Microbial production of 3-hydroxypropionic acid

10066245 · 2018-09-04

Assignee

Inventors

Cpc classification

International classification

Abstract

A yeast cell having a reduced level of activity of NAD dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has at least one exogenous gene encoding NADP dependent GAPDH and/or has up-regulation of at least one endogenous gene expressing NADP dependent GAPDH, wherein combined expression of the enzymes NADP dependent GAPDH, PDC, ALD, ACS, ACC* and MCR in said host cell increases metabolic flux towards 3-HP via malonyl-CoA compared to an otherwise similar yeast cell lacking said genetic modification.

Claims

1. A genetically modified yeast cell for use in producing 3-hydroxypropionic acid (3-HP), wherein said yeast cell expresses the enzymes: Pyruvate decarboxylase (PDC), Aldehyde dehydrogenase (ALD), Acetyl-CoA synthase (ACS), Acetyl-CoA carboxylase (ACC*), wherein the ACC* is yeast acetyl-CoA carboxylase mutated in at least one phosphorylation site to prevent inactivation by yeast sucrose non-fermenting 1 (Snf1), and Malonyl-CoA reductase (MCR), wherein the yeast cell has a reduced level of activity of NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by deletion or disruption of one or more genes encoding a NAD-dependent GAPDH, wherein the yeast cell has been transformed with at least one exogenous nucleic acid molecule encoding a NADP-dependent GAPDH, and wherein culturing said yeast cell expressing the enzymes NADP-dependent GAPDH, PDC, ALD, ACS, ACC* and MCR on a medium comprising at least one carbon substrate produces a supernatant concentration of at least 9 g/L 3-HP.

2. The yeast cell of claim 1, comprising one or more exogenous nucleic acid molecules encoding at least one of the enzymes PDC, ALD, ACS, ACC* and/or MCR.

3. The yeast cell of claim 2, wherein said one or more exogenous nucleic acid molecules is expressed from multiple integrations of said one or more exogenous nucleic acid molecules in the yeast cell genome.

4. The yeast cell of claim 2, wherein the nucleic acid molecule encoding the PDC enzyme is derived from Saccharomyces cerevisiae.

5. The yeast cell of claim 2, wherein the nucleic acid molecule encoding the ALD enzyme is derived from Saccharomyces cerevisiae.

6. The yeast cell of claim 2, wherein the nucleic acid molecule encoding the ACS enzyme is derived from Salmonella entherica.

7. The yeast cell of claim 2, wherein the ACC* enzyme is mutated in at least two phosphorylation sites in the enzyme.

8. The yeast cell of claim 2, wherein the nucleic acid molecule encoding the non-mutated version of the ACC* enzyme is derived from Saccharomyces cerevisiae.

9. The yeast cell of claim 8, wherein the ACC* enzyme is mutated at amino acid positions Ser659 and Ser1157, wherein Ser659 and Ser1157 are replaced by amino acids comprising side chains which are incapable of being phosphorylated.

10. The yeast cell of claim 2, wherein the nucleic acid molecule encoding the MCR enzyme is derived from Chloroflexus aurantiacus.

11. The yeast cell of claim 1, wherein the nucleic acid molecule encoding the NADP-dependent GAPDH is derived from Clostridium acetobutylicum, Kluyveromyces lactis or Bacillus subtilis.

12. A method for producing 3-HP, said method comprising culturing the yeast cell of claim 1 under conditions such that 3-HP is produced.

13. The method of claim 12, wherein said yeast cell is cultured on a medium comprising at least one carbon substrate.

14. The method of claim 12, wherein said method further comprises isolating the 3-HP produced by said yeast cell.

Description

FIGURES

(1) FIG. 1: Bar chart comparing yeast cells transformed with ACC comprising zero, one or two mutations at dephosphorylation sites.

(2) FIG. 2: Bar chart comparing the supernatant concentration of 3-HP produced by yeast cells transformed with a multicopy vector, a single integrative vector and a multiple integrative vector.

(3) FIG. 3: Bar chart comparing the supernatant concentration of 3-HP produced by yeast cells overexpressing ACS, ALD6 and/or PDC1 in both DELFT and FIT media.

(4) FIG. 4: Bar chart comparing the supernatant concentration of 3-HP produced by yeast cells with increased pool of available NADPH and those with no increased pool of available NADPH.

(5) FIG. 5: Bar chart demonstrating the effect of replacing the coding sequence of endogenous NAD dependent GAPDH with NADP dependent GAPDH on supernatant concentration of 3-HP in both DELFT and FIT media.

(6) FIG. 6: Bar chart comparing the supernatant concentration of 3-HP produced by yeast cells with improved NADPH supply in DELFT and FIT media.

(7) FIG. 7: Graph showing the supernatant concentration of 3-HP, glucose, glycerol, acetate and ethanol vs time in an N and C limited fed batch fermentation of highest producing yeast strain ST687

(8) FIG. 8: Graph showing the supernatant concentration of 3-HP, glucose, glycerol, acetate and ethanol vs time in a C limited fed batch fermentation of the highest producing yeast strain ST687

EXAMPLES

(9) TABLE-US-00001 TABLE1 Oligonucleotidesequences Oligoname Oligosequence5 --> 3 SeqIDNO ACC1m_fw CGTGCGAUTCATTTCAAAGTCTTCAACAATTT SeqIDNO11 ACC1m_rv AGTGCAGGUAAAACAATGAGCGAAGAAAGCTTA SeqIDNO12 CaMCR_fw_NEW ATCTGTCAUAAAACAATGAGTGGTACAGGTAG SeqIDNO13 CaMCR_rv_NEW CACGCGAUTCAGACTGTAATGGCTCTACCTC SeqIDNO14 PTEF1_fw ACCTGCACUTTGTAATTAAAACTTAG SeqIDNO15 PPGK1_rv ATGACAGAUTTGTTTTATATTTGTTG SeqIDNO16 ACC1-WT-UP ATTTGCGGCCGCTTTAGTTTCTACCATGAGCGAAG SeqIDNO17 ACC1-WT-DOWN GGCGAGCTCGCAAGGTTTATTTCAAAGTCTT SeqIDNO18 F-1-DOWNz CATATGACAAATCTGAAACAGCAACAGCCCTGTTCATACC SeqIDNO19 F-2-UP GGTATGAACAGGGCTGTTGCTGTTTCAGATTTGTCATATG SeqIDNO20 F-3-DOWN ATGGCAATCAAAAGACCACCATCAGCTAGTTGACGCAGTA SeqIDNO21 F-4-UP TACTGCGTCAACTAGCTGATGGTGGTCTTTTGATTGCCAT SeqIDNO22 ACSse_U1_fw AGTGCAGGUAAAACAATGTCACAAACACAC SeqIDNO23 ACSse_U1_rv CGTGCGAUTCATGATGGCATAGCAATAG SeqIDNO24 ald6_U2_fw ATCTGTCAUAAAACAATGACTAAGCTACACTTTGACAC SeqIDNO25 ald6_U2_rv CACGCGAUTCACAACTTAATTCTGACAGCTTTTAC SeqIDNO26 pdc1_U1longer_fw AGTGCAGGUAAAACAATGTCTGAAATTACTTTGGGTAAATATTTG SeqIDNO27 pdc1_U1longer_rv CGTGCGAUTCATTGCTTAGCGTTGGTAGCAGCAGTC SeqIDNO28 PTEF1_rv CACGCGAUGCACACACCATAGCTTC SeqIDNO29

(10) TABLE-US-00002 TABLE 2 Primers and templates used to generate gene fragments for USER cloning and yeast transformation by PCR Fragment name Gene Fw_primer Rv_primer Template DNA ACC**<- ACC1.sup.Ser659Ala, Ser1157Ala ACC1m_fw ACC1m_rv pAD from S. cerevisiae ->CaMCR Malonyl-CoA reductase from CaMCR_fw_NEW CaMCR_rv_NEW pYC6 Chloroflexus aurantiacus <-ScPTEF1- Fused promoters of tef1 PTEF1_fw PPGK1_rv plasmid pSP-GM1 ScPPGK1-> and pgk1 genes from S. cerevisiae ACC-pTEFpPGK- ACC1**<-ScPTEF1- ACC1m_fw CaMCR_rv_NEW P298 CaMCR ScPPGK1->CaMCR ACSse<- Acetyl-CoA synthetase from ACSse_U1_fw ACSse_U1_rv P324 Salmonella enterica ScALD6-> Acetaldehyde dehydrogenase ald6_U2_fw ald6_U2_rv S. cerevisiae 6 from S. cerevisiae gDNA ScPDC1<- Pyruvate decarboxylase pdc1_U1longer_fw pdc1_U1longer_rv S. cerevisiae isozyme 1 from gDNA S. cerevisiae <-ScPTEF1 TEF1 promoter from PTEF1_fw PTEF1_rv S. cerevisiae S. cerevisiae gDNA

(11) TABLE-US-00003 TABLE3 Plasmids Plasmid Parent Selection name plasmid marker Gene1 Promoter Gene2 P298 p054pESC-URA- URA3 ACC1**<- <-ScPTEF1-ScPPGK1-> ->CaMCR USER (SeqIDNO1) (SeqIDNO3) (SeqIDNO2) P343 P0255pX-2- KlURA3 ACC1**<- <-ScPTEF1-ScPPGK1-> ->CaMCR loxP-KlURA3 (SeqIDNO1) (SeqIDNO3) (SeqIDNO2) P376 P322 KlURA3 ACC1**<- <-ScPTEF1-ScPPGK1-> ->CaMCR (SeqIDNO1) (SeqIDNO3) (SeqIDNO2) P474 P376 KlURA3 ACC1**<- <-ScPTEF1-ScPPGK1-> ->CaMCR (SeqIDNO1) (SeqIDNO3) (SeqIDNO2) P380 p257(pX-3- KlLEU2 ACSse<- <-ScPTEF1-ScPPGK1-> ScALD6-> K1LEU2) (SeqIDNO4) (SeqIDNO3) (SeqIDNO5) P382 p258(pX-4- SpHIS5 ScPDC1<- <-ScPTEF1 LoxP-SpHiS5) (SeqIDNO6) (SeqIDNO7)

(12) TABLE-US-00004 TABLE 4 Yeast strains Strain Parent strain Genotype CEN.PK102-5B mata, ura3, his3, leu2 CEN.PK102-5D mata, ura3 tdh3-null CEN.PK102-5B mata, ura3, his3, leu2, tdh3::LoxP tdh1::CaGAPDH, tdh3-null mata, ura3, his3, leu2, tdh3 tdh1::CaGAPDH-LoxP, tdh3::LoxP tdh2::CaGAPDH, tdh3-null mata, ura3, his3, leu2, tdh3 tdh2::CaGAPDH-LoxP, tdh3::LoxP tdh1 + 2::CaGAPDH, tdh2::CaGAPDH, mata, ura3, his3, leu2, tdh3 tdh3 tdh1::CaGAPDH-LoxP, tdh2::CaGAPDH-LoxP, tdh3::LoxP tdh3::CaGAPDH CEN.PK102-5B mata, ura3, his3, leu2, tdh3::CaGAPDH-LoxP tdh1 + 3::CaGAPDH tdh3::CaGAPDH mata, ura3, his3, leu2, tdh1::CaGAPDH-LoxP, tdh3::CaGAPDH-LoxP tdh2 + 3::CaGAPDH tdh3::CaGAPDH mata, ura3, his3, leu2, tdh2::CaGAPDH-LoxP, tdh3::CaGAPDH-LoxP tdh1 + 2 + tdh2 + mata, ura3, his3, leu2, 3::CaGAPDH 3::CaGAPDH tdh1::CaGAPDH-LoxP, tdh2::CaGAPDH-LoxP, tdh3::CaGAPDH-LoxP

Example 1. Cloning of Over-Expression Targets into Expression Plasmids

(13) All plasmids listed in table 3 were generated by USER cloning using PCR generated gene fragments, which were amplified according to table 2. The typical USER reaction was as follows: 1 l of linearized and nicked parent plasmid was mixed with 1 l of promoter fragment, 2 l of gene fragment, 0.5 l Taq polymerase buffer, 0.5 l USER enzyme (NEB). The mix was incubated at 37 C. for 25 min, at 25 C. for 25 min and transformed into chemically competent E. coli DH5alpha. The clones with correct inserts were identified by colony PCR and the plasmids were isolated from overnight E. coli cultures and confirmed by sequencing.

(14) The expression plasmids were transformed into S. cerevisiae cells using the lithium acetate transformation protocol. The cells were selected on synthetic complete (SC) agar medium without uracil, histidine and leucine.

Example 2. ACC1** Engineering Acetyl-CoA Carboxylase for Improving the Production of 3-Hydroxypropionic Acid

(15) Ser659 and Ser1157 of ACC1 were identified as two putative phosphorylation sites according to the phosphorylation recognition motif (Hyd-X-Arg-XX-Ser-XXX-Hyd) for yeast Snf1 (Dale, S. et al, 1995). One of which, Ser1157 was verified by a phosphoproteome study (Ficarro, S. et al, 2002). Ser659 has not been reported through experimental data so far. Therefore, we have constructed mutated ACC1 with either one or two assumed phosphorylation sites.

(16) The endogenous ACC1 gene (wild-type) encoding acetyl-CoA carboxylase was amplified from genomic DNA of CEN.PK.113-5D by PCR with Phusion high-fidelity polymerase. The primers are listed in Table 1. The single mutatation ACC1.sup.Ser1157Ala and double mutation ACC1.sup.Ser659Ala, Ser1157Ala were introduced by oligonucleotide primers. Three versions of ACC1 were digested with NotI and SacI, and then ligated into the corresponding sites of pSP-GM2 (Chen et al., 2012), resulting in plasmid pAW (containing wild-type ACC1), pAS (containing single mutated ACC1) and pAD (containing double mutated ACC1), respectively.

(17) For re-constructing the pathway for 3-HP production, the gene CaMCR encoding malonyl-CoA reductase from Chloroflexus aurantiacus was codon optimized for expression in yeast and synthesized by GenScript (Piscataway, N.J., USA). CaMCR was cloned into pIYC04 (Chen et al., 2013) using the BamHI and XhoI cloning sites downstream of the TEF1 promoter, resulting in plasmid pYC6. To evaluate the effect of engineered ACC1 on 3-HP production, plasmids combinations pSP-GM2/pYC6, pAW/pYC6, pAS/pYC6 and pAD/pYC6 were transformed into CEN.PK 113-11C to construct yeast recombinant strain HPY15 to HPY18, respectively.

(18) For the cultivation of yeast recombinant strains, 20 ml cultures in 100 ml unbaffled cotton-stopped flasks were inoculated with an amount of pre-culture that resulted in a final optical density of 0.02 at 600 nm (OD600). The strains were grown at 30 C. with 180 r.p.m. orbital shaking in defined minimal medium with 20 g l.sup.1 glucose as described before (Chen et al., 2013). Samples were taken periodically to measure the cell mass, concentration of 3-HP, residual glucose and other metabolites.

(19) The results are shown in FIG. 1. Overexpression of wild-type ACC1 HPY16 increased 3-HP production by 60%, compared to the reference strain HPY15. Overexpression of mutated ACC1 by blocking the phosphorylation sites, HPY17 and HPY18, further enhanced the production of 3-HP. Double mutated ACC1.sup.Ser659Ala, Ser1157Ala HPY18 gave the highest improvement, around three-fold, relevant to that of the reference strain.

Example 3. Production of 3HP in S. cerevisiae by Over-Expression of CaMCR and ACC1** from Multiple Integration Plasmids

(20) CEN.PK102-5D was transformed with either episomal multicopy plasmid p298, or single integrative plasmid p343, or multiple integration plasmid p376. All three plasmids tested harboured ACC1** and CaMCR. Four single transformants for each plasmid tested were inoculated in 0.5 ml SC ura- in a 96-deep well microtiter plate with air-penetrable lid (EnzyScreen). The plates were incubated at 30 C. with 250 rpm agitation at 5 cm orbit cast overnight. 50 l of the overnight cultures were used to inoculate 0.5 ml Delft medium (Delft medium described in WO 2011/147818) in a 96-deep well plate and 0.5 ml FIT Fed-batch-media (M2P labs). Fermentation was carried out for 72 hours at the same conditions as above.

(21) At the end of the cultivation the OD.sub.600 was measured. 10 l of the sample was mixed with 190 l water and absorbance was measured at 600 nm wave length in a spectrophotometer (BioTek).

(22) The culture broth was spun down and the supernatant analyzed for 3-hydroxypropionic acid concentration using enzymatic assay, which was performed as follows: 20 l of standards (3HP at concentrations from 0.03 to 1 g/L in Delft medium) and samples were added to a 96-well flat bottom transparent plate (Greiner). 180 l of mix (14.8 ml water, 2 ml buffer (1 mM Tris, 25 mM MgCl.sub.2, pH 8.8), 1 ml NADP+ solution (50 mg/ml), and 0.2 ml purified YdfG enzyme in PBS buffer (1500 g/ml)) was added per well using a multichannel pipette. The start absorbance at 340 nm was measured and the plate was sealed and incubated at 30 C. for 1.5 hours. After incubation the absorbance at 340 nm was measured again. The difference between the end and the start values corrected for the background were in linear correlation with 3HP concentrations. The concentration of 3HP in each sample was calculated from the standard curve.

(23) Expression of ACC1** and CaMCR from the multiple integration plasmid p376 led to a 5 times improvement of 3HP production in the best clone, when compared to a S. cerevisiae strain bearing a single integrative vector with the same genes (FIG. 2).

Example 4. Improving 3HP Production in S. cerevisiae by Increasing the Precursor Supply Towards Acetyl-CoA

(24) Strains harbouring either p380-ALD6-ACS or p380-ALD6-ACS in combination with p382-PDC1 were transformed with p474-CaMCR-ACC1**. A minimum of 6 clones were picked, fermented and tested for 3HP production by enzymatic assay as in example 2 (FIG. 3). The best producer of strains having p380-ALD6-ACS in combination with p474-CaMCR-ACC1** gave up to 1.5 fold higher 3HP titer than the wild type (WT) strain with p474-CaMCR-ACC1**, and strains with all three plasmids combined gave up to 2.5 times more than the WT background in both DELFT and FIT media.

Example 5. Effect of Increasing the Pool of Available NADPH on the Production of 3-Hydroxypropionic Acid

(25) The effect of increasing NADPH supply on the production of 3-hydroxypropionic acid was tested. The gapN gene from Streptococcus mutants, which encodes non-phosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, was codon optimized and synthesized by GeneScript (Piscataway, N.J., USA). The gene gapN was cloned into pIYCO4 (Chen et al., 2013) using the restriction sites NotI and SacI, resulting in plasmid pJC2. Plasmids pJC2 and pYC1 were transformed into CEN.PK 113-11C, forming the recombinant yeast strain HPY09. It was found that the over-expression of gapN alone resulted in a final titer of 122 mg l.sup.1 3-HP, which is a 30% improvement compared to the reference strain (FIG. 4).

Example 6. Construction of Strain with Improved NADPH Supply

(26) An elevated level of NADPH was achieved by overexpression of an NADP dependent glyceraldehyde-3-phosphate dehydrogenase gene from either Clostridium acetobutylicum, CaGAPDH (Seq ID NO 08), Kluyveromyces lactis, K1GAPDH (Seq ID NO 9), or Bacillus subtilis, BsGapB (Seq ID NO 10). The NADP dependent GAPDH was expressed in yeast strains, where one, two or three of the endogenous NAD dependent glyceraldehyde-3-phosphate dehydrogenase genes TDH1-3 were deleted and/or exchanged with the CDS of GAPDH. By exchanging the CDS we aimed to ensure that the introduced GAPDH had the same expression profile as the endogenous NAD dependent GAPDH. Additionally, any potential futile cycling between the endogenous GAPDH and the introduced GAPDH was avoided by removing or lowering the level of endogenous GAPDH activity. Eight different combinations were made according to Table 4. Each of those eight strains and a WT strain were all transformed with p380-ALD6-ACS in combination with p382-PDC1 and p474-CaMCR-ACC1**. A minimum of 12 clones for each strain were tested for 3HP production as in example 2 (FIG. 5). In both media tested, there was a significant increase in 3HP yield for the strains where TDH3 was replaced with CaGAPDH. However, there was no further effect when this exchange was combined with any of the other CDS exchanges. The three best producers for the WT and the tdh3::CaGAPDH strains were analyzed further by HPLC (FIG. 6). The WT strains gave 1.460.14 g/l and 3.310.34 g/l 3HP in DELFT and FIT, respectively. The tdh3::CaGAPDH strains gave 2.010.01 g/l and 5.100.22 g/l 3HP in DELFT and FIT, respectively. Furthermore, the ratio between 3HP formed and glycerol formed was higher for the tdh3::CaGAPDH strains in both media tested.

(27) The best producer among the tdh3::CaGAPDH strains was named ST687 and was used in future fermentation experiments.

Example 7. Fermentations of High Producing Strain (ST687)

(28) Strain ST687 was fermented under two different fermentation regimes; 1, N and C limited fed batch, and 2, C limited fed batch.

(29) TABLE-US-00005 N and C limited fed batch C limited fed batch Parameter Value Value Reactor A1, A3, B2 A1, A2, A3 number Organism S. cerevisiae S. cerevisiae Strain ST687 ST687 Batch Mix per reactor: 20 ml Mix per reactor: 75 ml medium (NH.sub.4).sub.2SO.sub.4 (100 g/L), 25 (NH.sub.4).sub.2SO.sub.4 (100 g/L), 25 ml KH.sub.2PO.sub.4 (120 g/L), 10 ml KH.sub.2PO.sub.4 (120 g/L), 10 ml MgSO.sub.4, 7H.sub.2O (50 g/L), ml MgSO.sub.4, 7H.sub.2O (50 g/L), 1 ml trace metals, 0.2 2 ml trace metals, 0.2 ml antifoam, add water ml antifoam, add water to 500 ml. Separatelly to 500 ml. Separatelly autoclave 110 g dextrose autoclave 110 g dextrose in 500 ml water, add 100 in 500 ml water, add 40 ml of this glucose ml of this glucose solution to reactor solution to reactor after autoclavation. after autoclavation. Also add 1 ml vitamins. Also add 1 ml vitamins. Feed Mix per feed bottle: 0.5 Mix per feed bottle: 225 ml medium L of 200 g/L glucose (NH.sub.4).sub.2SO.sub.4 (100 g/L), 75 solution. Add about 100 ml KH.sub.2PO.sub.4 (120 g/L), 30 ml (20 g) before ml MgSO.sub.4, 7H.sub.2O (50 g/L), inoculation to start the 6 ml trace metals, 0.3 batch phase, then add ml antifoam. This will the rest during the fed- make a total of 336 ml. batch phase. Add the remaining glucose solution (160 ml) to the feed bottle after auto- clavation. Also add 3 ml vitamins. Temper- 30 C. 30 C. ature pH 5 5 pH with 2M NaOH with 2M NaOH control DO not controlled controlled at >20% by stirring speed and aeration Working batch with 0.5 L, batch with 0.5 L, volume then fill up to 1 then fill up to 1 L during fed-batch L during fed-batch Agitation 800 rpm 800 rpm (variable in the fed-batch phase) Aeration 1 vvm (1 L/min) 1 vvm (1 L/min) (variable in the fed-batch phase) Aeration Air Air gas Fermentation 70 hours 120 hours lengh Sampling 2-3 times a day 2 times a day frequency

(30) The inoculum was prepared as follows. A stock tube of ST/687 was inoculated into 50 ml SC-ura-his-leu and grown overnight at 30 C. 400 ml fresh medium is added and divided into 3 flasks, 150 ml in each and grown overnight at 30 C. The cultures from overnight shake flasks is combined to obtain a total of about 450 ml, which then is poured into 650 ml Falcon tubes. Tubes are spun 4,000g for 2 min and supernatant is discarded. The rest of the overnight culture is added to the 6 tubes (about 25 ml/tube), resuspended, and pooled into 2 tubes into one to end up with 3 tubes. Inoculate 1 tube per reactor.

(31) Each sample was analyzed by HPLC as in example 4. The results are summarized in table below and in FIGS. 7 and 8.

(32) TABLE-US-00006 N and C limited C limited Titers (3-HP) 9.5 g/L 9.83 0.43 g/L Prod. Rate in fed batch 0.20 g/L/h 0.09 0.01 g/L/h phase Specific yield, g/g DW 1.01 g/g DW 0.69 0.05 g/g DW Overall yield, % C-mol/ 18% 13 1% C-mol glucose

(33) Both fermentations involving the best 3-HP producing yeast strain ST687 produced supernatant concentrations of >9 g/L 3-HP. This is a significant increase over the supernatant concentrations disclosed in the prior art.

REFERENCES

(34) Chen, Y., Partow, S., Scalcinati, G., Siewers, V., Nielsen, J. Enhancing the copy number of episomal plasmids in Saccharomyces cerevisiae for improved protein production. FEMS Yeast Res. 12, 598-607 (2012). Chen, Y., Daviet, L., Schalk, M., Siewers, V., Nielsen, J. Establishing a platform cell factory through engineering of yeast acetyl-CoA metabolism. Metab Eng. 15, 48-54 (2013). Dale, S., Wilson, W. A., Edelman, A. M. & Hardie, D. G. Similar substrate recognition motifs for mammalian AMP-activated protein kinase, higher plant HMG-CoA reductase kinase-A, yeast SNF1, and mammalian calmodulin-dependent protein kinase I. FEBS Letters 361, 191-195 (1995). Ficarro, S. et al. Phosphoproteome analysis by mass spectrometry and its application to Saccharomyces cerevisiae. Nat Biotechnol 20, 301-305 (2002). Nielsen, J. Systems biology of lipid metabolism: From yeast to human. FEBS Letters 583, 3905-3913 (2009). Rathnasingh, C., Raj, S. M., Lee, Y., Catherine, C., Ashok, S., Park, S., J. Production of 3-hydroxypropionic acid via malonyl-CoA pathway using recombinant Escherichia coli strains. J. Biotechnol., 633-640 (2012). Shirra, M. K. et al. Inhibition of Acetyl Coenzyme A Carboxylase Activity Restores Expression of the INO1 Gene in a snf1 Mutant Strain of Saccharomyces cerevisiae. Mol. Cell. Biol. 21, 5710-5722 (2001).

(35) In this specification, unless expressly otherwise indicated, the word or is used in the sense of an operator that returns a true value when either or both of the stated conditions is met, as opposed to the operator exclusive or which requires that only one of the conditions is met. The word comprising is used in the sense of including rather than in to mean consisting of. All prior teachings acknowledged above are hereby incorporated by reference. No acknowledgement of any prior published document herein should be taken to be an admission or representation that the teaching thereof was common general knowledge in Australia or elsewhere at the date hereof.

(36) The invention may be summarised according to the following clauses:

(37) 1. A yeast cell for use in producing 3-hydroxypropionic acid (3-HP), wherein said yeast cell incorporates genetic modification such that said cell expresses the enzymes:

(38) Pyruvate decarboxylase (PDC) Aldehyde dehydrogenase (ALD) Acetyl-CoA synthase (ACS) Acetyl-CoA carboxylase (ACC*) mutated in at least one dephosphorylation site to prevent inactivation by Snf1 Malonyl-CoA reductase (MCR),
said cell has a reduced level of activity of NAD dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by virtue of deletion, attenuation, disruption, down-regulation, or mutation of one or more genes expressing NAD dependent GAPDH and has at least one exogenous gene encoding NADP dependent GAPDH and/or has up-regulation of at least one endogenous gene expressing NADP dependent GAPDH, and
wherein combined expression of the enzymes NADP dependent GAPDH, PDC, ALD, ACS, ACC* and MCR in said host cell increases metabolic flux towards 3-HP via malonyl-CoA compared to an otherwise similar yeast cell lacking said genetic modification.
2. A yeast cell as defined in clause 1, comprising one or more exogenous nucleic acid molecules encoding at least one of PDC, ALD, ACS, ACC* and/or MCR.
3. A yeast cell as defined in clause 2, wherein a said nucleic acid molecule is expressed from multiple integrations of said nucleic acid molecule in the host cell genome.
4. A yeast cell as defined in clause 2, wherein a nucleic acid molecule encoding PDC is derived from Saccharomyces cerevisiae.
5. A yeast cell as defined in clause 2, wherein the nucleic acid molecule encoding ALD is derived from Saccharomyces cerevisiae.
6. A yeast cell as defined in clause 2, wherein a nucleic acid molecule encoding ACS is derived from Salmonella entherica.
7. A yeast cell as defined in clause 2, wherein a ACC* enzyme is mutated in at least two dephosphorylation positions in the enzyme.
8. A yeast cell as defined in clause 7, wherein the ACC* enzyme is mutated at amino acid positions Ser659 and Ser1157, wherein Ser659 and Ser1157 are replaced by amino acids comprising side chains which are incapable of being phosphorylated.
9. A yeast cell as defined in clause 8, wherein said amino acids comprising side chains which are incapable of being phosphorylated are Ala, Val, Leu, Ile, Pro, Phe, Trp, Met.
10. A yeast cell as defined in clause 8, wherein the nucleic acid molecule encoding the non-mutated version of the ACC* enzyme is derived from Saccharomyces cerevisiae.
11. A yeast cell as defined in clause 2, wherein a nucleic acid molecule encoding MCR is derived from Chloroflexus aurantiacus.
12. A yeast cell as defined in clause 1, wherein a nucleic acid molecule encoding NADP dependent GAPDH is derived from Clostridium acetobutylicum, Kluyveromyces lactis or Bacillus subtilis.
13. A method for producing 3-HP, said method comprising culturing yeast cells as claimed in any of the preceding claims under conditions such that 3-HP is produced.
14. A method as defined in clause 13, wherein said yeast cells are cultured on a medium comprising at least one carbon substrate.
15. A method as defined in clause 14, wherein said carbon substrate is glucose, xylose, arabinose, or galactose.
16. A method as defined in clause 13, wherein said yeast cells produce a supernatant concentration of at least 5 g/L 3-HP.
17. A method as defined in clause 13, wherein said yeast cells produce a supernatant concentration of at least 6 g/L 3-HP.
18. A method as defined in clause 13, wherein said yeast cells produce a supernatant concentration of at least 7 g/L 3-HP.
19. A method as defined in clause 13, wherein said yeast cells produce a supernatant concentration of at least 8 g/L 3-HP.
20. A method as defined in clause 13, wherein said yeast cells produce a supernatant concentration of at least 9 g/L 3-HP. n
21. A method as defined in clause 13, wherein said method further comprises isolating 3-HP produced by said yeast cells.