BACILLUS BASED DELIVERY SYSTEM AND METHODS OF USE
20180250377 ยท 2018-09-06
Inventors
Cpc classification
C02F2101/22
CHEMISTRY; METALLURGY
C12N2770/10034
CHEMISTRY; METALLURGY
A61K2035/11
HUMAN NECESSITIES
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N2770/10022
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
C12N11/16
CHEMISTRY; METALLURGY
B09C1/10
PERFORMING OPERATIONS; TRANSPORTING
C12P3/00
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C07K2319/035
CHEMISTRY; METALLURGY
International classification
A61K39/00
HUMAN NECESSITIES
C12N11/16
CHEMISTRY; METALLURGY
Abstract
Herein a Bacillus exosporium antigen delivery (BEAD) system that provides a means to introduce recombinant proteins or small molecules into the exosporium of members of the B. cereus family of bacteria, i.e. B. anthracis, B. cereus, and B. thuringiensis, is disclosed. The system results in the surface display of recombinant proteins or small molecules such that they can stimulate an immune response. In addition, methods of making and using the system are described.
Claims
1-20. (canceled)
21. A Bacillus exosporium molecule delivery (BEMD) system comprising a recombinant Bacillus cereus family member expressing a fusion construct, wherein the fusion construct is expressed under the control of a sporulation-phase specific promoter and wherein the fusion construct comprises at least one molecule of interest (MOI) and: (a) a targeting sequence comprising an amino acid sequence having at least 43% identity with amino acids 20-35 of SEQ ID NO: 7, wherein the identity with amino acids 25-35 is at least 54%; (b) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 7; (c) a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 7; (d) a targeting sequence comprising SEQ ID NO: 13; (e) a targeting sequence comprising SEQ ID NO: 7; (f) a targeting sequence comprising at least the first 35 amino acids of a Bacillus BclA protein; (g) a full-length Bacillus BclA protein; (h) a targeting sequence comprising amino acids 1-27 of SEQ ID NO: 8; (i) a targeting sequence comprising amino acids 12-27 of SEQ ID NO: 8; (j) a targeting sequence comprising SEQ ID NO: 8; (k) a targeting sequence comprising at least the first 31 amino acids of a Bacillus BAS3290 protein; (l) a full-length Bacillus BAS3290 protein; (m) a targeting sequence comprising an amino acid sequence having at least 43% identity with amino acids 12-27 of SEQ ID NO: 8, wherein the identity with amino acids 17-27 is at least 63%; (n) a targeting sequence comprising amino acids 1-38 of SEQ ID NO: 9; (o) a targeting sequence comprising amino acids 23-38 of SEQ ID NO: 9; (p) a targeting sequence comprising SEQ ID NO: 9; (q) a targeting sequence comprising at least the first 36 amino acids of a Bacillus BAS4623 protein; (r) a full-length Bacillus BAS4623 protein; (s) a targeting sequence comprising an amino acid sequence having at least 43% identity with amino acids 23-38 of SEQ ID NO: 9, wherein the identity with amino acids 28-38 is at least 54%; (t) a targeting sequence comprising amino acids 1-28 of SEQ ID NO: 10; (u) a targeting sequence comprising amino acids 13-28 of SEQ ID NO: 10; (v) a targeting sequence comprising SEQ ID NO: 10; (w) a targeting sequence comprising at least the first 32 amino acids of a Bacillus BclB protein; (x) a full-length Bacillus BclB protein; or (y) a targeting sequence comprising an amino acid sequence having at least 43% identity with amino acids 13-28 of SEQ ID NO: 10, wherein the identity with amino acids 18-28 is at least 54%.
22. The BEMD system of claim 21, wherein the sporulation-phase specific promoter comprises at least one sigma-K element.
23. The BEMD system of claim 21, wherein the recombinant Bacillus cereus family member is selected from the group consisting of B. anthracis, B. cereus, B. thuringiensis, and combinations thereof.
24. The BEMD system of claim 23, wherein the recombinant Bacillus cereus family member comprises B. thuringiensis.
25. The BEMD system of claim 21, wherein the MOI comprises an immunogenic molecule.
26. The BEMD system of claim 25, wherein the immunogenic molecule of the fusion construct is physically oriented in the exosporium to be able to stimulate an immune response.
27. The BEMD system of claim 21, wherein the Bacillus cereus family member is inactivated.
28. The BEMD system of claim 21, wherein the fusion construct comprises: (a) a targeting sequence comprising an amino acid sequence having at least 50% identity with amino acids 20-35 of SEQ ID NO: 7, wherein the identity with amino acids 25-35 is at least 72%; (b) a targeting sequence comprising an amino acid sequence having at least 50% identity with amino acids 12-27 of SEQ ID NO: 8, wherein the identity with amino acids 17-27 is at least 63%; (c) a targeting sequence comprising an amino acid sequence having at least 43% identity with amino acids 23-38 of SEQ ID NO: 9, wherein the identity with amino acids 28-38 is at least 63%; or (d) a targeting sequence comprising an amino acid sequence having at least 50% identity with amino acids 13-28 of SEQ ID NO: 10, wherein the identity with amino acids 18-28 is at least 63%.
29. The BEMD system of claim 21, wherein the fusion construct comprises: (a) a targeting sequence comprising an amino acid sequence having at least 81% identity with amino acids 20-35 of SEQ ID NO: 7, wherein the identity with amino acids 25-35 is at least 90%; (b) a targeting sequence comprising an amino acid sequence having at least 81% identity with amino acids 12-27 of SEQ ID NO: 8, wherein the identity with amino acids 17-27 is at least 90%; or (c) a targeting sequence comprising an amino acid sequence having at least 50% identity with amino acids 23-38 of SEQ ID NO: 9, wherein the identity with amino acids 28-38 is at least 72%.
30. The BEMD system of claim 21, wherein the targeting sequence comprises SEQ ID NO: 13.
31. A Bacillus exosporium molecule delivery (BEMD) system comprising a recombinant Bacillus cereus family member expressing a fusion construct, wherein the fusion construct comprises at least one molecule of interest (MOI) and a targeting sequence comprising a methionine residue directly covalently bound to a targeting sequence comprising an amino acid sequence comprising 16 amino acids having at least 43% identity with amino acids 20-35 of SEQ ID NO: 7, wherein the identity with amino acids 25-35 is at least 54%.
32. The BEMD system of claim 31, wherein the recombinant Bacillus cereus family member is selected from the group consisting of B. anthracis, B. cereus, B. thuringiensis, and combinations thereof.
33. The BEMD system of claim 32, wherein the recombinant Bacillus cereus family member comprises B. thuringiensis.
34. The BEMD system of claim 31, wherein the MOI comprises an immunogenic molecule.
35. The BEMD system of claim 34, wherein the immunogenic molecule of the fusion construct is physically oriented in the exosporium to be able to stimulate an immune response.
36. The BEMD system of claim 31, wherein the Bacillus cereus family member is inactivated.
37. The BEMD system of claim 31, wherein the fusion construct comprises a targeting sequence comprising an amino acid sequence having at least 50% identity with amino acids 20-35 of SEQ ID NO: 7, wherein the identity with amino acids 25-35 is at least 72%.
38. The BEMD system of claim 31, wherein the fusion construct comprises a targeting sequence comprising an amino acid sequence having at least 81% identity with amino acids 20-35 of SEQ ID NO: 7, wherein the identity with amino acids 25-35 is at least 90%.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. The application contains at least one drawing executed in color. Copies of this patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DETAILED DESCRIPTION
[0045] The use of Bacillus endospores as a delivery vehicle has shown promise as a means of amplifying the magnitude and scope of the immune response to specific antigens. But, a procedure to efficiently localize foreign immunogenic proteins to the outer layers of exosporium-containing Bacillus spores has not been defined to date. Herein, are identified sequences of the BclA and BclB glycoproteins responsible for the insertion of these proteins into the exosporium layer of the spore. These sequences can be used as targeting domains to incorporate reporter proteins or antigens onto the spore surface. As such, herein is described a Bacillus exosporium antigen delivery (BEAD) system that provides a means to study the mechanisms of spore maturation in this important select agent pathogen. Furthermore, this novel delivery system can be exploited to incorporate foreign proteins into the exosporium of B. cereus family of bacteria, i.e. B. anthracis, B. cereus, and B. thuringiensis, resulting in the surface display of recombinant immunogens such as proteins or small molecules. In particular, the BEAD system described herein may be useful in combating exposure to pathogenic strains of B. anthracis by providing a means to deliver vaccines or other therapeutic compounds.
Identification of Domains Important in Protein Incorporation into the Exosporium
[0046] Two collagen-like glycoproteins, BclA and BclB, have been shown to be surface exposed on spores of B. anthracis. The BclA and BclB are found in the exosporium layer of B. anthracis spores. The protein BclA is the major constituent of the surface nap and has been shown to be attached to the exosporium with its N terminus positioned at the basal layer and its C-terminus extending outward from the spore. BclA extracted from spores has been shown to lack its N-terminal 19 amino acids, which suggests that a proteolytic event is involved in the incorporation of this protein into the exosporium. The mechanisms by which BclA and BclB are incorporated into the exosporium are unknown. Herein, sequences at the N-terminus of these Bcl proteins that are sufficient for the incorporation of the proteins into the exosporium have been identified. Additional proteins are encoded in the B. anthracis genome with collagen-like triplet amino acid repeats. These determinants possess sequences resembling ?.sup.K promoter elements, and each is expressed during the sporulation phase of the B. anthracis life cycle. The N-termini of these proteins possess interesting sequence similarities (
[0047] The N-terminal domains of BclA and BclB allow for the targeting and incorporation of these proteins into the exosporium of B. anthracis. The BclA N-terminal domain comprises an 11 amino acid conserved motif, SEQ ID NO: 11, described herein and a 24 amino acid N-terminal region that contains a putative proteolytic cleavage site. A suggested role of the conserved motif is as a potential recognition site that leads to the positioning of the proteins to their appropriate target sites within the exosporium layer, but the attachment of proteins relies on more N-terminal sequences. Interestingly, addition of only 5 additional amino acids to the conserved motif (amino acids 20-24) allows for efficient localization and attachment of proteins, suggesting a role for those 5 amino acids in attachment of BclA to the exosporium. Removal of the conserved motif (but retention of the N-terminal amino acid sequence) leads to poor incorporation of the fusion proteins into the exosporium. The low level of incorporation observed may result from reduced positioning of the proteins at their sites of incorporation (limited fluorescence targeted to the exosporium of developing spores), but those proteins that are aligned properly get incorporated. The role of the proteolytic cleavage event has yet to be elucidated, but the data suggest that removal of the N-terminus prior to the putative cleavage site does not lead to a change in the level of protein incorporation into the exosporium. If a cleavage event is required for incorporation of BclA, the single methionine residue upstream of the cleavage site is sufficient for cleavage to occur. Alternatively, no cleavage event is required for exosporium incorporation and the cleavage event may be involved in release of the protein from the spore.
[0048] The process of assembly and attachment of BclA and BclB has not been described in detail to date. It is known that the BxpB (also called ExsFA) protein is involved directly or indirectly in the assembly of BclA on the surface of the exosporium, as bxpB mutant spores do not contain a BclA-coated nap. The N-terminal domains of BclA and BclB are responsible for the targeting and incorporation of these proteins into the exosporium of B. anthracis.
[0049] Maturation of the exosporium basal layer and the beginning of nap assembly occur at the same pole as that involved in the initiation of basal layer assembly. This initial localization of BclA is to an area smaller than the described cap, suggesting that the cap in exsY mutant spores results from a stalling in the progression of the exosporium development, rather than a broader initial deposition of BclA. It is proposed herein that the conserved domain is a localization domain that is recognized by an exosporium protein or complex that positions BclA for subsequent cleavage and incorporation.
[0050] Subsequent to positioning of BclA around the spore, cleavage of the N-terminal domain after residue 19 occurs concomitantly with stable incorporation of the protein into the exosporium (
[0051] Correct localization of the proteins in the exosporium driven by the N-terminal domain (NTD) alone suggests that recognition of the N-terminal sequence is key in the nap assembly process. Glycosylation of the collagen-like repeat region of BclA and the trimerization of the BclA protein owing to the presence of these repeats do not appear to be necessary for recognition and incorporation of BclA into the exosporium.
[0052] BclB is produced in lower quantities in the mother cell in comparison with BclA. Expression of BclB under the more active bclA promoter allows for incorporation of BclB fusions into the exosporium. However, the pattern of incorporation differs from the uniform distribution observed with the BclA fusions. Differences in the N-terminal amino acid sequences may result in interactions with a different set of exosporium proteins, which may account for the different localization results.
Exploitation of the Targeting Domains as a Bacillus Exosporium Antigen Delivery (BEAD) System
[0053] During the sporulation process in Bacillus, spores are assembled with the outermost spore layers deposited last. The BclA glycoprotein is the predominant protein on the exosporium nap layer. This exosporium surface protein is expected to be among the last of the spore proteins to be incorporated into the spore. Data herein show that the N-terminal domains of the BclA and BclB proteins are sufficient for localization to the exosporium surface and that efficient expression on the spore surface is also dependent on the timing or levels of expression during sporulation. Amino acid sequences distal to the first 35 amino acids of the BclA protein are not required for surface localization on spores and can be replaced with foreign protein sequences or other small molecules that can be incorporated into fusions of the types described herein.
[0054] Use of the Bacillus exosporium antigen delivery (BEAD) system is expected to allow for high expression of foreign proteins or other small molecules in the endospore of B. anthracis and other BclA-containing Bacillus species (e.g. B. cereus and B. thuringiensis). The amount of incorporation surpasses that of recombinant proteins expressed on B. subtilis spores using the CotB/C systems. Advantageously, the ability of B. anthracis spores to illicit an immune response has been well characterized, and combining this ability with the inherent stability of the spores, provides a promising platform for the delivery of recombinant antigens or other small molecules.
[0055] The BEAD system has implications for the development of potentially better and safer vaccines against anthrax and other biothreat agents. Important immunogens, such as B. anthracis protective antigen, could be expressed on the surface of an anthrax spore or a spore from another B. cereus family member using any of the methods detailed herein. Herein, the BEAD system is demonstrated using well-known reporter proteins and a well-characterized antigen of viral origin. It is expected that any suitable antigen or small molecule may be recombined using the methods herein. Suitable antigens or small molecules are those that are known or expected to illicit a desired immune response that is sufficient to yield a therapeutic or protective effect when expressed on the exterior of a Bacillus spore. Suitability in large part will be determined by the folding in the three-dimensional structure once the recombinant antigen is incorporated into the exosporium, i.e. the antigenic portion(s) of the recombinant molecule must be available for detection by the immune system.
[0056] Preferably, spores used in the system are inactivated such that they cannot germinate. Exposure to ultraviolet (UV) radiation is a preferred method of inactivating spores; however, any of the compatible, inactivation methods known in the art may be used. Alternatively, spores derived from nontoxigenic strains, or genetically or physically inactivated strains, could be developed as part of a delivery system against anthrax. This system would provide the important protective antigen immunogen without the problems associated with residual toxicity and would have the additional advantage of providing spore-associated antigens that have been shown to provide enhanced protection against anthrax in animal models of infection. Furthermore, use of a recombinant spore as a delivery platform for therapeutic compositions provides adjuvant effects leading to both Th1 and Th2 immune responses, a feature not achieved with the current AVA vaccine. Lastly, expression of additional proteins, especially recombinant proteins, on the spore surface, for example; surface proteins from other biothreat agents, bacteria, viruses, or other pathogens could lead to the development of multivalent vaccines or therapeutic compositions against a variety of pathogens. Such vaccines or therapeutic compositions may suitable for use in man or animal.
[0057] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs at the time of filing.
Examples
[0058] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Experimental Procedures
Growth Conditions
[0059] Bacillus anthracis strain ASterne-1 was a gift from Dr. S. H. Leppla (National Institutes of Health, Bethesda, Md.). ASterne-1 is a strain derived from Sterne and lacks pXO1 and pXO2 (capsule- and toxin-negative). Sporulation was induced by growth on nutrient agar plates at 30? C. or in liquid culture using modified G Broth. Growth in liquid culture was monitored by absorbance at 600 nm. Sporulation was essentially complete (>95%) after 72 hours on nutrient agar plates. The degree of sporulation was assessed by phase contrast microscopy. Spores were harvested from 7-day old nutrient agar plates to ensure complete sporulation, washed 3 times in PBS, and stored at room temperature.
Creation of Fusion Constructs
[0060] Fusion constructs were created by polymerase chain reaction (PCR) amplification followed by splicing by overlapping extension as used in the art (see for example, Ho, et al., Gene 77: 51-59 (1989) and Horton, et al., Gene 77: 61-68 (1989)). Primers utilized in the PCR reactions are listed in Tables 1a and 1b. Correct fusions contained intact promoter regions including ?.sup.K elements, as well as native RBS and start codons. Fusion constructs were then subcloned into the shuttle plasmid pMK4 (see Sullivan et al., 1984), followed by electroporation into the ASterne strain of Bacillus anthracis. Selection of electrotransformed cells was on tryptic soy agar plates containing chloramphenicol at 10 ?g/ml. Verification of the correct identify of the plasmids in the transformed cells was accomplished by antibiotic selection, followed by DNA extraction and plasmid DNA sequencing from vegetative cells.
TABLE-US-00001 TABLE1a PolymeraseChainReactionPrimers. SEQ.ID. Fusion * Primer1 DNASequence NO. pBT1744 US 106 ctcgagtaatcaccctcttccaaatc 21 DS 177 ttaccaccgataccaccaatggtgagcaagggcgagg 22 pBT1742 US 106 ctcgagtaatcaccctcttccaaatc 23 DS 158 ccattattattgaaaaagttgctatggtgagcaagggcgagg 24 pBT1750 US 106 ctcgagtaatcaccctcttccaaatc 25 DS 213 ggaggtgaatttatggcatttgaccctaatcttg 26 pBT1758 US 106 ctcgagtaatcaccctcttccaaatc 27 DS 243 aaggctgccgcagcgatgtcaaataataattattcaaatgaccatgat 28 pBT1693 US 106 ctcgagtaatcaccctcttccaaatc 29 DS 65 ccaccgataccaccaatgagtaaaggagaagaacttttcac 30 pBT1694 US 106 ctcgagtaatcaccctcttccaaatc 31 DS 66 ttaccaccgataccaccaatgaccatgattacgccaagcttg 32 pBT1729 US 106 ctcgagtaatcaccctcttccaaatc 33 DS 83 acgctttatggaggtgaatttatgaccatgattacgccaagc 34 pBT1701 US 106 ctcgagtaatcaccctcttccaaatc 35 DS 94 tcaaatggattaaaccccgatgaatctttatcagctagtgcatttgac 36 cctaatatgaccatgattacgccaagcttgc pBT1720 US 106 ctcgagtaatcaccctcttccaaatc 37 DS 92 atgcttgtaggacctacattaccaccgataccaatgaccatgattacg 38 ccaagcttgc pBT1747 US 110 ctcgagattagaacgtaaccaatttag 39 DS 67 accttcccggttcttcccccaatgaccatgattacgccaagcttg 40 pBT1746 US 106 ctcgagtaatcaccctcttccaaatc 41 DS 142 acgctttatggaggtgaatttatgaaacagaatgacaaattatgg 42 *: DS, downstream primer; US, upstream primer US primer 1 corresponds upstream of the respective bclA or bclB promoter regions with associated XhoI sites. US primer 2 corresponds to the end of the promoter or sequences in the NTD with an overlapping extension matching DS primer 1. DS primer 1 corresponds with the 5p region of reporter genes (or NTDs fused to reporter genes for pBT1746, pBT1758). DS primer 2 corresponds to the 3p region of reporter genes with associated XhoI sites. pBT1746 was constructed by PCR amplification of construct pBT1747 (DS primers) followed by SOE to the bclA promoter region (US primers). pBT1758 was constructed by PCR amplification of the pBT1693 construct with (DS primers) followed by SOE to the PCR product of the amplification of the US primers.
TABLE-US-00002 TABLE1b PolymeraseChainReactionPrimers. SEQ.ID. Fusion * Primer2 DNASequence NO. pBT1744 US 178 cctcgcccttgctcaccattggtggtatcggtggtaa 43 DS 157 gcctcgagttacttgtacagctcgtccatgc 44 pBT1742 US 159 cctcgccatgctcaccatagcaactttttcaataataatgg 45 DS 157 gcctcgagttacttgtacagctcgtccatgc 46 pBT1750 US 214 gattagggtcaaatgccataaattcacctccata 47 DS 157 gcctcgagttacttgtacagctcgtccatgc 48 pBT1758 US 244 catcgctgcggcagccttgtacagctcgtccatgcc 49 DS 103 ctcgagttatttgtagagctcatccatgcc 50 pBT1693 US 100 ttctcctttactcattggtggtatcggtggtaatgtaggtcc 51 DS 103 ctcgagttatttgtagagctcatccatgcc 52 pBT1694 US 101 tggcgtaatcatggtcattggtggtatcggtggtaatgtagg 53 DS 104 ctcgagtaaaggaacagatggtggcgtccctcg 54 pBT729 US 90 caagcttggcgtaatcatggtcataaattcacctccataaagcgttc 55 DS 104 ctcgagtaaaggaacagatggtggcgtccctcg 56 pBT1701 US 95 gctgataaagattcatcggggtttaatccatttgaataattattatttgac 57 ataaattcacctccataaagcg DS 104 ctcgagtaaaggaacagatggtggcgtccctcg 58 pBT1720 US 85 tggtatcggtggtaatgtaggtcctacaagcataaattcacctccata 59 aagcg DS 104 ctcgagtaaaggaacagatggtggcgtccctcg 60 pBT1747 US 108 tggcgtaatcatggtcattgggggaagaaccgggaagg 61 DS 104 ctcgagtaaaggaacagatggtggcgtccctcg 62 pBT1746 US 143 cataatttgtcattctgtttcataaattcacctccataaagcgt 63 DS 104 ctcgagtaaaggaacagatggtggcgtccctcg 64 *Same footnote as Table 1a.
Spore Analysis by Flow Cytometry
[0061] Ten miligrams of spores were resuspended in 500 ?l of 4% paraformaldehyde in PBS and incubated for 2 hours at room temperature. The spores were then washed four times with PBS and resuspended in StartingBlock (Pierce) and incubated with mixing at room temperature for 45 minutes. The spores were then pelleted and resuspended in StartingBlock. Rabbit polyclonal antiserum (1:250 dilution) against rBclA was then added and incubated with mixing at room temperature for 45 minutes. The spores were then washed three times in StartingBlock PBS and then incubated with mixing with FITC-Protein A conjugate (Sigma Chemical Co.) and incubated for 45 minutes at room temperature. The spores were then washed three times with StartingBlock, followed by two washes with PBS and then processed on a FACScan flow cytometer using a 488 nm argon laser (Beckton Dickinson Biosciences). Data were analyzed using Cell Quest analysis software (Beckton Dickinson).
Micrograph Images
[0062] Samples from sporulating cells on nutrient agar plates or in modified G broth were collected at indicated intervals and diluted in 10 ?l of PBS containing DABCO (Diazabicyclooctane, Acros Organics) anti-fade reagent. All images were obtained using a Nikon E600 epi-fluorscence microscope using a 60? or 100? oil immersion objective.
Transmission Electron Microscopy
[0063] Immunogold labelling of embedded spores was performed after fixation of spores in a 2% glutaraldehyde and 2% formaldehyde PBS solution. Spores were embedded in 3% agar (EM Science, Gibbstown, N.J.). Dehydration involved sequential treatment with 25%, 50%, 75%, 95% and 100% acetone. Polymerization was carried out at 60? C. in Epon/araldite resin. Sections were cut at 85 nm thickness and put on 200-mesh carbon-coated copper grids; the cut grid sections were blocked in a 1% BSA solution for 30 min. The grids were washed three times in PBS, and the primary antibodies were added to the grids at a concentration of 1:25 in incubation buffer (Aurion). One hour later, the grids were washed six times in incubation buffer and incubated with 1:25 goat antirabbit secondary conjugated with 10 or 20 nm colloidal gold beads and allowed to bind for 2 hours. After a series of washes in PBS, the grids were post-fixed in 2% glutaraldehyde on 0.1 M PBS for 5 min and finished with washes in PBS and distilled water. Samples were examined with a JEOL 1200EX electron microscope.
Example 1: The BclA Protein Contains an N-Terminal Exosporium Targeting Domain
[0064] Given that the BclA protein associates with the exosporium via its N-terminus, this N-terminal conserved sequence, SEQ ID NO: 11 (see
[0065] To determine if the N-terminal domain of BclA is sufficient to target the native protein to the exosporium, two gene fusions were generated to the eGFP fluorescent reporter. PCR amplification of the upstream promoter/regulatory sequences of bclA and including the N-terminus coding sequence through the conserved motif or the entire bclA coding sequence was performed. These PCR products were then spliced with the eGFP reporter gene to produce in-frame fusions (
[0066] The transformed cells containing the BclA ORF fusion (pBT1742) or N-terminal domain (NTD) fusion (pBT1744) did not express the eGFP reporters during exponential growth (
[0067] For comparison, the BclA N-terminal domain fusion (pBT1744) was compared with a second constructed fusion consisting of the entire bclA open reading frame fused to the eGFP reporter gene (pBT1742,
Example 2: N-Terminal Amino Acids Required for Exosporium Incorporation
[0068] BclA released from spores lack its N-terminal 19 amino acids (Sylvestre et al., 2002; Steichen et al., 2003). It is unknown whether the proteolytic event resulting in the loss of these N-terminal residues takes place during exosporium assembly and BclA incorporation, or occurs after BclA has been stably inserted into the exosporium layer. To determine whether these initial N-terminal amino acids are required for efficient incorporation into the exosporium, a third fusion (pBT1750) was constructed, containing the bclA promoter region, RBS, through the bclA initiation codon followed by the the coding sequence for amino acids 20-35 of BclA fused to the eGFP coding sequence (see
[0069] To quantify the relative fusion incorporation levels, a direct comparison of the fluorescence associated with each spore type was undertaken by flow cytometry. All three fusions, (spores containing pBT1744, pBT1742, and pBT1750 fusions) localized to the spore surface to similar degrees (
TABLE-US-00003 TABLE 2 Fluorescence of Spores Determined by Flow Cytometry Designation % Positive Spores PMF PMF Fold Increase Over Background ?Sterne pMK4 5.5 7.42 1.0 pBT1742 89.5 140.9 19.0 pBT1744 99 307.9 41.5 pBT1693 98.3 59.69 8.0 ?Sterne pMK4 3.9 5.5 1.0 pBT1694 96.6 94.6 17.2 pBT1729 3.8 5.7 1.0 pBT1701 73.2 15.2 2.8 pBT1720 11.4 6 1.1 pBT1747 4.2 5.9 1.1 pBT1746 72.5 16 2.9
Example 3: Cleavage of the N-Terminal Domain Associates with Incorporation of BclA into the Exosporium
[0070] The attachment of the pBT1750-encoded fusion implied that the truncated BclA can be recognized and attached to the exosporium. To address the question of whether cleavage of the intact BclA N-terminal domain occurs during exosporium formation, a dual reporter fusion construct was made. The pBT1758-encoded fusion consists of the bclA promoter followed by the mCherry monomeric reporter gene (Shaner et al., 2005; Giepmans et al., 2006) fused in frame to the BclA N-terminal domain that was in turn fused in frame to the GFPuv reporter (
[0071] Similar to the findings with the single-reporter fusions, the pBT1758 fusion appeared in the mother cell cytoplasm prior to the appearance of the emerging spore (
[0072] The systematic cleavage of the reporter fusions at the site of the exosporium assembly demonstrated the difference in timing between the positioning of the BclA protein at the exosporium and the cleavage event. No discernable red or orange fluorescence was observed in the released spores, demonstrating a correlation of the cleavage event with the final incorporation of BclA into the exosporium. Therefore, the loss of the N-terminal residues of BclA results from events related to exosporium synthesis and not subsequent release of BclA.
Example 4: Reporter Oligomerization is not Required for Exosporium Incorporation
[0073] The interwinding of the individual native BclA molecules to form a triple helix in wild-type spores is made possible by interactions among the C-terminal domains of the BclA monomers (Boydston et al., 2005). The ability of pBT1744 and pBT1750 fusions, lacking both the C-terminal domain of BclA and the collagen-like region (CLR) with its associated glycosylation sites (Daubenspeck et al., 2004), to localize to the exosporium suggests that neither oligomerization of proteins nor glycosylation of the CLR are essential for incorporation of proteins into the exosporium of B. anthracis. Although not essential, oligomerization of proteins may be beneficial in localization to the exosporium. Two additional constructs were made that contained the BclA protein sequence from pBT1744, but fused to the GFPuv reporter (pBT1693) or DsRed (pBT1694,
[0074] To eliminate the possibility that the reporter proteins bind non-specifically to the exosporium, a control fusion was constructed. DsRed was expressed under the control of the bclA promoter and ribosome binding site (RBS) but without any of the bclA N-terminal coding sequence (pBT1729;
Example 5: Contributions of the Conserved Motif and N-Terminal Sequences to Exosporium Incorporation of Reporter Proteins
[0075] To determine if the conserved motif sequence identified in
[0076] The pBT1720-encoded fusion protein, consisting of the conserved motif alone fused to DsRed, but lacking the rest of the BclA initial N-terminal residues (residues 2-24, which includes the proteolytic cleavage site), concentrated around the spore periphery quickly after being expressed with a corresponding decrease in cytoplasmic fluorescence. However, released spores were devoid of fluorescence (
[0077] To quantify the level of incorporation of each of the DsRed-containing fusion constructs into the released spores, flow cytometry was performed on purified, paraformaldehyde-fixed spores (
Example 6: Exosporium Incorporation Utilizing the BclB N-Terminal Domain
[0078] After establishing that the BclA N-terminal domain was sufficient to localize proteins to the spore periphery, the ability of the corresponding BclB domain to target proteins to the exosporium was studied. The DsRed reporter was fused to the BclB N-terminus with the coding sequence up to and including the conserved region, with the natural bclB promoter and RBS (pBT1747;
[0079] To increase production of the BclB fusion proteins, the BclB N-terminal sequence fused to DsRed was positioned under the control of the more active bclA promoter and RBS elements (pBT1746;
Example 7: Native BclA is Incorporated into Spores Expressing Reporter Proteins
[0080] To determine if native BclA continued to be incorporated into the exosporium in cells expressing the Bcl-domain-containing fusions, fluorescent purified spores were incubated with rabbit anti-recombinant BclA polyclonal antibodies followed by FITC-Protein A conjugate (
Example 8: Incorporation of Fusion Proteins onto the Exosporium Surface
[0081] Exosporium targeting was checked by immune-electron microscopy analysis of spores containing the pBT1744-encoded BclA N-terminal fusion to eGFP. Spores were analysed under TEM after treatment with either anti-rBclA rabbit polyclonal antibodies or anti-GFP rabbit polyclonal antibodies (lmgenex). These primary antibodies were followed with secondary gold-labelled anti-rabbit antibodies bearing 20 and 10 nm gold particles, respectively (
Example 9: The BAS3290 Protein can be Used to Introduce Foreign Antigens
[0082] The BAS3290 protein of B. anthracis is predicted to localize to the exosporium due to the high degree of identity of its N-terminal domain (SEQ ID NO: 8) to the N-terminal domain of the localization domain of the BclA protein (SEQ ID NO: 7; 13 of 14 amino acid residues identical). A fusion of the entire BAS3290 ORF to the EGFP reporter under the control of the native BAS3290 ?.sup.K promoter was constructed. This fusion protein was produced late in the sporulation process, which was consistent with transcription under this promoter. This fusion protein was produced and localized immediately to the exosporium (
Example 10: Other Exosporium Containing-Bacillus Species
[0083] To demonstrate the conserved nature of the localization machinery in the Bacillus cereus family, the pBT1744 construct (B. anthracis BclA N-terminal domain fused to EGFP; see Thompson et al. 2008) was utilized. This pBT1744 construct was electroporated into B. cereus strain 14579 and B. thuringiensis strain kurstaki. Proper antibiotic resistant clones were allowed to enter sporulation, and observed upon release of free spores. The B. anthracis BclA N-terminal domain localized and attached to the spores of both B. cereus (
Example 11: Bacillus Exosporium Antigen Delivery (BEAD) Systems
[0084] The ORF5 from the Porcine Respiratory and Reproductive Virus (PRRSV), which encodes a protective, neutralizing protein, was chosen to be an exemplary foreign antigen expressed using the BEAD system in different Bacillus cereus family members. Polymerase chain reaction (PCR) of the PRRSV ORF5 was accomplished using standard techniques. Fusion of the PRRSV ORF5 to the N-terminal domain of BclA or BclB was accomplished by splicing and overlapping extension techniques well-known in the art. Correct fusions were cloned into the shuttle plasmid pMK4, sequenced, and electroporated into B. anthracis strain ASterne and B. thuringiensis strain kurstaki. Correct transformants were selected, grown in Brain Heart Infusion broth and then allowed to sporulate by plating onto N agar plates at 30? C. Free spores were collected after 3 days, and washed with PBS to remove vegetative cell debris. Purified spores were then subjected to immunolabeling with sera from either preimmune pigs, or from pigs previously infected with PRRSV and to whom a known titer to PRRSV had been established. Exposure to sera was followed with protein A-FITC conjugate, which binds to all antibodies and lights up green. As shown in
[0085] In B. thuringiensis, the BclA NTD tagged PRRSV ORF5 localized to the exosporium, but mostly preferentially to one pole (
[0086] Next, extraction of the spore layers from the B. thuringiensis spore expressing the PRRSV ORF5 protein fused to the BclA protein was undertaken. Separation of these extracted proteins by SDS-PAGE, followed by western blotting with immune and preimmune pig sera (
[0087] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the following claims.
REFERENCES
[0088] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. All patents and publications referred to herein are incorporated by reference. [0089] Baillie, L., Hibbs, S., Tsai, P., Cao, G. L., and Rosen, G. M. (2005) Role of superoxide in the germination of Bacillus anthracis endospores. FEMS Microbial. Lett. 245: 33-38. [0090] Baird, G. S., Zacharias, D. A., and Tsien, R. Y. (2000) Biochemistry, mutagenesis, and oligomerization of DsRed, a red fluorescent protein from coral. Proc. Natl. Acad. Sci USA 97: 11984-11989. [0091] Barnes, A. G., Cerovic, V., Hobson, P. S., and Klavinskis, L. S. (2007) Bacillus subtilis spores: a novel microparticle adjuvant which can instruct a balanced Th1 and Th2 immune response to specific antigen. Eur. J. Immunol. 37: 1538-1547. [0092] Basu, S., Kang, T. J., Chen, W. H., Fenton, M. J., Baillie, L., Hibbs, S., and Cross, A. S. (2007) Role of Bacillus anfhracis spore structures in macrophage cytokine responses. infect lmmun. 75: 2351-2358. [0093] Bergman, N. H., Anderson, E. C., Swenson, E. E., Niemeyer, M. M., Miyoshi, A. D., and Hanna, P. C. (2006) Transcriptional profiling of the Bacillus anthracis life cycle in vitro and an implied model for regulation of spore formation. J. Bacterial. 188: 6092-6100. [0094] Boydston, J. A., Chen, P., Steichen, C. T., and Turnbough, C. L. Jr. (2005) Orientation within the exosporium and structural stability of the collagen-like glycoprotein BclA of Bacillus anthracis. J. Bacteriol. 187: 5310-5317. [0095] Boydston, J. A., Yue, L., Kearney, J. P., and Turnbough, C. L. Jr. (2006) The ExsY protein is required for complete formation of the exosporium of Bacillus anthracis. J. Bacterial. 188: 7440-7448. [0096] Brossier, F., Levy, M., and Mock, M. (2002) Anthrax spores make an essential contribution to vaccine efficacy. Infect. Immun. 70: 661-664. [0097] Ciabattini, A., Parigi, R., Isticato, R., Oggioni, M. R., and Pozzi, G. (2004) Oral priming of mice by recombinant spores of Bacillus subtilis. Vaccine. 22:4139-4143. [0098] Chakrabarty, K., Wu, W., Booth, J. L., Duggan, E. S., Coggeshall, K. M., and Metcalf, J. P. (2006) Bacillus anthracis spores stimulate cytokine and chemokine innate immune responses in human alveolar macrophages through multiple mitogen-activated protein kinase pathways. Infect Immun. 74: 4430-4438. [0099] Daubenspeck, J. M., Zeng, H., Chen, P., Dong, S., Steichen, C. T., Krishna, N. R., Pritchard, D. G., and Turnbough, C. L. Jr. (2004) Novel oligosaccharide side chains of the collagen-like region of BclA, the major glycoprotein of the Bacillus anthracis exosporium. J. Biol. Chem. 279: 30945-30953. [0100] Driks, A. (2002) Maximum shields: the assembly and function of the bacterial spore coat. Trends Microbial. 10: 251-254. [0101] Duc, L. H, Hong, H. A., Atkins, H. S., Flick-Smith, H. C., Durrani, Z., Rijpkema, S., Titball, R. W., and Cutting, S. M. (2007) Immunization against anthrax using Bacillus subtilis spores expressing the anthrax protective antigen. Vaccine 25: 346-355. [0102] Duc, L. H., Hong, H. A., Fairweather, N., Ricca, E., and Cutting, S. M. (2003) Bacterial spores as vaccine vehicles. Infect. Immun. 71: 2810-2818. [0103] Giorno, R., Bozue, J., Cote, C., Wenzel, T., Moody, K. S., Mallozzi, M., Ryan, M., Wang, R., Zielke, R., Maddock, J. R., Friedlander, A., Welkos, S., and Driks, A. (2007) Morphogenesis of the Bacillus anthracis spore. J. Bacterial. 189: 691-705. [0104] Hachisuka, Y., Kojima, K., and Sato, T. (1966) Fine filaments on the outside of the exosporium of Bacillus anthracis spores. J. Bacterial. 91: 2382-2384. [0105] Haldenwang, W. G. (1995) The sigma factors of Bacillus subtilis. Microbial. Rev. 59: 1-30. [0106] Henriques, A. O., and Moran, C. P. Jr. (2007) Structure, assembly, and function of the spore surface layers. Ann. Rev. Microbial. 61: 555-588. [0107] Hilbert, D. W., and Piggot, P. J. (2004) Compartmentalization of gene expression during Bacillus subtilis spore formation. Microbial Mol. Biol. Rev. 68: 234-262. [0108] Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77: 51-59. [0109] Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., and Pease, L. R. (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61-68. [0110] Isticato, R., Cangiano, G., Tran, H. T., Ciabattini, A., Medaglini, D., Oggioni, M. R., De Felice, M., Pozzi, G., and Ricca, E. (2001) Surface display of recombinant proteins on Bacillus subtilis spores. J. Bacterial. 183: 6294-6301. [0111] Kramer, M. J., and Roth, I. L. (1968) Ultrastructural differences in the exosporium of the Sterne and Vollum strains of Bacillus anthracis. Can J. Microbial. 14: 1297-1299. [0112] Little, S. F., and Knudson, G. B. (1986) Comparative efficacy of Bacillus anthracis live spore vaccine and protective antigen vaccine against anthrax in the guinea pig. Infec. Immun. 52: 509-512. [0113] Mauriello, E. M., Due, L. H., Isticato, R., Cangiano, G., Hong, H. A., De Felice, M., Ricca, E., and Cutting, S. M. (2004) Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner. Vaccine 22: 1177-1187. [0114] Paccez, J. D., Nguyen, H. D., Luiz, W. B., Ferreira, R. C., Sbrogio-Almeida, M. E., Schuman, W., and Ferreira, L. C. (2007) Evaluation of different promoter sequences and antigen sorting signals on the immunogenicity of Bacillus subtilis vaccine vehicles. Vaccine 25: 4671-4680. [0115] Raines, K. W., Kang, T. J., Hibbs, S., Cao, G. L., Weaver, J., Tsai, P., Baillie, L., Cross, A. S., and Rosen, G. M. (2006) Importance of nitric oxide synthase in the control of infection by Bacillus anthracis. Infect. Immun. 74: 2268-2276. [0116] Redmond, C., Baillie, L. W., Hibbs, S., Moir, A. J., and Moir, A. (2004) Identification of proteins in the exosporium of Bacillus anthracis. Microbial. 150: 355-363. [0117] Steichen, C., Chen, P., Kearney, J. P., and Turnbough, C. L. Jr. (2003) Identification of the immunodominant protein and other proteins of the Bacillus anthracis exosporium. J. Bacterial. 185: 1903-1910. [0118] Steichen, C. T., Kearney, J. P., and Turnbough, C. L. Jr. (2005) Characterization of the exosporium basal layer protein BxpB of Bacillus anthracis. J. Bacterial. 187: 5868-5876. [0119] Sullivan, M. A., Yasbin, R. E., and Young, F. E. (1984) New shuttle vectors for Bacillus subtilis and Escherichia coli which allow rapid detection of inserted fragments. Gene 29: 21-26. [0120] Sylvestre, P., Couture-Tosi, E., and Mock, M. (2002) A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Mol. Microbial. 45: 169-178. [0121] Sylvestre, P., Couture-Tosi, E., and Mock, M. (2003) Polymorphism in the collagen-like region of the Bacillus anthracis BclA protein leads to variation in exosporium filament length. J. Bacterial. 185: 1555-1563. [0122] Swiecki, M. K., Lisanby, M. W., Shu, F., Turnbough, C. L. Jr, and Kearney, J. P. (2006) Monoclonal antibodies for Bacillus anthracis spore detection and functional analyses of spore germination and outgrowth. J. Immunol. 176: 6076-6084. [0123] Thompson, B. M., Walter, L. N., Fox, K. F., Fox, A., and Stewart, G. C. (2007) The BclB glycoprotein of Bacillus anthracis is involved in exosporium integrity. J. Bacterial. 189: 6704-6713. [0124] Thompson B M and Stewart G C. (2008) Targeting of the BclA and BclB proteins to the Bacillus anthracis spore surface. Mol Microbial. 70: 421-434. [0125] Turnbull, P. C. B. (1991) Anthrax vaccines: past, present and future. Vaccine 9: 533-539. [0126] Waller, L. N., Stump, M. J., Fox, K. F., Harley, W. M., Fox, A., Stewart, G. C., and Shahgholi, M. (2005) Identification of a second collagen-like glycoprotein produced by Bacillus anthracis and demonstration of associated spore-specific sugars. J. Bacterial. 187: 4592-4597. [0127] Weaver, J., Kang, T. J., Raines, K. W., Cao, G. L., Hibbs, S., Tsai, P., Baillie, L., Rosen, G. M., and Cross, A. S. (2007) Protective role of Bacillus anthracis exosporium in macrophagemediated killing by nitric oxide. Infect. Immun. 75:3894-3901. [0128] Yang, F., Moss, L. G., and Phillips, G. N. Jr. (1996) The molecular structure of green fluorescent protein. Nature Biotech. 14: 1246-1251.