Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, Mass., USA). Vectors for transient transformation were constructed with Golden Gate cloning using the MoClo Tool Kit (Weber et al., 2011; Addgene, Cambridge, Mass., USA), with the Bpil and BsaI restriction sites eliminated after cloning. The turboGFP sequence used in this assay was a variant codon-optimized for plants contained in the MoClo Plant Parts Kit (Engler et al., 2014; Addgene, Cambridge, Mass., USA). BvADH, BvADH, and turboGFP sequences were ultimately cloned into the pICH86988 binary vector under control of the Cauliflower Mosaic Virus 35S promoter and the Agrobacterium tumefaciens octopine synthase (OCS) terminator.
[0088] Transient gene expression assays in N. benthamiana were performed according to the previously described agroinfiltration method with some modifications (Sparkes et al., 2006). All constructs were transformed into the Agrobacterium tumefaciens GV3101 strain, and grown in LB media supplemented with kanamycin (50 mg/L), gentamycin (25 mg/L) and rifampicin (50 mg/L) until reaching an OD.sub.600 of 1.5. Cultures were then brought to a final OD.sub.600 of 0.5 in infiltration media (10 mM MgCl.sub.2, 0.1 mM acetosyringone, 10 mM MES at pH 5.6) for three hours prior to infiltration. Infiltration spots corresponding to 35S::BvADH, 35S::BvADH, and 35S::turboGFP were performed in the same leaves of 6-week old N. benthamiana plants alternating the position of the spots between plants in a clockwise manner to account for intra-leaf variation (Barshandy et al., 2015). Infiltrated tissue was sampled three days post-infiltration from five biological replicates for tyrosine quantification and qRT-PCR analysis.
[0089] For quantification of tyrosine and other amino acids, 40 mg fresh weight tissues were harvested, lyophilized, sent from the University of Cambridge (UK) to the University of Wisconsin-Madison (USA), and analyzed exactly as described. Tyrosine and other amino acids were extracted and measured as described previously (Wang et al., 2017). Amino acid standards (Sigma-Aldrich, St. Louis, Mo., USA) of 4 to 1000 M were prepared the same way to make standard curves.
Phylogenetic Analysis
[0090] Amino acid sequences from genomes (full open reading frame) and transcriptomes (full or partial open reading frame) of Brockington et al. (2015) were used for phylogenetic analysis following methods described in Brockington et al. (2015) with minor modifications. In addition, we carried out analysis of dN/dS ratio in ADH to test for relaxed selection in anthocyanic lineages (Table 2).
TABLE-US-00002 TABLE 2 Sequences of Caryophyllales (ingroups) and non-Caryophyllales (outgroups) used in this Example. Taxon Source Accession code Citation Ingroups Achatocarpaceae_Phaulothamnus_spinescens Smith Lab MJM1677 (Brockington et al., 2015) Aizoaceae_Cypselea_humifusum 1KP GJNX (Matasci et al., 2014) Aizoaceae_Delosperma_echinatum 1KP BJKT (Matasci et al., 2014) Aizoaceae_Sesuvium_porfulacastrum 1KP HZTS (Matasci et al., 2014) Aizoaceae_Sesuvium_verrucosum 1KP EDIT (Matasci et al., 2014) Aizoaceae_Trianthemum_porfulacastrum 1KP OMYK (Matasci et al., 2014) Aizoaceae_Zaleya_penfandra 1KP BERS (Matasci et al., 2014) Amaranthaceae_Aerva_javanica 1KP HDSY (Matasci et al., 2014) Amaranthaceae_Aerva_lanata 1KP PDQH (Matasci et al., 2014) Amaranthaceae_Alternanthera_brasiliana 1KP ZBPY (Matasci et al., 2014) Amaranthaceae_Alternanthera_caracasana 1KP OHKC (Matasci et al., 2014) Amaranthaceae_Alternanthera_sessilis 1KP BWRK (Matasci et al., 2014) Amaranthaceae_Alternanthera_fenella 1KP EYRD (Matasci et al., 2014) Amaranthaceae_Amaranthus_cruentus 1KP XSSD (Matasci et al., 2014) Amaranthaceae_Amaranthus_retroflexus 1KP WMLW (Matasci et al., 2014) Amaranthaceae_Atriplex_hortensis 1KP ONLQ (Matasci et al., 2014) Amaranthaceae_Atriplex_prostrata 1KP AAXJ (Matasci et al., 2014) Amaranthaceae_Atriplex_rosea 1KP CBJR (Matasci et al., 2014) Amaranthaceae_Bassia_scoparia 1KP WGET (Matasci et al., 2014) AmaranthEceae_Beta_maritima 1KP FVXD (Matasci et al., 2014) Amaranthaceae_Beta_vulgaris Genome v1.1 (Dohm et al., 2014) Amaranthaceae_Blutaparon_vermiculare 1KP CUTE (Matasci et al., 2014) Amaranthaceae_Chenopodium_amaranticolor SRA SRX151423 (Zhang et al., 2012) Amaranthaceae_Chenopodium_quinoa 1KP SMMC (Matasci et al., 2014) Amaranthaceae_Froelichia_floridana Smith Lab MJM1665 (Brockington et al., 2015) Amaranthaceae_Salicornia_europaea SRA SRX302090 (Fan et al., 2013) Basellaceae_Basella_alba 1KP CTYH (Matasci et al., 2014) Cactaceae_Lophophora_williamsii 1KP CPKP (Matasci et al., 2014) Cactaceae_Pereskia_aculeata 1KP JLOV (Matasci et al., 2014) Caryophyllaceae_Cerastium_arvense Smith Lab MJM1767 (Brockington et al., 2015) Caryophyllaceae_Dianthus_caryophyllus Genome v1.0 (Yagi et al., 2014) Caryophyllaceae_Drymaria_cordata Smith Lab LCMsn (Brockington et al., 2015) Caryophyllaceae_Polycarpaea_repens 1KP RXEN (Matasci et al., 2014) Caryophyllaceae_Saponaria_officinalis 1KP SKNL (Matasci et al., 2014) Caryophyllaceae_Schiedea_membranacea 1KP OLES (Matasci et al., 2014) Caryophyllaceae_Silene_latifolia 1KP FZQN (Matasci et al., 2014) Caryophyllaceae_Silene_latifoliaSRA SRA SRX118777- (Muyle et al., 2012) SRX118782 Caryophyllaceae_Silene_vulgaris SRA SRX096120 N/A.sup.1 Caryophyllaceae_Spergulana_media 1KP TJES (Matasci et al., 2014) Droseraceae_Aldrovanda_vesiculosa Smith Lab MJM1652 (Brockington et al., 2015) Droseraceae_Dionaea_muscipula SRA SRX312294 (Jensen et al., 2015) Frankeniaceae_Frankenia_laevis 1KP WPYJ (Matasci et al., 2014) Microteaceae_Microtea_debilis 1KP YNFJ (Matasci et al., 2014) Molluginaceae_Mollugo_cerviana 1KP RNBN (Matasci et al., 2014) Molluginaceae_Mollugo_nudicaulis 1KP SCAO (Matasci et al., 2014) Molluginaceae_Mollugo_verticillata 1KP NXTS (Matasci et al., 2014) Nepenthaceae_Nepenthes_alata 1KP WQUF (Matasci et al., 2014) Nyctaginaceae_Abronia_carletonii Smith Lab MJM1751 (Brockington et al., 2015) Nyctaginaceae_Acleisanthes_lanceolata Smith Lab MJM1741 (Brockington et al., 2015) Nyctaginaceae_Acleisanthes_obtusa Smith Lab MJM1697 (Brockington et al., 2015) Nyctaginaceae_Anulocaulis_leiosolenus Smith Lab SRX717838 (Yang et al., 2015) Nyctaginaceae_Boerhavia_burbidgeana 1KP VJPU (Matasci et al., 2014) Nyctaginaceae_Boerhavia_coccinea 1KP ZBTA (Matasci et al., 2014) Nyctaginaceae_Bougainvillea_spectabilis 1KP JAFJ (Matasci et al., 2014) Nyctaginaceae_Bougainvillea_stipitata Smith Lab SRX718672 (Yang et al., 2015) Nyctaginaceae_Cyphomeris_gypsophiloides Smith Lab MJM1714 (Brockington et al., 2015) Nyctaginaceae_Guapira_obtusata Smith Lab SRX718384 (Yang et al., 2015) Nyctaginaceae_Mirabilis_jalapa 1KP JGAB (Matasci et al., 2014) Nyctaginaceae_Mirabilis_multifiora Smith Lab MJM1771 (Brockington et al., 2015) Nyctaginaceae_Pisonia_aculeata Smith Lab SRX718389 (Yang et al., 2015) Nyctaginaceae_Pisonia_umbellifera Smith Lab SFB29 (Brockington et al., 2015) Physenaceae_Physena_madagascariensis 1KP RUUB (Matasci et al., 2014) Phytolaccaceae_Ercilla_volubilis Smith Lab MJM1649 (Brockington et al., 2015) Phytolaccaceae_Hilleria_latifolia 1KP SFKQ (Matasci et al., 2014) Phytolaccaceae_Petiveria_alliacea 1KP AZBL (Matasci et al., 2014) Phytolaccaceae_Phytolacca_americana 1KP BKQU (Matasci et al., 2014) Phytolaccaceae_Phytolacca_bogotensis 1KP MRKX (Matasci et al., 2014) Phytolaccaceae_Phytolacca_diuica Smith Lab SFB31 (Brockington et al., 2015) Phytolaccaceae_Rivina_humilis Smith Lab SRX718277 (Yang et al., 2015) Phytolaccaceae_Seguieria_aculeata Smith Lab SRX718486 (Yang et al., 2015) Plumbaginaceae_Limonium_spectabile 1KP WOBD (Matasci et al., 2014) Polygonaceae_Antigonon_leptopus Smith Lab MJM1811 (Brockington et al., 2015) Polygonaceae_Fagopyrum_esculentum SRA SRX112838 N/A.sup.1 Polygonaceae_Polygonum_convolvulus 1KP FYSJ (Matasci et al., 2014) Polygonaceae_Polygonum_cuspidatum SRA SRX079484 (Hao et al., 2012) Polygonaceae_Rheum_nobile SRA SRX621187 N/A.sup.1 Polygonaceae_Rheum_rhabarbarum SRA SRX286365 N/A.sup.1 Polygonaceae_Rumes_acetosa SRA ERX190940 N/A.sup.1 Polygonaceae_Rumex_palustris SRA ERX190941, N/A.sup.1 ERX190942 Portulacaceae_Portulaca_amilis 1KP LDEL (Matasci et al., 2014) Portulacaceae_Portulaca_cryptopetala 1KP LLQV (Matasci et al., 2014) Portulacaceae_Portulaca_grandiflora 1KP CPLT (Matasci et al., 2014) Portulacaceae_Portulaca_molokiniensis 1KP UQCB (Matasci et al., 2014) Portulacaceae_Portulaca_oleracea 1KP EZGR (Matasci et al., 2014) Portulacaceae_Portulaca_pilosa 1KP IWLS (Matasci et al., 2014) Portulacaceae_Portulaca_suffruticosa 1KP GCYL (Matasci et al., 2014) Sarcobataceae_Sarcobatus_vermiculatus 1KP GIWN (Matasci et al., 2014) Summondsiaceae_Simmondsia_chinensis 1KP CVDF (Matasci et al., 2014) Talinaceae_Talinum_sp 1KP LKKX (Matasci et al., 2014) Tamaricaceae_Reaumuria_trigyna SRA SRX099851, N/A.sup.1 SRX105466 Tamaricaceae_Tamarix_hispida SRA All 8 runs in (Wang et al., 2014) PRJNA170420 Outgroups Arabidopsis_thaliana Genome Accessed May 28, (Goodstein et al., 2012) 2014 Oryza_sativa Genome Accessed Apr. 21, (Goodstein et al., 2012) 2015 Solanum_lycopersicum Genome Accessed May 28, (Goodstein et al., 2012) 2014 Vitis_vinifera Genome Accessed Apr. 21, (Goodstein et al., 2012) 2015 .sup.1N/A, not available.
Subcellular Localization of GFP-Fused ADH Enzymes
[0091] The subcellular localization experiments of GFP-fused ADH enzymes were conducted as we described previously (Schenck et al., 2015).
Accession Numbers
[0092] The Genbank accession numbers for the sequences mentioned in this article are: BvADH W357B red beet variety (KY207366), BvADH Boltardy red beet variety (MF346292), BvADH Big Buck sugar beet variety (KY207367), BvADH Touch Stone yellow beet variety (KY207368), BvADH Blankoma white beet variety (KY207369), BvADH Sea beet P1562585 variety (KY207370), BvADH Big Buck sugar beet variety (KY207371), BvADH W357B red beet variety (KY207372), BvADH Boltardy red beet variety (MF346291), BvADH Blankoma white beet variety (KY207373), BvADH Touch Stone yellow beet variety (KY207374), BvADH Sea beet P1562585 variety (KY207375), SoADH (KY207376), SoADH (KY207378), NaADH (KY207377), MjADH (KU881770), RhADH (KY207379), PoADH (KY207380), SmADH (KY274179), PpADH (KY274180), and H1ADH (KY274181).
Results
[0093] B. vulgaris has two ADH enzymes.
[0094] To first investigate how B. vulgaris synthesizes Tyr, protein crude extracts of red beet leaf and root/stem tissues were analyzed for ADH and PDH activity, the production of Tyr or HPP from arogenate or prephenate, respectively. Tyr was produced from arogenate in the red beet extracts of both leaves and roots/stems (
[0095] To identify the gene(s) responsible for the ADH activity in B. vulgaris, previously reported plant and microbial ADH and PDH genes (Bonvin et al., 2006; Hudson et al., 1984; Legrand et al., 2006; Rippert & Matringe, 2002a,b; Schenck et al., 2015,
[0096] For biochemical characterization, these two putative BvADHs were expressed in E. coli as recombinant enzymes, which were further purified using affinity chromatography and subjected to ADH and PDH assays. Both of the beet recombinant enzymes showed ADH activity (i.e. the production of Tyr from arogenate,
Both BvADHs are Plastid Localized but Only BvADH Expression is Correlated with Betalain Pathway Genes.
[0097] Most plant enzymes involved in the aromatic amino acid pathways are localized within the plastids (Dal Cin et al., 2011; Maeda & Dudareva, 2012; Rippert et al., 2009), and both BvADH proteins also have a predicted N-terminal plastid transit peptide (
[0098] To examine expression patterns of BvADHs, especially in comparison to the betalain pathway genes, expression levels of BvADH and BvADH were analyzed and compared with those of DODA, CYP76AD1, and BvMYB1 in cotyledon and hypocotyl tissues of sugar and red beets (
BvADH but not BvADH Exhibits Relaxed Sensitivity to Tyr
[0099] Both ADH and PDH enzymes are usually inhibited by Tyr in most organisms (Bentley, 1990; Connelly & Conn, 1986; Gaines et al., 1982; Rippert & Matringe, 2002a,b; Sun, 2009). To determine if the BvADHs are also feedback regulated by Tyr, ADH activity of the recombinant BvADH enzymes were analyzed in the presence and absence of Tyr as an effector molecule. The ADH activity of glutathione S-transferase (GST)-tagged BvADH was inhibited by 80% and 100% in the presence of 100 M and 1 mM Tyr, respectively (
Heterologous Expression of BvADH but not BvADH Increase Tyr Accumulation in Plants.
[0100] To test if BvADH having relaxed sensitivity to Tyr can enhance the production of Tyr in planta, BvADH and BvADH were transiently expressed in N. benthamiana through Agrobacteria infiltration (
TABLE-US-00003 TABLE 3 Amino Acid levels of Nicotiana benthamiana leaves expressing GFP, BvADH, BvADH. Agrobacteria carrying the 35S::GFP, 35S::BvADH, or 35S::BvADH construct were infiltrated to Nicotiana benthamiana leaves and the levels of amino acids were analyzed after three days post-infiltration. Data are mean s.e.m. (nmol/gFW, n = 5 biological replications). Asterisks denote values significantly different from the control 35S::GFP sample (Student t-test, p < 0.01). Tryptophan, lysine, cysteine, and histidine levels were below quantification threshold. Amino Acids 35S::GFP 35S::BvADH 35S::BvADH alanine 99.8 15.5 93.0 14.8 88.1 20.0 glycine 15.5 1.sup. 17.5 2.1 13.6 0.2 valine 23.9 9.7 23.8 8.3 22.1 8.4 leucine 21.3 10.4 21.8 9.2 18.8 8.3 isoleucine 13.8 7.sup. 13.3 5.7 13.3 6.7 proline 154.8 67.4 126.7 56.3 137.3 75.4 methionine 2.8 0.4 3.1 0.4 2.6 0.2 serine 57.4 8.sup. 58.6 11.7 43.9 3.9 threonine 69.4 7.5 67.8 8.6 58.1 6.5 phenylalanine 10.8 0.7 5.9 1.2* 9.7 0.7 aspartic acid 173.5 45.5 176.8 40.6 132.7 41.5 glutamic acid 941.6 45.8 968.1 91.6 746.4 111.4 omithine.sup.a 54.9 1.6 56.2 2.4 48.4 2.9 asparagine 6.8 1.2 6.9 1.5 4.9 1.0 glutamine 345.2 116.1 348.7 138.4 291.3 107.7 tyrosine 11.2 2.8 116.8 15.1* 17.2 3.2 .sup.aArginine was quantified as its non-enzymatic degradation product omithine.
BvADH Orthologs Emerged During the Evolution of Betalain Pigmentation in Caryophyllales.
[0101] Domestication has modified metabolic traits in various crops (Hanson et al., 1996; Rapp et al., 2010; Rong et al., 2014). Thus, we hypothesized that the BvADH enzyme with relaxed Tyr regulation was selected during domestication and intensification of color in table beets, that have been used at least since the Roman times (Biancardi et al., 2012; Dohm et al., 2014). To test this hypothesis, the nucleotide and protein sequences of BvADH (and BvADH) were compared among different domesticated beets, red beet (W357B), sugar beet (Big Buck), yellow beet (Touch Stone), and white beet (Blankoma), as well as their wild relative, sea beet (Biancardi et al., 2012) (Beta vulgaris subsp. maritima). Several single nucleotide polymorphisms (SNPs) were detected among different lines in both BvADH and BvADH (
[0102] To further test if the ADH enzymes with reduced Tyr sensitivity are restricted to the species B. vulgaris, the corresponding genes for BvADH and BvADH were cloned from a closely related species within the same Amaranthaceae family, spinach (Spinacia oleracea), whose draft genome is available (http://bvseq.molgen.mpg.de). Spinach ADH and ADH orthologs (SoADH and SoADH) had 77 and 83% identity at amino acid levels to the corresponding BvADHs in the mature enzymatic regions. The recombinant enzymes of spinach ADHs showed similar Tyr sensitivity to beet ADHs: SoADH, but not SoADH, exhibited reduced Tyr sensitivity (
[0103] To determine the origin and molecular evolution of BvADH, we mined genome and transcriptomic data across the Caryophyllales for ADH orthologs and performed a phylogenetic analysis (
Betalain-Producing Species have Deregulated BvADH Enzyme and Elevated Tyr Levels.
[0104] To further test experimentally if ADH orthologs across Caryophyllales share the unique property of reduced Tyr inhibition, ADH genes from representative members of Caryophyllales (Brockington et al., 2011) were cloned and the Tyr sensitivity of encoded enzymes was evaluated. An ADH enzyme from the anthocyanin-producing non-core Caryophyllales, Nepenthes ventricosaalata (NaADH, Nepenthaceae,
[0105] To test if Tyr-insensitivity of the recombinant ADH enzyme is also detectable in vivo, Tyr sensitivity of leaf ADH activity was analyzed from species containing ADH (i.e. spinach) and ones lacking ADH [i.e. Arabidopsis thaliana; Dianthus barbatus, Caryophyllaceae]. Spinach rather than beet was used due to its cleaner background during HPLC-based enzyme assay. As shown in Table 4 and
TABLE-US-00004 TABLE 4 Tyr sensitivity of ADH activity from plant tissue extracts. Total protein extracts of spinach, Dianthus barbatus, and Arabidopsis leaf tissues were used to analyze ADH activity in the presence and absence of 0.5 mM Tyr analog (3-fluoro-Tyr), which were used to calculate percent inhibition. ADH activity was measured with 1 mM arogenate substrate and 1 mM NADP.sup.+ cofactor during 2 hr incubation (see FIG. 13). Data are means s.e.m. (n = 4). ADH activity (nmol/mg protein) species 0 mM 3-fluoro-Tyr 0.5 mM 3-fluoro-Tyr inhibition (%) Spinach oleracea 66.4 5.0 52.7 1.9 20.7% Dianthus barbatus 18.1 0.3 0.9 0.2 95.0% Arabidopsis thaliana 93.5 5.2 7.8 0.5 91.6%
[0106] To further test if the presence of deregulated ADH leads to increased Tyr accumulation in betalain-producing species, Tyr levels were quantified in young leaves of a variety of Caryophyllales species with or without ADH and also in Arabidopsis thaliana as a comparison. Anthocyanin-producing species from non-core Caryophyllales (e.g. Nepenthes ventricosaalata) and Caryophyllaceae (e.g. Dianthus barbatus) had Tyr levels (2.1 to 8.8 nmol/gFW) comparable to that of Arabidopsis (5.3 nmol/gFW). On the other hand, while large variations were observed, betalain-producing ADH-containing species all had significantly higher Tyr levels (from 12 to 180 nmol/gFW) than Arabidopsis (
ADH Orthologs Underwent Relaxed Selection and Gene Loss in Lineages that have Reverted from Betalain to Anthocyanin Pigmentation
[0107] Interestingly, when ADH orthologs were recovered from Caryophyllaceae or Molluginaceae transcriptomic data, they were often recovered in partial sequences, indicating general low abundance. Within the Caryophyllaceae, ADH orthologs was only detected in the subfamily Paronychioideae (Greenberg & Donoghue, 2011), which forms a grade paraphyletic to the rest of the family. To test for relaxed selection in anthocyanic lineages we further examined a subset of ADH orthologs with sequences either verified by Sanger sequencing or by transcriptome read mapping and manual inspection of read coverage. Although no obvious acceleration of substitution was observed in Caryophyllaceae from nucleotide coding sequences (CDS,
TABLE-US-00005 TABLE 5 RELAX analysis support the acceleration in amino acid substitution in Caryophyllales is due to relaxed purifying selection, instead of intensified positive selection Branch 1 (purifying 2 (nearly 3 (positive Model log L # par. AICc Ltree set selection) neutral) selection) Partitioned 5484.8 38 11046.5 2.23 Reference 0.0743 (100%) MG94xREV Test 0.166 (100%) Null 5374.3 41 10831.7 11.9 Reference 0.00 (83%) 0.550 (15%) 30.9 (1.4%) Test 0.00 (83%) 0.550 (15%) 30.9 (1.4%) Alternative 5359.6 42 10804.2 84.5 Reference 0.00598 (91%) 0.650 (7.9%) 540 (1.5%) Test 0.0646 (91%) 0.794 (7.9%) 29.0 (1.5%) K = 0.54. Test for selection relaxation (K < 1) was significant (p = 5.6e8, LR = 29.48)
Discussion
[0108] This study found that B. vulgaris has ADH but no PDH enzymes or activity (
[0109] Other insensitive ADH/PDH enzymes have been previously found in microorganisms (Legrand et al., 2006) and the structural analyses of Tyr sensitive and insensitive enzymes identified histidine 217 as a possible residue responsible for its Tyr sensitivity (Legrand et al., 2006; Sun et al., 2009). Also, phylogeny-guided structure-function analysis revealed that converting a single active site aspartate 222 residue into a non-acidic residue played a key role in the evolution of the legume PDH enzymes and simultaneously introduced prephenate substrate specificity and Tyr insensitivity (Schenck et al., 2017). However, the corresponding histidine and aspartate residues are still present in BvADH (
[0110] Previous analyses of molecular evolution of DODA and CYP76AD1, two enzymes which convert Tyr into betalains (Christinet et al., 2004; Ganda-Herrero & Garca-Carmona, 2012; Hatlestad et al., 2012), revealed that both of these genes arose through gene duplication, just prior to the origin of betalain pigmentation in Caryophyllales (Brockington et al., 2015). Similarly, this study found that ADH orthologs arose by gene duplication, prior to the emergence of DODA and CYP76AD1 (
[0111] In the anthocyanic Caryophyllaceae, the transition of betalain pigmentation to anthocyanin pigmentation was associated with down-regulation, relaxed natural selection, and deletion of ADH (
[0112] A mechanism underlying the mutually exclusive distribution of betalain and anthocyanin pigments has long fascinated evolutionary biologists (Brockington et al, 2011; Des Marais, 2015). Our analyses now provide one possible explanation. The relaxation of the Tyr-mediated feedback inhibition may direct more carbon flow towards Tyr, and away from Phe biosynthesis (
[0113] Prior heterologous reconstructions of specialized metabolic pathways resulted in significant accumulations of Tyr-derived plant natural products, such as a cyanogenic glycoside, dhurrin, in Arabidopsis (4% per dry weight, Tattersall et al., 2001; Kristensen et al., 2005) and betalains in tobacco (330 mg kg.sup.1 approaching red beet extract of 760 mg kg.sup.1, Polturak et al., 2016). In other cases, however, DODA and CYP76AD1 expression in Arabidopsis still required feeding of Tyr for betalain production (Harris et al., 2012; Sunnadeniya et al., 2016). Therefore, pulling a precursor (e.g. Tyr) may not be always enough to efficiently produce its downstream product, and pushing the precursor supply may be also important. Indeed, in red beets, increased Tyr levels have a strong positive correlation with enhanced accumulation of betalains (Wang et al., 2017), suggesting that elevated production of Tyr plays important role in overall production of betalains. Over 100-fold increase in Tyr accumulation observed in N. benthamiana leaves expressing ADH (
Additional Materials and Methods
[0114] ADH Activity from Plant Tissue Extracts
[0115] Spinach oleracea seeds (HighMowing, Wolcott, Vt.) and pink Dianthus barbatus (BloomIQ, Lansing, Mich.) seedlings were purchased from a nursery and were grown together with Arabidopsis thaliana (ecotype Columbia) in 22 C., 60% humidity, and 12/12 h light cycle growth chamber. Leaves of spinach and Arabidopsis seedlings were harvested at 3-week-old, and Dianthus barbatus leaves were harvested at 6-week-old. The crude extracts of Arabidopsis or Dianthus barbatus were prepared from 1 g leaf tissues according to Aryal et al. (2014). For spinach, 10 g leaf tissues were used to isolate the plastids according to Aryal et al. (2014) in order to avoid the undesired cytosolic polyphenol oxidase activity. Crude or plastid fractions were desalted by Sephadex G50 column to obtain protein extracts, and protein concentration of all biological replicates were adjusted to 0.06, 0.85, and 0.6 mg/mL for spinach, Dianthus barbatus, and Arabidopsis extracts, respectively. Time course ADH activity assays at 0, 1, 2, and 3 hr were performed in the presence and absence of 500 M Tyr analog, 3-fluoro-Tyr, in 10 L reaction containing 50 mM sodium phosphate (pH 8.0), 1 mM arogenate, 1 mM NADP.sup.+, 10 g/mL tetracycline (to inhibit prokaryotic-type protein synthesis of plastids or bacterial contamination), and 0.3, 4.25, and 3 g of spinach, Dianthus, and Arabidopsis protein, respectively. The reaction was stopped by adding 20 L methanol containing 10 M norvaline as an internal standard. Respective boiled protein extracts were used as negative controls. ADH activity was quantified by the formation of tyrosine according to (Schenck et al., 2015), except that tyrosine was detected as o-phthalaldehyde derivative with excitation/emission wavelength of 360/455 nm by fluorescence detector, and o-phthalaldehyde derivative of the norvaline internal standard was quantified at 336 nm by DAD detector.
Analysis of Tyr Contents from Caryophyllales Tissues
[0116] Metabolite extracts of thirteen Caryophyllales species were prepared from 70 mg of youngest leaves, except for flowers of a Cactaceae species to avoid succulent tissues. All plants were grown and harvested at Botany Greenhouse of the University of Wisconsin-Madison. Young leaf tissues of 4 weeks-old Arabidopsis Columbia ecotype were used as a control. Harvested tissues were extracted by adding 400 L extraction buffer containing methanol:chloroform (2:1, v/v) and 100 M 4-chlorobenzoic acid (an internal standard). After adding 300 L water and 125 L chloroform, the mixture was vigorously mixed by a vortex mixer for 5 min and centrifuged at 20,000 g for 5 min for phase separation. The upper polar phase of 400 L was transferred to a new centrifuge tube and dried down in a benchtop speed vacuum (Labconco, Kansas City, Mo., USA). The dried polar phase was resuspended in 200 L methanol. After centrifugation at 20,000 g for 5 min, 20 L was injected into the Agilent 1260 HPLC equipped with Atlantis T3 C-18 column (3 m, 2.1150 mm, Waters, Milford, Mass.), and separated by the following gradient of acetonitrile (B) in 0.1% formic acid (A): 1% B for the first 5 min, followed by a linear increase to 76% B at 10 min, an isocratic elution at 76% B until 16 min, followed by re-equilibration at 1% B. Tyr was monitored with the fluorescence detector at 274 and 303 nm for excitation and emission, respectively. The internal standard was monitored by photodiode array detector at 270 nm. Statistical analyses were conducted by the Statistica Analysis Software (SAS) based on the mixed effect model (Pinheiro, 2000) to compare between the two groups having and not-having ADH and using the fixed effect model (Milliken, 2009) to compare individual samples against Arabidopsis control.
Reverse Transcription PCR (RT-PCR) Analysis
[0117] RT-PCR was carried out on five biological replicates for each infiltrated vector (
Quantitative Real-Time PCR (qRT-PCR) Analysis
[0118] For quantification of endogenous expression of BvACTIN (internal control), BvADH, BvADH, BvDODA, BvMYB1 and BvCYP76AD1, red beet (W357B) and sugar beet (Big Buck) plants were grown in 22 C., 60% humidity, and 12/12 hr light cycle in a growth chamber. The seedlings were harvested at 7-days after germination and the tissue was divided into cotyledon and hypocotyl. RNA was extracted (O{umlaut over (n)}ate-Snchez and Vicente-Carbajosa, 2008) and DNAse treated (Ambion, Austin Tex., USA) following by cDNA preparation using MLV Reverse Transcriptase (Promega, Madison, Wis., USA). qRT-PCR was performed using the GoTaq qPCR Master Mix (Promega, Madison, Wis., USA), and the Stratagene Mx3000P qPCR System (Agilent Technologies, Stratagene, La Jolla, Calif., USA). Amplification conditions were as follow: an initial step of 1 min at 95 C. followed by 45 cycles of 15 s at 95 C., 30 s at 60 C. and 30 s at 72 C. The gene expression of BvADH was normalized using BvACTIN as an internal control and analyzed by using the relative expression of the genes. The results are shown in % expression relative to the highest sample (
Phylogenetic Analysis
[0119] Amino acids from genomes (full open reading frame) and transcriptomes (full or partial open reading frame) of Brockington et al. (2015) were used in this analysis with minor modifications in species included (Table 2). The final taxon sampling in this study consisted of 95 species, with 91 ingroup species (89 transcriptomes and 2 genomes) representing 26 of the 39 families in Caryophyllales (Hernndez-Ledesma et al., 2015) and four outgroup genomes from eudicots and monocots (Table 2). Amino acid sequences of the 11 functionally characterized ADH genes were used as baits to search against each of the 95 species. To maximize the sensitivity of homology searches in order to identify short and incomplete sequences from de novo assembled transcriptomes, we used SWIPE v2.0.11 (Rognes, 2011) with a high E-value cutoff of 10 and low minimal bitscore cutoff of 30. Hits from all 11 query sequences against each species were ranked from high to low by bitscore, and the top 10 hits from each species were pooled and used for the initial phylogenetic analysis.
[0120] The pooled top hits from each of the 95 species, together with the 11 baits were used as the starting sequence file (948 sequences). An initial phylogenetic analysis was conducted using MAFFT v7.215 with --genafpair--maxiterate 1000 (Katoh & Standley, 2013). Columns with more than 90% missing data in the resulting alignment were trimmed using Phyutility v2.2.6 with -clean 0.1 (Smith & Dunn, 2008) and a phylogeny was estimated using RAxML v8.1.5 with the model PROTCATWAG (Stamatakis, 2014). After visually examining the alignment and tree, tips with branch lengths that were outliers were removed (any terminal branches that had on average more than two substitutions for each amino acid site; or more than ten times longer than its sister group and on average had more than one substitution per site; Yang and Smith, 2014). Monophyletic or paraphyletic tips that belonged to the same species from transcriptome data most often resulted from isoforms produced during de novo assembly. These were masked, leaving only the tip with the highest number of aligned characters (Yang and Smith, 2014). Internal branches with molecular branch lengths longer than 1 were likely due to distantly related paralogs or assembly artifacts and were pruned. A large number of distantly related genes, isoforms, and assembly errors were removed during the tip trimming and long branch removing process, with 251 sequences left. A new fasta file was written from remaining tips, and this alignment, tree building, and tree trimming procedure was repeated once, with 229 sequences left. Following the homology search and filtering, we extracted the Caryophyllales ADH gene lineage rooted by outgroup genomes (Yang and Smith, 2014). While visually examining alignment and tree we found the sequence Cham@c36044_g1_i2_242_1480_minus that belonged to Chenopodium giganteum, but were placed in between ADH and ADH, outside of Chenopodiaceae. Further examination of the alignment showed that the half of the sequence was closely related to ADH, and the other half closely related to ADH. Although this can be real, it is most likely an assembly error and was removed from the analysis. Indeed, Chenopodium giganteum had additional, correctly assembled ADH and ADH copies nested in respective Chenopodiaceae clades. Therefore this putative chimeric sequence was removed.
[0121] Remaining sequences belonged to the Caryophyllales ADH lineage were aligned with MAFFT with --genafpair --maxiterate 1000 and trimmed by Phyutility with -clean 0.3. An alternative alignment was constructed with PRANK v140603 using default settings (Lytynoja & Goldman, 2008; 2010), poorly aligned sequences were manually removed, and trimmed by Phyutility with -clean 0.1. We used two alternative alignment methods because MAFFT tends to force regions to align even when they are highly divergent whereas PRANK tends to introduce lots of gaps in highly divergent regions. On the other hand, PRANK is an iterative alignment, tree building, and refinement pipeline that we run five iterations before obtaining the final alignment. For both trimmed alignments, a phylogenetic tree was constructed using RAxML with -m PROTCATAUTO and 200 rapid bootstrap replicates to evaluate support. Given that the resulting tree topologies and support values using both alignments were very similar we are presenting the results from MAFFT. The code used in the phylogenetic analysis is available from https://bitbucket.org/yangya/adh_2016.
Testing for Relaxed Section in Caryophyllaceae
[0122] To test for shift in selection pressure in ADH associated with loss of betalain, we carried out selection analysis on a reduced data set that included representative sequences across ADH that were either verified by Sanger sequencing or by mapping reads back to the de novo assembled contigs and carefully examining read coverages visually.
[0123] Within the family Caryophyllaceae, ADH expression was detected in the transcriptome of only the subfamily Paronychioideae. Those ADH transcripts from Corrigiola litoralis and Telephium imperati were both confirmed by PCR and Sanger sequencing. Two Spergularia media fragments from transcriptome assembly were both belonged to ADH and are non-overlapping in the alignment. These two fragments could be from two loci or from a single locus. To distinguish between these two scenarios, we first extended the two fragments separately using Assembly by Reduced Complexity (Hunter et al., 2015, ARC v.1.1.3) with maximum 10 cycles, Bowtie 2 v2.2.8 (Langmead & Salzberg, 2012) for read mapping and Newbler v2.9 (454 Life Sciences, downloaded Mar. 17, 2015) for assembly. After extending the original assembly and aligning it with other ADH sequences, the two extended fragments were still 22 base pairs apart. To evaluate whether these two fragments were supported by raw reads we concatenated the two fragments by fixing the direction and adding 22 Ns to the middle, and mapped raw reads to the concatenated reference using Bowtic 2 with the setting --phred64 --very-fast-local. The 22 bp gap was highly supported by read pairs and the joined read were kept for subsequent dN/dS analysis. We carried out the same procedure for Polycarpaea repens but were unable to join the reads nor confirm they are paralogs due to low read coverage and a longer gap between the two fragments. Therefore, the two fragments were kept in the alignments for phylogenetic analysis but were removed for dN/dS analysis.
[0124] To obtain ADH sequences from additional species of Caryophyllaceae, primers were designed to the conserved portion of the Spergularia media contig, and were used to amplify ADH sequences from the closely related Spergularia marina. Inverse PCR was used to obtain ADH sequences from Spergularia marina, Paronychia polygonifolia and Herniaria latifolia. For inverse PCR, genomic DNA was digested with restriction enzymes EcoRI and MfeI, and fragments were circularised with T4 ligase (Biolabs, New England). Nested primers were used to amplify the fragment containing the ADH ortholog. Amplified products were sanger sequenced to acquire the 5 and 3 terminals of the locus. In summary, a total of six well-supported ADH sequences were then taken forward for the dN/dS selection analyses.
[0125] Our final alignment for selection analysis included eight ADH sequences in Caryophyllaceae and six additional sequences from representative betalain-producing species across rest of the ADH lineage. We first trimmed the alignment to remove signal peptide and poorly aligned ends, leaving the region from BvADH amino acid no. 79 to 354 that covered the enzyme active domain. We then carried out phylogenetic analyses for both alignments in RAxML, with the model GTRCAT for the codon alignment and PROTCATAUTO for the amino acids alignment, and 200 rapid bootstrap replicates to evaluate node support (
Example 2: Overexpression of BvADH but not BvADH Leads to High Accumulation of Tyrosine in Arabidopsis thaliana
[0126] Beta vulgaris accumulates high amounts of endogenous tyrosine as well as its derived metabolites betalains due to the presence of the tyrosine-insensitive BvADH enzyme. To further test if the lack of BvADH feedback regulation is a critical factor for high tyrosine accumulation in plant tissues, BvADH, BvADH, and Arabidopsis ADH2 (AtADH2) were individually overexpressed by the 35S promoter of the cauliflower mosaic virus (CaMV) in A. thaliana Col-0 background. The empty vector containing no gene was also introduced as a negative control. Gas chromatography-mass spectrometry (GC-MS) based metabolite analysis showed that overexpression of BvADH but not BvADH or AtADH2 leads to much higher accumulation of tyrosine than the empty vector control (nearly 50-fold increase,
Material and Methods
[0127] Cloning of BvADH, BvADH and AtADH2 cDNAs into Overexpression Binary Vector
[0128] Total RNA isolated from Beta vulgaris and Arabidopsis thaliana leaf tissues were used to synthesize cDNA using random primers and the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Specific oligonucleotides to amplify each of the desired cDNAs were designed using In-Fusion Primer design tool (Clontech). PCR fragments were obtained using Phusion High-Fidelity DNA polymerase and cloned into the binary vector DF_264 vector, downstream of the 35S CaMV promoter, using the In-Fusion HD cloning kit. Plasmid was linearized with the restriction enzymes XbaI and BamHI (FastDigest, Thermo Scientific) and the enzymes sites were preserved after cloning. XbaI site is upstream of ATG start codon and BamHI is downstream of TAA stop codon. All reactions were performed accordingly with the instructions of the manufacter. In-Fusion cloning reactions were transformed into E. coli Stellar Competent cells (Clontech) and positive colonies were selected on LB agar plates containing 50 g/mL Spectinomycin. Antibiotic resistance colonies were confirmed for the presence of the cDNA insert by colony PCR and submitted to plasmid isolation. cDNA inserts were checked for possible point mutations by SANGER sequencing the obtained plasmids using primers annealing at the 35S CaMV promoter and NOS terminator. Confirmed vectors were transformed into Agrobacterium tumefaciens GV3101 by freeze-thaw method.
Arabidopsis Transformation and Transgenic Selection.
[0129] Flowering A. thaliana Col-0, 5-6 weeks old, were used to plant transformation by floral dip (Bent A (2006) Arabidopsis thaliana floral dip transformation method. Methods Mol Biol. 343: 87-103). Briefly, flower buds were submerged into Agrobacterium GV3101 solution. The excess of solution was removed using absorbent paper. Plants were transfer to a close container to preserve humidity and kept in a dark environment for 16 hours after transformation. After this period of time, plants were acclimated back to the growth chamber. The transformation process was repeated after 5 days of the first transformation and plants were kept in the growth chamber until harvesting. T.sub.0 seeds were chlorine sterilized and germinated on Force Murashige and Skoog (MS) agar plates supplemented with 1% Sucrose and 100 g/mL of Gentamycin. 10 positive T.sub.1 seedlings for each construct were transferred to soil and seeds were harvested for each individual plant. Transgenic lines were then checked for the number of insertions based on the segregation ratio of antibiotic resistant T.sub.2 seedlings. Single-insertion homozygous T.sub.2 lines were then germinated on soil and 4-weeks old plants were analyzed for Tyr and other organic acids contents by gas chromatography-mass spectrometry analysis (GC-MS).
GC-MS Analysis
[0130] Four-week old Arabidopsis plants overexpressing BvADH, BvADH, AtADH2 or empty vector were submitted to GC-MS analysis. Briefly, approximately 30 mg of fresh leaf tissue was excised from at least 3 plants of each transgenic line to compound one biological replicate. Tissue sample was transferred to a 1.5 mL microcentrifuge tube and 400 L of solvent extraction solution [Methanol:Chloroform (2:1) with 100 M norvaline]. Three 3 mm glass beads were added to each tube and samples were submitted to GenoGrindr (1500 strokes/min) for 5 min. After a brief spin 300 L of water, followed by 125 L of Chloroform were added to each sample. Samples were vortex on high for 30 seconds and centrifuged at 21000g for 5 minutes to achieve phase separation. The aqueous phase was carefully transferred to a new 1.5 mL tube and transfer to speedvac system at room temperature until completely dry. After dry, the polar phase compounds were resuspended in 210 L of methanol containing 100 M 4-chlorobenzoic acid. Samples were sonicated for 10 min and insoluble remaining debris was removed by centrifugation at 21000g for 5 min. at room temperature. 100 L of supernatant was transferred into a glass vial and the methanol was dry out in the speed vac. After dry, the inserts were transferred to a glass vial and the pellets were ressuspended in 40 L pyridine. Samples were submitted to sonication for 10 min and 40 L of N-methyl-N-(tert-butyldimethylsilyl) trifluoroacetamide with 1% tertbutyldimetheylchlorosilane (MTBSTFA+1% t-BDMCS) was added to each sample. Samples were incubated at 80 C. for 1 hour and transferred to analysis on GC-MS. The GC-MS was stablished as Hold at 70 C. for 2 min, increased to 250 C. by 5 C. per min., then hold at 300 C. for 10 min. Amino acid standard (Sigma, #AAS18) was used to stablish the standard curve of each amino acid. Peak areas were normalized by the internal standard norvaline and by fresh tissue weight (g).
Example 3In Planta Expression of Tyr-Insensitive BvADH Leads to Enhanced Accumulation of Tyr in Arabidopsis
[0131] BvADH was heterologously expressed in Arabidopsis, which only has Tyr-inhibited ADH enzymes (Rippert and Matringe, 2002a; Rippert and Matringe, 2002b; Schenck et al., 2015). Overexpression of BvADH, but not Tyr-inhibited BvADH or AtADH2, resulted in elevated Tyr accumulation by up to 60-fold compared to empty vector controls in T.sub.3 single insertion homozygous lines (
Example 4Heterologous Expression of Tyr-Insensitive BvADH Leads to Hyper-Accumulation of Tyr in Glycine max (Soybean)
[0132] BvADH or BvADH was also heterologously expressed in Glycine max (soybean), which has both Tyr-inhibited ADH and Tyr-insensitive PDH enzymes (Schenck et al., 2015). When Tyr levels were analyzed in the leaves of antibiotic resisitant T.sub.1 transgenic lines, nine out of twelve BvADH overexpression lines showed nearly 1,000 fold increase in Tyr relative to empty vector control (
REFERENCES
[0133] Ambawat S, Sharma P, Yadav N R, Yadav R C. 2013. MYB transcription factor genes as regulators for plant responses: an overview. Phyisyiology and Molecular Biology of Plants 19: 307-321. [0134] Bate-Smith E C. 1962. The phenolic constituents of plants and their taxonomic significance. Botanical Journal of the Linnean Society 58: 95-173. [0135] Barshandy H, Jalkanen S, Teeri T H. 2015. Within leaf variation is the largest source of variation in agroinfiltration of Nicotiana benthamiana. Plant Methods 11: 47. [0136] Beaudoin G A W, Facchini P J. 2014. Benzylisoquinoline alkaloid biosynthesis in opium poppy. Planta 240: 19-32. [0137] Bentley R. 1990. The ahikimate pathwayA metabolic tree with many branche. Critical Reviews in Biochemistry and Molecular Biology 25: 307-84. [0138] Biancardi E, Panella L W, and Lewellen R. 2012. Beta maritima: The origin of beets. New York: Springer. [0139] Bonvin J, Aponte R A, Marcantonio M, Singh S, Christendat D, Turnbull J L. 2006. Biochemical characterization of prephenate dehydrogenase from the hyperthermophilic bacterium Aquifex aeolicus. Protein Science 15: 1417-32. [0140] Brockington S F, Walker R H, Glover B J, Soltis P S, Soltis D E. 2011. Complex pigment evolution in the Caryophyllales. New Phytologist 190: 854-864. [0141] Brockington S F, Yang Y, Gandia-Herrero F, Covshoff S, Hibberd J M, Sage R F, Wong G K S, Moore M J, Smith S A. 2015. Lineage-specific gene radiations underlie the evolution of novel betalain pigmentation in Caryophyllales. New Phytologist 207: 1170-1180. [0142] Byng G, Whitaker R, Elick C, Jensen ROYA. 1981. Enzymology of L-tyrosine biosynthesis in corn (Zea mays). Phytochemistry 20: 1289-1292. [0143] Chen F, Tholl D, Bohlmann J, Pichersky E. 2011. The family of terpene synthases in plants: A mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom. Plant Journal 66; 212-229. [0144] Christinet L, Burdet F, Zaiko M, Hinz U, Zrd J P. 2004. Characterization and functional identification of a novel plant 4,5-extradiol dioxygenase involved in betalain pigment biosynthesis in Portulaca grandiflora. Plant Physiology 134: 265-274. [0145] Clement J S, Mabry T J. 1996. Pigment evolution in the caryophyllales: A systematic overview. Botanica Acta 109: 360-367. [0146] Connelly J A and, Conn E E. 1986. Tyrosine biosynthesis in Sorghum bicolor: isolation and regulatory properties of arogenate dehydrogenase. Zeitschrift fr Naturforschung C 41: 69-78. [0147] Dal Cin V, Tieman D M, Tohge T, McQuinn R, de Vos R C H, Osorio S, Schmelz E, Taylor M G, Smits-Kroon M T, Schuurink R C, et al. 2011. Identification of genes in the phenylalanine metabolic pathway by ectopic expression of a MYB transcription factor in tomato fruit. The Plant Cell 23: 2738-2753. [0148] Delaux P M, Varala K, Edger P P, Coruzzi G M, Pires J C, Ane J M. 2014. Comparative phylogenomics uncovers the impact of symbiotic associations on host genome evolution. PLoS Genetics 10: e1004487. [0149] Brockington S F, Alexandre R, Ramdial J, Moore M J, Crawley S, Dhingra A, Hilu K, Soltis P S. 2009. Phylogeny of the Caryophyllales sensu lato: Revisiting hypotheses on pollination biology and perianth differentiation in the core Caryophyllales. International Journal of Plant Sciences 170: 627-643. [0150] Dohm J C, Minoche A E, Holtgrawe D, Capella-Gutirrez S, Zakrzewski F, Tafer H, Rupp O, Sorensen T R, Stracke R, Reinhardt R, et al. 2014. The genome of the recently domesticated crop plant sugar beet (Beta vulgaris). Nature 505: 546-549. [0151] Dornfeld C, Weisberg A J, C R K, Dudareva N, Jelesko J G, Maeda H A. 2014. Phylobiochemical characterization of class-Ib aspartate/prephenate aminotransferases reveals evolution of the plant arogenate phenylalanine pathway. The Plant Cell 26: 3101-3114. [0152] Engler C, Youles M, Gruetzner R, Ehnert T M, Werner S, Jones J D G, Patron N J, and Marillonnet S. 2014. A golden gate modular cloning toolbox for plants. ACS Synthetic Biology 3: 839-843. [0153] Gaines, C. G., Byng G S, Whitaker R J and, Jensen R A. 1982. L-Tyrosine regulation and biosynthesis via arogenate dehydrogenase in suspension-cultured cells of Nicotiana silvestris Speg. et Comes. Planta 156: 233-240. [0154] Gandia-Herrero F, Garca-Carmona F. 2012. Characterization of recombinant Beta vulgaris 4,5-DOPA-extradiol-dioxygenase active in the biosynthesis of betalains. Planta 236: 91-100. [0155] Gleadow R M, Mller B L. 2014. Cyanogenic glycosides: synthesis, physiology, and phenotypic plasticity. Annual Review of Plant Biology 65: 155-185. [0156] Greenberg A K and Donoghue M J. 2011. Molecular systematics and character evolution in Caryophyllaceae. TAXON 60: 1637-1652 [0157] Goldman I L. 1996. A list of germplasm releases from the University of Wisconsin table beet breeding program. Hort Science 31: 880-881. [0158] Hanson M et al. 1996. Evolution of anthocyanin biosynthesis in maize kernels: the role of regulatory and enzymatic loci. Genetics 143: 1395-1407. [0159] Hatlestad G J, Sunnadeniya R M, Akhavan N, Gonzalez A, Goldman I L, McGrath J M, Lloyd A M. 2012. The beet R locus encodes a new cytochrome P450 required for red betalain production. Nature Genetics 44: 816-820. [0160] Hudson, G S, Wong, V., and Davidson B. 1984. Chorismate mutase/prephenate dehydrogenase from Escherichia coli K12: purification, characterization, and identification of a reactive cysteine. Biochemistry 23: 6240-6249. [0161] Ibarra-Laclette E, Zamudio-Hernndez F, Prez-Torres C A, Albert V A, Ramirez-Chvez E, Molina-Torres J, Fernndez-Cortes A, Caldern-Vzquez C, Olivares-Romero J L, Herrera-Estrella A, et al. 2015. De novo sequencing and analysis of Lophophora williamsii transcriptome, and searching for putative genes involved in mescaline biosynthesis. BMC Genomics 16: 657. [0162] Khan M I. 2015. Plant betalains: safety, antioxidant activity, clinical efficacy, and bioavailability. Comprehensive Reviews in Food Science and Food Safety 15: 316-330. [0163] Kajikawa M, Sierro N, Kawaguchi H, BakaherN, Ivanov N V, Hashimotp T, Shoji T. 2017. Genomic insights into the evolution of the nicotine biosynthesis pathway in tobacco. Plant Physiology 4: 999-1011. [0164] Kristensen C, Morant M, Olsen C E, Ekstrom C T, Galbraith D W, Moller B L, Bak S. 2005. Metabolic engineering of dhurrin in transgenic Arabidopsis plants with marginal inadvertent effects on the metabolome and transcriptome. Proceedings of the National Academy of Sciences of the United States of America 102: 1779-1784. [0165] Lee, E. J., An, D., Nguyen, C. T. T. Lee, E. J., An, D. Nguyen, C. T., Patill, B. S., Kim, J., & Yoo K. 2014. Betalain and betaine composition of greenhouse or field produced beetroot (Beta vulgaris L.) and inhibition of HepG2 cell proliferation. Journal of Agriculture and Food Chemistry 62: 1324-1331. [0166] Legrand P, Dumas R, Seux M, Rippert P, Ravelli R, Ferrer J L, Matringe M. 2006. Biochemical characterization and crystal structure of Synechocystis arogenate dehydrogenase provide insights into catalytic reaction. Structure 14: 767-776. [0167] Mabry T J. 1964. The betacyanins, a new class of red violet pigments, and their phylogenetic significance. In: Leone C A, ed. Taxonomic biochemistry, physiology, and serology. New York, N.Y., USA: Ronald Press: 239-254. [0168] Maeda H, Dudareva N. 2012. The shikimate pathway and aromatic amino acid biosynthesis in plants. Annual Review of Plant Biology 63: 73-105. [0169] Mene-Saffrane L, Jones A D, DellaPenna D. 2010. Plastochromanol-8 and tocopherols are essential lipid-soluble antioxidants during seed desiccation and quiescence in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 107: 17815-17820. [0170] Millgate A G, Pogson B J, Wilson I W, Kutchan T M, Zenk M H, Gerlach W L, Fist A J, Larkin P J. 2004. Analgesia: Morphine-pathway block in top1 poppies. Nature 431: 413-414. [0171] Mizutani M, Ohta D. 2010. Diversification of P450 genes during land plant evolution. Annual Review of Plant Biology 61: 291-315. [0172] Moghe G D, Last R L. 2015. Something old, something new: Conserved enzymes and the evolution of novelty in plant specialized metabolism. Plant Physiology 169: 1512-23. [0173] Neelwarne B, & Halagur S B. 2012. Red beet: an overview. In B. Neelwarne (Ed.), Red Beet Biotechnology: Food and Pharmaceutical Applications. New York, N.Y. USA, Springer: 1-43. [0174] Panchy N, Lehti-Shiu M, Shiu S-H. 2016. Evolution of gene duplication in plants. Plant Physiology 171: 2294-2316. [0175] Pencharz P B, Hsu J W-C, Ball R O. 2007. Aromatic amino acid requirements in healthy human subjects. The Journal of Nutrition 137: 1576S-1578S. [0176] Pichersky E, Lewinsohn E. 2011. Convergent evolution in plant specialized metabolism. Annual Review of Plant Biology 62: 549-566. [0177] Polturak G, Breitel D, Grossman N, Sarrion-Perdigones A, Weithorn E, Pliner M, Orzaez D, Granell A, Rogachev I, Aharoni A. 2016. Elucidation of the first committed step in betalain biosynthesis enables the heterologous engineering of betalain pigments in plants. New Phytologist 210: 269-283. [0178] Rapp R A, Haigler C H, Flagel L, Hovav R H, Udall J A, Wendel J F. 2010. Gene expression in developing fibres of upland cotton (Gossypium hirsutum L.) was massively altered by domestication. BMC Biology 8: 1-15. [0179] Rippert P, Matringe M. 2002a. Purification and kinetic analysis of the two recombinant arogenate dehydrogenase isoforms of Arabidopsis thaliana. European Journal of Biochemistry 269: 4753-4761. [0180] Rippert P, Matringe M. 2002b. Molecular and biochemical characterization of an Arabidopsis thaliana arogenate dehydrogenase with two. Plant Molecular Biology 48: 361-368. [0181] Rippert P, Puyaubert J, Grisollet D, Derrier L, Matringe M. 2009. Tyrosine and phenylalanine are synthesized within the plastids in Arabidopsis. Plant Physiology 149: 1251-1260. [0182] Rong J, Lammers Y, Strasburg J L, Schidlo N S, Ariyurek Y, de Jong T J, Klinkhamer P G L, Smulders M J M, Vrieling K. 2014. New insights into domestication of carrot from root transcriptome analyses. BMC Genomics 15: 895. [0183] Rubin J L, Jensen R a. 1979. Enzymology of L-tyrosine biosynthesis in mung bean (Vigna radiata [L.] Wilczek). Plant Physiology 64: 727-734. [0184] Schenck C A, Holland C K, Schneider M R, Men Y, Lee S G, Jez J M & Maeda H A. 2017. Molecular Basis of the evolution of alternative tyrosine biosynthetic routes in plants. Nature Chemocal Biology 13: 1029-1035. [0185] Schenck C A, Chen S, Siehl D L, Maeda H A. 2015. Non-plastidic, tyrosine-insensitive prephenate dehydrogenases from legumes. Nature Chemical Biology 11: 52-57. [0186] Shimada S, Inoue Y T, Sakuta M. 2005. Anthocyanidin synthase in non-anthocyanin-producing Caryophyllales species. The Plant Journal 44: 950-959. [0187] Siehl D L. 1999. The biosynthesis of tryptophan, tyrosine, and phenylalanine from chorismate in Plant Amino Acids: Biochemistry and Biotechnology. Singh B, ed. New York: CRC Press, New York, 171-204. [0188] Sparkes I A, Runions J, Kearns A, and Hawes C. 2006. Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nature Protocols 1: 2019-2025. [0189] Sun W, Shahinas D, Bonvin J, Hou W, Kimber M S, Turnbull J, Christendat D. 2009. The crystal structure of Aquifex aeolicus prephenate dehydrogenase reveals the mode of tyrosine inhibition. Journal of Biological Chemistry 284: 13223-13232. [0190] Sunnadeniya R, Bean A, Brown M, Akhavan N, Hatlestad G, Gonzalez A, Symonds V V, Lloyd A. 2016. Tyrosine hydroxylation in betalain pigment biosynthesis is performed by cytochrome P450 enzymes in beets (Beta vulgaris). PLoS ONE 11: 1-16. [0191] Tanaka Y, Sasaki N, Ohmiya A. 2008. Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant Journal 54: 733-749. [0192] Tattersall D B, Bak S, Jones P R, Olsen C E, Nielsen J K, Hansen M L, Hj P B, Mller B L. 2001. Resistance to an herbivore through engineered cyanogenic glucoside synthesis. Science 293: 1826-1828. [0193] Tzin, V. & Galili G. 2010. The biosynthetic pathways for shikimate and aromatic amino acids in Arabidopsis thaliana. The Arabidopsis Book/American. Society of Plant Biologists 8: e0132. [0194] Wang M, Lopez-Nieves S, Goldman I L, and Maeda H A. 2017. Limited tyrosine utilization explains lower betalain contents in yellow than red table beet genotypes. Journal of Agricultural and Food Chemistry 65: 4305-4313. [0195] Wang X, Xiao H, Chen G, Zhao X, Huang C, Chen C, Wang F. 2011. Isolation of high-quality RNA from Reaumuria soongorica, a desert plant rich in secondary metabolites. Molecular Biotechnology 48: 165-172. [0196] Weber E, Engler C, Gruetzner R, Werner S, and Marillonnet S. 2011. A modular cloning system for standardized assembly of multigene constructs. PLoS One 18: 6:e16765. [0197] Weng J K. 2014. The evolutionary paths towards complexity: A metabolic perspective. New Phytologist 201: 1141-1149. [0198] Weng J K, Philippe R N, Noel J P. 2012. The rise of chemodiversity in plants. Science 336; 1667-1670. [0199] Wertheim J O, Murrell B, Smith M D, Kosakovsky Pond S L, Scheffler K. 2014. RELAX: detecting relaxed selection in a phylogenetic framework. Molecular Biology and Evolution 32: 1-13. [0200] Xu S, Brockmller T, Navarro-Quezada A, Kuhl H, Gase K, Ling Z, Zhou W, Kreitzer C, Stanke M, Tang H, Lyons E, Pandey P, Pandey S P, Timmermann B, Gaquerel E, Baldwin I T. 2017. Wild tobacco genomes reveal the evolution of nicotine biosynthesis. Proceedings of the National Academy of Sciences of the United States of America 114: 6133-6138. [0201] Xu S, Huang Q, Lin C, Lin L, Zhou Q, Lin F and He E. 2016. Transcriptome comparison reveals candidate genes responsible for the betalain-/anthocyanidin-production in bougainvilleas. Functional Plant Biology 43: 278-286. [0202] Yagi M, Kosugi S, Hirakawa H, Ohmiya A, Tanase K, Harada T, Kishimoto K, Nakayama M, Ichimura K, Onozaki T, et al. 2014. Sequence analysis of the genome of carnation (Dianthus caryophyllus L.). DNA Research 21: 231-241. [0203] Zhang R, Guo C, Zhang W, Wang P, Li L, Duan X, Du Q, Zhao L, Shan H, Hodges S a, et al. 2013. Disruption of the petal identity gene APETALA3-3 is highly correlated with loss of petals within the buttercup family (Ranunculaceae). Proceedings of the National Academy of Sciences of the United States of America 110: 5074-9. [0204] Aryal U K, Xiong Y, McBride Z, Kihara D, Xie J, Hall M C, Szymanski D B. 2014. A proteomic strategy for global analysis of plant protein complexes. The Plant Cell 26: 3867-3882. [0205] Brockington S F, Yang Y, Gandia-Herrero F, Covshoff S, Hibberd J M, Sage R F, Wong G K S, Moore M J, Smith S A. 2015. Lineage-specific gene radiations underlie the evolution of novel betalain pigmentation in Caryophyllales. New Phytologist 207: 1170-1180. [0206] Hernandez-Ledesma P, Berendsohn W G, Borsch T, Mering S V, Akhani H, Arias S, Castaeda-Noa I, Eggli U, Eriksson R, Flores-Olvera H, Fuentes-Bazn S, Kadereit G, Klak C, Korotkova N, Nyffeler R, Ocampo G, Ochoterena H, Oxelman B, Rabeler R K, Sanchez A, Schlumpberger B O & Uotila P. 2015. A taxonomic backbone for the global synthesis of species diversity in the angiosperm order Caryophyllales. Willdenowia 45: 281-383. [0207] Hunter S S, Lyon R T, Sarver B A J, Hardwick K, Forney I. J, Settles M L. 2015. Assembly by Reduced Complexity (ARC): a hybrid approach for targeted assembly of homologous sequences. bioRxiv. doi:10.1101/014662. [0208] Katoh K, Standley D M. 2013. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30: 772-780. [0209] Kosakovsky Pond S L, Frost S D W. 2005. Datamonkey: Rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 21: 2531-2533. [0210] Langmead B, Salzberg S L. 2012. Fast gapped-read alignment with Bowtie 2. Nature Methods 9: 357-359. [0211] Lytynoja A, Goldman N. 2008. Phylogeny-aware gap placement prevents errors in sequence alignment and evolutionary analysis. Science (New York, N.Y.) 320: 1632-1635. [0212] Lytynoja A, Goldman N. 2010. webPRANK: a phylogeny-aware multiple sequence aligner with interactive alignment browser. BMC Bioinformatics 11: 579. [0213] Milliken, G A. 2009. Analysis of messy data. Boca Raton:CRC Press. [0214] Oate-Snchez L, and Vicente-Carbajosa J. 2008. DNA-free RNA isolation protocols for Arabidopsis thaliana, including seeds and siliques. BMC Research Note 1: 93. [0215] Pinheiro, J C. 2000. Mixed-effects models in S and S-PLUS. New York:Springer. [0216] Rognes T. 2011. Faster Smith-Waterman database searches with inter-sequence SIMD parallelisation. BMC bioinformatics 12: 221. [0217] Schenck C A, Chen S, Siehl D L, Maeda H A. 2015. Non-plastidic, tyrosine-insensitive prephenate dehydrogenases from legumes. Nature Chemical Biology 11: 52-57. [0218] Smith S A, Dunn C W. 2008. Phyutility: A phyloinformatics tool for trees, alignments and molecular data. Bioinformatics 24: 715-716. [0219] Stamatakis A. 2014. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30: 1312-1313. [0220] Wertheim J O, Murrell B, Smith M D, Kosakovsky Pond S L, Scheffler K. 2014. RELAX: Detecting relaxed selection in a phylogenetic framework. Molecular biology and evolution 32: 1-13. [0221] Yang, Y. and S. A. Smith. 2014. Orthology inference in non-model organisms using transcriptomes and low-coverage genomes: improving accuracy and matrix occupancy for phylogenomics. Molecular Biology and Evolution 31: 3081-3092.