Sulfolobal phosphotriesterase-like (PLL) lactonases activity having enhanced properties and the uses thereof

10072252 ยท 2018-09-11

Assignee

Inventors

Cpc classification

International classification

Abstract

Mutated hyperthermophilic PTE having a lactonase activity derived from a hyperthermophilic phosphotriesterase corresponding to the consensus sequence of SEQ ID NO: 1, the mutated PTE including the at least one mutation chosen amongst 53 putative positions and the mutated PTE having enhanced properties. Also provided are compositions including the mutated hyperthermophilic PTE and the uses thereof, notably as bioscavenger of organophosphate compounds or as quorum quencher of the bacteria using lactones to communicate.

Claims

1. A mutated hyperthermophilic phosphotriesterase, said mutated hyperthermophilic phosphotriesterase has an increased lactonase catalytic activity in comparison of the lactonase activity of a non-mutated hyperthermophilic phosphotriesterase, wherein the non-mutated hyperthermophilic phosphotriesterase is a wild-type phosphotriesterase corresponding to the consensus sequence of SEQ ID NO:1, wherein the amino acid W in position 265 is substituted by an amino acid selected from the group consisting of the amino acids isoleucine I, valine V, threonine T and alanine A within the mutated hyperthermophilic phosphotriesterase.

2. The mutated hyperthermophilic phosphotriesterase according to claim 1, wherein hydrolyzis of 3-oxo-C12 AHL by said mutated hyperthermophilic phosphotriesterase is increased by at least 2 times, in comparison of hydrolyzis of 3-oxo-C12 AHL by said non-mutated hyperthermophilic phosphotriesterase.

3. The mutated hyperthermophilic phosphotriesterase according to claim 1, wherein said mutated hyperthermophilic phosphotriesterase has a thermostability, which is substantially similar to the thermostability of said non-mutated hyperthermophilic phosphotriesterase.

4. The mutated hyperthermophilic phosphotriesterase according to claim 1, wherein the amino acid in position 2 in SEQ ID NO : 1 is missing.

5. The mutated hyperthermophilic phosphotriesterase according to claim 1, wherein said non-mutated hyperthermophilic phosphotriesterase is selected from the group consisting of SEQ ID NO : 3 from Sulfolobus solfataricus, SEQ ID NO : 5 from Sulfolobus acidocalaricus, and from SEQ ID NO : 7 Sulfolobus islandicus, wherein said sequences SEQ ID NO : 3, SEQ ID NO : 5 and SEQ ID NO : 7 belong to the consensus SEQ ID NO : 1, and for said mutated hyperthermophilic phosphotriesterase the amino acid in position 2 in SEQ ID NO: 1 being missing from SEQ ID NO: 5 and the amino acids in position 2 and 3 in SEQ ID NO: 1 being missing from SEQ ID NO: 3 and SEQ ID NO: 7.

6. The mutated hyperthermophilic phosphotriesterase according to claim 1, wherein said amino acid W in position 265 is substituted by an amino acid Isoleucine I.

7. The mutated hyperthermophilic phosphotriesterase according to claim 1, said mutated hyperthermophilic PTE selected from the group consisting of : SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105 and SEQ ID NO: 107.

8. A method of disrupting quorum-sensing in bacteria comprising administering a sufficient amount of the mutated hyperthermophilic phosphotriesterase as defined in claim 1.

9. The method according to claims 8, wherein the mutated hyperthermophilic phosphotriesterase is administered to boats or other sea equipment and limits the formation of biofilms in boats or other sea equipment.

10. The method according to claims 8, wherein the mutated hyperthermophilic phosphotriesterase is administered to plants or vegetables and inhibits fire blight in plants or rotting of vegetables.

11. A phytosanitary composition comprising as active ingredient at least one mutated hyperthermophilic phosphotriesterase as defined in claim 1.

12. An antibacterial composition comprising as active ingredient at least one mutated hyperthermophilic phosphotriesterase as defined in claim 1.

13. A pharmaceutical composition comprising as active ingredient at least one mutated hyperthermophilic phosphotriesterase as defined in claim 1, in association with a pharmaceutically acceptable vehicle.

14. The pharmaceutical composition according to claim 13, further comprising at least one antibiotic selected from the group consisting of gentamycine, ciprofloxacin, ceftazidime, imipenem, and tobramycine.

15. A medicament comprising hyperthermophilic phosphotriesteraseas defined in claim 1.

16. A method of treating bacterial infections, comprising administering to a patient in need thereof an effective amount of the mutated hyperthermophilic phosphotriesterase as defined in claim 1.

17. A method of treating pneumonia or nosocomial diseases, caused by bacteria using homoserin lactone substrates to communicate, in particular in the blood, wounds, burn, skin, biomaterial-body contact area, comprising administering to a patient in need thereof an effective amount of the mutated hyperthermophilic phosphotriesterase as defined in claim 1.

18. A method of treating dental plaque comprising administering to a patient in need thereof an effective amount of the mutated hyperthermophilic phosphotriesterase as defined in claim 1.

19. A method of treating eye infections or eye surface healing comprising administering to a patient in need thereof an effective amount of the mutated hyperthermophilic phosphotriesterase as defined in claim 1.

20. A mutated hyperthermophilic phosphotriesterase, said mutated hyperthermophilic phosphotriesterase has an increased lactonase catalytic activity in comparison of the lactonase activity of a non-mutated hyperthermophilic phosphotriesterase, wherein the non-mutated hyperthermophilic phosphotriesterase is a wild-type phosphotriesterase corresponding to the consensus sequence of SEQ ID NO:1, wherein the amino acid W in position 265 is the single substitution within the mutated hyperthermophilic phosphotriesterase.

21. The mutated hyperthermophilic phosphotriesterase according to claim 20, said mutated hyperthermophilic phosphotriesterase having a single mutation being a substitution of the tryptophan W in position 265 of the consensus sequence SEQ ID NO : 1 by a threonine T.

22. The mutated hyperthermophilic phosphotriesterase according to claim 20, said mutated hyperthermophilic phosphotriesterase having a single mutation being a substitution of the tryptophan W in position 263 of the sequence SEQ ID NO : 3 by an isoleucine I, a valine V, a threonine T or an alanine A.

Description

FIGURES

(1) FIG. 1: Chemical structure of SsoPox substrates

(2) The chemical structure of paraoxon (A.), CMP-coumarin (B.), 3-oxo-C12 AHL (C.), 3-oxo-C10 AHL (D.), undecanoic--lactone (E.) and undecanoic--lactone (F.) are presented.

(3) FIG. 2: SsoPox phosphotriesterase activity screening and characterization

(4) Relative phosphotriesterase activities of W263 saturation site variants have been screened with 1 mM (A.) and 100 M (B.) of paraoxon substrate and 50 M (C.) of CMP-coumarin substrate. The best variants (i.e. SsoPox W263F, W263M, W263A and W263L) have been characterized for paraoxon hydrolysis and catalytic efficiencies have been compared to SsoPox wt (D.).

(5) FIG. 3: SsoPox lactonase activity screening and characterization

(6) A. Schematic representation of P. aeruginosa based lactonase activity screening method. Relative lactonase activity of W263 saturation sites variants have been screened for 3-oxo-C12 AHL hydrolysis (B.). The best variants (i.e. SsoPox W263I, W263V, W263T and W263A) have been characterized for 3-oxo-C12 AHL hydrolysis and catalytic efficiencies have been compared to SsoPox wt (C.)

(7) FIG. 4: A. SsoPox W263I mediated inhibition of lasB transcription.

(8) The chart shows expression in treated cultures expressed as the percentage of lasB expression in untreated control (no SsoPox W263I), and represents data averaged from three independent experiments, each with three technical replicates; error bars represent 95% confidence intervals. Student's T test p=<0.05 for SsoPoxW263I. All T tests for comparison of baseline with highest dose of enzyme.

(9) FIG. 5: Inhibition of PAO1 biofilm formation by SsoPoxW263I.

(10) Biofilms were grown in an MBEC device as described in the methods section. Inhibition of P. aeruginosa biofilm formation by SsoPox W263I is seen in a dose-dependent fashion: Student's T test p=<0.05 for SsoPoxW263I.

(11) FIG. 6. Forty-eight hour survival curves of the 2 groups of animals after infection. Animals were infected with 10.sup.8 CFU/mL (300 L) of P. aeruginosa PAO1 and non-treated (NT) or immediately-treated (IT) with SsoPoxW263I.

(12) FIG. 7: Lung histological examination after infection

(13) Pathological mapping of lungs representative of non-treated (NT) (A), differed-treatment (DT) (B) and immediate-treatment (IT) (C) groups: photomicrographs of pathological Giemsa staining X 100 of the lung sections. Mean histological severity score (HSS) was of (meanSD) 2.640.4 for the NT group, 1.270.6 for the IT group (p=0.005 vs. NT) and 2.320.4 for the DT group (p=NS vs. NT).

EXAMPLES

Example 1

(14) In this example, SsoPox variants have been experimentally produced and characterized.

(15) 1Experimental Procedure

(16) 1.1Initial Material

(17) SsoPox coding gene is optimized for Escherichia coli expression and was synthesized by GeneArt (Life Technologies, France)[1]. The gene was subsequently cloned into a custom version of pET32b (Novagen) (=pET32b-Trx-SsoPox) NcoI and NotI as cloning sites. The SsoPox sequence has been verified by sequencage (Sequencage plateforme, Timone, Marseille, France). Both plasmids have been used for evolution protocols.

(18) 1.2Site Directed Mutagenesis

(19) A saturation site of position W263 of SsoPox was ordered to service provider (GeneArt, Invitrogen; Germany) from the initially used plasmid pET22b-SsoPox. Each variant were checked by sequencing and provided as Escherichia coli DH5 cell glycerol stocks. The 20 plasmids (pET22b-SsoPox-W263X) have been purified from E. coli DH5 cells and transformed into BL21(DE.sub.3)-pLysS strain by electroporation for activity screening and into BL21(DE3)-pGro7/EL (TaKaRa) for high amount production/purification (see concerning section below).

(20) For others site directed mutagenesis or saturation site of selected positions, pfu Turbo polymerase (Agilent) has been used to amplify the overall plasmid using primers incorporating wanted variations. PCR composition has been performed as advised by the customer in a final volume of 25 L and amplification was performed from 100 ng of plasmid. The PCR protocol was the following:

(21) TABLE-US-00001 95 C. 10 1X 95 C. 45 50 C. 1 30X 68 C. 15 68 C. 20 1X 14 C. 1X

(22) Remaining initial plasmids were removed by DpnI enzymatic digestion (1 l; Fermentas) during 45 at 37 C. After inactivation of 20 at 90 C., DNA was purified (QIAquick PCR Purification Kit; Qiagen) to obtain about 30 L of variable amount of DNA. 5 L of purified DNA was then transformed into Escherichia coli electrocompetent cells (50 L; E. cloni; Lucigen), recovered in 1 mL of SOC medium during 1 h at 37 C. and then plated on agar medium supplemented with ampicillin (100 g/mL). Several clones were sequenced to verify the well-performed mutagenesis (Sequencage plateforme, Timone, Marseille, France) and verified plasmids were transformed into E. coli strain BL21(DE.sub.3)-pGro7/GroEL (TaKaRa) for high amount production/purification and analysis (see concerning section below).

(23) 1.3Directed Evolution Process

(24) Directed evolution protocol has been performed using the GeneMorph II Random Mutagenesis Kit in 25 L final, using primers T7-promotor (TAA TAC GAC TCA CTA TAG GG) and T7-RP (GCT AGT TAT TGC TCA GCG G) and 500 ng of matrix (correspond to 6 g of pET32b-Trx-SsoPox plasmid). Others PCR elements have been performed as advised by the customer recommendations. The PCR protocol was the following:

(25) TABLE-US-00002 95 C. 5 1X 95 C. 30 55 C. 30 30X 72 C. 4 72 C. 10 1X 14 C. 1X

(26) Remaining plasmid was then digested by DpnI enzyme (1 l; Fermentas) during 45 at 37 C. and then inactivated 20, 90 C. DNA was then purified (QIAquick PCR Purification Kit; Qiagen) to obtain about 50 L of DNA at 100 ng/L. For the next steps please refer to part clonage and bank generation.

(27) 1.4Method

(28) SsoPox coding gene has been amplified from pET32b-Trx-SsoPox plasmid by PCR (500 L RedTaq; Sigma) using primers T7-promotor (TAA TAC GAC TCA CTA TAG GG) and T7-RP (GCT AGT TAT TGC TCA GCG G). The PCR protocol was the following:

(29) TABLE-US-00003 95 C. 2.sup. 1X 95 C. 30 55 C. 1.5 25X 72 C. 1.2 72 C. 7.sup. 1X 16 C. 1X

(30) Remaining plasmid was then digested by DpnI enzyme (1 l; Fermentas) during 45 at 37 C. and then inactivated 20, 90 C. DNA was then purified (QIAquick PCR Purification Kit; Qiagen) to obtain about 100 L, of DNA at 200 ng/L. 15 L of DNA (3 g) was digested by 2 UE of DNAseI (TaKaRa) in buffer TrisHCl 100 mM pH 7.5, MnCl.sub.2 10 mM at 20 C. during 30, 1 and 2. Digestions were stopped by 10 incubation at 90 C. in presence of EDTA 60 mM. After spin down, DNA aliquots were pooled and run on electrophoresis agarose (2%; w/v) gel in TAE buffer during 15 at 50 mA. Fragments consisting of average size of 70 bp (from 50 to 150 pb) were excised from gel and purified using D-Tube Dyalizer Maxi (Calbiochem) devices.

(31) DNA extracted from gel (concentration >12 ng/L) was used as matrix in assembly PCR consisting of 100 ng of matrix, 2 pmol of primers incorporating mutations and using 2.5 UE of Pfu Turbo polymerase (Agilent) with a final volume of 25 l. The primer mix was composed of an oligonucleotide mix consisting of equivalent amount of modified positions. The PCR protocol was the following:

(32) TABLE-US-00004 94 C. 2.sup. 1X 94 C. 30 65 C. 1.5 62 C. 1.5 59 C. 1.5 56 C. 1.5 53 C. 1.5 35X 50 C. 1.5 47 C. 1.5 45 C. 1.5 41 C. 1.5 72 C. 45 72 C. 7.sup. 1X 4 C. 1X

(33) The primer incorporating mutations in the directions 5-3 are as follows:

(34) TABLE-US-00005 TABLE1 Listingofprimersused tocreateSsoPoxvariants SEQIDNO Primer Sequence5-3 SEQIDNO:268 W263M-F TGCACCATTGATATG GGCACCGCAAAACCG SEQIDNO:269 W263M-R CGGTTTTGCGGTGCC CATATCAATGGTGCA SEQIDNO:270 W263L-F TGCACCATTGATCTG GGCACCGCAAAACCG SEQIDNO:271 W263L-R CGGTTTTGCGGTGCC CAGATCAATGGTGCA SEQIDNO:272 W263A-F TGCACCATTGATGCA GGCACCGCAAAACCG SEQIDNO:273 W263A-R CGGTTTTGCGGTGCC TGCATCAATGGTGCA SEQIDNO:274 W263I-F TGCACCATTGATATT GGCACCGCAAAACCG SEQIDNO:275 W263I-R CGGTTTTGCGGTGCC AATATCAATGGTGCA SEQIDNO:276 W263V-F TGCACCATTGATGTT GGCACCGCAAAACCG SEQIDNO:277 W263V-R CGGTTTTGCGGTGCC AACATCAATGGTGCA SEQIDNO:278 W263T-F TGCACCATTGATACC GGCACCGCAAAACCG SEQIDNO:279 W263T-R CGGTTTTGCGGTGCC GGTATCAATGGTGCA SEQIDNO:280 C258L-F ATTAGCCATGATTAT CTGTGCACCATTGAT SEQIDNO:281 C258L-R ATCAATGGTGCACAG ATAATCATGGCTAAT SEQIDNO:282 I261F-F GATTATTGCTGCACC TTTGATTGGGGCACC SEQIDNO:283 I261F-R GGTGCCCCAATCAAA GGTGCAGCAATAATC SEQIDNO:284 V27A-F GAACATCTGCGTGCA TTTAGCGAAGCAGTT SEQIDNO:285 V27A-R AACTGCTTCGCTAAA TGCACGCAGATGTTC SEQIDNO:286 Y97W-F GGCACCGGTATTTGG ATTTATATCGATCTG CCG SEQIDNO:287 Y97W-R CGGCAGATCGATATA AATCCAAATACCGGT GCC SEQIDNO:288 L228M-F GATCGTTATGGTCTG GACATGTTTCTGCCG GTT SEQIDNO:289 L228M-R AACCGGCAGAAACAT GTCCAGACCATAACG ATC SEQIDNO:290 I280T-F GCACCGCGTTGGAGC ACTACCCTGATTTTT G SEQIDNO:291 I280T-R CAAAAATCAGGGTAG TGCTCCAACGCGGTG C SEQIDNO:292 F46L-F CTGTATAATGAAGAT GAAGAACTGCGCAAT GCCGTGAATGAAG SEQIDNO:293 F46L-R CTTCATTCACGGCAT TGCGCAGTTCTTCAT CTTCATTATACAG SEQIDNO:294 I76T-F GTTATGGGTCTGGGT CGTGATACTCGTTTT ATGGAAAAAGTTGTG SEQIDNO:295 I76T-R CACAACTTTTTCCAT AAAACGAGTATCACG ACCCAGACCCATAAC SEQIDNO:296 Y99F-F GGCACCGGTATTTAT ATTTTTATCGATCTG CCG SEQIDNO:297 Y99F-R CGGCAGATCGATAAA AATATAAATACCGGT GCC SEQIDNO:298 L130P-F GGCATTCAGGGCACC CCGAATAAAGCAGGT TTTG SEQIDNO:299 L130P-R CAAAACCTGCTTTAT TCGGGGTGCCCTGAA TGCC SEQIDNO:300 L226V-F GATCGTTATGGTGTG GACCTGTTTCTGCCG GTT SEQIDNO:301 L226V-R AACCGGCAGAAACAG GTCCACACCATAACG ATC SEQIDNO:302 L72I-F GTTATGGGTATTGGT CGTGATATTCGTTTT SEQIDNO:303 L72I-R AAAACGAATATCACG ACCAATACCCATAAC SEQIDNO:304 F229S-F GATCGTTATGGTCTG GACCTGTCTCTGCCG GTT SEQIDNO:305 F229S-R AACCGGCAGAGACAG GTCCAGACCATAACG ATC SEQIDNO:306 T68S-F AAAACCATTGTTGAT CCGAGTGTTATGGGT SEQIDNO:307 T68S-R ACCCATAACACTCGG ATCAACAATGGTTTT SEQIDNO:308 K8E-F CATTCCGCTGGTTGG TGAAGATAGCATTGA AAG SEQIDNO:309 K8E-R CTTTCAATGCTATCT TCACCAACCAGCGGA ATG SEQIDNO:310 P67S-F AAAACCATTGTTGAT TCGACCGTTATGGGT SEQIDNO:311 P67S-R ACCCATAACGGTCGA ATCAACAATGGTTTT SEQIDNO:312 K164N-F CAATAAAGAAACCAA TGTTCCGATTATTAC CC SEQIDNO:313 K164N-R GGGTAATAATCGGAA CATTGGTTTCTTTAT TG

(35) Finally, assembly PCR was used as matrix for nested PCR. 1 L of assembly PCR was used as classical PCR (50 L, RedTaq; Sigma) with cloning primers SsoPox-lib-pET-5 (ATGCGCATTCCGCTGGTTGG) and SsoPox-lib-pET-3 ( TTATTAGCTAAAGAATTTTTTCGGATTTTC). The PCR protocol was the following:

(36) TABLE-US-00006 95 C. 2.sup. 1X 95 C. 30 25X 65 C. 1.5 72 C. 7.sup. 1X 16 C. 1X

(37) 1.5Clonage and Bank Generation

(38) PCR product has been purified using extraction kit (QIAquick PCR Purification Kit; Qiagen) and then digested for 45 at 37 C. by NcoI Fastdigest and NotI Fastdigest enzymes (12UE of each enzyme; Fermentas). Enzymes were then inactivated by 20 incubation at 90 C. and then purified (QIAquick PCR Purification Kit; Qiagen) to be cloned into pET32b-trx plasmid at the corresponding restriction sites previously dephosphorylated as recommended by the customer (10 UE/l CIP; NEB). Ligation has been performed in a molar ratio 1:3 with 50 ng of plasmid using T4-DNA ligase during 16 h at 16 C. (20 UE; NEB).

(39) After ligation, ligase was inactivated 20 at 90 C. and then purified from salts by classical alcohol precipitation and recovered in 10 L of water. Escherichia coli electrocompetent cells (50 L; E. cloni; Lucingen) were electroporated with 5 L of purified ligation and recovered in 1 mL of SOC medium for 1 h at 37 C. All 1 mL was then plated on agar selected medium (ampicillin 100 g/mL) and incubated overnight at 37 C.

(40) Obtaining transformation efficiency higher than 10.sup.4 colonies on agar plate, the colonies were then harvested using 1 mL of plasmidic extraction kit solution 1 (Qiaprep Spin Miniprep kit; Quiagen) and plasmids were then extracted from cells following the recommended procedure. The plasmid pool obtained constituting the bank, 100 ng were used to electroporate 50 L of electrocompetent BL21(DE3)-pGro7/EL (TaKaRa). After 1 h of recovering in SOC medium at 37 C., cells were plated on agar plate added of ampicillin (100 g/mL) and chloramphenicol (37 g/mL).

(41) 2Screening Procedure

(42) Microcultures consisting of 600 L of ZYP medium [3,4] supplemented by ampicillin (100 g/mL) and chloramphenicol (34 g/mL) are inoculated by a tip picked colony in 96 well plates. Cultures grew at 37 C. under 1 600 rpm agitation for 5 h before activation mediated by temperature transition to 25 C. and addition of CoCl.sub.2 (0.2 mM) and arabinose (0.2%, w/v). After overnight growth, tips were removed and used to pick separated colony on agar plate (ampicilin 100 g/mL; chloramphenicol 34 g/mL) for strain conservation. Cultures were centrifuged to keep cell pellets which were resuspended in lysis buffer consisting of 50 mM HEPES pH 8, 150 mM NaCl, CoCl.sub.2 0.2 mM, Lysozyme 0.25 PMSF 0.1 mM DNAseI 10 g/ml and MgSO.sub.4 20 mM. Cells were disrupted by freezing/thawing steps and cells debris were removed by centrifugation (13 000 g, 4 C., 30). Partial purification of the protein was performed exploiting SsoPox hyperthermostability [5] by 15 minutes incubation at 70 C. Aggregated proteins were harvested by centrifugation (13 000 g, 25 C., 30).

(43) 2.1Phosphotriesterase Activity Screening

(44) Phosphotriesterase activity screening was mediate by monitoring chromophoric phosphotriester hydrolysis (paraoxon, methyl-paroxon, parathion, methyl parathion (1 mM or 100 M,Fluka). Kinetics experiments were performed for 10 monitoring phosphotriester (.sub.405 nm=17 000 M.sup.1cm.sup.1) hydrolysis at 25 C. using a microplate reader (Synergy HT; BioTek, USA) and the Gen5.1 software in a 6.2 mm path length cell for 200 L reaction in 96-well plate. Standard assays were performed in pte buffer (50 mM HEPES pH 8, 150 mM NaCl, 0.2 mM CoCl.sub.2).

(45) 2.2Lactonase Activity Screening

(46) Lactonase activity screening was mediated by a genetically modified strain PAO1 of Pseudomonas aeruginosa (PAO1-lasI-JP2). The JP2 plasmid encodes proteins coding for bioluminescence production in presence of 3-oxo-C12 AHLs in P. aeruginosa; the lasI gene, responsible of 3-oxo-C12 AHLs synthesis in wt P. aeruginosa, is deleted. SsoPox variants (5 L of tenfold diluted partially purified variants) are mixed in 100 L of pte buffer with 3-oxo-C12 AHL (100 nM) and incubated 20 minutes at room temperature. A volume of 450 L of LB media (Trimethoprime lactate 300 g/mL) was inoculated by overnight preculture of P. aeruginosa PAO1-lasI-JP2 (1/50) and supplemented with the mixture protein/AHLs (50 L). The final theoretical concentration of 3-oxo-C12 AHLs is 20 nM, prior to enzymatic hydrolysis by SsoPox. After 270 minutes of culture at 37 C., cell density (OD.sub.600 nm) and bioluminescence (460-40 nm; intensity 100) of 200 L aliquots of culture are measured in a 96-well plate using a microplate reader (Synergy HT, BioTek, USA) monitored by Gen5.1 software. Controls consist in the same experiment without enzyme and/or without AHLs.

(47) Best hits were re-plated and then placed in microcultures as previously explained despite each clones were represented four times. The previous protocol was performed as identic to confirm the results. However, lysis buffer and pte buffer doesn't contain CoCl.sub.2 salt to avoid affinity loss for the metals by the enzyme during the improvement process.

(48) 3Improvement Confirmation and Analysis

(49) The best variants were then sequenced (Sequencage plateforme, Timone, Marseille, France) and produce in larger amount for catalytic properties analysis. Genes or plasmids selected for the best improvement can have been used to perform the next round of diversity generation (i.e. go back to the first sections).

(50) The high amount of protein production was performed using E. coli strain BL21(DE.sub.3)-pGro7/GroEL (TaKaRa). Productions have been performed in 500 mL of ZYP medium [3] (100 g/ml ampicilline, 34 g/ml chloramphenicol) as previously explained [4,6,7], 0.2% (w/v) arabinose (Sigma-Aldrich; France) was added to induce the expression of the chaperones GroEL/ES and temperature transition to 25 C. was performed. Purification was performed as previously explained [7]. Briefly, a single step of 30 incubation at 70 C. was performed, followed by differential ammonium sulfate precipitation, dialysis and exclusion size chromatography. Proteins were quantified using nanospectrophotometer (nanodrop, thermofisher scientific, France) using protein molar extinction coefficient generated using protein primary sequence in PROT-PARAM (expasy tool softwares) [8].

(51) 3.1Kinetics Generalities

(52) Catalytic parameters were evaluated at 25 C., and recorded with a microplate reader (Synergy HT, BioTek, USA) and the Gen5.1 software in a 6.2 mm path length cell for 200 L reaction in 96-well plate as previously explained [6]. Catalytic parameters were obtained by fitting the data to the Michaelis-Menten (MM) equation [9] using Graph-Pad Prism 5 software. When V.sub.max could not be reached in the experiments, the catalytic efficiency was obtained by fitting the linear part of MM plot to a linear regression using Graph-Pad Prism 5 software.

(53) 3.2Phosphotriesterase Activity Characterization

(54) Standard assays were performed in pte buffer measuring time course hydrolysis of PNP derivative of OPs (.sub.405 nm=17 000 M.sup.1cm.sup.1), nerve agents coumarin derivatives (CMP-coumarin, IMP-coumarin, PinP-coumarin) [10](.sub.412 nm=37 000 M.sup.1cm.sup.1) or malathion bu adding 2 mM DTNB in the buffer (.sub.412 nm=13 700 M.sup.1cm.sup.1). Kinetics have also been performed in pte buffer added of 0.1 and/or 0.01% of SDS as previously exemplified [1].

(55) 3.3Lactonase Activity Characterization

(56) The lactonase kinetics were performed using a previously described protocol [6]. The time course hydrolysis of lactones were performed in lac buffer (Bicine 2.5 mM pH 8.3, NaCl 150 mM, CoCl.sub.2 0.2 mM, Cresol purple 0.25 mM and 0.5% DMSO) over a concentration range 0-2 mM for AHLs. Cresol purple (pK.sub.a 8.3 at 25 C.) is a pH indicator used to follow lactone ring hydrolysis by acidification of the medium. Molar coefficient extinction at 577 nm was evaluated recording absorbance of the buffer over an acetic acid range of concentration 0-0.35 mM.

(57) 3.4Melting Temperature Determination

(58) Circular Dichroism spectra were recorded as previously explained [6] using a Jasco J-810 spectropolarimeter equipped with a Pelletier type temperature control system (Jasco PTC-4235) in a 1 mm thick quartz cell and using the Spectra Manager software. Briefly, measurements were performed in 10 mM sodium phosphate buffer at pH 8 with a protein concentration of 0.1 mg/mL. Denaturation was recorded at 222 nm by increasing the temperature from 20 to 95 C. (at 5 C./min) in 10 mM sodium phosphate buffer at pH 8 containing increasing concentrations (1.5-4 M) of guanidinium chloride. The theoretical Tm without guanidinium chloride was extrapolated by a linear fit using the GraphPadPrism 5 software.

(59) 2Results

(60) 2.1Phosphotriesterase and Lactonase Activity Screening

(61) It has been previously highlighted that some residues in SsoPox active site are deleterious for phosphotriesterase activity compared to P. diminuta PTE active site (Hiblot et al., 2012, PloS One 7(10), e47028). In particular, W263 make a steric hindrance in SsoPox active site blocking the entry of OPs. However, it has been shown that W263F variation allowed a phosphotriesterase activity improvement despite that Trp and Phe are both cumbersome residues.sup.5. This raises the question of the real impact of variation at position W263. Indeed, W263 position is located at the dimer interface and on the active site capping loop positioning the lactone ring in SsoPox complexed structure with HTL.sup.6. Thus, variations at this position have been study to better understand their structural impacts allowing activity improvement.

(62) Phosphotriesterase and Lactonase Activities Screening

(63) A saturation site of the W263 position has been performed in the aim to screen phosphotriesterase and lactonase activities. Each variant have been produced in small amount (3 mL) and partially purified exploiting the natural thermoresistance of SsoPox to perform activity screening.

(64) Phosphotriesterase Activity Screening

(65) The ability of each variant to hydrolyse paraoxon substrate (FIG. 1-A) has been evaluated with 1 mM and 100 M with same tendencies observed. The most efficient variants were respectively SsoPox W263L, W263M and W263F with specific activities enhancements ranging between 30-50 and 20-35 times respectively at 1 mM and 100 M, compared to SsoPox wt. Moreover, it is interesting to note that the native enzyme (W263) is the less efficient among the saturation site variants for paraoxon hydrolysis (after W263K).

(66) CMP-coumarin (FIG. 1-C) is a cyclosarin derivative used also to evaluate the ability of variants to hydrolyse nerve agents (50 M). The SsoPox variants W263F, W263M and W263L exhibit the best specific activities (FIG. 2-C). The improvements range between 4 and 11 times compared to SsoPox wt.

(67) In conclusion, SsoPox W263F, W263L and W263M seem the best able to improve phosphotriesters hydrolysis. Variations implicate mainly hydrophobic residues with variable cumbersome. These proteins will form the group phosphotriesterase selected variants.

(68) Lactonase Activity Screening

(69) It has been postulated that reduction of steric hindrance is not the only explanation for phosphotriesterase activity improvement of SsoPox W263F. So, variation at this position could allow a lactonase activity improvement. In the aim to explore this issue, a lactonase activity screening method has been developed. This screen is based on P. aeruginosa PAO1 derivative strain deleted for lasI gene and carrying a JP2 plasmid allowing to produce bioluminescence in presence of 3-oxo-C12 AHLs (l) (FIG. 1-C) (a main lactone implicated in P. aeruginosa quorum sensing system). In few words, this strain doesn't produce by itself 3-oxo-C12 AHLs and, thus, doesn't generate intrinsically bioluminescence. The bioluminescence intensity in experiment is only due to exogenously added 3-oxo-C12 AHLs. Thus, if a lactonase is pre-incubated with 3-oxo-C12 AHLs, the bioluminescence will be inversely proportional to lactonase (3-oxo-C12 AHLase) activity.

(70) Using this screening method, SsoPox W263A, W263I, W263T and W263V have been selected for a potential lactonase activity improvement (FIG. 3-B). The amplitude of the ameliorations in our conditions of screening can't be evaluated. Selected variations implicate small and mainly hydrophobic residues. These four variants form the group lactonase selected variants.

(71) 2.2Enzymatic Characterization of SsoPox Variants

(72) 2.2.1Single Position Variants

(73) Confirmation of screening results has been allowed by enzymatic characterisation of phosphotriesterase and lactonase selected variants. They have been produced and purified in large amount. Their catalytic parameters have been characterized for lactone (3-oxo-C12 AHL (l)) and phosphotriester (Paraoxon) substrates (Table 2).

(74) TABLE-US-00007 TABLE 2 Lactonase and phosphotriesterase activity of W263 variants of SsoPox (ND corresponds to not determined value). SsoPox variant k.sub.cat (s.sup.1) K.sub.M (M) K.sub.I (M) k.sub.cat/K.sub.M (M.sup.1s.sup.1) Enhancement/wt Paraoxon Wt 12.59 1.26 24250 3716 5.19(1.31) 10.sup.2 1 W263F 8.47 0.53 700 146 1.21(0.33) 10.sup.4 23.3 W263M 6.82 0.57 931 163 7.33(1.9) 10.sup.3 14.1 W263L ND ND 2.37(0.33) 10.sup.3 4.6 W263I ND ND 1.21(0.59) 10.sup.3 2.3 W263V ND ND 8.83(0.3) 10.sup.2 1.7 W263T ND ND 1.06(0.03) 10.sup.3 2.0 W263A 5.29 0.69 1491 351 3.55(1.30) 10.sup.3 6.8 3-oxo- Wt (9.9 1.2) 10.sup.1 .sup.335 10.4 2.96(0.99) 10.sup.3 1 W263F (6.6 0.3) 10.sup.1 146 33 4.52(1.04) 10.sup.3 1.5 W263M ND ND ND ND 0 W263L ND ND ND ND 0 W263I 2.89 0.08 17.8 4.87 1.62(0.45) 10.sup.5 54.7 W263V 4.82 0.11 24.7 5.2 1.95(0.44) 10.sup.5 65.8 W263T 10.4 0.35 137 19 7.56(1.08) 10.sup.4 25.6 W263A 20.4 1.21 1640 170 1.25(0.15) 10.sup.3 0.42
Phosphotriesterase Activity Characterization

(75) Phosphotriesterase activity of wt SsoPox has been characterized in a previous study (Hiblot et al., 2012, PloS One 7(10), e47028). As already observed in screening experiments, catalytic efficiencies of all selected variants were higher than the wt protein for paraoxon (Table 2). Among the phosphotriesterase selected variants, SsoPox W263F exhibits the highest paraoxonase catalytic efficiency (k.sub.cat/K.sub.M=1.21(0.33)10.sup.4 M.sup.1s.sup.1) followed by SsoPox W263M and SsoPox W263L with respective enhancements of 23.3, 14.1 and 4.6 times compared to wt enzyme (Table 2, FIG. 2-D). Among the lactonase selected variants, only SsoPox W263A (k.sub.cat/K.sub.M=3.55(1.30)10.sup.3 M.sup.1s.sup.1) exhibits a higher paraoxonase catalytic efficiency than the SsoPox W263L phosphotriesterase selected variant (6.8 times improvement compared to wt enzyme).

(76) SsoPox W263L variant was selected for its phosphotriesterase activity improvement. Owing its potential for phosphotriester hydrolysis, its ability to hydrolyze different nerve agent derivatives has been addressed (Table 3).

(77) TABLE-US-00008 TABLE 3 Phosphodiesterase activity of W263L variant of SsoPox. ND corresponds to not determined value. For paraoxon and methyl-parathion in presence of SDS, experimental data were fitted to substrate inhibition equation because of amore suitable fit than with classical MM equation. As a consequence, the calculated catalytic efficiencies are available only at low substrate concentration. SsoPox W263L k.sub.cat(s.sup.1) K.sub.M (M) K.sub.I (M) k.sub.cat/K.sub.M(M.sup.1s.sup.1) Paraoxon 3.13 0.25 985 169 3.18(0.60) 10.sup.3 Paraoxon + SDS 0.01% 8.89 0.99 141 33 1700 453 6.29(1.62) 10.sup.4 Paraoxon + DOC 0.01% 3.17 0.18 244 55 1.30(0.30) 10.sup.4 Methyl-paraoxon ND ND ND 3.16(0.10) 10.sup.4 Methyl-paraoxon + SDS ND ND ND 1.69(0.04) 10.sup.5 0.01% Methyl-parathion + SDS 1.22(0.13) 10.sup.1 168 31 1920 676 728 156 0.01%

(78) It has been shown that anionic detergents, like SDS, were able to enhance the phosphotriesterase activity of SsoPox (Hiblot et al., 2012, PloS One 7(10), e47028). Paraoxon hydrolysis by SsoPox W263L in presence of SDS at 0.01% (k.sub.cat/K.sub.M=6.29(1.62)10.sup.4 M.sup.1s.sup.1) has been compared to the paraoxon hydrolysis by wt enzyme (k.sub.cat/K.sub.M=6.41(1.51)10.sup.3 M.sup.1s.sup.1). The catalytic efficiency improvement induced by SDS on SsoPox W263L (19.8 times) is higher than one observed for wt SsoPox (12.4 times). It was proposed that activity improvement by SDS is due to global flexibilisation of the protein (Hiblot et al., 2012, PloS One 7(10), e47028). The higher improvement observed for SsoPox W263L could be due to variation-induced flexibility mimicking partially the SDS-induced flexibility. Indeed, leucine being less cumbersome than Trp, the phosphotriesterase improvement can be imputed to steric hindrance reduction.

(79) Moreover, SDS at 0.01% is also able to enhance methyl-paraoxon hydrolysis by SsoPox W263L (5.3 times).

(80) Deoxycholate acid (DOC), a mild detergent, is less effective than the SDS in increasing the paraoxon hydrolysis by the SsoPox W263L (k.sub.cat/K.sub.M=1.30(0.30)10.sup.4).

(81) Lactonase Activity Characterization

(82) Chemically different lactone substrates have been used in the aim to understand the lactonase activity improvement of SsoPox. AHLs and /-lactones (oxo-lactones) are differently acylated on the lactone cycle (FIG. 1). We have studied AHLs with different size chains. 3-oxo-C10 AHLs (l) (FIG. 1-D) are 10 times better substrate for wt enzyme compared to 3-oxo-C12 AHL (l) (respectively, k.sub.cat/K.sub.M=3.16(0.40)10.sup.4 M.sup.1s.sup.1 and k.sub.cat/K.sub.M=2.96(0.99)10.sup.3 M.sup.1s.sup.1; data not shown) for which variants have been screened. Two different oxo-lactones exhibiting different ring sizes have also been studied. Wt SsoPox exhibits a 10 times higher catalytic efficiency with undecanoic--lactones (r) (6 atoms ring-size) than with undecanoic--lactones (r) (5 atoms ring-size) (respectively, k.sub.cat/K.sub.M=6.72(2.54)10.sup.4 M.sup.1s.sup.1 and k.sub.cat/K.sub.M=2.36 (0.38)10.sup.3 M.sup.1s.sup.1; data not shown).

(83) Directed evolution allows to select what you screen for. Giving that best lactonase variants were selected on their ability do hydrolyse 3-oxo-C12 AHL, kinetic characterisations of the 3-oxo-C12 AHLase activity has been performed (Table 2). Results obtained allows to confine that lactonase selected variants exhibit 3-oxo-C12 AHLase improved catalytic efficiencies compared to SsoPox wt. These improvements range from 26 times for SsoPox W263T to 66 times for SsoPox W263V with a k.sub.cat/K.sub.M=1.95(0.44)10.sup.5 M.sup.1s.sup.1 that is the best referred to our knowledge (FIG. 3-C). Concerning the phosphotriesterase selected variants, none of them presents enhanced 3-oxo-C12 AHLase catalytic efficiencies, only SsoPox W263F presents an efficiency equivalent to the wt enzyme. SsoPox W263L, W263A and W263M lost the ability to hydrolyse this molecule. The extent of the improvements observed makes of 3-oxo-C12 a potential promiscuous substrate.

(84) Series of complementary results have been obtained for 3-oxo-C12 AHL, 3-oxo-C10 AHL, -lactone and undecanoic--lactone substrates (see table 2).

(85) TABLE-US-00009 TABLE 2 Lactonase activities of W263 variants of SsoPox (ND corresponds to not determined value). SsoPox variant k.sub.cat (s.sup.1) K.sub.M (M) K.sub.I (M) k.sub.cat/K.sub.M (M.sup.1s.sup.1) Enhancement/wt 3-oxo-C12 AHL wt 1.01 0.13 456 128 2.22(0.68) 10.sup.3 1 (l) (XII) W263F 0.41 0.02 146 33 2.81(0.65) 10.sup.3 1.3 0.5 W263M ND ND ND ND W263L ND ND ND ND W263I 1.80 0.05 17.8 4.9 1.0l(0.28) 10.sup.5 45.5 18.8 W263V 3.00 0.07 24.7 5.2 1.21(0.26) 10.sup.5 54.5 20.4 W263T 6.44 0.22 137 19 4.70(0.67) 10.sup.4 21.2 7.2 3-oxo-C10 AHL wt 4.52 0.10 143 15 3.16(0.40) 10.sup.4 1 (l) (XI) W263F 3.96 0.18 288 56 1.38(0.28) 10.sup.4 4.4(1.0) 10.sup.1 W263M ND ND ND 0 W263L ND ND ND 0 W263I .sup.(6.00 0.90) 10.sup.1 1605 443 3.74(1.17) 10.sup.2 1.2(0.4) 10.sup..sup.2 W263V .sup.(1.90 0.09) 10.sup.1 1346 298 1.41(0.32) 10.sup.2 4.5(1.2)10.sup.3 W263T .sup.(1.07 0.16) 10.sup.1 1000 343 1.06(0.40) 10.sup.2 3.4(1.3)10.sup.3 Undecanoic--lactone wt 7.38 0.28 94 18 7.86(1.53) 10.sup.4 1 (r) (XX) W263F (6.65 0.32) 10.sup.1 135.2 52.8 4.92(1.93) 10.sup.5 6.3 2.7 W263M (7.12 0.66) 10.sup.1 161 47 7 400 2 475 4.42(1.35) 10.sup.5 5.6 2.0 W263L (5.68 0.58) 10.sup.1 219 62 4 253 1 152 2.59(0.78) 10.sup.5 3.3 1.2 W263I (5.80 0.74) 10.sup.1 <10 803 213 >5.80(0.74) 10.sup.6 >73.8 17.2 W263V (4.48 0.50) 10.sup.1 57 16 789 186 7.92(2.34) 10.sup.5 10.1 3.6 W263T (9.33 0.80) 10.sup.1 130 41 3047 576 7.17(2.34) 10.sup.5 9.1 3.5 Undecanoic--lactone wt 4.95 0.26 2 099 230 2.36 (0.38) 10.sup.3 1 (r) (XVI) W263F 4.63 0.27 373 111 1.24(0.38) 10.sup.4 5.3 1.8 W263M 4.25 0.22 334 61 1.27(0.24) 10.sup.4 5.4 1.3 W263L 3.92 0.17 371.8 69.2 1.05(0.20) 10.sup.4 4.4 1.1 W263I 1.94 0.08 361 47 5.37(0.73) 10.sup.3 2.3 0.5 W263V 5.64 0.53 1 760 404 3.20(0.80) 10.sup.3 1.4 0.4 W263T 4.55 0.10 13.0 4.2 3.49(1.13) 10.sup.5 147.9 53.5
Thermostability

(86) The melting temperatures have been determined by circular dichroism spectroscopy for the wt SsoPox enzyme and the single position variants. Resultants are given below: wt: 104 C. W263F: 91.81.7 C. W263M: 85.30.9 C. W263L: 92.02.1 C. W263T: 89.20.4 C. W263V: 84.11.6 C. W263I: 87.81.2 C.

(87) 2.2.2Multiple Positions Variants

(88) Some of the above mentioned mutated hyperthermophilic phosphotriesterase (PTE) having a lactonase activity derived from a hyperthermophilic phosphotriesterase corresponding to the sequence of SEQ ID NO: 3 have been tested for their ability to hydrolyse either OPs or AHLs compounds. The results of their enzymatic activities are presented hereafter.

(89) Five mutated hyperthermophilic phosphotriesterase (PTE) having a lactonase activity derived from the hyperthermophilic PTE of Sulfolobus solfataricus corresponding to the sequence SEQ ID NO: 3 have been tested for their phosphotriesterase activity. The evaluation of phosphotriesterase activity has been performed using ethyl-paraoxon, methyl-paraoxon, ethyl-parathion, methyl-parathion and malathion. Results are presented in tables 4 and 5 hereafter.

(90) TABLE-US-00010 TABLE 4 Phosphodiesterase activity of variants of SsoPox sA1, sA6, sB5. Catalytic avtivity is expressed in M.sup.1s.sup.1 (ND = not detected, VLH = very low hydrolysis). SsoPox sA1 sA6 sB5 Substrat wt SEQ ID NO: 21 SEQ ID NO: 27 SEQ ID NO: 29 Ethyl-Paraoxon 5.19(1.31) .Math. 10.sup.2 3.37(0.94) .Math. 10.sup.4 3.61(1.69) .Math. 10.sup.3 4.98(0.94) .Math. 10.sup.4 Methyl-Paraoxon 1.27(0.7) .Math. 10.sup.3 2.29(1.09) .Math. 10.sup.4 1.08(0.30) .Math. 10.sup.4 4.31(0.14) .Math. 10.sup.3 Ethyl-Parathion ND VLH 2.39(0.47) .Math. 10.sup.2 9.32(1.44) .Math. 10.sup.2 Methyl-Parathion 9.09 0.9 3.68(0.5) .Math. 10.sup.1 61 15 9.49(1.15) .Math. 10.sup.2 Malathion 5.56 1.26 3.2 0.7 ND 31.1 7.7

(91) TABLE-US-00011 TABLE 5 Phosphodiesterase activity of variants of SsoPox sC6 and sD6. Catalytic avtivity is expressed in M.sup.1s.sup.1 (ND = not detected, VLH = very low hydrolysis). SsoPox sC6 sD6 Substrat wt SEQ ID NO: 31 SEQ ID NO: 23 Ethyl-Paraoxon 5.19(1.31) .Math. 10.sup.2 2.86(0.17) .Math. 10.sup.4 6.22(1.01) .Math. 10.sup.4 Methyl- 1.27(0.7) .Math. 10.sup.3 3.11(1.32) .Math. 10.sup.4 2.04(0.59) .Math. 10.sup.4 Paraoxon Ethyl-Parathion ND 1.10(0.20) .Math. 10.sup.2 6.05(1.50) .Math. 10.sup.3 Methyl- 9.09 0.9 24.8 3.9 2.01(0.36) .Math. 10.sup.4 Parathion Malathion 5.56 1.26 7.7(5.94) .Math. 10.sup.2 4.20(0.49) .Math. 10.sup.2

(92) Among the phosphotriesterase selected variants, SsoPox sD6 exhibits the highest paraoxonase catalytic efficiency for ethyl-paraoxon, ethyl-parathion and methyl parathion. SsoPox sC6 exhibits the highest paraoxonase catalytic efficiency for malathion. Unlike SsoPox wt, SsoPox sA6, sB5, sC6 and sD6 are now able to hydrolyze methyl parathion.

(93) SsoPox sD6 is probably the most interesting variant of SsoPox for its capacity to hydrolyze several OPs substrates.

Example 2

(94) In this example, we tested whether the variant SsoPox W263I, which has an improved ability to hydrolyze 3-oxo-C12 AHLs could decrease P. aeruginosa biofilm formation and virulence factor production in vitro, and reduce mortality in vivo. We present evidence that lactonase-mediated quorum quenching inhibits virulence and decreases lethality of P. aeruginosa in a rat pulmonary infection model.

(95) 1Experimental Procedure

(96) 1.1P. aeruginosa Culture

(97) The laboratory strain PAO1 (ATCC reference 15692) was used in all experiments. Strains were grown in LB (BD, France) medium and were maintained at 80 C. in 50% LB broth and 50% glycerol. P. aeruginosa PAO1 carrying a chromosomally integrated PlasB-luxCDABE reporter construct [11] was maintained in the same way as the wild-type strain. Strains were grown at 37 C. in Luria-Bertani (LB) medium (BD, France) with shaking (200 rpm). LB was solidified with 1.5 bacto agar when required.

(98) For in vivo studies, at the time of the experiments, aliquots containing the bacteria were thawed and cultured on a COS (Biomerieux, France) (Columbia with 5% Sheep blood) agar plate. Ten fresh colonies were sampled and cultured overnight at 37 C. in triptych soy broth (TSB, Biomerieux, France) with continuous agitating until the OD.sub.600 nm=1 with cultured PAO1. Serial dilution was subsequently performed to adjust the bacterial amount and exact concentrations were confirmed by plating serial dilutions on the appropriate culture medium and counting colonies. Inoculums of 10.sup.8 CFU/ml were used for all animal infections.

(99) 1.2Biofilm Formation Assays

(100) Cultures of P. aeruginosa PAO1 (18 hours) were diluted 1:50 in 10% TSB and dispensed into the wells of a Calgary Biofilm Device 96 well plate (Innovotech Inc., Edmonton, Canada). To test inhibition of biofilm formation, three-fold dilution series (50 g down to 0.5 g of SsoPox W263I) was added to the wells. Plates were incubated for 4 hours with rocking at 120 Hz at 37 C. The biofilms were stained with 1% crystal violet. Crystal violet was dissolved from biofilms in 100% ethanol and quantified by measuring absorbance at 600 nm [14]. P. aeruginosa PAO1 planktonic growth was also measured at 600 nm.

(101) 1.3LasB Reporter System

(102) Aliquots of P. aeruginosa PAO1 carrying PlasB-luxCDABE from an 18 hr old culture were placed in wells of a 96 well plate, after which dilutions from 50 g to 0.05 g of SsoPox W263I were added. Plates were incubated at 37 C. for 90 minutes, with shaking every 10 minutes during which luminescence was measured every 10 minutes to determine activity of the quorum sensing reporter.

(103) 1.4Animal General Procedure

(104) Adult Sprague-Dawley male pathogen-free rats weighting 250 to 300 g from SAS Janvier (Le-Genest-St-Isle, France) were housed in individual plastic cages placed in a ventilated pressurized cabinet (A-BOX 160, Noroit, Rez, France) with free access to water and standard diet food. Animals were anesthetized with 5% Sevoflurane (Abbott, Rungis, France) in 100% oxygen (anesthetizing box, Harvard Apparatus, Les Ulis, France). Their trachea was exposed and intubated using a 16-gauge catheter for drug and/or bacterial administration. Awaken animals were housed back in the same condition as initially and were weighed daily. At the end of each experiment, euthanasia was performed with an intra-peritoneal injection of a lethal dose of thiopental (Panpharma, France).

(105) 1.5Rat Tolerance of Inhaled SsoPox W263I

(106) The tolerance of SsoPox administered by intra-tracheal route was attested in a preliminary study on 3 groups of animals (n=3 per group) receiving 250 l of SsoPox W263I at a concentration of either 0.1, 1 or 10 mg/ml and compared to 5 controls receiving 250 l of phosphate buffered saline (PBS; Biomerieux; France). One animal of each group was sacrificed after 6, 24 and 48 hours. Surviving animals were sacrificed after 48 hours. Lungs were removed after death and their macroscopic aspect was noted, then they were preserved in formaldehyde for histological assessment.

(107) 1.6Rat Respiratory Infection Model and SsoPox W263I Treatment

(108) Three groups of 20 animals were infected by intra tracheal inoculation of 250 l of a solution of PBS containing 10.sup.8 CFU/ml of P. aeruginosa PAO1. At the same time, a first group received 250 additional l of PBS into the trachea (non-treated group: NT), another group received 250 l of SsoPox W263I at a concentration of 1 mg/ml (immediate treatment group: IT). In the last group, animals received 250 l of SsoPox W263I at 1 mg/ml 3 hours later (deferred treatment group: DT). SsoPox W263I and additional PBS were delivered intratracheally using the same anesthetic procedure as for the infection.

(109) 1.7Lung Processing After infection, animals were observed for 2 days and spontaneous mortality was noted. Surviving rats were euthanized after 48 hours. After death, lungs were removed aseptically. Right lung was homogenized in PBS for bacterial culture. Left lung was preserved for histological analysis.

(110) 1.8Histological Severity Score (HSS)

(111) Examination was performed by a pathologist blinded to the group identity (H. L.). An HSS was calculated based on the number of bronchopneumonia lesions (0, no lesions; 1, 30 lesions/lung; 2, 30 lesions/lung; 3, confluent lesions of bronchopneumonia), as previously reported [13].

(112) 1.9Statistics

(113) The number of studied animals (20 animals per group) was calculated based on a mortality reduction from 80% in the NT group infected with PAO1 (known from literature data [12]) to an expected mortality rate of 50% in the treated groups, with 90% statistical power and a two-sided alpha value of 0.05.

(114) 2Results

(115) 2.1Decreases of lasB Expression and Biofilm Formation by SsoPox W263I

(116) We measured lasB transcription in a P. aeruginosa PAO1 strain carrying the chromosomally integrated PlasB-luxCDABE reporter construct. The gene lasB codes for elastase, a classical virulence factor regulated by quorum sensing. Addition of SsoPox W263I into P. aeruginosa PAO1 cultures significantly reduced lasB transcription (FIG. 4). SsoPox W263I-mediated lasB inhibition exhibited a dose-dependent profile with a half inhibition concentration ([C.sub.1/2]) of the enzyme around 0.5 g/mL (FIG. 4).

(117) Biofilm development is also regulated in part by quorum sensing. The effect of SsoPox W263I on the ability of P. aeruginosa to form biofilms was investigated. Our results show that the lactonase inhibits biofilm formation in a dose-dependent manner, with a [C.sub.1/2] of approximately 170 g/mL (FIG. 5).

(118) 2.2SsoPox W263I Protects Rats from P. aeruginosa PAO1 Pneumonia

(119) The effects of SsoPox treatment on rat respiratory tissues were investigated. Tracheal instillation of SsoPox W263I was well toleratedno spontaneous mortality was observed regardless of the dose administered (up to 2.5 mg). Lungs removed after treatment showed no macroscopic signs of injury and histological analysis showed normal lung parenchyma. SsoPox W263I caused no observable acute inflammatory reactions in the rat respiratory parenchyma.

(120) The influence of SsoPox W263I on P. aeruginosa pulmonary infection was investigated in two groups of 20 rats. In the non-treated group (NT), the mortality rate after inoculation with P. aeruginosa was 75% (15/20). When the rats were treated with SsoPox (1 mg/mL) immediately after inoculation with P. aeruginosa (IT), the mortality was significantly reduced to 20% (4/20) (p=0.0001 vs NT) (FIG. 6). In addition we observed that loss of body weight, measured from the day of inoculation with P. aeruginosa until the day of death, was significantly less in the IT group than in the NT group (11.312 g vs. 20.49.3 g respectively; p=0.01). The DT group lost 25.61.82 g of body weight (p=0.77 vs NT group). Moreover, mean time to death was significantly longer in the DT group as compared to the control group (3713 vs. 2516 hours; p=0.01).

(121) Consistent with the increased survival of the IT group, we noted that the lungs of the animals in the IT group had less inflammatory damage as compared to the NT group (FIG. 7): HSS (1.270.6 vs. 2.640.4; p=0.005). In the DT group, the mean HSS was not different from the NT group.

Example 3

(122) The ecotoxicity of SsoPox has been tested on the viability and development of oyster larvae (Crassostrea gigas) and sea urchins larvae (Paracentrotus lividus) during 24 hours and 48 hours respectively. Experiments have been done using 10 mg/l, 1 mg/l, 100 g/l, 10 g/l, 1 g/l or 100 ng/l of SsoPox and two samples of at least 100 larvae have been analyzed. CuSO4 has been used as a toxic control. In the case of the urchin larvae, no effects have been observed at any of the tested concentrations. In the case of the oyster larvae, no effects have been observed for a concentration equal or lower to 1 mg/L, only 10% of the population is affected at a concentration of 2.9 mg/L (sample 1) or 3.5 mg/L (sample 2). These results indicate that high concentrations of SsoPox are not toxic for living organisms and thus, the use of SsoPox in sea environment can be considered favorably.

REFERENCES

(123) 1. Hiblot J, Gotthard G, Chabriere E, Elias M (2012) Characterisation of the organophosphate hydrolase catalytic activity of SsoPox. Sci Rep 2: 779.

(124) 3. Studier F W (2005) Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 41: 207-234.

(125) 4. Gotthard G, Hiblot J, Elias M, Chabriere E (2011) Crystallization and preliminary X-ray diffraction analysis of the hyperthermophilic Sulfolobus islandicus lactonase. Acta Crystallogr Sect F Struct Biol Cryst Commun 67: 354-357.

(126) 5. Del Vecchio P, Elias M, Merone L, Graziano G, Dupuy J, et al. (2009) Structural determinants of the high thermal stability of SsoPox from the hyperthermophilic archaeon Sulfolobus solfataricus. Extremophiles 13: 461-470.

(127) 6. Hiblot J, Gotthard G, Chabriere E, Elias M (2012) Structural and Enzymatic characterization of the lactonase SisLac from Sulfolobus islandicus. PLoS One 7: e47028.

(128) 7. Hiblot J, Gotthard G, Chabriere E, Elias M (2012) Characterisation of the organophosphate hydrolase catalytic activity of SsoPox. Sci Rep 2.

(129) 8. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins M R, et al. (2005) Protein Identification and Analysis Tools on the ExPASy Server. In: Walker J M, editor. The proteomics protocols handbook: Humana Press.

(130) 9. Copeland R A (2000) Enzymes, A Practical Introduction to Structure, Mechanism, and Data Analysis. New York, Chichester, Weiheim, Brisbane, Singapore, Toronto: WILEY-VCH. 390.

(131) 10. Ashani Y, Gupta R D, Goldsmith M, Silman I, Sussman J L, et al. (2010) Stereo-specific synthesis of analogs of nerve agents and their utilization for selection and characterization of paraoxonase (PON1) catalytic scavengers. Chem Biol Interact 187: 362-369.

(132) 11. Darch S E, West S A, Winzer K, Diggle S P (2012) Density-dependent fitness benefits in quorum-sensing bacterial populations. Proc Natl Acad Sci USA 109: 8259-8263.

(133) 12. Lesprit P, Faurisson F, Join-Lambert O, Roudot-Thoraval F, Foglino M, et al. (2003) Role of the quorum-sensing system in experimental pneumonia due to Pseudomonas aeruginosa in rats. Am J Respir Crit Care Med 167: 1478-1482.

(134) 13. Marquette C H, Wermert D, Wallet F, Copin M C, Tonnel A B (1999) Characterization of an animal model of ventilator-acquired pneumonia. Chest 115: 200-209.

(135) 14. O'Toole G A, Kolter R (1998) Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol 28: 449-461.