LINCOMYCIN BIOSYNTHETIC INTERMEDIATES, METHOD FOR PREPARATION, AND USE THEREOF

20180251486 ยท 2018-09-06

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided in the present invention are a class of Lincomycin biosynthetic intermediates and a preparation method and use thereof. Specifically provided are Lincomycin biosynthetic intermediates obtained from the genetic modification of a Lincomycin producing bacterium, and a method for the production thereof through fermentation and purification through separation.

    Claims

    1. A compound and a pharmaceutically acceptable salt thereof, wherein the structure of the compound is shown in formula I: ##STR00016## wherein in formula I, R.sub.1 is selected from a group consisting of H, halogen, C.sub.1-8alkyl, C.sub.2-8 s alkenyl, C.sub.2-8 alkynyl and ##STR00017## wherein R.sub.3 is selected from a group consisting of H, halogen and C.sub.1-8 alkyl; R.sub.2 is selected from ##STR00018##

    2. The compound of claim 1, wherein R.sub.1 is selected from a group consisting of H, C.sub.1-4 alkyl and ##STR00019##

    3. The compound of claim 1, wherein the structure of the compound is shown in formula Ia: ##STR00020## wherein in formula Ia, R.sub.1 and R.sub.2 are described as above.

    4. The compound of claim 1, wherein the structure of the compound is of any of formula I1-I5: ##STR00021##

    5. Use of the compound of claim 1, or a pharmaceutically acceptable salt thereof as a raw material for preparing n-propyl proline, disaccharide GlcN-Ins, Mycothiol or ergothione.

    6. A composition comprising a compound of claim 1, or a pharmaceutically acceptable salt thereof, and an optional carrier.

    7. A microbial strain, wherein the microbial is Streptomycin lincolnensis, and in the strain, one or more genes selected from a group consisting of the following have been inactivated or knocked out: lmbE, lmbE3457, lmbV, mshA, mshC, lmbC, lmbD, lmbN, and lmbF.

    8. The strain of claim 7, wherein in the strain, lmbE and/or lmbE3457 genes are inactivated or knocked out; and/or the lmbV, mshA and/or mshC genes are inactivated or knocked out; and/or the lmbC, lmbD and/or lmbN genes are inactivated or knocked out; and/or the lmbF gene are inactivated or knocked out.

    9. A preparation method of an intermediate compound, wherein the method comprises the following steps: (a) Using the compound of claim 1 or a pharmaceutically acceptable salt thereof as a raw material for hydrolysis reaction to produce the intermediate compound, wherein the compound or a pharmaceutically acceptable salt thereof is derived from a fermentation product of Streptomyces lincolnensis.

    10. The method of claim 9, wherein in the step (a), one or more selected from a group consisting of the compounds of Formula I1, Formula I2, and Formula I5 are subjected to hydrolysis reaction to generate n-propyl proline compound.

    11. The method of claim 9, wherein in the step (a), one or more selected from a group consisting of the compounds of Formula I1 and Formula I3 are subjected to hydrolysis reaction to generate disaccharide compound GlcN-Ins.

    12. The method of claim 9, wherein in the step (a), one or more selected from a group consisting of the compounds of Formula I2 and Formula I4 are subjected to hydrolysis reaction to generate ergothioneine.

    13. A preparation method for Mycohiol, wherein the method comprises the following steps: (1) Preparing disaccharide compound GlcN-Ins (a) Using the compound of claim 1 or a pharmaceutically acceptable salt thereof as a raw material for hydrolysis reaction to produce the disaccharide compound GlcN-Ins; (2) Chemically Synthesizing Mycothiol from GlcN-Ins.

    14. A preparation method for compound of claim 1, wherein the method comprises the following steps: (a) fermenting a microbial strain, wherein the microbial is Streptomycin lincolnensis, and in the strain, one or more genes selected from a group consisting of the following have been inactivated or knocked out: lmbE, lmbE3457, lmbV, mshA, mshC, lmbC, lmbD, lmbN, and lmbF to produce the compound of claim 1; and (b) isolating the compound of claim 1 from the fermentation product; and optionally converting the compound into a pharmaceutically acceptable salt thereof.

    15. A method for non-therapeutically inhibiting the growth of microorganisms or killing microorganisms in vitro, comprising the step of using the compound of claim 1, or a pharmaceutically acceptable salt thereof in a place in need thereof.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0057] The following figures are intended to illustrate specific embodiments of the present invention and are not intended to limit the scope of the present invention.

    [0058] FIG. 1 shows the results of electrophoresis of an in frame knockout mutant of a lincomycin-producing strain. FIG. 1a, lmbE knockout mutant; FIG. 1b, lmbE-E3457 double knockout mutant; FIG. 1c, lmbV knockout mutant: FIG. 1d, mshA knockout mutant; FIG. 1e, lmbC knockout mutant; FIG. 1f, lmbD knockout mutant; FIG. 1g, lmbF knockout mutant.

    [0059] FIG. 2 shows the results of HPLC-MS detection of the fermentation broth of the in frame knockout mutant of a lincomycin-producing strain, showing the production of lincomycin A and compounds 1-5 in each mutant.

    [0060] FIG. 3 shows the results of NMR analysis of compound 1, FIG. 3a, 1H NMR spectrum; FIG. 3b, 13C NMR spectrum; FIG. 3c, DEPT135 NMR spectrum; FIG. 3d, COSY NMR spectrum; FIG. 3e, HSQC NMR spectrum; FIG. 3f, HMBC NMR spectrum; FIG. 3g, NOESY NMR spectrum.

    [0061] FIG. 4 shows the results of NMR analysis of compound 2, FIG. 4a, 1H NMR spectrum; FIG. 4b, 13C NMR spectrum; FIG. 4c, DEPT135 NMR spectrum; FIG. 4d, COSY NMR spectrum; FIG. 4e, HSQC NMR spectrum; FIG. 4f, HMBC NMR spectrum; FIG. 4g, NOESY NMR spectrum.

    [0062] FIG. 5 shows the results of NMR analysis of compound 3. FIG. 5a, 1H NMR spectrum; FIG. 5b, 13C NMR spectrum; FIG. 5c, DEPT135 NMR spectrum; FIG. 5d, COSY NMR spectrum; FIG. 5e, HSQC NMR spectrum; FIG. 5f, HMBC NMR 50 spectrum; FIG. 5g, NOESY NMR spectrum.

    [0063] FIG. 6 shows the results of NMR analysis of compound 4. FIG. 6a, 1H NMR spectrum; FIG. 6b, 13C NMR spectrum; FIG. 6c, DEPT135 NMR spectrum; FIG. 6d, COSY NMR spectrum; FIG. 6e, HSQC NMR spectrum; FIG. 6f, HMBC NMR spectrum; FIG. 6g, NOESY NMR spectrum.

    [0064] FIG. 7 shows the results of NMR analysis of compound 5. FIG. 7a, 1H NMR spectrum; FIG. 7b, 13C NMR spectrum; FIG. 7c, DEPT135 NMR spectrum; FIG. 7d, COSY NMR spectrum; FIG. 7e, HSQC NMR spectrum; FIG. 7f, HMBC NMR spectrum; FIG. 7g, NOESY NMR spectrum.

    [0065] FIG. 8 shows the results of NMR analysis of n-propyl proline, FIG. 8a, 1H NMR spectrum; FIG. 8b, 13C NMR spectrum; FIG. 8c, DEPT135 NMR spectrum; FIG. 8d, COSY NMR spectrum; FIG. 8e, HSQC NMR spectrum; FIG. 8f, HMBC NMR spectrum; FIG. 8g, NOESY NMR spectrum.

    [0066] FIG. 9 shows the results of NMR analysis of the disaccharide compound GlcN-Ins, FIG. 9a, 1H NMR spectrum; FIG. 9b, 13C NMR spectrum.

    [0067] FIG. 10 shows NMR analysis of ergothioneine, 1H NMR spectrum.

    EMBODIMENTS FOR CARRYING OUT THE INVENTION

    [0068] After extensive and intensive studies, the present inventors obtained a mutant strain of Streptomycin lincolnensis by cloning of a lincomycin biosynthetic gene cluster and gene knockout. The in vitro biochemical activity of the proteins related to the biosynthesis of lincomycin was studied. The biosynthesis mechanism of lincomycin was studied in vitro and in vivo. Surprisingly, it was discovered that certain strains of Streptomycin lincolnensis mutants produced new compounds, and then the compounds were isolated and identified through extensive fermentation. The present invention is completed on this basis.

    [0069] Active Ingredients

    [0070] As used herein, the terms active ingredient of the present invention, compound of the present invention and lincomycin biosynthesis intermediate of the present invention are used interchangeably and refer to lincomycin biosynthesis intermediate such as compounds of formula I.

    [0071] It should be understood that the term also comprises the crystal forms, pharmaceutically acceptable salts, hydrates or solvates of the compound of the present invention.

    [0072] In a preferred embodiments of the present invention, the term C.sub.1-8 alkyl refers to linear or branched alkyl with 1 to 8 carbon atoms, such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, or similar groups.

    [0073] In a preferred embodiment of the present invention, the term C.sub.2-8 alkenyl refers to a straight or branched alkenyl group having 2-8 carbon atoms such as ethenyl, propenyl, 1,2-butenyl, 2,3-butenyl, butadienyl, or similar groups.

    [0074] In a preferred embodiment of the present invention, the term C.sub.2-8 alkynyl refers to an alkynyl group having 2 to 8 carbon atoms, e.g., ethynyl, propynyl, iso-alkynyl group, butynyl group, alkynyl isobutyl, sec-butynyl, t-butynyl group, or the like.

    [0075] In a preferred embodiment of the present invention, the term halogen refers to F, Cl, Br and I.

    [0076] As used herein, the term pharmaceutically acceptable salt refers to a salts suitable for use in pharmaceutics formed by the compound of the present invention with an acid or base. The pharmaceutically acceptable salt includes inorganic and organic salt. A preferred type of salt is a salt formed by the compound of the present invention and acid. A salt can be formed from a cation and a charged group (e.g., an amino group) on a compound of the present invention. Suitable cations include hydrogen ions, sodium ions, 50 potassium ions, magnesium ions, calcium ions, and ammonium ions. Bases suitable for salt formation include, but are not limited to, hydroxides of alkali metal and alkaline earth metal (such as NaOH, KOH), oxides of alkali metal and alkaline earth metal, carbonates of alkali metal and alkaline earth metal (such as Na.sub.2CO.sub.3), ammonia, and so on.

    [0077] In a preferred embodiment of the present invention, the compound structure is as follows:

    ##STR00007##

    [0078] The compound of the present invention can be used as a structural analog for preparing other lincosamide antibiotics and used to produce downstream products such as n-propyl proline, disaccharide compound GlcN-Ins, and/or ergothioneine through hydrolysis.

    [0079] In a preferred embodiment of the invention, n-propylproline is prepared by hydrolysis of compound 1, 2 or 5.

    [0080] In a preferred embodiment of the present invention, the process for preparing n-propylproline (PPL) is as follows:

    ##STR00008##

    In a preferred embodiment of the present invention, the disaccharide compound GlcN-Ins is prepared by hydrolysis of compound I or 3. GlcN-Ins can be used as a raw material to synthesize Mycothiol (the chemical synthesis method refer to: Org. Lett. 6, 365-368, 2004; Org. Lett. 12, 2630-2633, 2010).

    [0081] In a preferred embodiment of the present invention, the disaccharide compound GlcN-Ins is prepared by the following steps:

    ##STR00009##

    [0082] In a preferred embodiment of the invention, erythrothioneine is prepared by hydrolysis of compound 2 or 4.

    [0083] In a preferred embodiment of the present invention, the erythrothioneine is prepared by the following steps:

    ##STR00010##

    [0084] Starting Strain

    [0085] As used herein, the term starting strain of the present invention or starting microorganism of the present invention refers to Streptomycin lincolnensis with the number NRRL ISP-5355. The starting strain of the present invention is stored in the Agricultural Research Service Culture Collection (NRRL), numbered Streptomycin lincolnensis NRRL ISP-5355. It should be understood that the starting strain includes not only the strain numbered Streptomycin lincolnensis NRRL ISP-5355 but also its derivative strains.

    [0086] Engineered Strains

    [0087] The invention also provides engineered strains that can be used to produce the compounds of the invention.

    [0088] In a preferred embodiment of the present invention, several mutant strains of Streptomycin lincolnensis that produce the lincomycin biosynthesis intermediate of the present invention are provided.

    [0089] Preparation of Active Ingredients

    [0090] The present invention provides a method for preparing a compound of formula I, comprising the steps of:

    [0091] Fermenting the genetically modified strain of Streptomycin lincolnensis;

    [0092] Extracting the compound of formula I from the culture medium.

    [0093] The strains are discarded by centrifugation, and the supernatant liquid is adsorbed by macroporous resin, washed with distilled water, and then soaked in methanol. The macroporous resin was removed by filtration. The filtrate is concentrated under vacuum and dried, and the obtained paste is firstly roughly separated on a gel column, further purified with HPLC preparation to give the desired product.

    [0094] Functional Gene

    [0095] As early as 1995, Peschke et al. obtained a 35 kb lincomycin biosynthesis cluster by chromosome walking in S. lincolnensis 78-11 using three lincomycin resistance genes IprA, lprB and llmC [Mol Microbiol. 1995, 16(6):1137-1156]. The Janata team in Czech also cloned a 38217-bp lincomycin biosynthetic gene cluster in a low-yield strain of lincomycin S. lincolnensis ATCC 25466 in 2008. By bioinformatics analysis, the gene cluster contains 30 reading frames (ORF), consisting of 27 putative biosynthetic and regulatory genes (lmb) and 3 resistance-associated genes (lmr). Heterologous expression in S. coelicolor M145 and S. coelicolor CH 999 confirms that the gene cluster includes a complete gene associated with lincomycin synthesis [Folia Microbiol. 2008, 53(5): 395-401]. However, when aligning each gene product with the known protein sequence by sequence analysis, it is found that for several genes, homologous proteins can not be found at all, thus being impossible to infer the function. Even if the possible functions can be inferred from the homologous protein comparison, the functions of most genes in the biosynthesis of lincomycin are still unknown.

    [0096] Preferably, the lincomycin biosynthetic gene cluster involved in the present invention can be found in [Folia Microbiol. 2008, 53(5):395-401].

    [0097] In a preferred embodiment of the present invention, the polynucleotide sequence of lmbE gene is as follows:

    TABLE-US-00001 (SEQIDNO.:1) ATGACTCAGTGCCTGCTGACCGTCCACGCGCACCCGGACGACGAGGCCTC CCGCGGCGGCGCCACGGTCGCCCACTACACCGCGCAGGGCGTCCGCGCCG TCCTGGTCACCTGTACCGACGGCGGCGCCGGCGAGGTGCTCAACCCCGCC GTCACCGACGACTTCACCCCCGAACGGTTCGTCGCCGTCCGCAGCGCCGA ACTCGACGCCAGCGCACGGAACCTGGGCTACTCGGCCGTGCACCGGCTCG GCTACCGCGACTCCGGCATGGACGGCACGGCGGGCGGCGCCGAGGCCTTC GTACGGGCCCCGCTCGACGAGGCCGCCACCCGCCTCGCCCGGGTGATCGC GGACGAACGCCCCGACGTGGTGATCGGATACGGCACCAACCACACCCGCG ACCCGCACCCCGACCACATCCGCGCGAACGAAGTGCTGACGCGCGCCGTC GACCTCCTCGACCACACACCCGCCGTCTACCACATCGCCTTCTCGCGACG TCGCCACCGCGCCTTGCACCAGGCCTGCGTCGACAGCGGGGTGCCCAGCC CGTACGAGGGCGGCCTGAGCGCCCCGCCGGGCGCCTTCGACGACGAGTGG ATCACCACACTCGTCGACGTGACCAAGGGCGACGCCGTCGAGCGCAGGCT CGACGCGCTGCGCAGTCACGTGACCCAAGTACCGCCCGCCTCCGGCTGGT TCGCGCTGTCACCGCAGCAGCTGCGGGACGCCTTCCCGTACGAGGAGTAC ACCCGCGTCGGCGCCGCGCCCCGGGAAGCCGTGGTGCACGACCTGTTCAC CGCTCCCGCGTGA

    [0098] In a preferred embodiment of the present invention, the polynucleotide sequence of lmbE3457 gene is as follows:

    TABLE-US-00002 (SEQIDNO.:2) ATGGCCGTGCACGCCCACCCCGACGACGAGTCGAGCAAGGGCGCGGCCAC CATGGCGAAGTACGTGTCCGAGGGGGTGGACGTGCTGGTCGTGACCTGCA CGGGAGGGGAGCGCGGCTCCATCCTCAACCCCAAGCTCCAGGGGGACGCG TATATCGAGGAGCACATCCATGAGGTGCGCAAGAAGGAGATGGACGAGGC GAGAGAGATCCTCGGCGTCAAGCAGGAGTGGCTCGGGTTCGTCGACTCGG GCCTGCCCGAGGGGGACCCGCTGCCGCCGCTGCCGGAGGGCTGTTTCGCC CTGGAGGACGTCGACAAGGCGGCCGGTGAGCTGGTGAAGAAGATCCGCTC GTTCCGTCCCCAGGTGATCACCACCTACGACGAGAACGGCGGCTACCCGC ACCCCGACCACATCATGACCCACAAGATCTCGATGGTGGCGTTCGAGGGT GCCGCGGACACCGAGAAGTACCCGGAGCAGGAGTTCGGCCCCGCGTACCA GCCGCAGAAGATCTACTACAACCAGGGCTTCAACCGTGAGCGCACCGAGG CCCTGCACAACGCGCTGGTCGAGCGCGGCCTGGAGTCCCCCTACGGCGAC TGGCTCAAGCGCTGGGAGGAGTCCGGGATGCAGCAGCGGACGCTCACCAC GCACGTCCCGTGTGCCGAGTTCTACGAGATCCGCGACAAGGCCCTGATCG CCCACGCCACGCAGATCGACCCCGACGGCGGCTGGTTCCGGGTGCCGCTG GATCTCCAGAAGGAGGTCTGGCCGACCGAGGAGTACGAGCTCGCGAAGTC CCTCGTCGATACTTCCCTCCCCGAGGCGGACCTCTTTGCGGGCATCCGCG ACAATGCCTGA

    [0099] In a preferred embodiment of the present invention, the polynucleotide sequence of lmbV gene is as follows:

    TABLE-US-00003 (SEQIDNO.:3) TTGCAGCGCAAGGGACTGGCCCGGCTCGGGTCGGGTGTCACGGCACTGGC CGACGAGGGAAGACACCTGCGGGCCTGGCTCACGAGCGCCGACGCGGCGG CGTGGCGACGGCCCACACGCTGTGCGGAGTGGAACGTCCGGGACGTCGTC GCGCACCTGGCGAGCGGCGAGCTGTACAACCAGGCATGCGTGCACGACGA CATCGCCTCGCTCGGCGAGTGGGCCGACGACGAGGCGTACAACGTCGGCC AGGTGGAGATGCGCCGCCACCTGAGCCACCGCGACGTCTTCGCGGAGTGG GACGAGCGCCACCGGGACGTGGTGGCCGCCTGGGGGGCCATGGACCCGGC CGACCCGCTCACCACGAGCTGGGGACCGTACCTGGTCGGCCTGCAGGCGT GGCACATCGCGTCGGAGTACGCGACCCACGCCGACGACATCGGGGTCCCC GTCCCCGCGGAGCGGGCCGCCTCCCGGCTCGACTGGCGCCTCGCCTTCTC CCAGTACGCGGTCGAGGAGTGCGAGCTGGGCCTTACGGTCGAGCCCGCCG AGGGCGACAGTGTGCTCGTGCGGGACGGGGCCGGGGCCGGGGCCGAACTC GTACTGACCCGTGAGCAGTTCGTGGCCGCGGTCAGCGCCCGGCTGCCGTA CGACGCCGTCGCCGACGACCCCGCCGTTCACGCGCTGCTACGGCGCATGA CGGTGCTGGTGGGGCCGTGA

    [0100] In a preferred embodiment of the present invention, the polynucleotide sequence of mshA gene is as follows:

    TABLE-US-00004 (SEQIDNO.:4) GTGAGCCAGTACGTCAGCAGGCTCCAGCGTCGCTCCCAGGCCGCCACCCC CCGGCTGCGCCTGCACCGCCGCCCCCGCCGCGTCGCCATGCTCTCCGTGC ACACCTCGCCGCTGCACCAGCCGGGCACCGGCGACGCGGGCGGCATGAAC GTCTACATCGTGGAGCTCGCCCAGCGCCTCGCCGCGATCAACATCGAGGT GGAGATCTTCACGCGGGCGACCACCGGCGGACTCCCGCACTCGGTCGAGC TCGCCCCGGGCGTCCTCGTCCGGCATGTCGACGCCGGCCCGTACGAGGGC CTGGCCAAGGAGGAGCTGCCCGCGCAGCTGTGCGCCTTCACGCACGGCGT GATGCAGGCGTGGGCGGGCCACCGCCCCGGCTACTACGACCTGGTGCACT CGCACTACTGGCTTTCCGGCCACGTCGGCTGGCTCGCCGCCCAGCGCTGG GGCACCCCCCTGGTGCACGCCATGCACACCATGGCCAAGGTCAAGAACGC CAACCTGGCCGACGGCGACACCCCCGAGCCCGCCGCCCGTGTCATCGGCG AGACCCAGATCGTCGCCGCAGCGGACCGCCTCATCGCCAACACCGCCGAG GAGCGCGACGAACTCGTACGGCACTACGCCGCCGACCCCGACAAGGTCGC GGTCGTGCACCCCGGCGTGAACCTCGACCGCTTCCGCCCCGCCGACGGCC GCGCGGCCGCCCGCGCCCGCCTCGGGCTGCCCCAGGACGCCCTGATCCCG CTGTTCGCGGGCCGCATCCAGCCCCTGAAGGCCCCCGACGTGCTCCTGCG CGCCGTGGCGGTCCTCCTGGACGAACGCCCCGACCTGCGCTCCCGCCTCC TCGTCCCGGTCGTCGGCGGTCTCAGCGGCAGCGGCCTCGCCAAGCCGGAG GGCCTCCAGAAGCTGGCCTCCCGCCTCGGTATCGCGGACGTCGTACGGTT CCACCCGCCCGTCGGGCAGGAGCAGCTCGCCGACTGGTTCCGGGCCGCCT CCGTGCTCGTCATGCCGTCGTACAGCGAGTCCTTCGGACTGGTCGCCATA GAGGCGCAGGCGGCCGGCACCCCCGTGCTCGCGGCCGCGGTCGGCGGACT CCCGGTCGCCGTCCGCGACGGGCAGACCGGTTTCCTCGTACGAGGGCACA ATCCCGCCGACTACGCGCGCGTGCTGCGCGACTTCGCCGACAGCCCCGAG CTCGCGCCCCGCATGGGCGAGGCCGCCGCCCGGCACGCCGAGTTCTTCGG CTGGGACACCGCGGCCGCCGCCACCGCCGACGTCTACACGGCCGCGACCC AGTCGCACCGCCGTCACGTACGCTCCCACCATGGGTGA

    [0101] In a preferred embodiment of the present invention, the polynucleotide sequence of mshC gene is as follows:

    TABLE-US-00005 (SEQIDNO.:5) ATGCATGCCTGGCCCGCTTCCGAGGTCCCCGCCCTGCCTGGTCAGGGCCG CGACCTGAGGATCCACGACACCGCGACCGGCGGCCTCGTCACCCTCACCC CCGGTCCCGTCGCCCGTATCTACGTCTGCGGCATCACGCCGTACGACGCG ACCCACATCGGTCACGCGGCGACCTACAACGCGTTCGACCTCGTGCAGCG CGTGTGGCTCGACACCAAGCGGCAGGTCCACTACGTCCAGAACGTCACCG ACGTCGACGATCCGCTCCTGGAGCGGGCACAGCGCGACGCCATCGACTGG GTCGCCCTCGCCGAGAAGGAGACCGCCCTCTTCCGCGAGGACATGACCGC CCTGCGGATGCTGCCCCCGCGGCACTACATCGGCGCGGTCGAGGCGATAC CCGGCATCGTGCCGCTCGTCGAGCGGCTGCGGGACGCGGGCGCCGCGTAC GAACTCGAAGGGGACGTGTACTTCTCCGTCGAGTCCGATCCGCACTTCGG CGAGGTCTCCGGCCTCGACGCCGCCGCCATGCGGCTGCTGTCCGCCGAGC GCGGCGGCGACCCCGAGCGGCCCGGCAAGAAGAACCCGCTCGACCCGATG CTGTGGATGGCCGCCCGCGAGGGCGAGCCCAGCTGGGACGGCGCCTCGCT GGGGCGCGGCCGGCCGGGCTGGCACATCGAGTGCGTCGCGATCGCCCTCG ACCACCTCGGGATGGGCTTCGACGTCCAGGGCGGCGGCTCCGACCTCGCC TTCCCGCACCACGAGATGGGCGCCTCGCACGCCCAGGCGCTGACCGGCGA GTTCCCCATGGCCACGGCGTACGTCCACGCCGGCATGGTCGCCCTCCACG GCGAGAAGATGTCCAAGTCCAAGGGCAACCTGGTCTTCGTGTCGCAGCTG CGCCGCGAGGGCGTCGACCCCGCCGCCATACGGCTCGCGCTGCTCGCCCA CCACTACCGGGCCGACTGGGAGTGGACCGACCAGGTGCTGCGGGACGCCG TCGACCGCCTCGGCCGCTGGCGTGCCGCGGTCTCCCGGCCCGACGGCCCG TCCGCCGAGGCCCTCGTCGAGGAGATCCGCAAGGCGCTCGCCGACGACCT GGACGCCCCGGCCGCCCTGGCCGCGGTCGACCGCTGGGCCGCCTCGCAGG AGGAGCACGGCGGCACCGACATCGGCGCGCCGGGCGTGGTGACACGAGCG GTGGACGCGCTGTTGGGCGTGGCCCTGTGA

    [0102] In a preferred embodiment of the present invention, the polynucleotide sequence of lmbC gene is as follows:

    TABLE-US-00006 (SEQIDNO.:6) ATGTCGTCCTCCGTTCGACTCTCCACACTCCTCGCCTCGGCCGCCGAGGC GAGGCCCGAGGCCCCCGCCGTCCTGGGGGAGACCCGGCTCCCGGTCACCT ATGGGGAGCTGGCCGCGCGGGCGGGCGGCATCCAGGCCGCCCTGGCAGGC CTGGGGGTGCGCGCCGGTGACCGGGTAGCGCTGCTGTCCGGGCGGACCGA CGCGGACGCCGTGGCCGCGGTGCACGCGATCCTGGCCGCGGGCGCCGTGT ACGTGCCGCTCGACGCCGCGTCGCCGCCCGCGCGGTGGGCTTCGGTGAGC CGGGTCTGCGCGCCCACCGCCGTGGTGGGCGAACGCGCGCTGCTCGACCG GTTCGCCGCCGCCGTACCGGGGCCGCGGCGGCTCGCCCTGCCATCGGACG GGGACGAGCTGCCCGCGGGCCGCCTCGACCCCGTCCGGAGCGACGGCACC GATGTCGCGTACCTGCTCACCACCTCCGGCTCCACCGGCGTTCCCAAGTG CGTGGCCCACACCGGTGCGGGCGCCGTCGCCTTCCTGGAGTGGATGGTCG GCGCGTTCCCGGTGGGCGGCGACGATGTGTTCGCCTGCCACGCCCCGCTG CACTTCGACGTGTCGGTGGCCTCGGTGCTCGGCTCCGCGCTGGGCGGCGC GGCCCTGGCCCCGGTGCCCCGTGAACTGTCCGGGTTTCCCGTCGAGCTGG CCACCTGGATCGCCGAACGCGCCGTCACCGTATGGCTCTCCGTGCCCTAT CCGCTCGCCCGCCTGTCCGGACTGGAGGAGCGGGCCGCGCGTGAGCGCCT CGCCACCTTGAGGACGGTCGTGTTCGCCGGTGACGTCTTTCCGCACCAGC GGCTCGCCGCACTGATGCGCTGCGCGCCCGGGGCCCGGTTCCTCAACATC TACGGCCCGACCGAGACCAACGGCTGTACGTACGAGGTCGTGGACGCCCC GCCCGCCGGCCCCGTGCCCATCGGCCGGCCCGTCGAGTGCGCCGAGTGCT GGGTCGAGGACGACGACGGGCGGCCGGTCGACGCGGTGGGGTCGGTGGGT GAACTCGTCGTCGCGGGGCCCACGGTGGCCGCCGGATACTGGGGCGTCGA GGGGCACGGAGCCGAGCGGTTCCGCACGGGGGAGACCTGTCCGGGCGGCC GGGCCTACGCCACCGGGGACCAGGTCCGCGTCCTGCCCGGGGGCCGGTAC GCCTTCCTCGGCCGCATGGACAACATGATCAAGATGCGCGGGCAGCGGTT CGAGCTGGAGGAGGTGGAGAACGCTGTACGGCTCGCTCCCGGCGTCGAGG ACTGCTGCGTGGTGAAGGTGGACGTCCGCGACGATCACTCCCGCCTCCTC GCCGTCGTGGTCGGGCCCGGCGCCGGCGACCCGCGCACCCTGCGCGAGCA CTGCCTGACCAGGCTGCCGTCGTGGGCGGTGCCGCACCGGTTCCTCACGG CCGCCGCGCTGCCCCTGGGCTCCACCGGCAAGGTGGACCGCCGCGCGCTC AGGGAGGAACTCGTCACACGCGGGGAGTGA

    [0103] In a preferred embodiment of the present invention, the polynucleotide sequence of lmbD gene is as follows:

    TABLE-US-00007 (SEQIDNO.:7) ATGGCGGTATCACCCCAGTCGGTTCGGTTGCCGGAACACGCGCCGCA CTGCGAGATCGGCTGCGCGGCGAACGTGGCGAAGAGGGTCGGTGTCGACT TCCCGCGGCACGTGGCCGGGTCCCAGTGGGCGCTGCGCACCTTCGTCCGG GAGCCCGGCGACATCCCGCAGCCCATGCTGGACCGCACGCATCTGACGTT CGGCGCGCACGGCGAGGGCTGGCCCACCGCCCTCGCGGGGATCACGGACG GCACCGTGCACGACCGCCGGGTGGCGCGTTCGGAGCTCCCGGAGGTGCTG CGGGACGACCTCGCCCGGGGCGGCAGTCTGCTGTTCCTGGAGGACCGCGG CTGCCCATGGCTGCACTCCGCCGGCCCCGGGCTGCTGCCGCACACGGTGA CCCCGGACGGTGTCGACGCGGCCGGGGTCTGGCAGCTGATCGAGGGGCAC AGCTGGTGGGCGGGCCGGTACCCGATGGCGGAGGCCGACCTGCTGGCCGC GGCCTACCCGGACCCCGACCCGCACCATGTGGCGGGCCGGGTCCTGAGCC TGCGTCTGGCCCTGACGCCCGAGCGTCGCGCGGCCCTGGACGCCCTCGCC CTGGACCGGCTGCGGGACAGCGTGCGCGCCTACCTCACGGGGGGCGACGG CCGGCTCGACACCCCGGCGGGCACGCTGGTGTGGACGGACGGGCAGGCGG CGGTCGCGGAACTGCTGGACCGGCTGCGGGGCTGGGAGTACCTGTGCGCG CTCGCCGCCGACGACGGGGCCGGCGTCGAGCAGGGCATCGACATCGCCGT GGGCCGGTATCTGTTCCTGGGCCTGGCGGACGAGCTGGCCTACACGTCGT ACGCCCGCGCGGGCGCCCGGCGCCTGACCCGACGCCTCGGCGCTCTCGCG GACATCGGCGACGAACACCTCCCCGACGTGGTGTGGCAGCGGGCGTGGCG CAGCGCCCAGCGGTTCTACCGGTCGCTGCGCGCGGAGCACTTCGACGCCC TGTTGCACGACATCGACGCGGCGGGGGTGGCCGACGCCGCTTGTGCGCGC CGGCTCGCGGAGGTCCTGTAG

    [0104] In a preferred embodiment of the present invention, the polynucleotide sequence of lmbN gene is as follows:

    TABLE-US-00008 (SEQIDNO.:8) GTGAGCACTCTGGACGAGGTCCTCGCCCTGCTCCGCACCATCGCGCC GAGCGGCGACGAGACCGAACTCACCGCCGACACCCTCCTGTTCAGCTCCG GCCTGCTCGACAGTCTCGCCCTGGAGGAGCTGCACGTCGCCATCGAGGAG CGCTGGGCGCCCATCCCACCCATGGAACTGGCGCGGGCGAACTTCGACAC CCCGGCCGCCATCGCCGCGACGGTGGCCCGTATCACCCATGAGGAGACCC CTGTGAGTGTTGTGAGGAACCTCCTGTCCGACTCGGGCCGGCTGACCGCC GACCTCGCACCGGACGCTATCGAGCGCGGTGCGCAGCTGCTCTTCGACAC CTGGCACGCCGGCGGCACCACCCTGTCCTGCGGCAACGGCGGCTCGGCCT CGACCGCCTCCCACTTCGCCGCCGACCTCGCCAAGCTCACCATCGTGCCC GGACAGCGCCGCATGCGGACGCTGTGCCTGAACGACAACGCCTCCGCGTT CTCGGCGTGGACCAACGACGAGGGCTTCCCCGTCGTCTACCGGGAGCAGG CCGAGCCCTGGCTGGAGCCCACCGCCACTCTGGTCGCGTTCTCCGTGCAC GGCGGCTCCCGCGGGGGCGAAGTGTCGGCGAACCTGCCCGCCGTCGCCCG CCTCGCCAAGGAACGCGGCGCCGCCGTGGTCGCGGTCACCGGCTTCGACG GCGGCGCCCTCGGCGACCTCGCGGACGTCCACATCAACATCCCGCACGCC ACCGAGCCCGTGGCGACCCCGCTGATCGAGTCGCTGCACGTCCTCGTCCA CCACGCCCTGTGCGTCGGCGCACGCGCCCTGATCCTGGAGAAGGCGGGGG AGCCGGCATGA

    [0105] In a preferred embodiment of the present invention, the polynucleotide sequence of lmbF gene is as follows:

    TABLE-US-00009 (SEQIDNO.:9) ATGACCGCCACGGCGAGCGGCGCGCAGACCGCCGCACCGGAACGGCT CACCGACGACGGCTGGCTGATCCGGCGCACATCCGTCGACACCGTCCGCC CCTTCGACGACCCGAGCGCCCAGTGGATGCTGGACCGCGCCCAGGCCCGT CTGCCGCTGTACCTGCTGCACGTCGCCGACCACGCGGAGGCCACGCCGCC CGGACTGCGCGAGGCCCTGCACGCCCAGGACGCGGCCCCCTGCGACGGCC TGCTGTTCTCCCAGTACGGCCTGCCGGAGCTGCGCCGGCGGCTCGACGCC TGGCTCGCCGCCGACGAGGAGTGGGACACCGCGGCGGAGCCGCTCGTCAG CGTCGCGTGGTCGGGCACCGGCGCGGCCATCTTCGACCTGCTGCGCATGC TCAAGGACGGCCGCCCGGGCCCCAGCGCCGTGCTGCTGCCGCGCCCCGGG TGGGGATATGACATGTCGGTGCGCGACACCGGACACGTACCGGTGAGTTA CGAGGTGCCCCCCGAGTCCCCGCACGGCCCGGACCCCGCGCACCTGGAGG AGGCGTGGCAGCGGTGCCGCAGCGAGGGCCTCGACGTCGCCTGCATCCTC ATCAACCCGCAGCACAACCCGTGGGGCGGCAACTGGACCCCCGAGTTCCT CGCCGCCGTCGCCGCCCTCGCCGAACGTGAGCGAGTGCCCGTCCTGGTGG ACAACGCCTTCTACGGGCTGACCGCCGAGGACGTGCGCCCCACCAGCGCG GTCCGGCTCCTCGGCCATCTCGTCGGCCAGGAACTCCTGGTGTCGGTGCG CAGCCTGAGCAAGCAGTTCGCGTGCAGCGGCTGGGCCCTGGGAGCCGTCG CGGGCAGCCCGGGTCTGGTCTCGGCGTACTCCGGCCGCTGGCGCTGTCTG CGGGAGCCGACCGCGGGCTTCCGCGCCCAGGCGGCGATGGCGGCCTGGCT CGGGGGCGCCGAACCCGAGCGCTTCACCCGGCGCCGCCGATCCGAGGCCA CCCGGCACGCCAGGCTCCTGCGCACCACACTGCGCGCGGCGGGGCTGCCC GACGACGCCGTCCTGCACCACGGCGGCGCCCCCTTCACCCTGCTGCGGCC CCCGGGCGGCAGCACGGTCGAGGAGGTGCGCGAGCAGACCGTCGTGCGGC ACGGCGTCCTGCTCGGCCTGGAGCGGGACGCGCGCGAACGGCCGTGGTTC AAGGTCTGGCTGGGCCGGGACAGCAGCGTCTTCGAACCCGCGGCGCGGGC CCTCGGCGACGCCGCGGCCGAGTGGCGGTACCGGTGA

    [0106] Pharmaceutical Composition and Administration Thereof

    [0107] The compound of the present invention has excellent bacteriostatic (antibacterial) activity and thus can be used as an anti-bacterial agent (or antibiotics), and its properties is beneficial to form injections.

    [0108] The compounds of the present invention can be administered to mammals (e.g, humans) and can be administered orally, rectally, parenterally (intravenously, intramuscularly or subcutaneously), topically, and the like. The compounds can be administrated alone, or in combination with any other pharmaceutically acceptable compounds. It should be pointed out that the compound of the present invention can be administrated in mixture.

    [0109] Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules. In these solid dosage forms, the active compounds are mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or CaHPO.sub.4, or mixed with any of the following components: (a) fillers or compatibilizer, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid; (b) binders, for example, hydroxymethyl cellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and arabic gum; (c) humectant, such as, glycerol; (d) disintegrating agents such as agar, calcium carbonate, potato starch or tapioca starch, alginic acid, certain composite silicates, and sodium carbonate; (e) dissolution-retarding agents, such as paraffin; (f) absorption accelerators, for example, quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glyceryl monostearate; (h) adsorbents, for example, kaolin; and (i) lubricants such as talc, stearin calcium, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, or the mixtures thereof. In capsules, tablets and pills, the dosage forms may also contain buffering agents.

    [0110] The solid dosage forms such as tablets, sugar pills, capsules, pills and granules can be prepared by using coating and shell materials, such as enteric coatings and any other materials known in the art. They can contain an opaque agent. The release of the active compounds or compounds in the compositions can be released in a delayed mode in a given portion of the digestive tract. Examples of the embedding components include polymers and waxes. If necessary, the active compounds and one or more above excipients can form microcapsules.

    [0111] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active compounds, the liquid dosage forms may contain any conventional inert diluents known in the art such as water or other solvents, solubilizers and emulsifiers, for example, ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butanediol, dimethyl formamide, as well as oil, in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, or the combination thereof.

    [0112] Besides these inert diluents, the composition may also contain additives such as wetting agents, emulsifiers, and suspending agent, sweetener and perfume.

    [0113] In addition to the active compounds, the suspension may contain suspending agent, for example, ethoxylated isooctadecanol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, methanol aluminum and agar, or the combination thereof.

    [0114] The compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders which can be re-dissolved into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, 50 polyols and any suitable mixtures thereof.

    [0115] The dosage forms for topical administration of compounds of the invention include ointments, powders, patches, aerosol, and inhalants. The active ingredients are mixed with physiologically acceptable carriers and any preservatives, buffers, or propellant if necessary, under sterile conditions.

    [0116] Compounds of the present invention can be administrated alone, or in combination with other active ingredients (such as antibiotics).

    [0117] When the pharmaceutical compositions are used, a safe and effective amount of compound of the present invention is applied to a mammal (such as human) in need of, wherein the dose of administration is a pharmaceutically effective dose. For an individual weighed 60 kg, the daily dose is usually 1-1000 mg, preferably 20-500 mg. Of course, the particular dose should also depend on various factors, such as the route of administration, healthy status of the individual, which are well within the skills of an experienced physician.

    [0118] The Main Advantages of the Present Invention are:

    [0119] 1. The present invention provided a class of Lincomycin biosynthetic intermediates with noval structure (which can be referred as lincomycin derivatives).

    [0120] 2. The present invention provides a genetic modification method for a lincolomycin-producing strain. High-yield production of a high-purity lincomycin biosynthesis intermediate product can be achieved through fermentation production, separation and purification of the strain.

    [0121] 3. Based on the lincomycin analogs of the present invention, it is not only conducive to the preparation of other structural analogues of lincosamide antibiotics, but also facilitates the production of a variety of extremely useful intermediate compounds (including n-propyl proline, disaccharide GlcN-Ins, and/or ergothioneine) by simple hydrolysis.

    [0122] 4. The preparation of the intermediate compound by the biological method of the present invention less affects environment and is of mild conditions and suitable for large-scale industrial production.

    [0123] 5. The method of the present invention not only can conveniently prepare a variety of useful intermediate compounds, but also avoids the use of expensive and complex full-chemical synthesis, and therefore has low cost and other comprehensive advantages and application prospects.

    [0124] The present invention will be further illustrated below with reference to the specific examples. It should be understood that these examples are only to illustrate the invention but not to limit the scope of the invention. The experimental methods with no specific conditions described in the following examples are generally performed under the conventional conditions (for example, according to J. Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's instructions. Unless indicated otherwise, parts and percentage are calculated by weight.

    [0125] Unless otherwise defined, the technical terms and scientific terminology used herein are of the same meanings as with that familiar to all to those skilled in the art. In addition, any methods and materials similar or equal to that recorded can be applied in the present invention. The preferred embodiments and the materials described herein are for demonstration purposes only and are not intended to limit the scope of the present invention.

    Example 1 Construction of in Frame Knockout Mutant of Lincomycin

    [0126] 1. Construction of a Recombinant Plasmid for in Frame Knockout

    [0127] Primer Design:

    [0128] The primer sequence for the left arm DNA fragment of the PCR clone lmbE gene is as follows:

    TABLE-US-00010 (SEQIDNO.:10) Primer1: 5-TATGAATTCCACCTTCACCACGCAGCAGTCC-3 (SEQIDNO.:11) Primer2: 5-TATTCTAGACCTTCCCGTACGAGGAGTACAC-3

    [0129] The primer sequence for the right arm DNA fragment of the PCR clone lmbE gene is as follows:

    TABLE-US-00011 (SEQIDNO.:12) Primer3: 5-TATTCTAGACGAACCGTTCGGGGGTGAAGTC-3 (SEQIDNO.:13) Primer4: 5-TATAAGCTTCCCGTTGCACACGACGTTTCAC-3

    [0130] The primer sequence for the left arm DNA fragment of the PCR clone lmbE3457 gene is as follows:

    TABLE-US-00012 (SEQIDNO.:14) Primer5: 5-TATGAATTCCTGTTCACCTCCTACGGCGAC-3 (SEQIDNO.:15) Primer6: 5-TATTCTAGAATCCGCGACAAGGCCCTGATC-3

    [0131] The primer sequence for the right arm DNA fragment of the PCR clone lmbE3457 gene is as follows:

    TABLE-US-00013 (SEQIDNO.:16) Primer7: 5-TATTCTAGAGCGGATCTTCTTCACCAGCTC-3 (SEQIDNO.:17) Primer8: 5-TATAAGCTTCGCCACATCGCCGAATGGAAC-3

    [0132] The primer sequence for the left arm DNA fragment of the PCR clone lmbV gene is as follows:

    TABLE-US-00014 (SEQIDNO.:18) Primer9: 5-TATGAATTCGACGACGCTGACGTAGTGCAGG-3 (SEQIDNO.:19) Primer10: 5-TATTCTAGACTGACCCGTGAGCAGTTCGTGG-3

    [0133] The primer sequence for the right arm DNA fragment of the PCR clone lmbV gene is as follows:

    TABLE-US-00015 (SEQIDNO.:20) Primer11: 5-TATTCTAGAGATGTCGTCGTGCACGCATGCC-3 (SEQIDNO.:21) Primer12 5-TATAAGCTTGTCACCGCGGTTGAGCTCGATC-3

    [0134] The primer sequence for the left arm DNA fragment of the PCR clone mshA gene is as follows:

    TABLE-US-00016 (SEQIDNO.:22) Primer13: 5-TATGAATTCCGGTTCGATCTCCACACCGACCAC-3 (SEQIDNO.:23) Primer14: 5-TATTCTAGACTTGGCCATGGTGTGCATGGCGTG-3

    [0135] The primer sequence for the right arm DNA fragment of the PCR clone mshA gene is as follows:

    TABLE-US-00017 (SEQIDNO.:24) Primer15: 5-TATTCTAGACAGACCGGTTTCCTCGTACGAGGG-3 (SEQIDNO.:25) Primer16: 5-TATAAGCTTCATGGTCACCCGGCAGGAAGTCAC-3

    [0136] The primer sequence for the left arm DNA fragment of the PCR clone lmbC gene is as follows:

    TABLE-US-00018 (SEQIDNO.:26) Primer17: 5-TATGAATTCGGATGTACCGTTTCCTGGACC-3 (SEQIDNO.:27) Primer18: 5-TATTCTAGAGGAGGTGGAGAACGCTGTACG-3

    [0137] The primer sequence for the right arm DNA fragment of the PCR clone lmbC gene is as follows:

    TABLE-US-00019 (SEQIDNO.:28) Primer19: 5-TATTCTAGAGGAGGTGGAGAACGCTGTACG-3 (SEQIDNO.:29) Primer20: 5-TATAAGCTTCAGTCACGTGACCCAAGTACCG-3

    [0138] The primer sequence for the left arm DNA fragment of the PCR clone lmbD gene is as follows:

    TABLE-US-00020 (SEQIDNO.:30) Primer21: 5-TATGAATTCCCTGATGCTCCTGTACACCAGC-3 (SEQIDNO.:31) Primer22: 5-TATTCTAGAGTCCTCCAGGAACAGCAGACTG-3

    [0139] The primer sequence for the right arm DNA fragment of the PCR clone lmbD gene is as follows:

    TABLE-US-00021 (SEQIDNO.:32) Primer23: 5-TATTCTAGACGGTATCTGTTCCTGGGCCTGG-3 (SEQIDNO.:33) Primer24: 5-TATAAGCTTGAACGGTACGTGCAACTCCTCG-3

    [0140] PCR Amplification

    [0141] The PCR amplification was performed by using the total DNA of Lincomycin producing strain, Streptomycin lincolnensis NRRL ISP-5355 as the template, and using the above left and right arm DNA fragments specific primers of lincE, lmbE3457, lmbV, mshA, and lmbC, to amplify the upstream and downstream sequence, the left and right arm DNA amplified fragments.

    [0142] Construction of Recombinant Shuttle Plasmid

    [0143] The left and right arm fragments of each gene were separated by gel electrophoresis, and the gel was recovered and purified. The left arm fragments were digested with EcoRI and XbaI, and the downstream fragments were digested with XbaI and HindIII. After the fragments were collected, they were together inserted into pKC1139 plasmid which was treated with restriction enzymes HindIII and EcoRI (a temperature-sensitive E. coli-Streptomyces shuttle plasmids, see: U.S. Pat. No. 5,955,319), thus forming recombinant plasmid shuttle plasmids of each gene.

    [0144] The recombinant plasmid was transformed into the conventional E. coli DH5a, and a monoclonal colony was picked into LB culture medium (containing an alabamamycin antibiotic 100 g/ml) and cultured overnight until the bacteria solution turned to dense. The recombinant plasmid was extracted and verified by enzyme digestion. Commercial sequencing was performed. The results showed that the recombinant shuttle plasmid was constructed correctly.

    2. Construction and Screening of in Frame Knockout Mutants

    [0145] The correct recombinant shuttle plasmid was transformed into the conventional methylation-deleted E. coli ET12567 (see U.S. Pat. No. 7,326,782 and U.S. Pat. No. 7,105,491) and the lmbE, lmbV, mshA, lmbC and lmbD gene knockout plasmid was introduced into the Streptomycin lincolnensis NRRL ISP-5355 strain by conjugative transfer. The lmbE3457 knockout plasmid was introduced into the lmbE knockout mutant to construct the lmbE-E3457 double knockout mutant. The amylin-resistant zygote was selected and the zygote was grown at 37 C. to homologously recombine the upstream or downstream fragment of the plasmid gene with the homologous fragment on the chromosome. The zygote grown well at 37 C. were inoculated into TSB liquid medium without any antibiotics (purchased from SIGMA-ALDRICH) and incubated at 30 C. for two days. A small amount of bacteria was taken and inoculated in TSB liquid medium without antibiotics. After 5 to 6 rounds, the bacteria solution was streaked on MS solid medium and single colonies that lost apramycin resistance were picked. DNA was extracted and genotypes were determined by PCR.

    [0146] In the present example, a mutant strain of the biosynthesis gene cluster of lincomycin was successfully constructed by the above method. The experimental results are shown in FIG. 1.

    [0147] FIG. 1a is the verification result of the lmbE knockout mutant. From the electrophoretogram of Figure a, it can be seen that the lmbE gene in the lmbE knockout mutant was deleted by about 0.55 kb, indicating that the lmbE knockout mutant strain was successfully constructed in this Example.

    [0148] FIG. 1b is the verification result of the lmbE-E3457 double knockout mutant. On the basis of the lmbE knockout mutant, lmbE3457 was further knocked out. From the electropherogram of figure b, it can see that the lmbE3457 gene was deleted by about 0.34 kb in lmbE-E3457 double knockout mutant, indicating that the lmbE-E3457 double knockout mutant was successfully constructed in this example.

    [0149] FIG. 1c is the verification result of the lmbV knockout mutant. From the electrophoretogram of Figure c, it can be seen that the lmbV gene in the lmbV knockout mutant was deleted by about 0.4 kb, indicating that the lmbV knockout mutant strain was successfully constructed in this Example.

    [0150] FIG. 1d is the verification result of the mshA knockout mutant. From the electrophoretogram of Figure d, it can be seen that the mshA gene in the mshA knockout mutant was deleted by about 0.6 kb, indicating that the mshA knockout mutant strain was successfully constructed in this Example.

    [0151] FIG. 1e is the verification result of the lmbC knockout mutant. From the electrophoretogram of Figure e, it can be seen that the lmbC gene in the lmbC knockout mutant was deleted by about 0.7 kb, indicating that the lmbC knockout mutant strain was successfully constructed in this Example.

    [0152] FIG. 1f is the verification result of the lmbD knockout mutant. From the electrophoretogram of Figure f, it can be seen that the lmbD gene in the lmbD knockout mutant was deleted by about 0.4 kb, indicating that the lmbD knockout mutant strain was successfully constructed in this Example.

    [0153] FIG. 1g is the verification result of the lmbF knockout mutant. From the electrophoretogram of Figure g, it can be seen that the lmbF gene in the lmbF knockout mutant was deleted by about 0.5 kb, indicating that the lmbF knockout mutant strain was successfully constructed in this Example.

    Example 2 Fermentation of Recombinant Strains

    [0154] 1. Seed Activation and Culture

    [0155] Spores of recombinant strain preserved at 80 C. were spread on MS medium (mannitol 2%, soybean meal 2%, agar 2%) and cultured at 30 C. for 7 days. Approximately 1 cm.sup.2 of agar block containing spores and hyphae was cut out and inoculated into the primary fermentation medium (Soluble starch 20.0 g, Soy flour 10.0 g, Corn steep liquor 30.0 g, Glucose 10.0 g, (NH.sub.4).sub.2SO.sub.4 1.5 g, CaCO.sub.3 5.0 g, pH=7.0), cultured at 30 C. 250 rpm for 40 hours to obtain a seed culture solution for the next experiment.

    [0156] 2. Enlarge Cultivation

    [0157] The seed culture solution was inoculated into the fermentation medium at a seeding volume of 10% by volume (Glucose 100.0 g, Soy flour 25.0 g, Corn steep liquor 2.0 g, NaNO.sub.3 8.0 g, NaCl 5.0 g, (NH.sub.4).sub.2SO.sub.4 8.0 g, K.sub.2HPO.sub.4 0.2 g, CaCO.sub.3 8.0 g, pH=7.0), cultured at 30 C., 250 rpm for 7 days, and the fermentation broth was harvested to obtain a crude product containing a structural analog of lincomycin, which was stored at low temperatures for detection and isolation of purified compounds.

    Example 3 Detection of Fermentation Products

    [0158] 1 mL of fermentation broth was filtered and centrifuged at 12,000 r/min for 10 min. 300 L of fermentation broth was pipetted and three-fold diluted with 600 L mobile phase (5 mM ammonium acetate:methanol=40:60). The sample was fully vortex shaken with vortex, and allowed to stand for 24 h at 4 C., centrifuged at 12,000 r/min for 10 min, 50 and a small amount of supernatant was taken for HPLC and LC-MS detection and analysis. The detection conditions were as follows: Agilent ZORBAX SB-C18 (5 m 4.6250 mm) was used as column; 210 nm detection wavelength; the mobile phase was 5 mM ammonium acetate solution:methanol (40:60); constant gradient elution for 17 min; the flow rate was 0.6 mL/min; and the injection volume was 20 L.

    [0159] The test results are shown in FIG. 2. It can be seen from the figure that compared with the wild type, the content of compound 1 in the fermentation product of the lmbE knockout mutant and the lmbE-E3457 double knockout mutant has significantly increased; The content of compound 2 in the fermentation product of the lmbV knockout mutant and the mshA knockout mutant has significantly increased; the content of compound 5 in the fermentation product of the lmbF knockout mutant has significantly increased; and the content of the compound 3, 4 in the fermentation product of the lmbC knockout mutant has increased. While the wild-type strain did not produce or produced only a trace amount of the above compounds.

    Example 4 Isolation and Purification of Lincomycin Structural Analogs

    [0160] The fermentation broth was centrifuged at 4000 rpm for 20 minutes and the supernatant was taken. Firstly, the macroporous resin XAD-2 was used to adsorb the fermentation broth of the mutant and eluted with methanol; then, the eluate was concentrated and separated on a Sephadex LH20 gel column, and the target compound-enriched tube was determined by TLC/LC-MS analysis; The C18 semi-preparative column was used for crude separation to obtain relatively pure compounds. Finally, the compounds were further purified by Sephadex G10 gel column to obtain each target compound, and the structure of each target compound was identified.

    [0161] FIG. 3 shows the results of NMR analysis of compound 1, FIG. 3a, 1H NMR spectrum; FIG. 3b, 13C NMR spectrum; FIG. 3c, DEPT135 NMR spectrum; FIG. 3d, COSY NMR spectrum; FIG. 3e, HSQC NMR spectrum; FIG. 3f, HMBC NMR spectrum; FIG. 3g, NOESY NMR spectrum. The structure of Compound 1 was identified based on the above spectra as shown in Formula I1.

    ##STR00011##

    [0162] FIG. 4 shows the results of NMR analysis of compound 2, FIG. 4a, 1H NMR spectrum; FIG. 4b, 13C NMR spectrum; FIG. 4c, DEPT135 NMR spectrum; FIG. 4d, COSY NMR spectrum: FIG. 4e, HSQC NMR spectrum: FIG. 4f, HMBC NMR spectrum; FIG. 4g, NOESY NMR spectrum. The structure of Compound 2 was identified based on the above spectra as shown in Formula I2.

    ##STR00012##

    [0163] FIG. 5 shows the results of NMR analysis of compound 3. FIG. 5a, 1H NMR spectrum; FIG. 5b, 13C NMR spectrum; FIG. 5c, DEPT135 NMR spectrum; FIG. 5d, COSY NMR spectrum; FIG. 5e, HSQC NMR spectrum; FIG. 5f, HMBC NMR spectrum; FIG. 5g, NOESY NMR spectrum. The structure of Compound 3 was identified based on the above spectra as shown in Formula I3.

    ##STR00013##

    [0164] FIG. 6 shows the results of NMR analysis of compound 4. FIG. 6a, 1H NMR spectrum; FIG. 6b, 13C NMR spectrum; FIG. 6c, DEPT135 NMR spectrum; FIG. 6d, COSY NMR spectrum; FIG. 6e, HSQC NMR spectrum; FIG. 6f, HMBC NMR spectrum; FIG. 6g, NOESY NMR spectrum. The structure of Compound 4 was identified based on the above spectra as shown in Formula I4.

    ##STR00014##

    [0165] FIG. 7 shows the results of NMR analysis of compound 5. FIG. 7a, 1H NMR spectrum; FIG. 7b, 13C NMR spectrum; FIG. 7c, DEPT135 NMR spectrum; FIG. 7d, COSY NMR spectrum; FIG. 7e, HSQC NMR spectrum; FIG. 7f, HMBC NMR spectrum; FIG. 7g, NOESY NMR spectrum. The structure of Compound 5 was identified based on the above spectra as shown in Formula I5.

    ##STR00015##

    Example 5

    [0166] Pharmaceutical Composition

    TABLE-US-00022 Compound 20 g starch 140 g Microcrystalline cellulose 60 g

    [0167] The above substances are mixed by conventional methods, and then filled into general gelatin capsules to obtain 1000 capsules.

    Example 6 Production of Downstream Products Such as n-Propyl Proline, Disaccharide GlcN-Ins and Ergothioneine by Hydrolysis

    [0168] N-propyl proline: 5 ml of an aqueous solutions of Compound 1, 2 or 5 (containing about 50 mg of starting material) were taken in a 25 ml round bottom flask, and 5N NaOH solution was added dropwise to pH=11, and heated to reflux for 3 h. After the reaction was completed by LC-MS, the reaction solvent was removed under vacuo. The system was dissolved in 1 ml water, and semi-preparative purifications were performed on a reversed-phase C18 column for twice. Conditions: H.sub.2O (5 mM)/CH.sub.3OH=80/20; 2 ml/min; 210 nm UV detection, and the obtained pure n-propyl proline was subjected to nuclear magnetic identification. The results are shown in FIG. 8. The identification results show that the n-propyl proline was successfully produced in this example.

    [0169] Disaccharide GlcN-Ins: 5 ml of an aqueous solutions of Compound 1 or 3 (containing about 50 mg of starting material) were taken in a 25 ml round bottom flask, and 5N NaOH solution was added dropwise to pH=11, and heated to reflux for 3 h. After the reaction was completed by LC-MS, the reaction solvent was removed under vacuo. The system was dissolved in 1 ml water, and semi-preparative purifications were performed on a HIIIC column for twice. Conditions: H.sub.2O (10 mM)/CH3CN=25/75; 2 ml/min; differential detection, and the obtained GlcN-Ins was subjected to nuclear magnetic identification. The results are shown in FIG. 9. The identification results show that the disaccharide GlcN-Ins was successfully produced in this example. GlcN-Ins can be used as the raw material of Mycothiol chemical synthesis (The chemical synthesis method refers to: Org. Lett. 6, 365-368, 2004; Org. Lett. 12, 2630-2633, 2010).

    [0170] Ergothioneine: 5 ml of an aqueous solutions of Compound 2 or 4 (containing about 50 mg of starting material) were taken in a 25 ml round bottom flask, and 5N HCl solution was added dropwise to pH=1, and heated to reflux for 3 h. After the reaction was completed by LC-MS, the reaction solvent was removed under vacuo. The system was dissolved in 1 ml water, and semi-preparative purifications were performed on a HIIIC column for twice. Conditions: H.sub.2O (10 mM)/CH3CN=28/72; 2 ml/min; 243 nm UV detection, and the obtained pure Ergothioneine was subjected to nuclear magnetic identification. The results are shown in FIG. 10. The identification results show that the Ergothioneine was successfully produced in this example.

    [0171] All literatures mentioned in the present application are incorporated herein by reference, as though each one is individually incorporated by reference. Additionally, it should be understood that after reading the above teachings, those skilled in the art can make various changes and modifications to the present invention. These equivalents also fall within the scope defined by the appended claims.