Interleukin 2 receptor gamma gene targeting vector, production of immune cell-deficient transgenic cloned mini pig having vector introduced therein, preparation method therefor and use thereof

Abstract

The present invention relates to an interleukin-2 receptor gamma (IL2RG) gene-targeting vector, a method for producing an immune cell-deficient transgenic cloned miniature pig having the vector introduced therein, and the use thereof.

Claims

1. A method for producing an immune cell-deficient transgenic miniature pig having an allelic mutation that disrupts the interleukin-2 receptor gamma (IL2RG) gene, the method comprising the steps of: (a) introducing into a miniature pig somatic cell a TALEN that recognizes a TALEN recognition sequence, wherein the TALEN recognition sequence is nucleotides 1-19 and 32-50 of SEQ ID NO:1 of the IL2RG gene on chromosome X of the pig somatic cell, and wherein said TALEN produces a deletion of nucleotides 26-29 of SEQ ID NO:1 of the IL2RG gene, and wherein said deletion results in an allelic mutation represented by SEQ ID NO:24 and a premature stop codon in the IL2RG gene; (b) producing a nuclear transfer miniature pig embryo by introducing the pig somatic cells produced in step (a) into enucleated miniature pig oocyte; and (c) transferring the embryo into a surrogate gilt and allowing the embryo to gestate to term to produce a transgenic miniature pig comprising a disruption in the IL2RG gene on chromosome X, wherein said disruption ablates IL2RG expression, and wherein the transgenic pig is immune cell deficient.

2. A method of claim 1, wherein said introducing of said TALEN comprises transfecting the miniature pig somatic cell with a vector encoding said TALEN.

3. A transgenic, cloned, immune cell-deficient miniature pig produced by the method of claim 1.

4. A cell from the transgenic, cloned immune cell-deficient miniature pig of claim 3.

5. The cell of claim 4, wherein the cell is a fibroblast cell line having accession number KCTC12497.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1a, FIG. 1b, FIG. 1c, and FIG. 1d show the production of SCID pigs using TALENs. Specifically, FIG. 1(a) schematically shows TALEN-mediated knockout of IL2RG and RAG2 (SEQ ID NOs: 22 and 23, respectively, in order of appearance). FIG. 1(b) shows a donor reporter vector including a TALEN recognition site. Cleavage of the TALEN recognition site in the donor reporter vector induces the expression of GFP. FIG. 1(c) shows the results of confirming designed TALENs in vitro. The expression of GFP can be detected even when TALENs are transfected with the donor reporter gene in HEK 293T cells. FIG. 1(d) shows the genotype of a pig produced by a genetic engineering method (SEQ ID NOs: 1 and 24, respectively, in order of appearance).

(2) FIG. 2 shows construction of a surrogate reporter vector for enrichment of cells targeted by TALENs. (a) The reporter vector comprises a monomeric RFP gene, a programmable nuclease-targeting sequence (left half-site and right half-site), an enhancer GFP and an H-2KK gene (the upper panel of FIG. 2). If the GFP and H-2KK sequences are out of the frame due to the absence of programmable nuclease activity, only the RFP gene is expressed. When double-strand cleavage by programmable nuclease is inserted into the targeting sequence, the cleavage is repaired by non-homologous end-joining (NHEJ), and often causes frame shift mutations. Such mutations can make GFP in frame with RFP, and induce the expression of an mRFP-eGFP-H-2KK fusion protein (lower panel of FIG. 2). (b) Two systems: magnetic separation by H-2KK antibody, and enrichment of nuclease-induced mutations in mRFP+eGFP+H-2KK+ cells sorted by flow cytometry according to the expressions of RFP and GFP. In cells, the reporter plasmid and the chromosome target site are shown. Mutations are indicated by black spots.

(3) FIG. 3a and FIG. 3b show FACS sorting of GFP-positive cells after introduction of TALENs. FIG. 3(a) High co-expression of RFP and GFP after 48 hours of transfection. FIG. 3(b) The box below the arrow indicates GFP-positive cells. The top 10% cells expressing strong GFP were sorted and placed in a 96-well plate. GFP-positive cells ranged from 23.0% to 38.0%. Scale bar=20 m.

(4) FIG. 4 shows the off-target analysis of the IL2RG mutant porcine IL2RG gene. Top) treatment of heteroduplex DNA with Surveyor nuclease showed no additional off-target mutation in 9 loci having the highest homology with the IL2RG gene. SM: size marker, lane 1: LRRIQ1; 2: BNC2; 3: SLC17A5; 4: ZNF334; 5: TTN; 6: PGRMC2; 7: AVPR2.8: CCDC18; and 9: ZSWIM2. Bottom) genes having IL2RG-related sequences (SEQ ID NOs: 25-34, respectively, in order of appearance) for excluding off-target mutations, and sequence homology between the genes.

(5) FIG. 5 shows the results of PCR sequencing for identifying candidate cell colonies for SCNT (SEQ ID NOs: 35 and 36, respectively, in order of appearance). Introduction of TALENs induced polymorphisms near the TALEN binding sites due to NHEJ. The types of polymorphisms were analyzed and used as cell colonies for SCNT.

(6) FIG. 6 is an image of an SCID pig model produced in the present invention. The genetic background of the pig is a Minnesota mini-pig.

(7) FIG. 7 shows produced IL2RG+/ piglets.

(8) FIG. 8a, FIG. 8b, and FIG. 8c show the results of verifying the expression of IL2R.

(9) FIG. 9a and FIG. 9b show the results of analyzing a subset of CD3+ T cells using T cell markers (CD25 and CD3).

(10) FIG. 10a, FIG. 10b, FIG. 10c, and FIG. 10d show the results of microarray chip analysis performed using IL2RG+/ tissue and normal tissue.

(11) FIG. 11a, FIG. 11b, and FIG. 11c show factors that influence IL2 receptors, and factors that are influenced by IL2 receptors.

MODE FOR INVENTION

(12) Hereinafter, the present invention will be described in further detail by non-limiting examples. It is to be understood, however, that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

(13) All animals and experiments used in the present invention were approved by the Institutional Animal Care and Use Committee, University of Missouri.

Example 1: Cell Transfection and Gene Targeting

(14) For gene targeting, 2-3 million cells were transfected with TALEN constructs having a reporter vector (2 g of each construct/million cells). The cells were electroporated with the construct using a BTX Electro Cell Manipulator (Harvard Apparatus, Holliston, Mass.) at 490 V, 1 msec and 3 pulses. Next, the cells were plated in T75 flasks for 48 hours, and then sorted for GTP positive cells using Beckman Coulter MoFlo XDP. The sorted cells were plated in 96-well plates. After 10 days, half of the cells were used for genotyping. To examine the presence of indels after insertion of TALENs, genomic DNA fragments flanking the TALEN cleavage site were amplified by PCR Genomic DNA from the cultured cells was isolated using cell lysis buffer, and then used for PCR. PCR for amplification was performed under the following conditions: initial denaturation at 95 C. for 2 min, followed by 32 cycles, each consisting of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 30 min (see the PCR primer set in Table 1 below). The predicted sizes of the PCR products were 417 bp for IL2RG and 426 bp for RAG2. The PCR products were sequenced to identify the presence of indels.

Example 2: Somatic Cell Nuclear Transfer

(15) To produce SCNT embryos, sow oocytes were purchased from ART (Madison, Wis.). The oocytes were shipped overnight in a maturation medium (TCM199 with 2.9 mM Hepes, 5 g/ml insulin, 10 ng/ml EGF, 0.5 g/ml p-FSH, 0.91 mM pyruvate, 0.5 mM cysteine, 10% porcine follicular fluid, and 25 ng/ml gentamicin). After 24 hours, the oocytes were transferred to a fresh medium. After 40-42 hours of maturation, cumulus cells were removed from the oocytes by vortexing in the presence of 0.1% hyaluronidase. During manipulation, the oocytes were placed in a manipulation medium supplemented with 7.0 g/ml of cytochalasin B. The polar body along with a portion of the adjacent cytoplasm, probably containing the metaphase II plate, was removed, and donor cells were placed in the perivitelline space using a thin glass capillary.

(16) Next, the reconstituted embryos were fused in a fusion medium (0.3 M mannitol, 0.1 mM CaCl.sub.2, 0.1 mM MgCl.sub.2, 0.5 mM Hepes) by two DC pulses (1-sec interval) at 1.2 kV/cm for 30 sec using BTX Electro Cell Manipulator (Harvard Apparatus). After fusion, the fused embryos were fully activated with 200 M thimerosal for 10 min and 8 mM dithiothreitol for 30 min under dark conditions. Then, the embryos were incubated with 0.5 M scriptaid (that is a histone deacetylase inhibitor) in Porcine Zygote Media 3 (PZM3).sup.3 for 14-16 hours. The next day, the SCNT embryos were transferred into surrogates. For blastocyst transfer, the embryos were washed from scriptaid and cultured in PZM3 in the presence of 10 ng/ml of CSF2 for additional five days. The SCNT embryos were surgically transferred into the ampullary-isthmic junction of surrogates.

Example 3: Immunohistochemistry (IHC)

(17) For IHC, tissues fixed in neutral buffer with 10% formalin were used. The tissues were placed on slides for IHC. Endogenous peroxidase activity was first blocked in 3% hydrogen peroxidase. The samples were pretreated with Borg Decloaker, and then blocked in background Sniper solution. After washing, the samples were incubated with primary antibodies specific either for B cells (CD79A; Diagnostic Biosystems-# Mob118, 1:100) or for T cells (CD3; DAKO-# A0452, 1:400). After incubation, the samples were washed and incubated with HRP-conjugated secondary antibodies. Then, the samples were stained with Romulin Red Chromogens to visualize the signals. In addition, the samples were also stained with IP FLX Hematoxylin to provide backgrounds. The Borg, Sniper, Romulin Red and IP FLX hematoxylin were all purchased from Biocare (Concord, Calif.). All micrographs were acquired using a Zeiss Axiophot microscope (Carl Zeiss, Oberkochen, Germany) equipped with an Olympus DP70 high-resolution digital microscope camera (Olympus, Center Valley, Pa.).

Example 4: Flow Cytometry

(18) The spleens from euthanized wild-type and biallelic piglets were collected into RPMI-1640 medium (Mediatech, Inc., Manassas, Va.) supplemented with 10% fetal bovine serum, minced with a scalpel blade, aspirated several times using a 20 gauge needle, and then passed through a 70 m nylon mesh cell strainer (BD Biosciences, San Jose, Calif.). The splenocyte suspension was then incubated for 15 minutes with Pharm Lyse solution (BD Biosciences) to lyse erythrocytes, and then pelleted at 200g for 5 minutes. After discarding the supernatant, the pellets were resuspended in cold staining buffer (BD Pharmingen), and the cells were counted on a hemacytometer. Then, the cells were divided into aliquots of 510.sup.6 cells in 200 L staining buffer. FITC-labeled mouse anti-pig CD21, mouse anti-pig CD 3, and mouse anti T-2 mycotoxin IgGlk (Isotype control group) (SouthemBiotech, Birmingham, Ala.) were added to the cells in an amount of 0.5 g/110.sup.6 cells, and then incubated at 4 C. under dark conditions for 30 minutes. The cells were then washed twice and resuspended in fresh staining buffer. The cells were analyzed using a CyAn ADP flow cytometer (Beckman Coulter, Brea, Calif.) in a Cell and Immunobiology Core facility at the University of Missouri. Data were analyzed using Summit v4.3 software (Beckman Coulter).

Example 5: Off-Target Analysis

(19) To identify putative off-target sequences from the TALENs used in the present invention, bioinformatics tools were used to identify sequences similar to each TALEN binding site from the most recent pig genome assembly (S scrofa10.2). PCR primers were designed flanking the most likely off-target sites based on the number of nucleotide differences. These regions were amplified in the founder animals and tested for off-targeting events using a Surveyor nuclease assay (Table 2 below). After PCR amplification, 300-500 ng of the PCR products (10-15 l) were transferred into fresh tubes, and then denaturated and reannealed according to a thermocycler program (95 C. for 2 min, 95 C. to 85 C. at a rate of 2 C./second, 85 C. to 25 C. at a rate of 0.1 C./second, 4 C. indefinitely). 1 l of Surveyor nuclease and 1 l of Surveyor enhancer were added thereto, and then incubated at 42 C. for 30 minutes. Then, the reactions were immediately placed on ice, and 6 Surveyor nuclease stop buffer and 6 dye were added to the reactions. The samples were electrophoresed on 2.0% agarose gel.

(20) TABLE-US-00001 TABLE1 Gene Primers Product IL2RG F:CTGGACTATTAGAAGGATGTGGGC 417 (SEQIDNO:2); R:ATATAGTGGGAAGCCTGGGATGCT (SEQIDNO:3)

(21) Table 1 above shows the primers used for genotyping of IL2RG mutants induced by TALENs.

(22) TABLE-US-00002 TABLE2 Abbre- Prod- Gene viation Primers uct Leucine-rich LRRIQ1 F:CGTTTGTTAAAACTGC 150 repeatsand AGCATA IQmotif (SEQIDNO:4); containing1 R:TTTTGCTTCCCTTTCC TTCC(SEQIDNO:5) Basonuclin2 BNC2 F:AGCCAGAGGAAGGGGT 199 TTTA(SEQIDNO:6); R:GGTTAACCAGCTCAGG CAAC(SEQIDNO:7) Solutecarrier SLC17A5 F:GTCTGGTTGCAGCTCA 369 family17 AGGT(SEQIDNO:8); (anion/sugar R:GCCACTGTGGACTCTAG transporter), AGGAT(SEQIDNO:9) member5 Zincfinger ZNF334 F:ATTCACACAGGGGAGAA 233 protein334 ACG(SEQIDNO:10); R:GTGGAAATTTTTCCCCC ATT(SEQIDNO:11) Titin TTN F:CTTTGGACCTGCCCACT 228 TT(SEQIDNO:12); R:GGATGTGTGATCGGTTC CAT(SEQIDNO:13) Progesterone PGRMC2 F:TGAGGGAGAGAGGAGAC 238 receptor CTG(SEQIDNO:14); membrane R:CTAGGGGAAGGAAAGGG component2 ATG(SEQIDNO:15) Arginine AVPR2 F:GGCGTACATGCCTACCA 246 vasopressin TCT(SEQIDNO:16); receptor2 R:CTGTCCACGGTCTTTGT GG(SEQIDNO:17) Coiled-coil CCDC18 F:TTCTCCCAACCCCATTT 405 domain ACA(SEQIDNO:18); containing18 R:CCTGAGTTGAACCAGCA CCT(SEQIDNO:19) Zincfinger, ZSWIM2 F:AAAAAGTTCTTCCTGTT 150 SWIM-type TTGACAGA(SEQIDNO: containing2 20);R:TGGTTATTCCAC CAATGCAA (SEQIDNO:21)

(23) Table 2 above shows the primer sets used to identify off-site targeting of porcine IL2RG.

(24) TABLE-US-00003 TABLE 3 IL2RG Embryo Transfer List Number Day of embryos of ET Date Donor cell transferred heat Results Oct. 12, 2012 Korean IL2RG 216 1 1 female 010, 13, 15 Feb. 25, 2013 Korean IL2RG 53-1 96 4 Cycled Feb. 25, 2013 Korean IL2RG 53-1 179 4 Cycled Apr. 2, 2013 Korean IL2RG 53-1 35 Blast 6 Cycled Apr. 9, 2013 Korean IL2RG 53-1 35 Blast 4 Cycled Apr. 10, 2013 Korean IL2RG 53-1 48 Blast 4 Apr. 23, 2013 Korean IL2RG 53-1 51 Blast 5 Apr. 25, 2013 Korean IL2RG 53-1 187 1 Apr. 26, 2013 Korean IL2RG 53-1 + 243 0 RAG2

(25) Table 3 above shows the nuclear transfer efficiencies obtained in the present invention.

(26) Accession No.

(27) Name of depository authority: Korea Research Institute of Bioscience and Biotechnology;

(28) Accession No.: KCTC 12497;

(29) Deposition Date: Oct. 2, 2013.