ANDROGENETIC HAPLOID EMBRYONIC STEM CELL, AND PREPARATION METHOD AND USE THEREOF

20180251728 ยท 2018-09-06

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to an AG-haESCs in which H19 DMR and IG-DMR are knocked out, a method for preparing the AG-haESCs, and use of the AG-haESCs in constructing a genetically modified semi-cloned animal and a library of a genetically modified semi-cloned animal. The AG-haESCs is capable of obtaining characteristics resembling a round spermatid, and upon injection into an oocyte, a viable SC mouse is stably obtained. The present invention is capable of being effectively used in multi-gene genetic manipulation, advancing the acquisition of animals with multiple genetic modifications.

Claims

1. An androgenetic haploid embryonic stem cell (AG-haESC), in which H19 DMR and IG-DMR are knocked out.

2. The AG-haESC according to claim 1, wherein the AG-haESC is derived from a mammal, preferably from a rodent, more preferably from a murine, and most preferably from a mouse.

3. A method for producing an AG-haESC, comprising: knocking out H19 DMR and IG-DMR from an AG-haESC, to obtain the AG-haESC.

4. The method for producing an AG-haESC according to claim 3, wherein the H19 DMR and IG-DMR are knocked out by CRISPR/Cas9-mediated genetic manipulation.

5. The method for producing an AG-haESC according to claim 3, further comprising: modifying one or more target genes of interest in the AG-haESC.

6. (canceled)

7. A method for constructing a genetically modified semi-cloned animal, comprising: combining an AG-haESC in which H19 DMR and IG-DMR are both knocked out with an oocyte to obtain a semi-cloned embryo, and incubating the semi-cloned embryo to obtain a semi-clone animal.

8. The method for constructing a genetically modified semi-cloned animal according to claim 7, wherein the semi-cloned embryo is obtained by ICAHCI with the AG-haESC in which H19 DMR and IG-DMR are both knocked out as a donor for ICAHCI.

9. The method for constructing a genetically modified semi-cloned animal according to claim 7, wherein one or more target genes of interest in the AG-haESC in which H19 DMR and IG-DMR are both knocked out are modified.

10. The method for constructing a genetically modified semi-cloned animal according to claim 7, wherein the semi-cloned animal is a non-human mammal, preferably a rodent, more preferably a murine, and most preferably a mouse.

11. A genetically modified animal, which is a semi-cloned animal constructed according to the method as set forth in claim 7, or a sexually reproduced offspring of a semi-cloned animal constructed according to the method as set forth in claim 7.

12. A method for constructing a genetically modified semi-cloned animal library, which is one of Method 1, comprising the steps of: 1) infecting the AG-haESCs according to claim 1 with virus particles prepared with the lentiviral sgRNA library plasmids, to obtain an AG-haESC library carrying the sgRNA library; 2) obtaining a semi-cloned embryo library by ICAHCI using a vector expressing Cas9 and/or Cas9 mRNA, with AG-haESCs in the AG-haESC library carrying the sgRNA library as a donor for ICAHCI; and 3) incubating the embryos in the semi-cloned embryo library to obtain a semi-cloned animal library; and Method 2, comprising the steps of: 1) infecting the AG-haESCs according to claim 1 with lentiviral particles expressing Cas9 and lentiviral particles prepared with the lentiviral sgRNA library, to obtain an AG-haESC library with constant expression of the sgRNA library and Cas9; 2) obtaining a semi-cloned embryo library by ICAHCI with AG-haESCs in the AG-haESC library with constant expression of the sgRNA library and Cas9 as a donor for ICAHCI; and 3) incubating the embryos in the semi-cloned embryo library to obtain a semi-cloned animal library.

13. The method for constructing a genetically modified semi-cloned animal library according to claim 12, wherein Step 2) in Method 1 is selected from any one of: Method A, comprising: further transfecting the AG-haESC library carrying the sgRNA library with a plasmid expressing Cas9, and obtaining the semi-cloned embryos by ICAHCI using the resultant AG-haESCs as a donor for ICAHCI; Method B, comprising: injecting AG-haESCs in the AG-haESC library carrying the sgRNA library, as a donor for ICAHCI, into mature oocytes by ICAHCI, and then injecting Cas9 mRNA into the reconstructed oocytes, to obtain the semi-cloned embryos; and Method C, comprising: further transfecting the AG-haESC library carrying the sgRNA library with a plasmid expressing Cas9, injecting the resultant AG-haESCs, as a donor for ICAHCI, into mature oocytes by ICAHCI, and then injecting Cas9 mRNA into the reconstructed oocytes, to obtain the semi-cloned embryos.

14. The method for constructing a genetically modified semi-cloned animal library according to claim 13, wherein the plasmid expressing Cas9 is pX330-mCherry plasmid.

15. The method for constructing a genetically modified semi-cloned animal library according to claim 12, wherein the animals in the semi-cloned animal library are heterozygous and/or biallelic mutant animals.

16. The method for constructing a genetically modified semi-cloned animal library according to claim 12, wherein the semi-cloned animal library is a non-human mammalian library, preferably a rodent library, more preferably a murine library, and most preferably a mouse library.

17. A genetically modified semi-cloned animal library, constructed according to the method for constructing a genetically modified semi-cloned animal library as set forth in claim 12.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG. 1A is a view schematically showing the production of SC mice by intracytoplasmic AG-haESCs injection (ICAHCI) of AG-haESCs bearing 2 DMR knockouts.

[0020] FIG. 1B shows androgenetic haploid embryos produced by injection of H19.sup..sup.DMR spermatids into enucleated MII oocytes.

[0021] FIG. 1C shows one of the AG-haESC lines established with an androgenetic haploid blastocyst.

[0022] FIG. 1D shows H19.sup..sup.DMR AG-haESCs (H19.sup..sup.DMR-AGH-1) established by multiple FACS enrichments of haploid cells.

[0023] FIG. 1E shows SC mice produced with H19.sup..sup.DMR-AGH-1 (p8) by ICAHCI.

[0024] FIG. 1F is a view schematically showing an IG-DMR knockout sgRNA sequence.

[0025] FIG. 1G shows production of H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-1 cell line. Left panel: collected mCherry positive cells plated in a Petri dish. Right panel: established H19.sup..sup.DMR-IG.sup..sup.DMR-AGH cell line (H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-4).

[0026] FIG. 1H shows SC mice produced with H19.sup..sup.DMR-IG.sup..sup.DMR-AGU-4 (p29) by ICAHCI.

[0027] Fig. S1A shows genotyping of H19.sup..sup.DMR-AGH cell line.

[0028] Fig. S1B shows that 80% of the embryos reconstructed with H19.sup..sup.DMR-AGH cells reach 2-cell embryos, which is similar to the developmental rate obtained upon round spermatid injection (ROSI).

[0029] Fig. S1C shows SC mice produced with H19.sup..sup.DMR-AGH-1, 2, 3 cell lines by ICAHCI, in which asterisk represents growth-arrested SC mice.

[0030] Fig. S1D shows genotyping of H19.sup..sup.DMR-AGH cell-derived SC mice.

[0031] Fig. S1E shows expression analysis of imprinted gene (Gtl2 and Dlk1) in various organs of H19.sup..sup.DMR-AGH cell-derived normal and growth-arrested SC mice.

[0032] Fig. S1F shows severely erased methylation imprinting of IG-DMR in growth-arrested SC mice.

[0033] Fig. S1G shows Cobra assay of IG-DMR in growth-arrested and normal SC mice.

[0034] Fig. S1H shows methylation state of IG-DMR in H19.sup..sup.DMR-AGH cell line.

[0035] FIG. 2A shows semi-cloned mice produced with IG.sup..sup.DMR-AGH-1 cell line (P17), in which asterisk represents growth-arrested SC mice, which die shortly after birth.

[0036] FIG. 2B shows methylation state of H19 DMR in normal and abnormal SC mice produced with IG.sup..sup.DMR-AGR-1 cell line.

[0037] FIG. 2C schematically shows H19 DMR knockout sgRNAs designed.

[0038] FIG. 2D shows genotyping of H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-OG3 cell lines, produced by knocking out H19 and IG-DMRs from AGH-OG3 cell line.

[0039] FIG. 2E shows genotyping of offspring obtained by mating SC mice produced with DKO-AG-haESCs, where the offspring carrying IG-DMR die before or shortly after birth.

[0040] FIG. 2F shows analysis of gene expression profile of DKO-AG-haESCs by RNA-seq. The gene expression profile is clustering of the expression of all genes. The three DKO-AG-haESC cell lines show a gene expression profile that is similar to that of the AG-haESCs in the control group, but very different from that of the round spermatid. To avoid the effect of haploid diploidization on the expression profile, G0/G1 cells are collected by FACS for RNA-seq.

[0041] FIG. 2G shows imprinted gene expression profile of DKO-AG-haESCs. The expression profiles of three different DKO-AG-haESC lines are similar to that of the AG-haESCs in the control group, but different from that of the round spermatids in mice

[0042] FIG. 2H shows analysis of methylation in DKO-AG-haESCs by RRBS.

[0043] Fig. S2A shows genotyping of H19.sup..sup.DMR-IG.sup..sup.DMR-AGH cell line obtained by knocking out IG-DMR from H19.sup..sup.DMR-AGH cells.

[0044] Fig. S2B shows the sequencing result of a DKO-AG-haESC cell line (H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-4).

[0045] Fig. S2C shows 2-cell embryos obtained with H19.sup..sup.DMR-IG.sup..sup.DMR-AGR cells by ICAHCI.

[0046] Fig. S2D shows genotyping of SC mice, where H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-4-derived SC mice all have H19 and IG DMR knockouts.

[0047] Fig. S2E shows SC mice produced with IG.sup..sup.DMR-AGH-2 (p8).

[0048] Fig. S2F shows the methylation state of H19 DMR in IG.sup..sup.DMR-AGH cells.

[0049] Fig. S2G shows the methylation state of H19 DM in IG.sup..sup.DMR-AGH-2-derived normal and growth-arrested SC mice.

[0050] Fig. S2H shows sequencing of a DKO-AG-haESC cell line (IG.sup..sup.DMR-H19.sup..sup.DMR-AGH-2).

[0051] Fig. S2I shows SC mice produced with IG.sup..sup.DMRH19.sup..sup.DMR-AGH-2 cells (p24) by ICAHCI.

[0052] FIG. 52J shows genotyping of IG.sup..sup.DMR-H19.sup..sup.DMR-AGR-2-derived SC mice.

[0053] FIG. 3A is a view schematically showing Tet1, Tet2 and Tet3 sgRNAs.

[0054] FIG. 3B shows mCherry positive cells collected by FACS, which are plated in a Petri dish, to obtain DKO-AG-haESCs with mutant Tet family of genes.

[0055] FIG. 3C shows a Tet-TKO-DAH cell line obtained.

[0056] FIG. 3D shows sequencing of Tet1, Tet2 and Tet3 in the Tet-TKO-DAH cell line.

[0057] FIG. 3E shows sequencing of PCR products of Tet1, Tet2 and Tet3 genes in SC mice produced with Tet-TKO-DAH-1 and Tet-TKO-DAH-2 cell lines.

[0058] FIG. 3F is a view schematically showing p53, p63 and p73 sgRNAs.

[0059] FIG. 3G shows sequencing of p53, p63 and p73 in p53-TKO-DAH-2 cell line.

[0060] FIG. 3H is a view schematically showing Tet1-EGFP, Tet2-mCherry, and Tet1-ECFP double-stranded DNA vectors, in which EGFP, mCherry, and ECFP are respectively fused to a stop codon of Tet1, Tet2, and Tet3.

[0061] FIG. 3I shows genotyping of Tet-TKO-DAH-1 cell line.

[0062] Fig. S3A shows sequencing of 2 DKO-AG-haESCs cell lines (H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-OG3-1 and H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-OG3-1) obtained by knocking out H19 and IG-DMR from WT-AG-haESCs (AGH-OG3).

[0063] Fig. S3B shows SC mice produced with H19.sup..sup.DMR-IG.sup..sup.DMR-AGU-OG3-1 (p26) by ICAHCI.

[0064] Fig. S3C shows genotyping of SC mice produced with H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-OG3-2 cell line.

[0065] Fig. S3D shows expression analysis of imprinted gene (H19, Igf2, Gtl2 and Dlk1) in DKO-AG-haESCs and normal AG-haESCs, where after H19 and IG-DMR are knocked out, the expression of H19 and Gtl2 in AGH-OG-3 is down regulated, while the expression of Igf2 and Dlk1 is up regulated.

[0066] Fig. S3E shows bigwig track of H19 and Gtl2. The RNA-seq result shows that compared with WT-AG-haESCs, the expression level of H19 and Gtl2 in DKO-AG-haESCs is much lower.

[0067] Fig. S3F shows the methylation levels in H19-Igf2 and Dlk1-Dio3 imprinted cluster regions.

[0068] Fig. S3G shows the methylation state of imprinted genes in DKO-AG-haESCs, WT-AG-haESCs, and round spermatids.

[0069] FIG. 4A is a view schematically showing a large number of heterozygous mutant SC mice produced with DKO-AG-haESCs carrying sgRNA library by ICAHCI.

[0070] FIG. 4B represents mCherry-positive haploid cells successfully transfected with Cas9 enriched by FACS for subsequent ICAHCI.

[0071] FIG. 4C shows PCR identification of sgRNAs in single cell derived haploid clones, where the tested cell clones all carry sgRNAs.

[0072] FIG. 4D shows sequencing of different mutant genes in cell clones, where the tested cell clones all have modifications of the genes of interest.

[0073] FIG. 4E shows SC mice derived from DKO-AG-haESCs carrying sgRNA library.

[0074] FIG. 4F shows PCR identification of sgRNAs in SC mice.

[0075] FIG. 4G shows sequencing of different mutant genes of interest in SC mice, where all the tested SC mice have modifications of the genes of interest.

[0076] Fig. S4A shows sequencing of Tet1, Tet2 and Tet3 in Tet-TKO-DAH-3 cell line.

[0077] Fig. S4B shows SC mice produced with Tet-TKO-DAH-3 (p36) by ICAHCI.

[0078] Fig. S4C shows sequencing of p53, p63 and p73 in p53-TKO-DAH-1 cell line.

[0079] Fig. S4D shows SC mice produced with p53-TKO-DAH-1 cell line (p44) by ICAHCI.

[0080] Fig. S4E shows sequencing of p53, p63 and p73 in SC mice produced with p53-TKO-DAH-1 and p53-TKO-DAH-2 cell line.

[0081] FIG. 5A is schematic representation of a large number of bi-allelic mutant SC mice produced by ICAHCI with DKO-AG-haESCs that carry consistently expressed Cas9 and sgRNA library.

[0082] FIG. 5B shows PCR analysis of Cas9 in single cell-derived cell clone, where all tested cell clones comprises the Cas9 transgene.

[0083] FIG. 5C shows quantitative PCR analysis of Cas9 in single cell-derived cell clones.

[0084] FIG. 5D shows PCR identification of sgRNAs in single cell-derived cell clones.

[0085] FIG. 5E shows SC mice derived from DKO-AG-haESCs that carry constantly expressed Cas9 and sgRNA library.

[0086] FIG. 5F shows PCR identification of sgRNAs in SC mice.

[0087] FIG. 5G shows bi-allelic mutant SC mice produced by ICAHCI with DKO-AG-haESCs that carry constantly expressed Cas9 and sgRNA Library, in which the Polm bi-allelic mutant SC mice are taken as an example.

[0088] FIG. 5H shows analysis of the polm gene mutation in the mouse tail by TA cloning and sequencing, where 24 out of 26 tested clones have a frameshift mutation.

[0089] FIG. 5I shows summary of TA cloning and sequencing results of 7 bi-allelic mutant SC mice, in which more than 80% of the clones have insertion or deletion mutations.

[0090] FIG. 5J shows TA cloning and sequencing of different organs in Scube1 bi-allelic mutant SC mice.

[0091] Fig. S5A is a view schematically showing Tet1-EGFP, Tet2-mCherry, and Tet3-ECFP exogenous double-stranded vectors.

[0092] Fig. S5B shows genotyping of Tet1-EGFP knock-in DKO-AG-haESCs.

[0093] Fig. S5C shows genotyping of Tet3-ECFP knock-in DKO-AG-haESCs.

[0094] Fig. S5D shows genotyping of Tet1&3-KI-DAH-1 cell line.

[0095] Fig. S5E shows sequencing of Tet1-EGFP and Tet-ECFP in Tet1&3-KI-DAH-1 cell line.

[0096] Fig. S5F shows 3-week-old SC mice produced with Tet1&3-KI-DAH-1 cell line (p40) by ICAHCI.

[0097] Fig. S5G shows genotyping of SC mice produced with Tet1&3-KI-DAH-1 cell line.

[0098] Fig. S5H shows sequencing of Tet2-mCherry in Tet-TKI-DAH-1 cell line.

[0099] Fig. S5I shows SC mice produced with Tet-TKI-DAH-2 cell line (p50).

[0100] Fig. S5J shows genotyping of SC mice produced with Tet-TKI-DAH-1 cell line.

[0101] Fig. S6A shows bi-allelic mutant mice produced by injecting haploid cells transiently treansfected with pX330-mCheny plasmid and carrying sgRNAs into mature oocytes and then injecting Cas9 mRNA to the reconstructed oocytes (where the protocol is known as Lenti-sgRNA+pX330+Cas9 injection).

[0102] Fig. S6B shows PCR identification of sgRNA insertion into single cell-derived haploid ES clones.

[0103] Fig. S6C shows SC mice produced with DKO-AG-haESCs carrying sgRNA library.

[0104] Fig. S6D shows PCR identification of sgRNAs in SC mice.

[0105] Fig. S6E shows bi-allelic mutant mice produced by injecting DKO-AG-haESCs carrying sgRNA library into oocytes, and then injecting Cas9 mRNA to SC embryos, in which bi-allelic mutant mice carrying Slco5al gene are taken as an example.

[0106] Fig. S6F shows TA cloning and sequencing of tails of mice carrying Slco5al gene, where 18 out of the 20 tested clones have insertion or deletion mutations.

[0107] Fig. S6G shows summary of TA cloning and sequencing results of 4 bi-allelic mutant mice.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0108] The present invention provides an androgenetic haploid embryonic stem cell (AG-haESC), in which H19DMR and IG-DMR are knocked out.

[0109] The AG-haESCs have a whole genome derived from spermatid, has the self-replication ability and pluripotency of stem cells, and can replace the spermatid to combine with oocytes to support the full development of embryos.

[0110] H19 DMR refers to a differentially methylated region (DMR) within the H19-Igf2 imprinted cluster. The specific location and sequence of H19 DMR can be determined according to the existing methods such as methylation sequencing or homologous sequence analysis and prediction. Human H19DMR is known to be located in the 1p15.5 region of the chromosome 1 and the mouse H19 DMR is located at the distal end of chromosome 7 between the two genes H19 and Igf2, a position from 2 kb to 4 kb upstream of the H19 gene. H19 DMR is methylated on the paternal allele, resulting in the inability of CTCF protein to bind to this methylated region so that the enhancer downstream of H19 does not need to cross over the obstacle CTCF, thereby increasing the expression of upstream Igf2 and decreasing the H19 expression. H19 DMR is demethylated on the maternal allele, and the CTCF protein is able to bind to this unmethylated region, so the enhancer downstream of H19 can only increase the H19 expression, and cannot regulate the upstream Igf2. If the paternal H19 DMR is knocked out, the enhancer downstream of H19 can upregulate the expression of Igf2. Since the androgenetic haploid is of paternal origin, theoretically it should be in a completely methylated state. However, studies show that the H19 DMR in the androgenetic haploid cultured in vitro suffers from abnormally erased methylation, and becomes demethylated, so that the expression of H19 is abnormally up-regulated and the expression of Igf2 is down-regulated. In the present invention, H19 DMR is knocked out and the abnormal state in which H19 expression is up-regulated and the Igf2 expression is down-regulated is corrected.

[0111] IG-DMR refers to a differentially methylated region (DMR) within the Dlk-Dio3 imprinted cluster. The specific location and sequence of IG DMR can be determined according to the existing methods such as methylation sequencing or homologous sequence analysis and prediction. The mouse IG-DMR is known to be located on the chromosome 12 in a 4.15 kb repeat between the genes Dlk1 and Gtl2 in the imprinted cluster, and the human IG-DMR is located on the chromosome 14 (14q32.2). IG-DMR is DNA methylated on the paternal allele, so the gene Gtl2 and some micromRNAs in this imprinted cluster are not expressed while the gene Rtl1, Dlk1 and Dio3 are expressed. IG-DMR is un-DNA methylated (in demethylated state) on the maternal allele, so Gtl2 and some micromRNAs are expressed while the gene Rtl1, Dlk1 and Dio3 are not expressed. In the androgenetic haploid (of paternal origin) and SC animals born abnormal, studies show that the normally methylated IG-DMR suffers from abnormally erased methylation, causing the silencing of the genes Rtl1, Dlk1, and Dio3, and the abnormal activation of Gtl2 and some microRNAs.

[0112] Further, the AG-haESCs undergo other genetic modifications in addition to H19 DMR and IG-DMR knockouts.

[0113] Specifically, genetic modification refers to the structural change of a gene made by a biological, chemical or physical means compared with that before modification, and this change mainly refers to the change in base pair composition, comprising, but not limited to, changes caused by the replacement, insertion, and deletion of one or more base pairs.

[0114] In a preferred embodiment, the genetic modifications of Tet1, Tet2, Tet3 and p53 family of genes are exemplified.

[0115] The AG-haESCs are derived from mammals, comprising human or non-human mammals. Preferably, the AG-haESCs are derived from a rodent, such as rabbit and murine that may be a mouse or a rat. In a preferred embodiment, the AG-haESCs are derived from mice.

[0116] Compared with AG-haESCs in which H19 DMR and IG-DMR are not both knocked out, the birth rate of semi-cloned animals constructed with the AG-haESCs of the present invention is higher.

[0117] The present invention also provides a method for preparing the AG-haESCs, which comprises knocking out the H19 DMR and IG-DMR from AG-haESCs, to obtain the AG-haESCs.

[0118] The H19 DMR and IG-DMR can be knocked out by using an existing gene editing method. In a preferred embodiment, the H19 DMR and IG-DMR are knocked out using CRISPR/Cas9-mediated gene manipulation. Gene knockouts may also be performed by other methods, and the present invention is not limited to the methods listed in the examples.

[0119] Due to the H19 DMR knockout, the complete sequence of H19 DMR is removed from the chromosome DNA; and due to the IG DMR knockout, the complete sequence of IG-DMR is removed from the chromosome DNA.

[0120] In an embodiment, H19 DMR knockout AG-haESCs are constructed firstly, and then IG-DMR is further knocked out. In another embodiment, IG-DMR knockout AG-haESCs are constructed firstly and then H19 DMR is further knocked out. In another example, AG-haESCs in which H19 DMR and IG-DMR are both knocked out are directly constructed.

[0121] Further, the AG-haESCs also undergo other genetic modifications.

[0122] Such other genetic modifications refer to genetic modifications other than H19 DMR and IG-DMR knockouts. Such other genetic modifications may be the modification of a single target gene or the modifications of multiple target genes of interest. The target gene of interest is not specific and can be set and modified as desired in the research. For example, such other genetic modifications may be the modifications of one, two or more target genes. The AG-haESCs of the present invention in which H19 DMR and IG-DMR are both knocked out can be passaged in vitro, and thus they can theoretically be genetically modified constantly. The number of modifications made to the target gene can be set as needed without particular limitation.

[0123] The genetic modifications comprise, but are not limited to, knock-in and knock-out of a target gene, and the like. The knock-in and knock-out of a target gene may be accomplished by techniques such as gene targeting and homologous recombination, comprising, but not limited to, genetic manipulation based on ZFN (zinc finger nuclease), TALEN (transcriptional activator-like effector nuclease) and CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats).

[0124] In an embodiment, the AG-haESCs in which the H19 DMR and IG-DMR are both knocked out undergo one or more genetic modifications to obtain the AG-haESCs with H19 DMR and IG-DMR knockouts and with other genetic modifications. Alternatively, AG-haESCs can be genetically modified first, followed by knocking out H19DMR and IG-DMR from the genetically mutated AG-haESCs. In addition to the above, other biotechnological means that can achieve the H19 DMR and IG-DMR knockouts and other genetic mutations can also be used to construct the AG-haESCs with H19 DMR and IG-DMR knockouts and with other genetic modifications.

[0125] The present invention also provides the use of the AG-haESCs in constructing genetically modified semi-cloned animals. Further, the AG-haESCs are used as a fertilizing vector in place of spermatid in the construction of genetically modified animals.

[0126] The present invention also provides a method for constructing a genetically modified semi-cloned animal, which comprises: combining an AG-haESC in which H19 DMR and IG-DMR are both knocked out with an oocyte to obtain a semi-cloned embryo, and incubating the semi-cloned embryo to obtain a semi-clone animal.

[0127] In general, the oocytes and the AG-haESCs are derived from the same kind of animal, preferably the same species of animal.

[0128] The semi-cloned embryo may specifically be an semi-cloned embryo obtained by ICAHCI using the AG-haESCs in which H19 DMR and IG-DMR are both knocked out as a donor for ICAHCI.

[0129] Further, the semi-cloned animal can be obtained by incubating the semi-cloned embryo in a suitable female organism by embryo transfer. In a preferred embodiment, the suitable maternal is a pseudopregnant ICR female rat.

[0130] Further, the AG-haESCs undergoes other genetic modifications.

[0131] The present invention further provides a genetically modified animal, which is constructed according to the above method, or is a sexually reproduced offspring of a semi-cloned animal constructed according to the above method.

[0132] The semi-cloned animal according to the present invention may be a non-human mammal. Preferably, the semi-cloned animal is a rodent, such as rabbit or murine. In a preferred embodiment, the semi-cloned animal is a mouse.

[0133] The present invention also provides a method for constructing a genetically modified semi-cloned animal library, which comprises the steps of:

[0134] 1) infecting the AG-haESCs according to the present invention with virus particles prepared with the lentiviral sgRNA library plasmids, to obtain an AG-haESC library carrying the sgRNA library;

[0135] 2) obtaining a semi-cloned embryo library by ICAHCI using a vector expressing Cas9 and/or Cas9 mRNA, with AG-haESCs in the AG-haESC library carrying the sgRNA library as a donor for ICAHCI; and

[0136] 3) incubating the embryos in the semi-cloned embryo library to obtain a semi-cloned animal library.

[0137] The sgRNA lentiviral library plasmids comprise several lentiviral vectors that express different sgRNAs. The lentiviral sgRNA library can be constructed by current technologies, or existing lentiviral sgRNA library plasmids may be used. Specifically, sgRNAs designed for different genes can be cloned into lentiviral vectors. The sgRNA can be designed according to the gene of interest.

[0138] In a preferred embodiment, a commercially available lentiviral sgRNA library of whole genomes of mice is employed.

[0139] Specifically, Step 2) may be selected from any one of:

[0140] Method A:

[0141] The AG-haESC library carrying the sgRNA library is further transfected with a plasmid expressing Cas9, and the semi-cloned embryos are obtained by ICAHCI using the resultant AG-haESCs as a donor for ICAHCI.

[0142] Method B:

[0143] AG-haESCs in the AG-haESC library carrying the sgRNA library, as a donor for ICAHCI, are injected into mature oocytes by ICAHCI, and then Cas9 mRNA is injected into the reconstructed oocytes, to obtain the semi-cloned embryos.

[0144] Method C:

[0145] The AG-haESC library carrying the sgRNA library is further transfected with a plasmid expressing Cas9, the resultant AG-haESCs, as a donor for ICAHCI, are injected into mature oocytes by ICAHCI, and then Cas9 mRNA is injected into the reconstructed oocytes, to obtain the semi-cloned embryo, from which a semi-cloned animal is obtained after embryo transfer.

[0146] In the methods A and C, the plasmid expressing Cas9 can be constructed by cloning the Cas9 expressing gene into an expression plasmid. In a preferred embodiment, the plasmid expressing Cas9 is pX330-mCherry plasmid. The plasmid that is constructed to express Cas9 is not limited to the pX330 plasmid. The expression plasmid only needs to be suitable for expression of exogenous genes in mammalian cells.

[0147] The present invention further provides another method for constructing a genetically modified semi-cloned animal library, which comprises the steps of:

[0148] 1) infecting the AG-haESCs according to the present invention with lentiviral particles expressing Cas9 and lentiviral particles prepared with the lentiviral sgRNA library, to obtain an AG-haESC library with constant expression of the sgRNA library and Cas9;

[0149] 2) obtaining a semi-cloned embryo library by ICAHCI with AG-haESCs in the AG-haESC library with constant expression of the sgRNA library and Cas9 as a donor for ICAHCI; and

[0150] 3) incubating the embryos in the semi-cloned embryo library to obtain a semi-cloned animal library.

[0151] The virus particles expressing Cas9 can be obtained by cloning the encoding gene expressing Cas9 into a lentiviral vector and then packaging the lentivirus in the prior art. The lentiviral vector expressing Cas9 is commercially available.

[0152] The semi-cloned animal library comprises several genetically mutated semi-cloned animals. The animals may be heterozygous or biallelic mutant animals.

[0153] Further, semi-cloned animals can be obtained by culturing the semi-cloned embryos in a suitable female organism by embryo transfer. In a preferred embodiment, the suitable female organism may be a pseudopregnant ICR female rat.

[0154] The present invention also provides a genetically modified semi-cloned animal library, which is constructed according to the method as described above.

[0155] The genetically modified semi-cloned animal library of the present invention can be used in genetic screening of genes at subordinate individual level.

[0156] The semi-cloned animal library of the present invention may be a non-human mammalian library. Preferably, the semi-cloned animal library is a rodent library, such as a rabbit library, and a murine library. In a preferred embodiment, the semi-cloned animal library is a mouse library.

[0157] The embodiments of the present invention are described below with reference to specific examples, and other advantages and effects of the present invention can be easily understood by those skilled in the art from the disclosure of the present invention. The present invention can also be implemented or practiced through additional different specific embodiments. The details in this specification may also be based on different perspectives and applications, and various modifications or changes can be made without departing from the spirit of the present invention.

[0158] When a numerical range is given in an example, it is to be understood that both endpoints of each numerical range and any numerical value between the two endpoints are encompassed, unless the context otherwise indicates. Unless defined otherwise, all technical and scientific terms as used herein have the same meanings as those commonly understood by those skilled in the art. In addition to the specific methods, equipment and materials used in the examples, the present invention may be implemented using any of the methods, devices, and materials in the prior art that are similar or equivalent to the methods, devices, and materials described in the examples of the present invention, based on the knowledge of those skilled in the art the prior art and the disclosure of the present invention,

[0159] Unless otherwise specified, in the experimental methods, detection methods, and preparation methods disclosed in the present invention, the conventional molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and conventional techniques in related fields are adopted. These techniques are well documented in the literature.

Abbreviations

[0160] AG-haESCs: androgenetic haploid embryonic stem cells

[0161] DKO-AG-haESCs: H19 DMR and IG-DMR double knockout androgenetic haploid embryonic stem cell

[0162] 1. Experimental Materials and Methods

[0163] 1.1. Materials and Reagents

[0164] The cell culture medium (DMEM), fetal bovine serum (FBS), serum replacement (KSR), trypsin, Opti-MEM, DPBS, and Lipofectamine 2000 were purchased from Life Technologies Inc.; the restriction endonucleases and T4 ligase were purchased from NEB; the Taq enzyme and dNTPs were purchased from TaKaRa; the CDNA reverse transcription kit, and fluorescent quantification reagent SYBR-Green were purchased from TOYOBO; and the oligonucleotides were synthesized by Shanghai Generay Company.

[0165] HEPES-CZB culture medium

[0166] H-CZB Stock 98.5 ml, Hepes.2Na (sigma, CAT#H0763) or ICN 520 mg or Hepes (sigma, CAT#H4034) 476 mg, NHCO.sub.3 42 mg, CaCl.sub.2.2H.sub.2O 100 stock 1 ml, Pyruvate 3.0 mg, and Glutamin 200 stock 0.5 ml, adjusted to pH 7.4, and filtered well.

[0167] H-CZB stock:

[0168] CZB stock 500 ml, PVA (sigma, P8136) 50 mg, CZB stock: H.sub.2O 985 ml, NaCl (sigma, CAT#55886) 4760 mg, KCL (sigma, CAT#P5405) 360 mg, MgSO.sub.4.7H.sub.2O (sigma, CAT#M1880) 290 mg, EDTA-2Na (sigma, CAT#E6635) 40 mg, Na-Lactate (sigma, CAT#L7900) 5.3 ml, D-Glucose (sigma, CAT#G6152) 1000 mg, and KH.sub.2PO.sub.4 (sigma, CAT#P5655) 160 mg

[0169] Activation solution: 10 mM Sr2+, 5 ng/ml Trichostatin A (TSA)

[0170] KSOM culture medium (KSOM+AA with glucose): millipore, CAT#MR-106-D

[0171] ESC medium:

[0172] DMEM (millipore, CAT#SLM-220-M) 75%, 20% serum replacement KSR (Gibco, CAT#10828-028), 1,500 U/ml LIF (Millopre, CAT#ESG1107), 3M CHIR99021 (Stemgent, CAT#04-0004), and 1M PD0325901 (Stemgent, CAT#04-0006)

[0173] Acid Tyrode solution: sigma, CAT#T1788

[0174] CZB culture medium:

[0175] CZB stock 99ML, CaCl.sub.2.2H.sub.2O 100 stock 1 ml, Pyruvate 3.0 mg, Glutamin 200 stock 0.5 ml, BSA 500 mg

[0176] pX330-mCherry:

[0177] enzymatically cleaving px330 (addgene) plasmid with Notl, and then inserting a CMV-mcherry-pA fragment amplified from pmCherry-C1 (Clontech) into the enzymatically cleaved px330 plasmid.

TABLE-US-00001 Primersforamplification: mCherry-F: ATTTGCGGCCGCATAGTAATCAATTACGGG mCherry-R: ATTTGCGGCCGCATGCAGTGAAAAAAATGC

[0178] Lentiviral sgRNA library of mice: supplied by Addgene

[0179] viral plasmid expressing Cas9: supplied by Addgene

[0180] Cas9 mRNA:

[0181] obtained as described in Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., and Jaenisch, R. (2013). One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910-918.

[0182] Round spermatid:

[0183] The mouse testis was digested with collagenase IV for 20 minutes and then with trypsin for 10 minutes, and then sorted by FACS, to obtain round spermatid of mice.

[0184] 1.2. Test Animals

[0185] All animals were used in accordance with the procedures in the animal operation manual of Institute of Biochemistry and Cells, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0186] H19 3.8 kb KO mice (C57/B6 background, homozygous): constructed as described in (Thorvaldsen, J. L., Mann, M R., Nwoko, O., Duran, K. L., and Bartolomei, M. S. (2002). Analysis of sequence upstream of the endogenous H19 gene reveals elements both essential and dispensable for imprinting. Molecular and cellular biology 22, 2450-2462.)

[0187] IG-DMRKO mice (C57/B6 background, heterozygous): constructed as described in (Lin, S. P., Youngson, N., Takada, S., Seitz, H., Reik, W., Paulsen, M., Cavaille, J., and Ferguson-Smith, A C. (2003). Asymmetric regulation of imprinting on the maternal and paternal chromosomes at the Dlk1-Gtl2 imprinted cluster on mouse chromosome 12. Nature genetics 35, 97-102)

[0188] B6D2F1 (C57BL/6DBA2) female mice: female offspring obtained after mating with female mice of C57BL/6 strain with male mice of DBA2 strain.

[0189] Pseudopregnant ICR female mice: ICR adult female mice purchased from SLAC Laboratory Animal Co., Ltd were mated with ligated adult ICR male mice, to obtain pseudopregnant ICR female rats.

[0190] 1.3. Establishment of AG-haESC Line

[0191] The AG-haESC line was constructed according a reported method (Yang, H., Shi, L., Wang, B. A., Liang, D., Zhong, C., Liu, W., Nie, Y., Liu, J., Zhao, J., Gao, X., et al. (2012). Generation of genetically modified mice by oocyte injection of androgenetic haploid embryonic stem cells. Cell 149, 605-617).

[0192] Method:

[0193] The MII oocytes were enucleated, into which the corresponding sperm heads were injected. Mouse MII oocytes were harvested 14 hours after treatment with human chorionic gonadotropin (HCG) and then enucleated using a Piezo needle in HEPES-CZB medium containing 5 g/ml cytochalasin B (CB). After enucleation, single sperm heads were injected into the cytoplasm of the oocytes. The reconstructed embryos were cultured in CZB medium for 1 hour and then transferred to the activation solution containing 1 mM Sr.sup.2+ for activation. After activation, all reconstructed embryos were transferred to KSOM medium containing amino acids and incubated at 37 C., and 5% CO.sub.2. The reconstructed embryos reaching the morula or blastula stage 3.5 days later were seeded in ESC medium.

[0194] The zona pellucid of the reconstructed embryos was removed by digestion with the acid Tyrode solution. Each embryo was transferred to a 96-well plate plated with a mouse fibroblast feeder layer and cultured with ESC medium containing 20% serum replacement (KSR), 1,500 U/ml LIF, 3M CHIR99021 and 1 M PD0325901. After 4-5 days of culture, the cell clones were trypsinized and transferred to a 96-well plate plated with a fresh feeder layer. The cells were further expanded, and passaged into a 48-well plate and further into a 6-well plate, and the cells were daily maintained in a 6-well plate. To sort the haploid cells, after the embryonic stem cells were trypsinized, they were washed once with PBS (GIBCO) and then in ESC medium containing 15 g/ml Hoechst 33342. After being placed in a water bath for 30 min, haploid cells of 1N peak were sorted by the flow cytometer BD FACS Ariall and subsequently subcultured to obtain the AG-haESC line.

[0195] 1.4 CRISPR-Cas9-Mediated Genetic Manipulation

[0196] Construction of CRISPR-Cas9 plasmid: The synthesized forward oligonucleotide strand and reverse oligonucleotide strand of sgRNA were annealed to obtain a double-stranded oligonucleotide strand (in the present invention, the sgRNA sequence refers to the sequence of the forward oligonucleotide strand of the sgRNA), which was then ligated to pX330-mCherry enzymatically cleaved with BbsI (New England Biolabs). The constructed corresponding plasmid was transfected into the AG-haESCs using Lipofectamine 2000 (Life Technologies) according to the instructions. 48 hours after transfection, the haploid cells with the red fluorescent protein were sorted by flow cytometry (FACSAriaII, BD Biosciences) and then plated at a low density. After 4-5 days of growth, monoclones were picked up for subsequent construction of cell lineages. Finally, cell lines with corresponding gene mutations were obtained by sequencing target genes by PCR.

[0197] If gene knock-in was involved, a double-stranded DNA donor needed to be constructed.

[0198] Preparation of double-stranded DNA donor:

[0199] A sequence encoding EGFP, mCherry or ECFP was amplified and then ligated to the pMD19-T vector, to give pMD19-T-EGFP/mCherry/ECFP. Subsequently, the left and right homologous arms of the target gene were inserted into the pMD 19-T-EGFP/mCherry/ECFP vector.

[0200] 1.5. Virus Production and Viral Infection of Double Knockout AG-haESCs (DKO-AG-haESCs)

[0201] The viral sgRNA library of mice and the Cas9 expressing viral plasmid have been reported mice (Cong., L, Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L A., et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823; and Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., and Yusa, K. (2014). Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature biotechnology 32, 267-273, 2014). The viral sgRNA library of mice and the Cas9 expressing viral plasmid used in the present invention were provided by Addgene. To prepare the virus, HEK293T was passaged in advance into a 10 cm petri dish, 3 g of viral plasmid (lentiviral sgRNA library or lentiviral Cas9) and 9 g of ViraPower Lentiviral Packaging Mix (Invitrogen) were transfected into HEK293T cells by using Lipofectamine 2000 Reagent (Invitrogen, Life Technologies). The supernatant were collected 72 hours after transfection and concentrated with Lenti-Concentin virus precipitation solution (SBI) and then stored at 80 C.

[0202] Infection with lentiviral Cas9: A cell suspension of 10.sup.8 DKO-AG-haESCs was infected for 48 hours with 8 g/ml polybrene (Sigma) and packaged lentiviral Cas9, and then screened for 3 days with 10 g/ml blasticidin (Sigma). The remaining resistant clone was a cell line integrated with lentiviral Cas9.

[0203] Infection with lentiviral sgRNA library: A cell suspension of 10.sup.8 DKO-AG-haESCs was infected for 48 hrs with 8 g/ml polybrene (Sigma) and packaged lentiviral CRISPR-sgRNA library, and then screened for 2 days in a medium comprising 1 g/ml puromycin (Invitrogen), to obtain a positive clone that is a cell line carrying lentiviral sgRNA library.

[0204] Co-infection with lentiviral Cas9 and lentiviral sgRNA library:

[0205] A cell line integrated with lentiviral Cas9 was prepared first, then further infected with the lentiviral sgRNA library, and then screened for 2 days in a medium comprising 1 g/ml puromycin (Invitrogen), to obtain a positive clone that is a cell line integrated with lentiviral Cas9 and lentiviral sgRNA library.

[0206] If the DKO-AG-haESC cell line was only infected with the lentiviral sgRNA library, then the cells did not express Cas9. At this time, transfection with the pX330-mCherry plasmid at the cellular level was needed to achieve the genome editing.

[0207] 1.6. Bisulfite Sequencing for Methylation

[0208] 1) Mouse DNA was packaged into beads with 15 l of 2% LMP agarose (low melting point agarose), 460 l of DNA digestion buffer, and then 40 l of proteinase K were added to each sample and the sample was digested by incubation overnight at 50 C.

[0209] 2) After 3 washes with TE, the beads were reacted with a bisulfate solution and incubated at 50 C. for 4-8 hours.

[0210] 3) Nested PCR was performed using the beads as a template, and the PCR product was recovered and then ligated to the PMD19-T vector, followed by transformation and plating.

[0211] 4) 10 colonies were picked from each sample for sequencing.

[0212] If the EZ DNA methylation Gold kit (ZYMO Research) was used, an appropriate amount of DNA was prepared, and the following procedures were operated according to the steps of use of the kit. The resulting product recovered with the kit was used as a template for PCR, the product was recovered and then ligated to the PMD19-T vector, followed by transformation and plating. 10 colonies were picked from the plate for sequencing.

[0213] 1.7. Fluorescent Quantitative PCR

[0214] Total RNA was extracted from the cells or organs with Trizol reagent (Invitrogen) and then 1 g of total RNA was reversely transcripted into cDNA using the First Strand cDNA Synthesis kit (TOYOBO). Real-time fluorescent quantitative PCR reactions were performed on a Bio-Rad CFX96 instrument using SYBR Green Realtime PCR Master Mix (TOYOBO), with 3 replicates for each set of samples. All the gene expression levels were detected with the expression level of housekeeping gene Gapdh as an internal reference.

[0215] 1.8. Cobra Assay

[0216] 1) 100 ng of sample DNA was taken and enzymatically cleaved with TaqI restriction endonuclease (Fementas) (T/CGA) for 15 min [0217] 2) Agarose gel electrophoresis was performed.

[0218] 1.9. Construction of Semi-Cloned Mice by ICAHCI, ROSI and Embryo Transfer

[0219] Intracytoplasmic AG-haESCs injection (ICAHCI):

[0220] To obtain semi-cloned (SC) embryos, AG-haESCs were treated for 8 hrs with a medium containing 0.05 g/ml colchicine to synchronize the cells to M phase and then intracytoplasmically injected into the oocytes. The digested AG-haESCs were washed 3 times with HEPES-CZB medium and then re-suspended in 3% (w/v) polyvinylpyrrolidone (PVP) in HEPES-CZB medium. Nuclei of AG-haESCs in M phase were injected into MII oocytes under a Piezo microscope. The reconstructed embryos were cultured in CZB medium for 1 hour and then activated with a CB-free medium for 5-6 hours. After activation, all the reconstructed embryos were cultured in KSOM medium at 37 C., and 5% CO.sub.2. ICAHCI embryos reached 2-cell embryo after being cultured in the KSOM medium for 24 hours.

[0221] ROSI (round spermatid injection):

[0222] The operation followed a reported method (Kishigami, S., Wakayama, S., Nguyen, V. T., and Wakayama, T. (2004). Similar time restriction for intracytoplasmic sperm injection and round spermatid injection into activated oocytes for efficient offspring production. Biology of reproduction 70, 1863-1869).

[0223] Every 15-20 2-cell embryos obtained by ICAHCI or ROSI were transferred into each uterus of pseudopregnant ICR mice at 0.5 dpc (0.5 day post-mating). The female mice experienced caesarean section or natural birth after 19.5 days of pregnancy. Caesarean section was done for reconstructed embryos obtained with WT AG-haESCs or single DMR knockout AG-haESCs, and expired fetuses were quickly peeled off from the female's uterus. For embryos obtained by ROSI or with DKO-AG-haECs, females after 19.5 days of pregnancy experienced natural birth. After removing the fluid from the born mice, the mice were placed in an oxygen incubator, and survived mice were subsequently nourished by the surrogate females.

[0224] 1.10. RNA-Seq and Gene Expression Analysis

[0225] The RNA-seq library of total RNA was established according to Illumina's official TreSeq RNA Sample Prep v2 Guide. After establishment, deep sequencing was performed on the IlluminaHiSeq 2000 instrument available from the Computational Biology Center of the Institute of Computing Biology, Chinese Academy of Sciences-Max-Planck-Gesellschaft zur Frderung der Wissenschaften e.V. 6 samples, comprising 2 WT AG-haESCs, H19.sup..sup.DMR-IG.sup..sup.DMR-AGH, H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-OG3, IG.sup..sup.DMR-H19.sup..sup.DMR-AGH and round spermatid were subjected to subsequent analysis.

[0226] The algorithm for gene expression level was RPKM, specifically as described in (Yang, L., Duff, M. O., Graveley, B. R., Carmichael, G. G., and Chen, L. L. (2011). Genomewide characterization of non-polyadenylated RNAs. Genome biology 12, R16).

[0227] The p-value of differentially expressed genes was calculated using the waldscore method (Yang et al., Genome boil 2011) in which abs (waldscore) was set to be >1.96 (that is, p-value<0.05), and then the differentially expressed genes were screened.

[0228] 1.11. RRBS (Reduced Representation Bisulfite Sequencing)

[0229] The RRBS library was established according to Illumina's official protocol, and then sequenced on the IlluminaHiSeq 2000 instrument (Gu, H., Smith, Z. D., Bock, C., Boyle, P., Gnirke, A., and Meissner, A. (2011). Preparation of reduced representation bisulfite sequencing libraries for genome-scale DNA methylation profiling. Nature protocols 6, 468-481.). All sequencing reads were aligned with the mouse genome.

[0230] 1.12. Genotyping Methods

[0231] The extracted genomic DNA was amplified by PCR using corresponding primers, and the PCR product was further subjected to agarose gel electrophoresis.

Example 1

[0232] Construction of Semi-Cloned Mice Based on H19 DMR Single Knockout AG-haESC Line

[0233] A. Construction of AG-haESC Line:

[0234] Source of spermatids: H19 3.8 kb KO mice (C57/B6 background, homozygous);

[0235] Source of oocytes: B6D2F1 (C57BL/6DBA2) female mice

[0236] The haploid sperm heads of H19 3.8 kb mice were injected into enucleated oocytes (FIG. 1A) following the method as described in Section 1.3, to obtain reconstructed blastocysts, with which AG-haESC cell lines were constructed. Three haploid cell lines were established from 250 reconstructed blastocysts (which were designated as H19.sup..sup.DMR-AGH-1, H19.sup..sup.DMR-AGU-2, H19.sup..sup.DMR-AGU-3) (FIGS. 1B-1D).

[0237] B. Construction of Semi-Cloned Mice:

[0238] Following the method as described in Section 1.9, H19-AGH cells were used as a donor for ICAHCI, and 1443 2-cell embryos reconstructed with these 3 cell lines were transferred into the pseudopregnant female mice. Finally, 86 healthy, viable semi-cloned mice and 39 growth-arrested mice were obtained by caesarean section of the female mice on day 19.5 after pregnancy (FIG. 1E, Table 1). The birth rate in normal half-cloned mice is about 5.9%; however, about 2.7% of the semi-cloned mice developed from the embryos constructed with H19.sup..sup.DMR-AGH still have abnormal growth.

[0239] Semi-cloned mice were constructed with wild-type AG-haESCs as a donor for ICAHCI. The birth rate of normal semi-cloned mice is about 0.7-1.8%.

[0240] C. Detection of Gtl2 Expression

[0241] Fluorescent quantitative PCR was used to detect whether aberrant high expression of Gtl2 was also present in the major organs of H19.sup..sup.DMR-AGH-derived growth-arrested mice, following the method as described in Section 1.7.

TABLE-US-00002 PrimersequencesforfluorescentquantitativePCR: Gtl2-F: TTGCACATTTCCTGTGGGAC Gtl2-R: AAGCACCATGAGCCACTAGG

[0242] The experimental results show that Gtl2 overexpression occurs in most of the organs tested in growth-arrested semi-cloned mice compared to normal mice (Fig. S1E).

[0243] D. Methylation Analysis

[0244] Experimental Methods: The analysis was carried out following the methods as described in Sections 1.6 and 1.8.

TABLE-US-00003 Primersused: IGDMR-BS-OF: TTAAGGTATTTTTTATTGATAAAATAATGTAGTTT IGDMR-BS-OR: CCTACTCTATAATACCCTATATAATTATACCATAA IGDMR-BS-IF: TTAGGAGTTAAGGAAAAGAAAGAAATAGTATAGT IGDMR-BS-IR: TATACACAAAAATATATCTATATAACACCATACAA

[0245] The results of methylation analysis show that the growth-arrested semi-cloned mice show obvious hypomethylation in the IG-DMR region of the differential methylation sites in the Dlk1-Gtl2 imprinted cluster (Figs. S1F-G). Interestingly, a more severe loss of IG-DMR methylation imprinting occurred in the later generation of H19.sup..sup.DMR-AGH (H19.sup..sup.DMR-AGU-1, p16) compared to with its earlier generation (H19.sup..sup.DMR-AGH-1, p7), resulting in a significantly increased rate of growth arrested mice (Fig. S1H, Table S1). This indicates that the abnormal expression of Gtl2 may be another important factor leading to the failure in development of the semi-cloned mice obtained with H19.sup..sup.DMR-AGH cells.

Example 2

[0246] Construction of Semi-Cloned Mice Based on H19 DMR and IG-DMR Double Knockout AG-haESC Line

[0247] A. Construction of H19 DMR and IG-DMR Double Knockout AG-haESC Line:

[0248] The construction was carried out following the method as described in Section 1.4.

[0249] 2 sgRNAs were designed according to the sequence between Dlk1 and Gtl2 which had a 4.15 kb IG-DMR knocked out (designated as IG-DMR-sgRNA1 and IG-DMR-sgRNA2) (FIG. 1F).

TABLE-US-00004 IG-DMR-sgRNA1sequence: (SEQIDNO:1) CGTACAGAGCTCCATGGCAC IG-DMR-sgRNA2sequence: (SEQIDNO:2) CTGCTTAGAGGTACTACGCT

[0250] The plasmids pX330-mCherry expressing Cas9 and IG-DMR-sgRNAs were constructed and transfected into the H19.sup..sup.DMR-AGH cells, to finally obtain 71 AG-haESC lines. The sequencing of the PCR product of the target gene (IG-DMR deletion check-F: TGTGCAGCAGCAAAGCTAAG; IG-DMR deletion check-R: ATACGATACGGCAACCAACG) found that the IG-DMR were successfully knocked out in 58 cell lines (designated as H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-1 through H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-58) (FIGS. 1G, S2A and S2B). Off-target analysis of H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-2 shows that no mutations occur to a total of 22 potential off-target sites (Table S2), where these sites are predicted by genome-wide searching by using software reported previously (Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., et al. (2013). DNA targeting specificity of RNA-guided Cas9 nucleases. Nature biotechnology 31, 827-832).

[0251] B. Construction of Semi-Cloned Mice:

[0252] Following the method as described in Section 1.9, H19.sup..sup.DMR-IG.sup..sup.DMR-AGH cells were used as a donor for ICAHCI to construct semi-cloned mice. The results show that 22.3% of the semi-cloned embryos can well developed (FIG. 1H, Fig. S2C, Table 1, Table S1), which is similar to the ROSI birth rate reported by our laboratory (Table 1) or other laboratories (Kishigami, S., Wakayama, S., Nguyen, V. T., and Wakayama, T. (2004). Similar time restriction for intracytoplasmic sperm injection and round spermatid injection into activated oocytes for efficient offspring production. Biology of reproduction 70, 1863-1869.). Furthermore, compared with the semi-cloned mice obtained with wild type AG-haESCs and H19.sup..sup.DMR-IG.sup..sup.DMR-AGH by ICAHCI that require caesarean section, after the embryos reconstructed with H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-2 is transferred to pseudopregnant female mice, the pseudopregnant female mice can carry out natural birth, and the born semi-cloned mice all survive healthy. The data suggests that H19.sup..sup.DMR-IG.sup..sup.DMR-AGH cells obtain characteristics resembling a round spermatid successfully by knocking out IG-DMR, from which semi-cloned mice can be produced efficiently.

Example 3

[0253] Construction of Semi-Cloned Mice Based on IG-DMR Single Knockout AG-haESC Line

[0254] A. Construction of AG-haESC Line:

[0255] Source of spermatids: IG-DMR KO mice;

[0256] Source of oocytes: B6D2F1 (C57BL/6DBA2) female mice

[0257] The haploid sperm heads of IG-DMR KO mice were injected into enucleated oocytes following the method as described in Section 1.3, to obtain reconstructed blastocysts, with which AG-haESC cell lines were constructed. Among the 8 haploid cell lines established, 2 cell lines carried IG-DMR knockout (designated as IG.sup..sup.DMR-AGH-1 and IG.sup..sup.DMR-AGH-2)

[0258] B. Construction of Semi-Cloned Mice:

[0259] Following the method as described in Section 1.9, IG.sup..sup.DMR-AGH cells were used as a donor for ICAHC to construct semi-cloned mice. It is found that the IG.sup..sup.DMR-AGH cells are not donors effective in the production of semi-cloned mice (Table 1, Table S1), with which it is difficult to obtain healthy normal SC mice (where only 4 normal SC mice are obtained from 499 transferred embryos) (FIGS. 2A and S2E). Moreover, most of the mice are growth arrested.

[0260] C. Methylation Analysis

[0261] Experimental Methods: The analysis was carried out following the methods as described in Sections 1.6 and 1.8.

TABLE-US-00005 Primersused: H19DMR-BS-OF: 5 GAGTATTTAGGAGGTATAAGAATT3 H19DMR-BS-OR: 5 ATCAAAAACTAACATAAACCCCT3 H19DMR-BS-IF: 5 GTAAGGAGATTATGTTTATTTTTGG3 H19DMR-BS-IR: 5 CCTCATTAATCCCATAACTAT3

[0262] The result show that the H19 DMR of IG.sup..sup.DMR-AGH cell line suffers erased methylation, and complete loss of methylation occurs in the growth-arrested mice (FIGS. 2B, S2F, and S2G).

Example 4

[0263] Construction of Semi-Cloned Mice Based on H19 DMR and IG-DMR Double Knockout AG-haESC Line

[0264] A. Construction of H19 DMR and IG-DMR Double Knockout AG-haESC Line:

[0265] The construction was carried out following the method as described in Section 1.4.

TABLE-US-00006 H193.8kbDMRKOsgRNAsequence: H19-3.8KsgRNA-1: (SEQIDNO:3) CATGAACTCAGAAGAGACTG H19-3.8KsgRNA-2: (SEQIDNO:4) AGGTGAGAACCACTGCTGAG

[0266] The H19 3.8 kb DMR were knocked out from the IG.sup.DMR-AGH cell line obtained in the above example by the CRISPR-Cas9 method (see Thorvaldsen, J. L., Mann, M. R., Nwoko, O., Duran, K. L., and Bartolomei, M. S. (2002). Analysis of sequence upstream of the endogenous H19 gene reveals elements both essential and dispensable for imprinting. Molecular and cellular biology 22, 2450-2462), and 13 DKO-AG-haESC cell lines were successfully obtained (designated as IG.sup..sup.DMR-H19.sup..sup.DMR-AGH-1 through IG.sup..sup.DMR-H19.sup..sup.DMR-AGH-13) (FIGS. 2C and S2H, and Table S2).

[0267] B. Construction of Semi-Cloned Mice:

[0268] Following the method as described in Section 1.9, 2 cell lines above were used as a donor for ICAHCI to construct semi-cloned mice. The results show that the 2 cell lines have the similar ability to produce health SC mice as the H19.sup..sup.DMR-IG.sup..sup.DMR-AGH cells (Figs. S2I and 2J, and Table 1, Table S1).

Example 5

[0269] Construction of Semi-Cloned Mice Based on H19-DMR and IG-DMR Double Knockout AG-haESC Line

[0270] A. Construction of H19-DMR and IG-DMR Double Knockout AG-haESC Line:

[0271] Initial cells: 21st-generation AGH-OG-3 cells of WT-AG-haESC cell line AGH-OG-3

[0272] It has been reported that the 22.sup.nd generation of this cell line has substantially lost the ability to produce healthy, semi-cloned mice (Yang, H., Shi, L., Wang, B. A., Liang, D., Zhong, C., Liu, W., Nie, Y., Liu, J., Zhao, J., Gao, X., et al. (2012). Generation of genetically modified mice by oocyte injection of androgenetic haploid embryonic stem cells. Cell 149, 605-617).

[0273] The oligo of sgRNA were annealed and then the sgRNAs of H19 and IG-DMR were respectively ligated to the BbsI digested px330-mCherry plasmid and transformed. Plasmid was extracted from the bacterial suspension sequenced to be correct for subsequent transfection.

[0274] The 21st generation of the AGH-OG-3 cell line was transformed with the plasmid obtained above.

[0275] 12 H19 and Gtl2 DMR double knockout AG-haESC cell lines (designated as H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-OG3-1 through H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-OG3-12) were finally obtained (FIGS. 2D and S3A and Table S2).

[0276] B. Construction of Semi-Cloned Mice:

[0277] Following the method as described in Section 1.9, H19.sup..sup.DMR-IG.sup..sup.DMR-AGH-OG3 cells were used as a donor for ICAHCI to construct semi-cloned mice. Surprisingly, by injecting 2 of these cell lines into MII oocytes, about 17% of semi-cloned embryos were able to develop fully (Fig. S3B, S3C, Table 1, and Table S1). This shows that WT-AG-haESCs, which had previously completely lost the ability to produce SC mice, were able to regain characteristics resembling a round spermatid after knockdown of H19-DMR and IG-DMR.

Example 6

[0278] Genotyping of SC Mice Obtained with 3 DKO-AG-haESC Lines

[0279] Genotyping method: The method as described in Section 1.12 was used.

TABLE-US-00007 H19-DMRdeletioncheck-F2: GTGGTTAGTTCTATATGGGG H19-DMRdeletioncheck-R2: TCTTACAGTCTGGTCTTGGT IG-DMRdeletioncheck-F: TGTGCAGCAGCAAAGCTAAG IG-DMRdeletioncheck-R: ATACGATACGGCAACCAACG

[0280] Three H19-DMR and IG-DMR double-knockout AG-haESC cell lines were constructed by using the three methods described in the foregoing Examples 2, 4 and 5, and a total of 402 SC mice were obtained. A mouse birth rate of 20.2% was achieved with the transferred embryos. These DKO-AG-haESC derived SC mice are able to grow to adulthood and are capable of producing offspring. Genotyping of 33 neonatal mouse offspring in 7 litters find that 13 animals carry H19-DMR knockout and 11 animals are WT (FIG. 2E). 6 out of the other 9 mice have IG-DMR knockout and 3 have H19 and Gtl2 DMR double knockouts. The 9 mice died shortly after birth, consistent with the previously reported lethal phenotype of the maternally inherited IG-DMR before or after birth (Lin, S. P., Youngson, N., Takada, S., Seitz, H., Reik, W., Paulsen, M., Cavaille, J., and Ferguson-Smith, A C. (2003). Asymmetric regulation of imprinting on the maternal and paternal chromosomes at the Dlk1-Gtl2 imprinted cluster on mouse chromosome 12. Nature genetics 35, 97-102).

Example 7

[0281] Detection of Gene Expression and Methylation Analysis of AG-haESCs

[0282] RNA-seq and gene expression analysis were performed following the methods described previously in Sections 1.10 and 1.7.

[0283] Reagent: SYBR-Green (TOYOBO)

TABLE-US-00008 PrimersforQ-PCR: Gapdh-F: CACTCTTCCACCTTCGATGC Gapdh-R: CTCTTGCTCAGTGTCCTTGC Igf2-F: CTAAGACTTGGATCCCAGAACC Igf2-R: GTTCTTCTCCTTGGGTTCTTTC Gtl2-F: TTGCACATTTCCTGTGGGAC Gtl2-R: AAGCACCATGAGCCACTAGG Dlk-F ACTTGCGTGGACCTGGAGAA Dlk-R: CTGTTGGTTGCGGCTACGAT H19-F: CATGTCTGGGCCTTTGAA H19-R: TTGGCTCCAGGATGATGT

[0284] Genome-wide methylation level analysis was performed following the method as described in Section 1.11.

[0285] The results of Q-PCR showed that the expression of H19 and Gtl2 is down-regulated while the expression of Igf2 and Dlk1 is up-regulated in DKO-AG-haESCs (Fig. S3D). The gene expression profiles of DKO-AG-haESCs, normal AG-haESCs and round spermatids were compared. Clustering data based on RNA-seq reveals that the expression profile of DKO-AG-haESCs is highly similar to that of WT-AG-haESCs, but greatly different from that of round spermatids (FIGS. 2F, S3E). Further analysis of the expression profiles of imprinted genes in DKO-AG-haESCs and WT-AG-haESCs revealed that all imprinted genes in DKO-AG-haESCs and WT-AG-haESCs have extremely similar expression levels (FIG. 2G). In order to further evaluate the epigenetics, reduced representation bisulfate sequencing (RRBS) was performed to detect the genome-wide methylation level. As shown in FIGS. 2H, S3F, and S3G, knockouts of H19 and Gtl2 DMRs do not alter the methylation levels in the promoter regions of all the genes and imprinted genes detected. Taken together, the results show that H19 and Gtl2 DMRs are two major impairments for AG-haESCs in obtaining characteristics resembling spherical spermatid.

Example 8

[0286] Production of Semi-Cloned Mice with DKO-AG-haESCs Carrying Multiple Genetic Modifications

[0287] A. Construction of DKO-AG-haESCs Carrying Multiple Genetic Modifications:

[0288] The construction was carried out following the method as described in Section 1.4.

[0289] Initial cells: DKO-AG-haESCs. Knockouts of the TET family of genes employed the DKO-AG-haESCs prepared in Example 4, and knockouts of the p53 family of genes employed the DKO-AG-haESCs prepared in Example 2.

[0290] Target mutations: mutations of Tet1, Tet2, Tet3, and p53 family

[0291] Construction procedure:

[0292] Construction procedure of Tet-TKO-DAH:

[0293] sgRNAs of Tet1, Tet2, and Tet3 were annealed respectively, and ligated to a BbsI digested px330-mCherry plasmid respectively, and positive plasmids in which sgRNAs were ligated were picked up by sequencing.

TABLE-US-00009 Tet1sgRNAsequence: (SEQIDNO:5) GGCTGCTGTCAGGGAGCTCA Tet2sgRNAsequence: (SEQIDNO:6) GAAAGTGCCAACAGATATCC Tet3sgRNAsequence: (SEQIDNO:7) AAGGAGGGGAAGAGTTCTCG

[0294] The plasmids expressing the sgRNAs of Tet1, Tet2, and Tet3 were co-transformed into the DKO-AG-haESC cell line. mCherry positive cells were sorted, and plated in a Petri dish. After 5 days of growth, the clones were picked and passaged for amplification. The established cell line was identified for the Tet1, Tet2, and Tet3 mutations by sequencing the PCR product.

TABLE-US-00010 Primersforsequencing: Tet1check-F: GCCCCTGTTGTCTTATACGTT Tet1check-R: CATTCGCCTCAGGACCAC Tet2check-F: CCGCCACAAGAAAATATGTCC Tet2check-R: AGCTAACTCTGGCAAACACC Tet3check-F: CAGAGTGGCCTCAGTTTCCC Tet3check-R: ACAACTTTTACCCAGGAGTCACAC

[0295] Construction procedure of p53-TKO-DAH:

[0296] sgRNAs of p53, p63, and p73 were annealed respectively, and ligated to a BbsI digested px330-mCherry plasmid respectively, and positive plasmids in which sgRNAs were ligated were picked up by sequencing.

TABLE-US-00011 p53sgRNAsequence: (SEQIDNO:8) CACCTGGGCTTCCTGCAGTC p63sgRNAsequence: (SEQIDNO:9) TGGGCCCGGGTAATCTGTGT p73sgRNAsequence: (SEQIDNO:10) TGTCGATAGGAGTCAACCAA

[0297] The plasmids expressing the sgRNAs of p53, p63, and p73 were co-transformed into the DKO-AG-haESCs cell line. mCherry positive cells were sorted, and plated in a Petri dish. After 5 days of growth, the clones were picked and passaged for amplification. The established cell line was identified for the p53, p63, and p73 mutations by sequencing the PCR product.

TABLE-US-00012 P53check-F: CCCCTGTCATCTTTTGTCCCT P53check-R: AAGAGAGTTCCACGTCCCCTG P63check-F: CACACCAAATAATGCCAATT P63check-R: CAGACTCTCTTACCGTCCAG P73check-F: GACCCACTTCTAAACCTGCC P73check-R: CCATACCTCCTGTGCTCCTG

[0298] B. Construction of Semi-Cloned Mice:

[0299] Following the method as described in Section 1.9, the cells constructed above were used as a donor for ICAHCI to construct semi-cloned mice.

[0300] C. Results

[0301] In this example, Tet1, Tet2 and Tet3 were mutated in DKO-AG-haESCs by CRISPR-Cas9 method. The plasmids constructed to express Cas9 and 3 sgRNAs of Tet1, 2, and 3 (FIG. 3A) (see Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., and Jaenisch, R. (2013). One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910-918) were transformed into DKO-AG-haESCs. 56 DKO-AG-haESC lines were finally established. The sequencing of the PCR products of the Tet1, 2, and 3 gene revealed that triple gene mutations occur in 18 cell lines (designated as Tet-TKO-DAH-1 through Tet-TKO-DAH-18) (FIGS. 3B-D and S4A). ICAHCI results of 4 of the cell lines indicated that SC mice with Tet1, 2 and 3 mutations can be obtained with corresponding rate (FIGS. 3E and S4B, Table 1 and Table S3). Corresponding SC mice can also be obtained with DKO-AG-haESCs with mutant p53 family of genes by ICAHCI (Figs. S4D, S4E, Table 1 and Table S3). These results show that WT-AG-haESCs are failed to produce viable SC mice after in vitro genetic manipulation, but DKO-AG-haESCs are still able to efficiently and stably produce semi-cloned mice after gene editing.

Example 9

[0302] Gene Editing of DKO-AG-haESCs and Production of Semi-Cloned Mice Therewith

[0303] A. Construction of Genetically Edited DKO-AG-haESC Cell Line

[0304] Initial cells: DKO-AG-haESCs (prepared in Example 4)

[0305] Construction procedure:

[0306] Construction procedure of Tet1&3-KI-DAH:

[0307] sgRNAs of Tet1, and Tet3 were annealed and ligated to a BbsI digested px330-mCherry plasmid respectively, and positive plasmids in which sgRNAs were ligated were picked up by sequencing. For the preparation of Tet1-EGFP and Tet3-ECFP donors, pEGFP-N1 plasmid and pECFP-N1 plasmid were respectively used as a template (primers: P2A-fluorescence F: GCCACGAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCTGTGAGCAAGGGCG AGGAG

[0308] P2A-fluorescence R: CTTGTACAGCTCGTCCATG), a sequence encoding EGFP or ECFP was amplified, and then correspondingly ligated to a multiclonal site on a pMD19-T vector, to obtain a pMD19-T-EGFP/ECFP vector. Subsequently, the left and right homologous arms of the gene of interest were respectively inserted into two sides of the EGFP or ECFP gene in the pMD19-T-EGFP/ECFP vector.

[0309] Sequences of homologous arms:

[0310] TET1LA (left homologous arm): (SEQ ID NO: 11)

[0311] TET1 RA (right homologous arm): (SEQ ID NO: 12)

[0312] TET3 LA (left homologous arm): (SEQ ID NO: 13)

[0313] TET3 RA (right homologous arm): (SEQ ID NO: 14)

[0314] The 4 plasmids, comprising plasmids carrying Tet1 and Tet3 sgRNA, and Tet1-EGFP and Tet3-ECFP donors were co-transfected into the DKO-AG-haESCs cell line. mCherry positive cells were sorted, and plated in a Petri dish. After 5 days of growth, the clones were picked and passaged for amplification. The established cell line was identified for the Tet1-EGFP and Tet3-ECFP knockins by PCR. The double knock-in cells were designated as Tet1&3-KI-DAH.

TABLE-US-00013 PrimersforidentificationbyPCR: Tet1LA-F: TTTGTGTCTATGAACTACCAGTGAG Tet1LA-F: CAGGCCCGGGGTTTTCTTC Tet1RA-F: CAACGAGAAGCGCGATCACA Tet1RA-F: TTTTGACTGATCCCAATTTGCCT Tet3LA-F: TGTTCACTGGTGAAGGCCAG Tet3LA-F: GAACAGCTCCTCGCCCTTG Tet3LA-F: TGAGCAAAGACCCCAACGAG Tet3RA-R: ATCGACAAACTTTGGGGCGA

[0315] Construction procedure of Tet-TKI-DAH:

[0316] sgRNA of Tet2 was annealed and ligated to a BbsI digested px330-mCherry plasmid, and a positive plasmid in which sgRNA was ligated was picked up by sequencing.

[0317] For the preparation of Tet2-mCherry donor, by using pmCherry-N1 as a template, and P2A-fluorescence F: GCCACGAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCTGTGAGCAAGGGCG AGGAG and P2A-fluorescence R: CTTGTACAGCTCGTCCATG as primers, a sequence encoding mCherry was amplified and then ligated to a pMD19-T carrier. Subsequently, the left and right homologous arms of the gene of interest were respectively inserted into two sides of the mCherry sequence in the pMD19-T-mCherry vector.

[0318] TET2 LA (left homologous arm): (SEQ ID NO: 15)

[0319] TET2 RA (right homologous arm): (SEQ ID NO: 16)

[0320] The 2 plasmids, comprising the plasmid carrying Tet2 sgRNA and the Tet2-mCherry donor were co-transfected into the Tet1&3-KI-DAH cell line. mCherry positive cells were sorted, and plated in a Petri dish. After 5 days of growth, the clones were picked and passaged for amplification. The established cell line was identified for the Tet2-mCherry knock-in by PCR. The positive cell clone was the Tet-TKI-DAH cell line.

TABLE-US-00014 Primersforidentification: Tet2LA-F: CACACCCTTCACCAACAGACG Tet2LA-R: ATCTCGAACTCGTGGCCGTT Tet2RA-F: AAGACCACCTACAAGGCCAAG Tet2RA-R: GGTAGGCAAAGTGCTTTTCTAAGAC

[0321] B. Construction of Semi-Cloned Mice:

[0322] Following the method as described in Section 1.9, the cells constructed above were used as a donor for ICAHCI to construct semi-cloned mice.

[0323] C. Results

[0324] In this example, DKO-AG-haESCs were obtained in which endogenous Tet1, Tet2 and Tet3 were knocked in different fluorescent reporter groups. First, DKO-AG-haESCs were transfected with a plasmid co-expressing Cas9 and Tet1 and Tet3 sgRNAs (FIG. 3A) and a double stranded DNA donor vector having EGFP and ECFP reporter groups fused respectively to the last terminator of Tet1 and Tet3 (FIGS. 3H and S5A). A total of 150 DKO-AG-haESC cell lines were obtained, with 10 Tet1-EGFP knock-in and 7 Tet3-ECFP knock-in cell lines (Figs. S5B and S5C). One of the cell lines carrying both Tet1-EGFP and 7 Tet3-ECFP knock-ins was designated as Tet1 & 3-KI-DAH-1 (Figs. S5D and S5E). ICAHCI results showed that DKO-AG-haESCs carrying Tet1-EGFP and Tet3-ECFP knock-ins have similar semi-cloned mice production capability to WT DKO-AG-haESCs (Figs. S5F and S5G, Table 1 and Table S3). Next, the plasmid expressing Cas9 and Tet2 sgRNA and the double-stranded DNA donor vector having the mCherry reporter group fused to the last terminator of the Tet2 gene were transfected into the Tet1 & 3-KI-DAH-1 cell line (FIGS. 3A and 3H). Out of the established 130 cell lines, 8 red-KFP knock-in haploid cell lines were identified (designated as Tet-TKI-DAH-1 through Tet-TKI-DAH-8) (FIGS. 31 and S5H). Finally, the developmental potential of the Tet-TKI-DAH cell line was verified by ICAHCI. Consistently, Tet-TKI-DAH was able to efficiently produce viable semi-cloned mice by injection into oocytes (Figs. S5S, S5J, Table 1, and Table S3). Taken together, these results indicate that it is a possible route to produce SC mice having corresponding genetic characteristics by ICAHCI after multi-gene genetic manipulation of DKO-AG-haESCs.

Example 10

[0325] Large-Scale Production of Heterozygous Mutant SC Mice with DKO-AG-haESCs Carrying sgRNA Library

[0326] A. Construction of DKO-AG-haESCs Carrying sgRNA Library

[0327] Initial cells: IG.sup..sup.DMR-H19.sup..sup.DMR-AGH-1

[0328] Following the method as described in Section 1.5, the virus was prepared and DKO-AG-haESCs were infected with a genome-wide lentiviral sgRNA library, and then transfected with a pX330-mCherry plasmid expressing Cas9, to finally construct DKO-AG-haESCs carrying the sgRNA library.

[0329] B. Construction of Semi-Cloned Mice:

[0330] Following the method as described in Section 1.9, semi-cloned mice were constructed using the previously constructed cells as a donor for ICAHCI.

[0331] Detection of sgRNAs Carried in Semi-Cloned Mice:

[0332] The sgRNAs were detected by PCR amplification using specific primers, and then the PCR product was subjected to agar gel electrophoresis to observe the presence of a strip.

TABLE-US-00015 Lenti-sg-F: GTTACTCGAGCCAAGGTCGG Lenti-sg-R: GACTCGGTGCCACTTTTTCA

[0333] Detection of Allelic Mutation:

[0334] According to the sgRNA sequencing, the corresponding gene inserted was identified, and then the upstream and downstream primers were designed by the conventional method in the vicinity of the target gene sgRNA, followed by PCR and sequencing.

[0335] C. Results

[0336] At present, the genome-wide sgRNA library has been successfully established and used in the loss-of-function genetic screening in human and mouse cells (Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., and Yusa, K. (2014). Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature biotechnology 32, 267-273). This experiment demonstrates that DKO-AG-haESCs are capable of carrying the sgRNA library and that a large number of mutant mouse models can be obtained simply by a one-step method by ICAHCI (FIG. 4A) (this method is known as Lenti-sgRNA+pX330). In this test, a newly established and more definite mouse lentiviral library was used. This library had 87,897 sgRNAs designed for the genes of 19,150 encoded proteins in mice. 1.010.sup.7 haploid cell line IG.sup..sup.DMR-H19.sup..sup.DMR-AGH-1 enriched by FACS were infected with the genome-wide lentiviral sgRNA library. After 2 days, these infected cells were treated with puromycin for 7 days, followed by transfection with the pX330-mCherry plasmid expressing Cas9. Haploid cells expressing mCherry indicated the successful transfection and expression of Cas9, which were then used in ICAHCI experiments following FACS enrichment (FIG. 4B). To detect whether the haploid gene is induced to be mutated by CRISPR-Cas9, 7 haploid cell clones were randomly selected. All of the detected cell clones carried one sgRNA, which was also found to be mutated by DNA sequencing, indicating that gene mutations can be successfully induced in haploid cells by CRISPR-Cas9.

[0337] 114 semi-cloned mice were obtained by three independent ICAHCI experiments (FIG. 4E and Table 2), of which 82 carried one sgRNA (FIG. 4F). Sequencing of the PCR products of sgRNA revealed that 43 SC mice harbored one allelic mutation of the gene of interest, 39 of which carried insertions or knockouts mutation (indel) that result in frameshift, leading to the loss of function of one allele (FIG. 4G). Interestingly, all the mutations were of the same genotype, indicating that gene mutations are realized in haploid cells after the transient expression of Cas9. Although the remaining 39 mice carried one sgRNA, no DNA cleavage was shown at the site needed to be mutated. This rate was consistent with that previously observed in human cells (Zhou, Y, Zhu, S., Cai, C., Yuan, P., Li, C., Huang, Y., and Wei, W. (2014). High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature 509, 487-491) or mouse embryos (Wu, Y., Liang, D., Wang, Y., Bai, M., Tang, W., Bao, S., Yan, Z., Li, D., and Li, J. (2013). Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell 13, 659-662). This data demonstrates that the introduction of genetic mutations into SC mice can be achieved by ICAHCI of DKO-AG-haESCs harboring the sgRNA library that are transiently transfected to express Cas9, to finally obtain a large number of heterozygous mutant mice in one step.

Example 11

[0338] Production of Mice Harboring sgRNA-Mediated Biallelic Mutations with DKO-AG-haESCs in One Step

[0339] A. Construction of sgRNA-Bearing Haploid Cells

[0340] Initial cells: IG.sup..sup.DMR-H19.sup..sup.DMR-AGH-1

[0341] DKO-AG-haESCs were infected with the lentiviral CRISPR-sgRNA library following the method as described in Section 1.5, to obtain a cell line carrying the lentiviral sgRNA library.

[0342] B. Construction of Semi-Cloned Mice:

[0343] The nuclei of the haploid cells carrying sgRNA were injected into mature oocytes by ICAHCI, followed by intracytoplasmic injection of Cas9 mRNA into the reconstructed oocyte (where this protocol was known as Lenti-sgRNA+Cas9 injection). Semi-cloned mice were then constructed by embryo transfer.

[0344] sgRNA detection in semi-cloned mice: The detection was carried out following the method as described in Example 9.

[0345] Detection of allelic mutation: The detection was carried out following the method as described in Example 9. In addition, the PCR product of the target gene was ligated into the pMD19-T vector, and then the clones were picked up and sequenced.

[0346] C. Results

[0347] In this experiment, haploid cells carrying sgRNA were injected into mature oocytes by ICAHCI and then Cas9 was injected into the reconstructed oocytes (where this protocol was known as Lenti-sgRNA+Cas9 injection). A total of 45 SC mice carrying one sgRNA were born, of which 22 had genetic mutations (Table 2). Sequencing of the PCR product of the gene of interest revealed that 10 mice had only a monoallelic modification, and other 12 mice were biallelic mutant (which is 23.5% of all born SC mice). Sequencing by TA cloning of the 7 biallelic mutant SC mice revealed that approximately 63% of the clones carried the insertion or deletion mutations (Table S4).

Example 12

[0348] Production of Mice Harboring sgRNA-Mediated Biallelic Mutations with DKO-AG-haESCs in One Step

[0349] A. The sgRNA-bearing haploid cells were constructed following the method as described in Example 10A and the pX330-mCherry plasmid was then transiently transfected into the sgRNA-bearing haploid cells.

[0350] B. Construction of Semi-Cloned Mice:

[0351] The nuclei of the haploid cells obtained in A were injected into oocytes by ICAHCI, followed by intracytoplasmic injection of Cas9 mRNA. Semi-cloned mice were then constructed by embryo transfer.

[0352] sgRNA detection in semi-cloned mice: The detection was carried out following the method as described in Example 9.

[0353] Detection of allelic mutation: The detection was carried out following the method as described in Example 11.

[0354] C. Results

[0355] In this experiment, the pX330-mCheny plasmid was transiently transfected into the sgRNA-bearing haploid cells, and then the cells were injected into oocytes, followed by injection of Cas9 mRNA (Fig. S6A and S6B) (where this protocol was known as Lenti-sgRNA+pX330+Cas9 injection). A total of 27 SC mice carrying one sgRNA were obtained. 22 mice carried genetic mutations (Figs. S6C and S6D and Table 2), in which 13 of the mutant mice carried biallelic mutations (Fig. S6E) (which was 41.9% of all the SC mice) and the other 9 mice were monoallelic mutant. TA cloning and sequencing results of 5 biallelic mutant mice revealed that about 79% of the clones have insertion or deletion mutations (Figs. S6F and S6G and Table S4)

Example 13

[0356] Production of Mice Harboring sgRNA-Mediated Biallelic Mutations with DKO-AG-haESCs in One Step

[0357] A. Construction of DKO-AG-haESCs with Constant Expression of Cas9 and sgRNA Library

[0358] Initial cells: IG.sup..sup.DMR-H19.sup..sup.DMR-AGH-1

[0359] Specific construction of cell lines by Lenti-Cas9+lenti-sgRNA method: The construction was carried out following the method co-infection with lentiviral Cas9+lentiviral sgRNA library as described in Section 1.5.

[0360] The cell line integrated with lentiviral Cas9 and lentiviral sgRNA library was further sorted by FACS to enrich the haploid cells for use in subsequent ICAHCI operation.

[0361] B. Construction of Semi-Cloned Mice:

[0362] Following the method as described in Section 1.9, semi-cloned mice were constructed by ICAHCI using DKO-AG-haESCs with constant expression of Cas9 and sgRNA library as a donor.

[0363] Detection of allelic mutation: The detection was carried out following the method as described in Example 11.

[0364] Exemplary primers for identifying the mutations in mice:

TABLE-US-00016 Polmcheck-F: TCCGATGGGAAGCCAAAAGC Polmcheck-R: CGTACCGCAACCGCGAAGTA Scube1check-F: CCATAATAATCCACTTCCAT Scube1check-R: CCAACCCCTGTCCACTACCT

[0365] C. Results

[0366] In this experiment, DKO-AG-haESCs with constant expression of Cas9 and sgRNA library were obtained by two rounds of screening with drugs. SC mice were then generated by ICAHCI (FIG. 5A-D) (where this protocol was known as Lenti-Cas9+lenti-sgRNA). 272 (18.7%) of the 1,453 embryos reconstructed by ICAHCI were developed fully (FIG. 5E) and the birth rate was basically similar to that obtained with WT DKO-AG-haESCs or DKO-AG-haESCs carrying different gene modifications (Table 2), indicating that after multiple genetic manipulations, the ability of DKO-AG-haESCs to produce SC mice is not affected. A total of 224 SC mice carried one sgRNA and were used for subsequent genotyping (FIG. 5F and Table 2). The results showed that 143 SC mice are genetically mutated, of which 83 are biallelic mutant mice (FIG. 5G). 60 monoallelic mutant SC mice were obtained. Although Cas9 in these mice was supposed to be constantly expressed, silencing of the viral vector led to transcriptional silencing of Cas9 at different development stages of the SC mice. TA cloning and sequencing of 26 biallelic mutant SC mice showed that about 66.3% of the clones have insertion or deletion mutations (FIGS. 5H and I). In order to further determine the mutation efficiency throughout the body of the SC mice, the genetic mutations in different organs (comprising the brain, heart, kidney, liver and lung) of 4 SC mice were analyzed and all of these organs were found to have biallelic mutations. Finally, TA cloning and sequencing of different organs in one SC mouse carrying Scube1 mutation was performed. The results showed that about 80% of the clones have insertion or deletion mutations (FIG. 5J). Interestingly, this SC mouse died within an hour after birth, consistent with previous reports that the Scube1 mutant mouse died shortly after birth (Tu, C. F., Yan, Y. T., Wu, S. Y., Djoko, B., Tsai, M. T., Cheng, C. J., and Yang, R. B. (2008). Domain and functional analysis of a novel platelet-endothelial cell surface protein, SCUBE1. The Journal of biological chemistry 283, 12478-12488). In conclusion, the above experimental results provide sufficient evidence for the possibility of obtaining a large number of mutant mice with DKO-AG-haESCs carrying the sgRNA library, thereby achieving the large-scale gene knockout-based screening at the mouse level, which greatly simplifies the DKO-AG-haESC-mediated gene knockout-based screening.

TABLE-US-00017 TABLE 1 Summary of in-vivo development of ICAHCI embryos Number of growth-arrested Number of Number mice (% of normal mice Cell of number of (% of number Type of donor Haploid ES cell passage embryos embryos of embryos cells line number transferred transferred) transferred) Single DMR KO H19.sup..sup.DMR-AGH p8-pl7 1443 39 (2.7) 86 (5.9).sup.c AG-haESCs Cells IG.sup..sup.DMR-AGU p8-p23 499 12 (2.4) 4 (0.8).sup.d Cells DKO-AG- H19.sup..sup.DMR-IG.sup..sup.DMR- pl9-p33 939 4 (0.4) 210 (22.4) haESCs AGH Cells IG.sup..sup.DMR-H19.sup..sup.DMR- p24-p28 544 5 (0.9) 105 (19.3) AGH Cells H19.sup..sup.DMR-IG.sup..sup.DMR- p26-p37 510 1 (0.2) 87 (17.1) AGH-OG3 Cells Subtotal pl9-p37 1993 10 (0.5) 402 (20.2).sup.e DKO-AG-ha Tet-TKO-DAH p35-p37 407 4 (1) 59 (14.5) ESCs carrying Cells Tel 1, 2 and 3 triple mutations DKO-AG-ha p53-TKO-DAH p41-p46 660 2 (0.3) 111 (16.7) ESCs carrying Cells p53, 63 and 73 triple mutations DKO-AG-ha Tet1&3-KI- p40-p47 138 1 (0.7) 21 (15.2) ESCs carrying DAH-1 Tet1 and 3 knock-ins DKO-AG-ha Tet-TKI-DAH-1 p47-p51 874 6 (0.7) 151 (17.3) ESCs carrying Tet1, 2 and 3 knock-ins WT AG-haESCs AGH Cells.sup.a p9-p20 294 3 (1.0) 2 (0.7) AGH-OG-3 pl2-p26 379 6 (1.6) 7 (1.8) Cells.sup.b Round spermatid 125 0 28 (22.4) .sup.aAG-haESCs: prepared according to the present invention. See Method 1.3. .sup.bAG-haESCs: derived from the prior art, supplied by the author of (Yang, H., Shi, L., Wang, B. A., Liang, D., Zhong, C., Liu, W., Nie, Y., Liu, J., Zhao, J., Gao, X., et al. (2012). Generation of genetically modified mice by oocyte injection of AG-haESCss. Cell 149, 605-617). .sup.cFor H19.sup..sup.DMR-AGR Cells, p < 0.05, compared with WT AG-haESCs .sup.dFor IG.sup..sup.DMR-AGU Cells, p > 0.05, compared with WT AG-haESCs .sup.eFor DKO-AG-haESCs, p < 0.001, compared with WT AG-haESCs

TABLE-US-00018 TABLE SI Summary of in-vivo development of ICAHCI embryos constructed with different AG-haESCs Number of growth-arrested Number of Number mice (% of normal mice Cell of number of (% of number Type of donor Haploid ES cell passage embryos embryos of embryos cells line number transferred transferred) transferred) H19-DMR H19.sup..sup.DMR-AGH-1 p8 375 10 (2.7) 10 (2.7) KO p9 180 9 (5.0) 13 (7.2) AG-haESCs H19.sup..sup.DMR- AGH-2 p8 210 5 (2.4) 6 (2.9) p9 116 2 (1.7) 4 (3.4) p11 123 3 (2.4) 3 (2.4) H19.sup..sup.DMR-AGH-3 p8 271 1 (0.4) 29 (10.7) p17 168 9 (5.4) 21 (12.5) IG-DMR KO IG.sup..sup.DMR-AGH-1 p14 84 0 0 AG-haESCs p15 100 4 (4) 0 p17 54 4 (7.4) 1 (1.9) p23 81 1 (1.2) 0 IG.sup..sup.DMR-AGH-2 p8 180 3 (1.7) 3 (1.7) H19.sup..sup.DMR- H19.sup..sup.DMR-IG.sup..sup.DMR- pl9 175 1 (0.6) 44 (25.1) IG.sup..sup.DMR-AGH AGH-1 Cells H19.sup..sup.DMR-IG.sup..sup.DMR- pl9 245 2 (0.8) 56 (22.9) AGH-2 H19.sup..sup.DMR-IG.sup..sup.DMR- p29 204 0 46 (22.5) AGH-3 H19.sup..sup.DMR-IG.sup..sup.DMR- p29 165 1 (0.6) 32 (19.4) AGH-4 p33 150 0 32 (21.3) IG.sup..sup.DMR-H19.sup..sup.DMR- IG.sup..sup.DMR-H19.sup..sup.DMR- p24 120 1 (0.8) 26 (21.7) AGH Cells AGH-1 IG.sup..sup.DMR-H19.sup..sup.DMR- p24 180 2 (1.1) 47 (26.1) AGH-2 p28 244 2 (1.3) 32 (22.2) IG.sup..sup.DMR-H19.sup..sup.DMR- IG.sup..sup.DMR-H19.sup..sup.DMR- p26 118 0 17 (14.4) AGH-OG3 AGH-OG3-1 Cells IG.sup..sup.DMR-H19.sup..sup.DMR- p30 192 1 (0.5) 36 (18.8) AGH-OG3-2 p37 200 0 34 (17) WT AGH-OG-3.sup.a p12 82 0 1 (1.2) AG-haESCs p20 93 4 (4.3) 0 p24 140 2 (1.4) 5 (3.6) p26 64 0 1 (0.9) AGH-2.sup.b p19 114 0 1 (0.9) p20 62 3 (4.8) 0 AGH-3.sup.c p9 118 0 1 (1.2) .sup.aAG-haESCs: made according to the prior art. .sup.bAG-haESCs: derived from the prior art (Yang, H., Shi, L., Wang, B. A., Liang, D., Zhong, C., Liu, W., Nie, Y., Liu, J., Zhao, J., Gao, X., et al. (2012). Generation of genetically modified mice by oocyte injection of androgenetic haploid embryonic stem cells. Cell 149, 605-617)

TABLE-US-00019 TABLE S3 Summary of in-vivo development of ICAHCI embryos constructed with genetically modified DKO-AG-haESCs Number of growth-arrested Number of Number mice (% of normal mice Cell of number (% of number Type of donor Haploid ES passage embryos of embryos of embryos cells cell line number transferred transferred) transferred) DKO-AG-ha ESCs Tet-TKO-DAH-1 p37 131 2 (1.5) 17 (13) Carrying Tet1, 2 Tet-TKO-DAH-2 p37 54 0 9 (16.7) and 3 Mutations Tet-TKO-DAH-3 p36 174 1 (0.6) 27 (15.5) Tet-TKO-DAH-4 p35 48 1 (2.1) 6 (12.5) DKO-AG-ha p53-TKO-DAH-l p42 182 1 (0.5) 34 (18.7) ESCs carrying p53, p44 186 0 32 (17.2) p63 and p73 p53-TKO-DAH-2 p41 154 0 23 (14.9) mutations p42 48 1 (2.1) 8 (16.7) p53-TKO-DAH-3 p46 90 0 14 (15.6) DKO-AG-haESCs Tet1&3-KI- p40 58 1 (1.7) 10 (17.2) carrying Tet1 and 3 DAH-1 p47 80 0 11 (13.8) knock-ins DKO-AG-ha ESCs Tet-TKI-D p47 48 1 (2.1) 8 (16.7) carrying Tet1, 2 AH-1 p49 174 0 32 (19) and 3 knock-ins Tet-TKI-D p47 96 3 (3) 10 (10.4) AH-2 p50 136 1 (0.7) 22 (16.2) Tet-TKI-D AH-3 p49 48 0 8 (16.7) Tet-TKI-D AH-4 p50 102 1 (1.0) 14 (13.7) Tet-TKI-D AH-5 p51 174 0 39 (22.4) Tet-TKI-D AH-6 p51 96 0 18 (18.8)

TABLE-US-00020 TABLE 2 Summary of in-vivo development of ICAHCI embryos constructed with DKO-AG-haESCs carrying sgRNA library Number of SC Number Number Number Number of Number of mice of SC of SC of SC SC mice SC mice Number of (% of number mice mice with mice with with with embryos of embryos without sgRNA one biallelic monoallelic Strategy transferred transferred) sgRNA (n > 2) sgRNA mutation mutation Lenti- 580 114 (19.7) 11 21 82 0 43 sgRNA+ pX330 Lenti- 306 51 (16.7) 0 4 47 12 10 sgRNA+ Cas9 injection Lenti-sgR 238 31 (13.5) 3 1 27 13 9 NA+pX330+ Cas9 injection Lenti-Cas 1453 272 (18.7) 22 13 237 83 60 9+lenti- sgRNA

[0367] The above examples are provided for the purpose of illustrating the embodiments disclosed in the present invention and are not to be construed as limiting the present invention. In addition, various modifications and variations of the methods and compositions made without departing from the scope and spirit of the present invention are apparent to those skilled in the art. While the present invention has been specifically described in connection with various specific preferred embodiments thereof, it is to be understood that the present invention is not limited to these specific embodiments. In fact, various apparent modifications made to the present invention as described above are embraced in the scope of the present.

TABLE-US-00021 Sequencelisting <110> ShanghaiInstitutesforBiologicalSciencesChineseAcademyofSciences <120> Androgenetichaploidembryonicstemcell(AG-haESC),andpreparation methodandusethereof <130> 140709 <160> 16 <170> PatentInversion3.3 <210> 1 <211> 20 <212> DNA <213> Artificial <220> <223> IG-DMR-sgRNA1sequence <400> 1 cgtacagagctccatggcac20 <210> 2 <211> 20 <212> DNA <213> Artificial <220> <223> IG-DMR-sgRNA2sequence <400> 2 ctgcttagaggtactacgct20 <210> 3 <211> 20 <212> DNA <213> Artificial <220> <223> H19-3.8KsgRNA-1sequence <400> 3 catgaactcagaagagactg20 <210> 4 <211> 20 <212> DNA <213> Artificial <220> <223> H19-3.8KsgRNA-2sequence <400> 4 aggtgagaaccactgctgag20 <210> 5 <211> 20 <212> DNA <213> Artificial <220> <223> Tet1sgRNAsequence <400> 5 ggctgctgtcagggagctca20 <210> 6 <211> 20 <212> DNA <213> Artificial <220> <223> Tet2sgRNAsequence <400> 6 gaaagtgccaacagatatcc20 <210> 7 <211> 20 <212> DNA <213> Artificial <220> <223> Tet3sgRNAsequence <400> 7 aaggaggggaagagttctcg20 <210> 8 <211> 20 <212> DNA <213> Artificial <220> <223> p63sgRNAsequence <400> 8 cacctgggcttcctgcagtc20 <210> 9 <211> 20 <212> DNA <213> Artificial <220> <223> p63sgRNAsequence <400> 9 tgggcccgggtaatctgtgt20 <210> 10 <211> 20 <212> DNA <213> Artificial <220> <223> p73sgRNAsequence <400> 10 tgtcgataggagtcaaccaa20 <210> 11 <211> 895 <212> DNA <213> Artificial <220> <223> SequenceofTET1LAlefthomologousarm <400> 11 aagcttaaggttcacacaacactaagagcttttcatcagcctcatctacttctcacctag 60 tgaaagacgaatctacagacttctgtcccctgcaggcttcctccgcagaaacatctacct 120 gtacgtacagtaaaacagcctcaggtgggtttgcagaaacaagtagtattctccactgca 180 caatgccttctggagcacacagtggtgctaatgcagctgctggggaatgtactggaacgg 240 tgcagcctgccgaggtggctgctcatcctcaccagtctcttcccacagccgattctcccg 300 ttcatgctgagcctctcactagtccatctgagcagctaacttctaaccagtcaaaccagc 360 agctccctctcctcagcaattctcagaaactggcttcctgtcaggtggaagatgagcggc 420 accctgaagcggatgagcctcagcaccccgaggacgataacttgcctcaacttgatgaat 480 tctggtcagacagtgaggagatctacgccgatccttcctttggtggcgtggcgatagcac 540 ccattcacggctcggtgctcattgagtgcgctcggaaggagettcatgctaccacctctt 600 tgcgctcccccaaacgaggggtcccttttcgtgtgtcccttgtattctaccagcacaaaa 660 gcctaaacaagcctaatcatggttttgatatcaacaaaattaagtgtaaatgcaaaaaag 720 taacgaaaaaaaagcccgcagaccgggagtgtcctgatgtatcccccgaagccaatttat 780 cacaccaaattccttctcgagttgcatcaaccttaacccgagacaatgttgttaccgtgt 840 ccccatactctctcactcatgttgcgggaccctacaatcgttgggtcgcgtcgac 895 <210> 12 <211> 803 <212> DNA <213> Artificial <220> <223> SequenceofTET1RArighthomologousarm <400> 12 taaaggcttctctcatgtaatgcctttgctaatgtggtgtagtgggtatttttgtttgtt 60 tgtttgttttcttttgtttttttgttttttccggtgctgttaaaaagaaagtcattctgt 120 tgtttactgtagctttgtttcgcccatttcaactccgacgtaaatattaaaaaaaaaaaa 180 agggtgaatacttaactgtgattacattttgagaattggtagaaggtgaacattttcagc 240 aaaaataaactttttatagttttaaatacttaaaggaacatcttggttaggtgttggcca 300 tgctagaaccatagagtctggtgctttcccccgggtttgtttactattcagagggtttat 360 aacaggttcctgcaataagaagtaaagaccaagatgtagtgttaactctacacagttcct 420 ggtgctttaaccacatcaacacacggagtgatgagctgagtgattgttttctggtgccat 480 tgctcaagcctcttccaatcattgccatcgtgtctgcacatttctttgaagtaaaccaat 540 gaaatgctttttctcttaaaacatttctcctatataaagtagttctctattctcatgatg 600 gttggaagctgttcgctaactataaatgtatatattttaaaaagcactttttacttttaa 660 gagtaacttgaaatagtatagtagcagaatcctattgtctattatgtgtgcatatttgaa 720 taccagagaagtcatttgttcttgctctgtagagtcccatcccgttaacctcagcctgta 780 ctcaaataacacacggcttctgt 803 <210> 13 <211> 809 <212> DNA <213> Artificial <220> <223> SequenceofTET3LAlefthomologousarm <400> 13 ctggtcccagcctaactgagaagtcatgggggatgggaaccggggatttcaacctcgccc 60 tgaaaggtggacctgggttccaagacaagttgtggaatcctgtgaaggtggaggagggca 120 ggattcccataccgggggccaactcgctagacaaagcctggcaagcctttggcatgccct 180 tgagctccaacgagaagctatttggggccctgaagtcagaggagaaactgtgggatccct 240 tcagcctggaggaggggacagctgaggagccccccagcaagggggtggtgaaggaagaga 300 agagtggacccacagtgaaagaggacgaggaggaactgtggtcggacagtgaacacaact 360 tcctggatgagaacataggcggggtggccgtggccctcgcccattgctccatcctcatcg 420 agtgtgcccggcgagagctgcatgccaccactccactcaaaaaacccaaccgctgccacc 480 ccacccgcatctcgctggtcttctaccaacacaagaacctcaaccagtccaaccacgggc 540 tggcgctctgggaggccaagatgaagcagctggcggaatgggcgcggcagcggcaagagg 600 aggccgcacgcctgggcctgggccagcaggaggccaagctctacgggaagaagcgaaaat 660 gggggggtgctatggtggctgagccccagcaeaaagaaaagaagggggctatccctaccc 720 ggcaggcgctggccatgcccacagacttcgcggtcaccgtgtcctcttacgcctacacaa 780 aggtcactggcccctacagccgctggatc 809 <210> 14 <211> 837 <212> DNA <213> Artificial <220> <223> SequenceofTET3RArighthomologousarm <400> 14 taggtgccaggagccagcgtacctcagcgtcgggcccggcccgagctgctctgtggtgct 60 tttgccctcatgcccgggggcgggttgggggtgcagaagtctctctatatctacatatat 120 ggatatgcttatcatatatatgtatttatggtccaaacctcagaactgacccgccctccc 180 tcctcttcttccccagcactttgaagaaactacggctgtcgggtgatttttttttttttt 240 tgatcttaatatttatatctccacgttttatttttccccttgttttgagggggcttttat 300 tttccttttgtttttaaaactttatccttgtatatcacaataatggaaagaaagtttata 360 gtgtcctttcacaaaggagcgtagttttaaaattccatttaaaatatgtatttattgggt 420 ttttttaaagcaacaatagtaatgggttacaggtgggcaggaaaggccggcagtgcttcc 480 tgcctggcaagcccagcctcctgggggctgcaggctctctcagccatctgcctcacaaac 540 caaggttagcatgtagccctggtttatccctccttcccacaggctggggagccttttggg 600 accaccccgttctcctctgtggaatgggggaagctgcagacatctgggggcctggcctgg 660 aaatgctggtgttagatatccccagaaaccaggttggaagtagacagcttcaagcttgct 720 agtctccacactgaatcctctctgtccgttatttaccaagtcatatgatgtcctggttcg 780 ctaggcagcacctcaagctggagcaggagtcgagaggctccgaggagctcttctcgt 837 <210> 15 <211> 824 <212> DNA <213> Artificial <220> <223> SequenceofTET2LAlefthomologousarm <400> 15 caaatgtacaccacctagcaacgttttctccttaccccaccoccaagatggatagtcatt 60 tcatgggagctgcctccagatcaccatacagccacccacacactgactacaaaaccagtg 120 agcatcatctaccctctcacacgatctacagctacacggcagcagcttcggggagcagtt 180 ccagccacgccttccacaacaaggagaatgacaacatagccaatgggctctcaagagtgc 240 ttccagggtttaatcatgatagaactgcttctgcccaagaactattatacagtctgactg 300 gcagcagtcaggagaagcagcctgaggtgtcaggccaggatgcagctgctgtgcaggaaa 360 ttgagtattggtcagatagtgagcacaactttcaggatccttgcattggaggggtggcta 420 tagctccaactcatgggtcaattcttattgagtgtgcaaagtgtgaggttcatgccacaa 480 ccaaagtaaacgatcccgaccggaatcaccccaccaggatctcacttgtactgtataggc 540 ataagaatttgtttctaccaaaacattgtttggctctctgggaagccaaaatggctgaaa 600 aggcccggaaagaggaagagtgcggaaagaatggatcagaccacgtgtctcagaaaaatc 660 atggcaaacaggaaaagcgtgagcccacagggccacaggaacccagttacctgcgtttca 720 tccagtctcttgctgagaacacagggtctgtgactacggattctaccgtgactacatcac 780 catatgctttcactcaggtcacagggccttacaacacatttgta 824 <210> 16 <211> 792 <212> DNA <213> Artificial <220> <223> SequenceofTET2RArighthomologousarm <400> 16 tgacgctggccattaggccagaccaccaaggacgacctgtgagcagtatgtctttcatgg 60 catgggccgtagggacaggtcacagcatctgtgacaaatgcagtgtgtgtttgtgtgtat 120 gtttattgggggggggctgtcagctcaccagcaaaatagtttattttatcattatattta 180 atctctcccgtggtccatggtggcattcaggaagagcatcctatgcaagggcacagtggg 240 aaggaagcgctggacatttgtcttgaaaaccactggttctcttattggctgaggtcatgc 300 gtgtgccatgcccctcagcactctacacgtaactgcttctagtattcagcgtgtgtaacc 360 gtgggacacagcgctgtagtagagcagttgcaggatcatctggtgctgacgtatgatgta 420 ctgaagaaatactggaactaagactttttaacatgcaggttttttactgtaatcttaata 480 acttatttatcaaagtagctacagaaagcttaagtgaataatggcaaaacactgaatctg 540 tttgggtgttaacattaaatggtgctacaaatggtgtttttaatagctgaaaaatcaatg 600 ccttctatcatctagccagtgtggtcgagggccctggaggcactggggtacctctgattt 660 tacatttctatcttaattattcagcttagtttttaaaatgtggacatttcaaaggcctct 720 ggattgtagttatccaccgatgtccttgtaggactataatgtatagatatgcacacttac 780 acatgtgtactg 792