TARGET FOR TREATING HEPATITIS B VIRUS

20180256550 ยท 2018-09-13

    Inventors

    Cpc classification

    International classification

    Abstract

    A method of treating hepatitis B virus includes inhibiting the activities of AKT and/or mTOR, inhibiting the synthesis of 5-phosphate ribose, and inhibiting HBV DNA and HBV cccDNA.

    Claims

    1. (canceled)

    2. (canceled)

    3. (canceled)

    4. A method of treating hepatitis B virus comprising: inhibiting the activities of AKT and/or mTOR, inhibiting the synthesis of 5-phosphate ribose, and inhibiting HBV DNA and HBV cccDNA.

    5. The method of claim 4, wherein the activities of AKT and mTOR are inhibited simultaneously.

    6. The method of claim 4, wherein the activities of AKT is inhibited by ADZ5363 or AKTi.

    7. The method of claim 4, wherein the activities of mTOR is inhibited by rapamycin or a rapamycin analog.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0022] FIG. 1 shows the expression of AKT-Ser473 in hepatocytes LO2, HepG2, HepG2.215, Bel, and SMMIC-7721. The results showed that the expression of AKT-Ser473 in HepG2.215 transfected with HBV gene was higher than that in other cells, indicating that the activation of AKT is prompted when cells were infected with HBV.

    [0023] FIG. 2 shows HepG2 cells and Huh7 cells transfected with different quality pcDNA3.1-HBV1.3 plasmid and AKT phosphorylation changes.

    [0024] FIG. 3 shows the expression of AKT in liver tissue of nude mice infected with HBV and normal nude mice

    [0025] FIG. 4 shows the difference of AKT activation levels in liver tissue of patient infected with HBV and normal person.

    [0026] FIG. 5 shows the change of HBV DNA after transfection of EGFP-NA-AKT plasmid, which was able to inhibit endogenous AKT activation and had no AKT activity itself, and EGFP-CA-AKT plasmid, which had continuous AKT activity, in HepG2.215 cells.

    [0027] FIG. 6 shows the effect of different doses of ADZ5363, AKTi-, rapamycin on HBV DNA in HepG2.215 cells and their antiviral effects compared with tenofovir.

    [0028] FIG. 7 shows HepG2.215 cells in ADZ5363, rapamycin treatment with the treatment time after the extension of HBV DNA changes and the efficacy of tenofovir antivirus comparison;

    [0029] FIG. 8 shows the HBsAg and HBeAg changes in HepG2.215 cells after treatment with rapamycin compared with tenofovir.

    [0030] FIG. 9 shows the changes of HBV cccDNA in HepG2.215 cells after ADZ5363 and rapamycin treatment.

    [0031] FIG. 10 shows the changes of HBV DNA in nude mice infected with HBV before and after treatment.

    DETAILED DESCRIPTION OF THE ILLUSTRATED EMBODIMENTS

    [0032] 1. The expression of AKT-Ser473 in LO2, HepG2, HepG2.215, Bel, SMMC-7721 cells was detected by western blot. The results showed that AKT-Ser473 in HepG2.215 cells was higher than that in other cells. FIG. 1 shows that HBV infection can promote the activation of AKT.

    [0033] 2. HepG2.215 cells were placed in a 6-well plate at a density of 810.sup.6 per well. 10 L Lipo2000 was dissolved in 100 L opto-MEM (gibico) medium and placed for 5 minutes. 5 g, 1 g, and 0.5 g pcDNA3.1-HBV1.3 plasmid were dissolved in 100 L opti-MEM, respectively, and the plasmid solutions were then added to lipo2000, and placed at room temperature for 15 minutes. Finally, 5 g, 1 g, and 0.5 g of the HNV plasmid were added to HepG2 and Huh7 cells, respectively. After 48 hours, cell protein was extracted for western blot analysis, and the cell culture supernatant was collected and extract for DNA for digital PCR. The changes of AKT phosphorylation and HBV DNA were recorded. See FIG. 2. The results showed that when normal cells were transferred with the virus plasmid, AKT activity was increased, indicating that HBV replication and AKT are related.

    [0034] 3. (1) Building nude mice model long-term infected with HBV

    [0035] {circle around (1)} Each nude mouse was injected with 6 g plasmid dissolved in 2 mL PBS at room temperature, materials, plasmids, and mice were transported to the animal room.

    [0036] {circle around (2)} The nude mice were 8 weeks old and fixed on lab bench for weighing. Each mouse was about 20 mg.

    [0037] {circle around (3)} The nude mice were irradiated with 200-watt light bulb until blood vessels were expended and bodies turned red. The nude mice were placed in a fixed device. Tail veins were cleaned with alcohol cotton balls, blood vessels were expanded, and both sides of the tail veins from the end of the root were chosen for injection.

    [0038] {circle around (4)} 2 mL PBS (including 6 g plasmid) 5s was injected into the mice.

    [0039] {circle around (5)} 3 weeks after the injection, the tip of the mouse tail was cut to collect 100 L anti-coagulated whole blood, and 1.75 L sodium citrate anticoagulant (citrate 0.48 g, sodium citrate 1.32 g, glucose 1.47 g, adding water to 100 mL) was added to the blood. The blood was then placed in a 1.5 mL centrifuge tube.

    [0040] 3. (2) Immunohistochemistry used to detect the expression of AKT-s473 and HBsAg proteins in liver tissue

    [0041] {circle around (1)} Liver tissue was fixed with 40 g/L paraformaldehyde at 4 C. for 30 min.

    [0042] {circle around (2)} Preparation of paraffin sections, cutting conventional slices, dewaxing: 30 mL/L H.sub.2O.sub.2 inactivation of endogenous peroxidase, 50 g/L BSA room temperature sealed for 20 min.

    [0043] {circle around (3)} Rabbit anti-AKS-s473 (1: 200) and rabbit anti-HBsAg antibody (1: 200) were incubated overnight at 4 C. After washing, biotinylated goat anti-rabbit IgG (1: 100) was added, 37 C., 2 h.

    [0044] {circle around (4)} Alkaline phosphatase-labeled streptavidin was added, 37 C., 20 min. 5-bromo-4-chloro-3-indolyl phosphate/nitrogen blue tetrazolium mixture (BCIP/NBT) (1:20) coloring 20 min, nuclei solid red re-coloring, observation after sealing. See FIG. 3.

    [0045] The results showed that the expression of AKT-Ser473 in HBV-carrying nude mice was higher than that in normal nude mice, which indicated that HBV infection could promote the activation of AKT.

    [0046] 4. The liver tissue samples of 25 patients with chronic hepatitis B and the liver tissue samples of 8 patients without HBV infection were examined by western blot. The results showed that the expression of AKT-5473 in hepatocytes of patients with chronic hepatitis B was significantly higher than that of patients without HBV infection. See FIG. 4. This indicated that HBV infection could promote the activation of AKT.

    [0047] And at 0 h, 12 h, 24 h, 48 h, 72 h, respectively, from the time of transfection,

    [0048] 5. HepG2.215 cells were plated in a 6-well plate at a density of 810.sup.6 per well. Lipo200010u was dissolved in 100 L opto-MEM (gibico) medium and set for 5 min. 4 g EGFP-NA-AKT and EGFP-CA-AKT plasmids were dissolved in 100 L opti-MEM, respectively. EGFP-NA-AKT and EGFP-CA-AKT plasmids were added to lipo2000, incubated at room temperature for 15 min, and finally added to hepg2.215 cells. At 0 h, 12 h, 24 h, 48 h, 72 h after transfection, the fluorescence of the cells was record (FIG. 5a). The cell culture supernatant was collected and HBV DNA was extracted for digital PCR to observe the changes of HBV (FIG. 5c). The results showed that after HepG2.215 cells were transfected with plasmids that can activate and inhibit AKT, the inhibition of ATK decreased HBV DNA, which indicated the decrease the content of HBV DNA was related to the inhibition of AKT activation.

    [0049] 6. ADZ5363, AKTi-, rapamycin (RAPA) anti-HBV DNA dose and the drug-resistant drug tenofovir (TDF) comparison:

    [0050] (1) Different doses of RAPA (10 M, 0.5 M, 1 M), ADZ5363 (10 nM, 100 nM, 1000 nM), AKTi (10 nM, 100 nM, 1000 nM) and TDF (0.1 M, 0.15 M, 0.25 M, 1 M) were added to HepG2.215 medium; continuous dosing for three days, adding additional dose every 24 hours, and the supernatants of the cells were collected after 3 days.

    [0051] (2) Extraction of HBV DNA supernatant: 500 L HepG2.215 cell suspension was centrifugation at 4 C. at 5000 r/min for 15 min; the precipitation discarded; and the supernatant was collected. Treatment of the supernatant: 0.5% SDS+10 mmol TRIS-HCL (pH 8.0)+0.1 mol EDTA (pH 8.0) was added, followed by 100 g/mL proteinase K, at 56 C. water bath for 1 h. The supernatant was collected and added an equal volume of tris saturated phenol 650 L (up and down thoroughly mixed), centrifuged (4 C., 12000 r/min, 10 min). After centrifugation, 600 L upper layer of water was collected and added an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) 600 L, up and down thoroughly mixed, set at room temperature for 10 min, centrifuged (4 C., 12000 r/min, 10 min). After centrifugation, 500 L upper layer of water was collected, and added 4 C. pre-cooled 1/10volume of sodium acetate 50 L (3 mol/L, pH=5.2), and 2 times the volume of anhydrous ethanol (4 C. precooling) 1.1 mL, up and down thoroughly mixed, set at 20 C. for 10 min, centrifuged (4 C., 12000 r/min, 10 min). The supernatant was discarded, and 1 mL 70% ethanol was added, washed twice, centrifuged (4 C., 12000 r/min, 10 min). The remaining ethanol was removed (about 30 min), and double distilled water 40 L was added.

    [0052] (3) HBV DNA content in supernatant was detected by digital PCR. The results of the comparison are shown in FIG. 6. It indicated that AKT and mTOR inhibitors can effectively reduce the effect of HBV DNA and the antiviral effect is better than TDF.

    [0053] 7. The effect of treating HepG2.215 cells with ADZ5363, AKTi-, and rapamycin at different times on HBV DNA, cccDNA, HBsAg, HBeAg

    [0054] (1) The concentrations of ADZ5363, AKTi-, rapamycin were 1 Um, and 6 time points were set, 0 day, 3 days, 6 days, 9 days, 12 days and 15 days. hepg2 .2.15 cells in the number of 1.510.sup.6 cells were placed. Each time point corresponds to a 6 cm cell culture dish.

    [0055] After overnight adhere, 15-day drug treatment cells were added a specific concentration of drugs. After 24 hours, the 15-day drug treatment cells were added the drugs. After 3 days, the 15-day drug treatment cells and 13-day drug treatment cells were added the drugs. The drugs were administered in this manner for 15 days. After all the drugs were added, the supernatant of cells was collected.

    [0056] (2) The collection of the supernatant of HBV DNA: the same method as above.

    [0057] (3) The detection of HBV DNA content with digital PCR: the same method as above. See FIG. 7.

    [0058] (4) The detection of the changes HBsAg, HBeAg with clinical methods. See.

    [0059] (5) The detection of cccDNA with a regular semi-quantitative method. See FIG. 9.

    [0060] Extraction of HBV cccDNA:

    [0061] The supernatant was treated with a mixture 150 mmol/L NaCl, 50 mmol/L Tris-HCl (pH 7.4), 10 mmol/L EDTA, 0.1% SDS Proteinase K (800 g/mL) was set at 37 C. overnight. Same volume of tris saturated phenol 500 was added to the mixture, and up and down thoroughly mixed, then centrifuged (4 C., 12000 r/min, 10 min). 500 L of upper water layer was collected and added same volume 500 L of phenol:chloroform:isoamyl alcohol (25:24:1), up and down thoroughly mixed, set at room temperature for 10 min, centrifugation (4 C., 12000 r/min, 10 min).

    [0062] After centrifugation, 450 L upper layer of water was collected, and added 4 C. pre-cooled 1/10 volume of sodium acetate 45 L (3 mol/L, pH=5.2), and 2 times the volume of anhydrous ethanol (4 C. precooling) 1.1 mL, up and down thoroughly mixed, set at 20 C. for 10 min, centrifuged (4 C., 12000 r/min, 10 min). The supernatant was discarded, and 1 mL 70% ethanol was added, washed twice, centrifuged (4 C., 12000 r/min, 10 min). The remaining ethanol was removed (about 30 min), and TE buffer 40 L was added, and frozen for future use.

    [0063] Primer design and synthesis:

    [0064] The primers were synthesized by a biological company, and the sequences re as follows:

    TABLE-US-00001 P1- (SEQIDNO.1) 5CTGAATCCTGCGGACGACCC(nt1443-1462) P2- (SEQIDNO.2) 5GCCCCAAAGCCACCCAAG(nt1885-1902)

    [0065] Closed Loop DNA Safe DNA Enzyme Purification:

    [0066] Digestion system: 3 g DNA, 5 L 10buffer, 2 L 25 mMATP, 10U DNase, adding ddH.sub.2O to 50 L, keeping at 37 C. constant temperature for 30 min. 70 C. constant temperature for 30 min inactivated the enzyme.

    [0067] PCR amplification:

    [0068] Reaction system: 1 L 10 um P1, 1 L 10 um P2, 2taqPCRMsterMix 10 L, adding ddH.sub.2O to 20 L.

    [0069] Reaction conditions: 95 C. preheat 1 min, 95 C. 10 s, 58 C. 5 s, 63 C. 15 s, 72 C. 20 s, 34 cycles.

    [0070] The results showed that HBV DNA, HBsAg, HBeAg and cccDNA were significantly decreased with the increase of target inhibitor time, and the effect was better than that of antiviral drug telenovir.

    [0071] Agarose Gel Electrophoresis

    [0072] 8. Nude mice with chronic hepatitis B model before and after treatment of HBV DNA changes.

    [0073] Nude mice model with long-term HBV long-term was prepared by the same way as above. Based on drugs tested, mice were divided into ADZ5363 (10 mg/kg/day) treatment group, TDF (300 mg kg/day) treatment group, ADZ5363 (10 mg/kg/day) and TDF (300 mg kg/day) combined treatment group, and control (no drug treatment) group. Mice were treated with the above doses for 4 weeks.

    [0074] Each week, the tails of the mice were cut to collect blood samples. Blood DNA was extracted with DNeasy Blood & Tissue blood extraction kit. HBV DNA was quantitatively detected by ddPCR. See FIG. 10.

    [0075] One month after drug treatment, mouse liver was collected. The changes of AKT-S473 and HBsAg in the liver after drug treatment were detected by immunohistochemistry (in the same manner as above). See FIG. 10.

    [0076] The results of in vivo experiments show that AKT inhibitors have anti-HBV effects and can reduce HBsAg.