USE OF LACTOBACILLUS PARACASEI STRAIN GMNL-653 TO PREPARE COMPOSITION FOR RESISTING BONE LOSS

Abstract

A use of a Lactobacillus paracasei strain to prepare a composition for resisting bone loss is provided. The Lactobacillus paracasei strain GMNL-653 is capable of promoting the expression of TGF- and IL-10, while inhibiting the expression of osteoclast related genes and reducing the content of IL-17A in serum, so that the bone loss is slowed down.

Claims

1. A use of a Lactobacillus paracasei strain to prepare a composition for resisting bone loss, wherein the Lactobacillus paracasei strain is Lactobacillus paracasei strain GMNL-653 deposited in the China Center for Type Culture Collection (CCTCC) with an accession number of CCTCC M2016226.

2. The use according to claim 1, wherein the Lactobacillus paracasei strain GMNL-653 is a dead strain.

3. The use according to claim 1, wherein the Lactobacillus paracasei strain GMNL-653 is a thermal death strain.

4. The use according to claim 1, wherein the Lactobacillus paracasei strain GMNL-653 has an ability of reducing the content of interleukin-17A in serum.

5. The use according to claim 1, wherein the Lactobacillus paracasei strain GMNL-653 has an ability of increasing the expression of interleukin-10.

6. The use according to claim 1, wherein the Lactobacillus paracasei strain GMNL-653 has an ability of increasing the expression of TGF-.

7. The use according to claim 1, wherein the Lactobacillus paracasei strain GMNL-653 has an ability of inhibiting the expression of osteoclast-related gene RANKL.

8. The use according to claim 1, wherein the composition is a pharmaceutical composition, a nutritional supplement, a health food, a medical food, or the combination thereof.

9. The use according to claim 1, wherein the composition further comprises a carrier to form the composition into tablets, capsules, powders, or oral liquid preparations.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1 is a diagram showing the expression of TGF- of each group in the experiment 2 according to one embodiment of the present disclosure.

[0021] FIG. 2 is a diagram showing the expression of osteoclast related gene RANKL of each group in the experiment 2 according to one embodiment of the present disclosure.

[0022] FIG. 3 is a diagram showing the expression of interleukin-10 (IL-10) of each group in the experiment 2 according to one embodiment of the present disclosure.

[0023] FIG. 4 is a diagram showing the interleukin-17A (IL-17A) content in serum of each group in the experiment 3 according to one embodiment of the present disclosure.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] The structure and the technical means adopted by the present disclosure to achieve the above and other objects can be best understood by referring to the following detailed description of the preferred embodiments. Furthermore, if there is no specific description in the disclosure, singular terms such as a, one, and the include the plural number. For example, a compound or at least one compound may include a plurality of compounds, and the mixtures thereof. If there is no specific description in the disclosure, % means weight percentage (wt %), and the numerical range (e.g., 10%-11% of A) contains the upper and lower limit (i.e., 10%A11%). If the lower limit is not defined in the range (e.g., less than, or below 0.2% of B), it means that the lower limit may be 0 (i.e., 0%B0.2%). The proportion of weight percent of each component can be replaced by the proportion of weight portion thereof. The abovementioned terms are used to describe and understand the present disclosure, but the present disclosure is not limited thereto.

[0025] One embodiment of the present disclosure provides a Lactobacillus paracasei strain for resisting bone loss and a use of the strain to produce a composition for resisting bone loss. The Lactobacillus paracasei strain is referred to as Lactobacillus paracasei strain GMNL-653, which is deposited in the China Center for Type Culture Collection (CCTCC) with an accession number of CCTCC M2016226. The Lactobacillus paracasei strain GMNL-653 can be a viable strain or a dead strain, for example a thermal dead strain. The Lactobacillus paracasei strain GMNL-653 has an anti-inflammatory ability, and can inhibit the expression of osteoclast related gene RANKL and formation of interleukin-17A (IL-17A).

[0026] One embodiment of the present disclosure provides a composition for resisting bone loss, comprising the abovementioned Lactobacillus paracasei strain GMNL-653. Preferably, the composition can be a pharmaceutical composition, a nutritional supplement, a health food, a medical food, or the combination thereof. The composition can be formed in various form based on the effectivity or convenience, for example, a carrier is used for forming the composition into tablets, capsules, powders, or oral liquid preparations, but it is not limited thereto. The composition can be formed into any pharmacologically or physiologically acceptable form. In addition, the composition is preferably administrated by means of food to enter the digestive system, so that the Lactobacillus paracasei strain GMNL-653 can exert its effect in the digestive system.

[0027] The Lactobacillus paracasei strain GMNL-653 in the abovementioned embodiments is one of a plurality of isolates mainly isolated from human intestines. The primers (SEQ ID NO: 1 and SEQ ID NO: 2) listed in Table 1 are used to perform PCR to reproduce 165 rDNA segments of each isolate, and then sequencing the 16S rDNA segment of each isolate. After sequencing, a 165 rDNA gene sequence of one of the isolates can be obtained as below (SEQ ID NO: 3); subsequently, from the comparison results on the NCBI website, it shows that the 16S rDNA sequences of the isolates are similar to that of the Lactobacillus paracasei strains with identities all over 99%, so that the strain GMNL-653 indeed belongs to the Lactobacillus paracasei genus.

TABLE-US-00001 TABLE1 PCRprimer Primer SEQIDNO: SEQ PAF 1 AGAGTTTGATCCTGGCTCAG 536R 2 GTATTACCGCGGCTGCTG

[0028] A complete 16S rDNA sequence (SEQ ID NO: 3 of the Lactobacillus paracasei strain GMNL-653 is listed as below:

TABLE-US-00002 CGGAGGCCCCTATGATGGGCGTCGTACGAGTTCTCGTTGATGATCGGTGC TTGCACCGAGATTCTCATGGAACGAGTGGCGGACGGGTGAGTAACACGTG GGTAACCTGCCCTTAAGTGGGGGATAACATTTGGAAACAGATGCTAATAC CGCATAGATCCTGTAACCGCATGGTTCTTGGCTGATAGATGGCGTAAGCT ATCGCTGTTGGATGGACCCGCGGCGTATTATCTAGTTGGTGAGGTAGTGG CTCACCGAGGCCATGATACGTATCCGAGCTGAGAGGTTGATGGGCGAGTT TGTGACTGAGACACGTCCCAAACTACTACGGGAGGCAGCAGTAGGGAATC TTCCACAATGGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAG GCTTTCGGGTCGTAAAACTCTGTTGTTGGAGAAGAATGGTCGGCAGAGTA ACTGTTGTCGGCGTGACGGTATCCAACCAGAAAGCCACGGCTAACTACGT GCCAGCAGCCGGGGGGTAATACA

[0029] A fermentation test of the Lactobacillus Paracasei strain GMNL-653 is carried out to obtain the results shown in Table 2.

TABLE-US-00003 TABLE 2 Fermentation Test Strips No. carbohydrates substrate GMNL-653 0 CONTROL 1 Glycerol 2 Erythritol 3 D-Arabinose 4 L-Arabinose 5 D-Ribose + 6 D-Xylose 7 L-Xylose 8 D-Adonitol 9 Methyl--D-Xylopyranoside 10 D-Galactose + 11 D-Glucose + 12 D-Fructose + 13 D-Mannose + 14 L-Sorbose 15 L-Rhamnose 16 Dulcitol 17 Inositol + 18 D-Mannitol + 19 D-Sorbitol 20 Methyl--D-mannopyranoside 21 Methyl--D-glucopyranoside + 22 N-Acetyl glucosamine + 23 Amygdalin 24 Arbutin + 25 Esculin ferric citrate + 26 Salicin + 27 D-Cellobiose + 28 D-Maltose + 29 D-Lactose (bovine origin) 30 D-Melibiose 31 D-Saccharose (sucrose) + 32 D-Trehalose + 33 Inulin 34 D-Melezitose + 35 D-Raffinose 36 Amidon (starch) 37 Glycogen 38 Xylitol 39 Gentiobiose 40 D-Turanose + 41 D-Lyxose 42 D-Tagatose + 43 D-Fucose 44 L-Fucose 45 D-Arabitol 46 L-Arabitol 47 Potassium gluconate 48 Potassium 2-ketogluconate 49 Potassium 5-ketogluconate : negative; +: positive

[0030] To verify the anti-inflammatory ability of the Lactobacillus paracasei strain GMNL-653 according to the present disclosure, and to confirm that the Lactobacillus Paracasei strain GMNL-653 can inhibit the bone loss, experiments 1 to 3 are executed.

[0031] Experiment 1: Bone Tissue Analysis

[0032] Strain: Lactobacillus paracasei Strain GMNL-653

[0033] Strain Treatment:

[0034] Preparation of dead bacteria: 1 l Lactobacillus paracasei strain GMNL-653 and the Lactobacillus salivarius strain GMNL-678 frozen viral was inoculated to 1 ml of MRS broth, respectively, and aerobically incubated at 37 C. for 20 hours (first activation). The next day, adding 15 l culture solution (first activation) into 1.5 ml of MRS broth, and then and aerobically incubated at 37 C. for 20 hours (secondary activation) Estimating the bacteria number by using OD 600 nm to adjust the bacteria concentration to 4.110.sup.8 CFU/ml, and heat-killed bacteria was carried by autoclaving at 121 C. for 15 minutes.

[0035] Osteoporosis Mouse Model:

[0036] 8-week-old ICR female mice were purchased from BioLASCO Taiwan Co., Ltd. and ovariectomy was performed when they were 9 week-old. The mice underwent anesthesia and were ovariectomized through back on both sides of the ovaries. All groups were given the test substance by oral gavage at 4 days after surgery. The groups were divided into a sham operation group (control group, their abdominal cavities were cut but their ovaries were not removed); and 4 ovariectomized groups (Ovariectomy; OVX). When the mice were sacrificed, the ovarian tissues were checked and confirmed whether the removal of ovarian was successful. The experimental results of the mice under failed operation were not used. In the 4 groups of the ovariectomized mice, one group was the vehicle group (H.sub.2O group), and one group was the positive drug group (anti-osteoporosis drug, Alendronate). Alendronate was formulated with deionized water at a concentration of 0.25 mg/ml. The mice were given 0.1 ml drug per 10 grams of body weight and 4 times a week. The remaining two groups were fed with 0.2 ml of dead GMNL-653, and dead GMNL-678, respectively (strain concentration is 4.110.sup.8 cells/ml; daily dose of the mouse is 8.210.sup.7 cells/mouse, the human dose is 210.sup.10 cells/60 kg adult). The two groups were oral gavage probioyic once/day until 28 days. The mice were anesthetized and sacrificed for intraperitoneal cephalic vein sampling, and each femur was removed for analysis.

[0037] Analysis Method:

[0038] Micro computed tomography (SkyScan 1076, Kontizh, Belgium, with resolution of 18 m) was taken of the backbone of the right femur far from the end was taken, and the trabecular bone volume ratio (i.e. bone volume/tissue volume; BV/TV) was analyzed by a software. The analyzed position was selected to include the area of 100 pieces under the growth plate excluding cortical bone. The bone mineral density analysis was applied to the same area. The obtained data in the experiments were analyzed with two-way analysis of variance, and the T-test statistical analysis. All data were presented as meanSD. After comparisons, the abovementioned groups were analyzed statistically and noted by different marks to represent the statistically significant differences (* represents p<0.05; ** represents p<0.01 See Table 3 and Table 4, showing the results of the experiment 1.

TABLE-US-00004 TABLE 3 Trabecular bone volume ratio (BV/TV, bone volume/tissue volume) BV/TV (%) OVX + OVX + OVX + GMNL-653 GMNL-678 OVX + Control H.sub.2O Dead Dead Alendronate 42.12 30.9 36.80 32.38 34.88 2.4** 1.1 1.6** 0.8** 0.9**

[0039] From table 3, after removing the ovaries, the trabecular bone volume ratio in (OVX+H.sub.2O) group (disease group) was lower than the control group, which means that the osteoporosis animal model was successful. Comparing the dead GMNL-653 group, the dead GMNL-678 group, and the positive drug group with the control group, it can be found that BV/TV of the three group were higher than the disease group, which means that the GMNL-653, GMNL-678, and the drug Alendronate all indeed slow down bone loss to a certain degree after removing the ovaries. The group of the tube fed GMNL-653 strain even has slightly better protective effects than the anti-osteoporosis drug Alendronate.

TABLE-US-00005 TABLE 4 Femur bone mineral density (BMD, excluding cortical bone) BMD (g/cm.sup.3) OVX + OVX + OVX + GMNL-653 GMNL-678 OVX + Control H.sub.2O Dead Dead Alendronate 0.502 0.344 0.444 0.38 0.426 0.04** 0.04 0.043** 0.027 * 0.02*

[0040] From table 4, it can be noted that the disease group (OVX+H.sub.2O) has lower BMD than the control group; in the groups of dead GMNL-653, the BMD is significantly higher than the BMD in the disease group (OVX+H.sub.2O). That is, the group of the tube fed GMNL-653 strain can slow down bone loss of the mice after removing the ovarian, and the protection effect of the GMNL-653 is better than the GMNL-678.

[0041] Experiment 2: Effects of GMNL-653 on Osteoclast Genes, and Cytokines

[0042] Extraction of tibial RNA: The left femurs of the mice were removed, cut into small pieces with scissors, and an appropriate amount of liquid nitrogen was added to grind the bones quickly. 0.5 ml TRizol Reagent was added to the ground bone powder to extract RNA; 0.1 ml chloroform was then added thereto to turn up and down 15 times. The solution was placed at room temperature to react for 5 minutes, followed by centrifugalized and extracted the upper layer to new eppendorf; 0.25 ml isopropanol was added thereto and the solution was placed at room temperature for 10 minutes and then centrifugalized; the supernatant was removed and the precipitate was washed with 0.5 ml 75% ethanol; after the precipitate was dried, 20-50 l DEPC water was added to dissolve the precipitate and the RNA concentration was measured.

[0043] RNA reverse transcription cDNA: 1-5 g RNA was obtained and RNase-free water was added therein to 10 l; additionally, 10 Random primer (2 l), 10 mM dNTP (1 l) were added, at 65 C. for 5 minutes, and on ice for 2-3 minutes; after first stage interaction, additional 5RT buffer (4 l), 0.1M DTT (1 l), RNase inhibitor (Invitrogen, RNaseOUTTM, 1 l), RT enzyme (Invitrogen, SuperScriptIII, 1 l) were added and mixed at room temperature for 5 minutes, and then placed at 50 C. for 60 minutes, at 70 C. for 15 minutes, to proceed the enzyme reverse transcription.

[0044] Tibial cDNA in real-time PCR analysis: 1 l tibial cDNA was obtained and added 4 l of 1 M F+R primers (forward/reverse primers are listed below), and 5 l of 2 Rotor-Gene SYBR Green PCR Master Mix (Qiagen, Cat. 204076), placed into Q-PCR apparatus to react. The relative expression of TGF- and RANKL were obtained by deducting the GAPDH itself.

TABLE-US-00006 TABLE5 Primers TGF- Forward SEQIDNO:4 GAGTAACGCTTTCCGGAGTC primer TGF- Reverse SEQIDNO:5 ACAGTCACCAGCATCTCAGC primer RANKLForward SEQIDNO:6 CGTACCTGCGGACTATCTTCA primer RANKLReverse SEQIDNO:7 CTTGGACACCTGGACGCTAA primer IL-10Forward SEQIDNO:8 GGTTGCCAAGCCTTATCGGA primer IL-10Reverse SEQIDNO:9 ACCTGCTCCACTGCCTTGCT primer GAPDHForward SEQIDNO:10 GCACAGTCAAGGCCGAGAAT primer GAPDHReverse SEQIDNO:11 GCCTTCTCCATGGTGGTGAA primer

[0045] Analysis method: The obtained data in the experiments were analyzed with two-way analysis of variance, and executed T-test statistical analysis. The abovementioned groups were analyzed statistically compared with the OVX+H.sub.2O group, wherein * represents p<0.05; ** represents p<0.01.

[0046] As shown in FIG. 1, GMNL-653 dead strain can increase the expression of TGF- which can protect bone against bone loss. Comparing the mice of the control group with the disease group (OVX+H.sub.2O), the expression of osteoblast-related cytokine TGF- of the disease group is significantly reduced; the mice fed with GMNL-653 have significant increased expression of TGF- compared with the disease group (OVX+H.sub.2O). This result means that the GMNL-653 strain has ability of promoting the expression of TGF so as to slow down bone loss.

[0047] Next, as shown in FIG. 2, the expression of osteoclasts-related gene RANKL in the disease group (OVX+H.sub.2O) are higher than the control group, while in the groups of the mice given the dead strain GMNL-653 after removing ovarian, the expression of RANKL is lower than the the disease group. The result means that the GMNL-653 has an ability to inhibit the expression of RANKL, thereby slowing down bone loss.

[0048] Refer to FIG. 3, it can be observed that the dead strain GMNL-653 increases the expression of the cytokine IL-10. Compared with the mice in the sham operation group (Control group), the expression of the anti-inflammatory cytokine IL-10 in the disease group (OVX+H.sub.2O) is significantly reduced; while in the groups of dead strain GMNL-653, the expression of IL-10 is significantly increased compared with the disease group (OVX+H.sub.2O). That is, the GMNL-653 strain has an ability to promote the expression of IL-10 so as to slow down bone loss.

[0049] Experiment 3: Effects of GMNL-653 on Osteoclasts Related Cytokine 1L-17A

[0050] Analysis method: the mice of each group were sacrificed with anesthesia. The blood of the sacrificed mice was gathered and stood at room temperature for 30 minutes. Subsequently, the gathered blood was centrifuged at 10,000 g for 10 minutes to gather the serum, and the serum was individually packed and stored at 80C. The analysis of IL-17A was performed by an antigen-antibody binding reaction on the original serum, and run the analysis experiment with BioLegend's ELISA MAX Deluxe Sets. The experiment steps were followed by the original instructions. Finally, the absorbance of OD 450 nm was measured by ELISA reader. The measurement of each group was repeated twice.

[0051] The analysis result is shown in FIG. 4. After removing ovaries, the content of the IL-17A in serum of the mice in the disease group (OVX+H.sub.2O) is increased as compared with the sham group (control), but the content of IL-17A in serum is apparently reduced in the GMNL-653 dead strain group. The abovementioned groups were analyzed statistically compared with, the OVX+H.sub.2O group, wherein * represents p<0.05; ** represents p<0.01.

[0052] In summary, according to the above results, it is certain that the Lactobacillus paracasei strain GMNL-653 in the dead form can significantly slow down bone loss of the mice after removing ovaries in the bone tissue analysis (trabecular bone volume ratio, BV/TV) and bone mineral density (BMD) of animal experiments. It is reported that the TGF- plays an important role during the procedure of intracartilanginous ossification or endochondral ossification, and the mice with defective TGF- may reduce bone growth and bone mineralization. The IL-10 is an important cytokine related to anti-inflammation. It has been suggested that IL-10 may provide an indirect balance between the ionic ratio of Ca.sup.2+ (calcium)/Pi (phosphorous); In addition, bone-loss related cytokine IL-17A has been shown to be associated with RANKL to be osteoclast precursor cells or induce the expression of osteoclasts in the mice lack of estrogen so as to carry out the multi-core reaction, so that the proliferation and differentiation of the osteoclasts are promoted. In rodents, the estrogen can inhibit the differentiation of the cells regulated by IL-17A, and further can inhibit the formation and mineralization of the osteoblasts. Therefore, the composition containing Lactobacillus paracasei strain GMNL-653 in the present disclosure can resist bone loss through increasing the expression of the osteoblast-related cytokine TGF- and anti-inflammatory cytokine IL-10, inhibiting the expression of osteoclasts-related genes (e.g. RANKL), and reducing the quantity of cytokine IL-17A contained in serum to resist bone loss.

[0053] In addition, it can be found in the experiment results that the GMNL-653 has a better protective effect than the anti-osteoporosis drug Alendronate. Alendronate has been found to have many side effects, including heart disease, stubborn pain, jaw osteonecrosis, fractures, and esophageal cancer. Therefore, the Lactobacillus Paracasei strain GMNL-653, safe and with no side effects, is applicable to slow down bone loss. It should be a better choice for the menopausal women in considering the future prevention and inhibition of bone loss.

[0054] The present disclosure has been described with preferred embodiments thereof and it is understood that many changes and modifications to the described embodiments can be carried out without departing from the scope and the spirit of the disclosure that is intended to be limited only by the appended claims.

TABLE-US-00007 SEQUENCELISTING <110> GENMONTBIOTECHINC. <120> USEOFLACTOBACILLUSPARACASEISTRAINGMNL-653TOPREPARECOMPOSITION FORRESISTINGBONELOSS <130> TP170229-US <160> 11 <170> PatentInversion3.5 <210> 1 <211> 20 <212> DNA <213> ArtificialSequence <220> <223> PAFprimer <400> 1 agagtttgatcctggctcag 20 <210> 2 <211> 18 <212> DNA <213> ArtificialSequence <220> <223> 536Rprimer <400> 2 gtattaccgcggctgctg 18 <210> 3 <211> 523 <212> DNA <213> ArtificialSequence <220> <223> Sequencingprimer <400> 3 cggaggcccctatgatgggcgtcgtacgagttctcgttgatgatcggtgcttgcaccgag 60 attctcatggaacgagtggcggacgggtgagtaacacgtgggtaacctgcccttaagtgg 120 gggataacatttggaaacagatgctaataccgcatagatcctgtaaccgcatggttcttg 180 gctgatagatggcgtaagctatcgctgttggatggacccgcggcgtattatctagttggt 240 gaggtagtggctcaccgaggccatgatacgtatccgagctgagaggttgatgggcgagtt 300 tgtgactgagacacgtcccaaactactacgggaggcagcagtagggaatcttccacaatg 360 gacgcaagtctgatggagcaacgccgcgtgagtgaagaaggctttcgggtcgtaaaactc 420 tgttgttggagaagaatggtcggcagagtaactgttgtcggcgtgacggtatccaaccag 480 aaagccacggctaactacgtgccagcagccggggggtaataca 523 <210> 4 <211> 20 <212> DNA <213> ArtificialSequence <220> <223> TGFbetaforwardprimer <400> 4 gagtaacgctttccggagtc 20 <210> 5 <211> 20 <212> DNA <213> ArtificialSequence <220> <223> TGFbetareverseprimer <400> 5 acagtcaccagcatctcagc 20 <210> 6 <211> 21 <212> DNA <213> ArtificialSequence <220> <223> RANKLforwardprimer <460> 6 cgtacctgcggactatcttca 21 <210> 7 <211> 20 <212> DNA <213> ArtificialSequence <220> <223> RANKLreverseprimer <400> 7 cttggacacctggacgctaa 20 <210> 8 <211> 20 <212> DNA <213> ArtificialSequence <220> <223> IL-10forwardprimer <400> 8 ggttgccaagccttatcgga 20 <210> 9 <211> 20 <212> DNA <213> ArtificialSequence <220> <223> IL-10reverseprimer <400> 9 acctgctccactgccttgct 20 <210> 10 <211> 20 <212> DNA <213> ArtificialSequence <290> <223> GAPDHforwardprimer <400> 10 gcacagtcaaggccgagaat 20 <210> 11 <211> 20 <212> DNA <213> ArtificialSequence <220> <223> GAPDHreverseprimer <400> 11 gccttctccatggtggtgaa 20