Needle-free administration of PRRSV vaccines

20180236056 ยท 2018-08-23

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides novel methods and compositions for the vaccination of porcine animals against porcine reproductive and respiratory syndrome virus (PRRSV). Described herein are immunological and/or vaccine compositions comprising a DNA vector encoding a PRRSV protein, particularly a truncated ORF7 protein, which are administered to porcines using needle-free delivery. The plasmid can include more than one nucleic acid molecule such that the plasmid can express more than one antigen. Also disclosed are methods for using and kits employing such compositions.

Claims

1-20. (canceled)

21. A non-viral DNA plasmid vector comprising a nucleic acid sequence encoding a truncated porcine reproductive and respiratory syndrome virus (PRRSV) ORF7 protein; wherein when said plasmid is administered to a suidae animal there is expression in vivo in the suidae animal of the truncated PRRSV ORF7 protein in an effective amount to provide the suidae animal protection from subsequent challenge with a virulent PRRSV; with the proviso that the truncated ORF7 protein lacks at least ii carboxy terminal amino acids when said truncated ORF7 protein is aligned and compared with a non-truncated PRRSV ORF7 protein having the polypeptide sequence as set forth in SEQ ID NO: 2.

22. The plasmid of claim 21, wherein the encoded truncated PRRSV ORF7 protein has at least 85% homology to the sequence as set forth in SEQ ID NO: 4.

23. The plasmid of claim 21, wherein the nucleic acid sequence consists of a sequence encoding the polypeptide sequence as set forth in SEQ ID NO: 4.

24. The plasmid of claim 21, wherein the truncated PRRSV ORF7 protein is encoded by a sequence having at least 70% homology with the sequence as set forth in SEQ ID NO:3.

25. The plasmid of claim 24, wherein the truncated PRRSV ORF7 protein is encoded by a sequence set forth in SEQ ID NO: 3.

26. A vaccine comprising the plasmid of claim 21.

27. The vaccine of claim 26, further comprising an adjuvant.

28. The vaccine of claim 27, formulated as an oil-in-water emulsion.

29. The vaccine of claim 28, wherein the emulsion is TS6.

30. The vaccine of claim 26, further comprising a pharmaceutically or veterinarily suitable carrier.

31. The vaccine of claim 26, formulated for transdermal administration.

32. The vaccine of claim 26, which is more effective at eliciting in an animal a protective immune response as compared with an otherwise identical vaccine, wherein the PRRSV protein is full-length instead of truncated.

33. The vaccine of claim 32, wherein the full-length protein has the sequence as set forth in SEQ ID NO: 2, and wherein the truncated PRRSV ORF7 protein has the sequence as set forth in SEQ ID NO: 4.

34. A method of eliciting in a suidae animal a safe and protective immune response against PRRSV comprising administering the vaccine of claim 26.

35. The method of claim 34, wherein the animal is a weaned piglet from about 11 to about 24 days of age.

36. The method of claim 34, wherein the vaccine is delivered using a liquid jet needle-free injector.

37. The method of claim 36, wherein the liquid jet needle-free injector is a DERMAVAC device.

38. The method of claim 34, wherein the plasmid is a pMASIA-based plasmid.

39. A vaccination kit or set, comprising a liquid jet needle-free injector and at least one vaccine vial containing the PRRSV vaccine of claim 26, operatively assembled to perform the administration of the vaccine to a suidae animal and to elicit a safe and protective immune response against PRRSV.

40. The kit of claim 39, comprising about 100 ng to about 500 g of the plasmid.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0022] The following Detailed Description, given by way of example, and not intended to limit the invention to specific embodiments described, may be understood in conjunction with the accompanying Figures, incorporated herein by reference, in which:

[0023] FIGS. 1A-1B illustrate the cloning scheme for producing pORF7 (SEQ ID NO:10) and pORF7t (SEQ ID NO:11); included is a map of pBAD-ORF7 (SEQ ID NO:13) and pMASIA (SEQ ID NO:9);

[0024] FIG. 2 presents amino acid sequence alignments of nucleocapsid proteins 1) US pMA C2 (SEQ ID NO:15), pBAD (SEQ ID NO:16), 01NP1.2 (SEQ ID NO:17); and 2) 01NP1 (SEQ ID NO:18) and ORF7t (SEQ ID NO:4);

[0025] FIG. 3 is an agarose gel image showing presence or absence of PRRSV-nucleocapsid gene (ORF7) PCR amplification products for the of the PRRSV-nucleocapsid gene (ORF7) in porcine PBMC transfected with either pORF7, pORF7t, or pMASIA plasmids;

[0026] FIG. 4 presents a Western blot analysis of the recombinant proteins produced from the expression vector containing ORF7 or ORF7t gene fragment;

[0027] FIG. 5 is an agarose gel image depicting the NcoI restriction analyses of pMASIA, pORF7, and pORF7t;

[0028] FIG. 6 presents the PRRSV vaccination study plan, including timeline of events and data collection;

[0029] FIGS. 7A-7B show intradermal injection of a plasmid into skin using a tuberculin syringe;

[0030] FIGS. 8A-8B show agarose gel images;

[0031] FIG. 9A is a graph of the numbers of PRRSV-specific IFN+ in the PBMC;

[0032] FIG. 9B is a graph of the numbers of IL-10+ cells in the PBMC;

[0033] FIG. 10A is a graph of the numbers of PRRSV-specific CD4+ CD25+ in the PBMC;

[0034] FIG. 10B is a graph of the numbers of CD4+ CD25+ Foxp3+ cells (B) in the PBMC;

[0035] FIG. 11A presents an overview of the experimental plan described in Example 3;

[0036] FIG. 11B presents clinical tests performed during the study;

[0037] FIG. 12A is a graph of the numbers of PRRSV-specific IL-10+ cells in the PBMC;

[0038] FIG. 12B is a graph of the numbers of PRRSV-specific IL-10+ cells in the lymphocyte population;

[0039] FIG. 12C is a graph of the number of PRRSV-specific IFN+ cells in the PBMC;

[0040] FIG. 12D is a graph of the number of PRRSV-specific IFN+ cells in the lymphocyte population; the FIGS. 12A-12D data represents mean percentage (SEM) of the cytokine producing cells, obtained by the percentage of the cytokine producing cells from the PRRSV-cultured cellsthe percentage of cytokine producing cells from the cells cultured with mock lysate. a indicates statistical difference from other groups, at p<0.05. b indicates statistical difference between the pORF7t and null plasmid, at p<0.05. c indicates statistical different between the pORF7t and PBSA, at p<0.05. d indicates statistical different between the null and PBSA, at p<0.05.

[0041] FIG. 13A is a graph of the numbers of PRRSV-specific Foxp3+ cells in the PBMC of the experimental pigs;

[0042] FIG. 13B is a graph of the numbers of PRRSV-specific Foxp3+ cells in the CD4+ CD25+ lymphocyte subpopulation from the PBMC of the experimental pigs; the FIGS. 13A-13B data represents mean percentage (SEM) of the Foxp3+ cells, obtained by the percentage of the Foxp3+ cells from the PRRSV-cultured cellsthe percentage of Foxp3+ cells from the cells cultured with mock lysate. (a indicates statistical difference from other groups, at p<0.05. b indicates statistical difference between the pORF7t and null plasmid, at p<0.05.)

[0043] FIG. 14A is a graph of the numbers of PRRSV-specific IL-10+ cells in the PBMC;

[0044] FIG. 14B is a graph of the numbers of PRRSV-specific IL-10+ cells in the lymphocyte population (B);

[0045] FIG. 14C is a graph of the number of PRRSV-specific IFN+ cells in the PBMC;

[0046] FIG. 14D is a graph of the number of PRRSV-specific IFN+ cells in the lymphocyte population; pigs were vaccinated with pORF7t, null plasmid, or PBSA on d35, and moved to the finisher unit. The freshly isolated porcine PBMC samples were cultured with 0.1 m.o.i. of US-PRRSV (strain 01NP1), or mock-infected MARC-145 lysate for 48 hrs prior to fluorescent staining and flow cytometric analyses. The data represents mean percentage (SEM) of the cytokine producing cells, obtained by the percentage of the cytokine producing cells from the PRRSV-cultured cellsthe percentage of cytokine producing cells from the cells cultured with mock lysate. (a indicates statistical difference from other groups, at p<0.05. b indicates statistical difference between the pORF7t and null plasmid, at p<0.05. c indicates statistical different between the pORF7t and PBSA, at p<0.05. d indicates statistical different between the null and PBSA, at p<0.05);

[0047] FIG. 15A is a graph of the numbers of PRRSV-specific Foxp3+ cells in the PBMC of the experimental pigs;

[0048] FIG. 15B is a graph of the numbers of PRRSV-specific Foxp3+ cells in the CD4+ CD25+ lymphocyte subpopulation from the PBMC of the experimental pigs; the data are mean percentage (SEM) of the Foxp3+ cells, obtained by the percentage of the Foxp3+ cells from the PRRSV-cultured cellsthe percentage of Foxp3+ cells from the cells cultured with mock lysate. (a indicates statistical difference from other groups, at p<0.05. b indicates statistical difference between the pORF7t and null plasmid, at p<0.05.)

[0049] FIG. 16 is a graph of PRRSV-specific antibody responses, as measured by IDEXX ELISA

[0050] FIG. 17 is a plot of the PRRSV viral load in the serum of the experimental pigs at d43

[0051] FIG. 18 are images of the needle-free injectors being used on the pigs;

[0052] FIG. 19 are graphs depicting numbers of Treg and IL-10+ cells from lymphocyte subpopulations in PBMC, isolated from pigs immunized with ORF7t500 g, ORF7t200 g, or Null500 g via Intradermal, Pulse50, or Dermavac;

[0053] FIG. 20 are graphs depicting numbers of IFN+ and CD8+ IFN+ cells from lymphocyte subpopulations in PBMC, isolated from pigs immunized with ORF7t500 g, ORF7t200 g, or Null500 g via Intradermal, Pulse50, or Dermavac;

[0054] FIG. 21 is a summary table of the sequence identification listing;

[0055] FIGS. 22A-22F show Numbers of PRRSV-specific CD4+ CD25+ FoxP3+ cells (A), IL-10+ cells (B), CD4+ CD25+ cells (C) and IFN+ cells (D) in a lymphocyte gate, numbers of PRRSV-specific IL-10+ (E), IFN+(F) cells in the CD4+ CD8+ lymphocyte subpopulation from pigs raised in the PRRSV-positive production system. Pigs were immunized with PBSA, null plasmid, or pORF7t on d0 (V1) and d21 (V2), and then moved to the fattening site on d35 (Move). The PBMCs were cultured with PRRSV (01NP1) or mock lysate for 48 hr prior to flow cytometric analysis. The data are meanSEM of the % PRRSV-activated lymphocyte subpopulations, subtracted with background obtained from the cells cultured with MARC-145 lysate. * indicates statistical difference between the DNA vaccinated group and the control groups (p<0.05, one-way ANOVA followed by Tukey multiple comparison test);

[0056] FIG. 23 is a graph showing S/P ratio among control and pORF7t vaccinated pigs;

[0057] FIG. 24 is a graph of lung scores obtained from the experimental pigs;

[0058] FIGS. 25A-25F are graphs indicating numbers of PRRSV-specific CD4+ CD25+ FoxP3+ cells (A), CD4+ CD25+ FoxP3+ IL-10+ cells (B), CD4+ CD25+ cells (C) and IFN+ cells (D) in a lymphocyte gate, numbers of PRRSV-specific IFN+ cells in CD4+ CD8+ (E) CD8+ subpopulation from pigs raised in a PRRSV-negative production system** indicates statistical difference between the DNA vaccinated group and the control groups (p<0.05, one-way ANOVA followed by Tukey multiple comparison);

[0059] FIG. 26A is a graph showing numbers of FoxP3.sup.+ cells from challenged pigs; Pigs were vaccinated with PBSA, null plasmid, or pORF7t on d0 (V1) and d21 (V2), and challenged (Chall.) on d35. The data are meanSEM of the % PRRSV-activated lymphocyte subpopulations, subtracted with background obtained from the cells cultured with MARC-145 lysate. Mean differences were considered significant if p<0.05, using one-way ANOVA followed by Tukey multiple comparison test (for FIG. 22A, pORF7t and PBSA means were significantly different).

[0060] FIG. 26B is a graph showing numbers of CD4.sup.+CD25.sup.+FoxP3.sup.+ cells from challenged pigs (pORF7t differed significantly from either null plasmid (pMASIA) or PBSA immunized group);

[0061] FIG. 26C is a graph showing numbers of CD4.sup.+CD25.sup.+FoxP3.sup.+IL-10.sup.+ cells form challenged pigs (pORF7t and null plasmid differed significantly);

[0062] FIG. 26D is a graph showing IL-10.sup.+ cells in a lymphocyte gate from challenged pigs;

[0063] FIG. 27A is a graph showing % CD4.sup.+CD25.sup.+ cells in a lymphocyte gate; Pigs were vaccinated with PBSA, null plasmid, or pORF7t on d0 (V1) and d21 (V2), and challenged (Chall.) on d35. The data are meanSEM of the % PRRSV-activated lymphocyte subpopulations, subtracted with background obtained from the cells cultured with MARC-145 lysate;

[0064] FIG. 27B is a graph showing % IFN producing cells in a lymphocyte gate;

[0065] FIG. 27C is a graph showing % IFN producing cells in CD4.sup.+ CD8.sup.+ population;

[0066] FIG. 27D is a graph showing % IFN producing cells in CD8.sup.+ population;

[0067] FIG. 28A is a graph showing % FoxP3.sup.+ cells following vaccination;

[0068] FIG. 28B is a graph showing % FoxP3.sup.+ cells following vaccination;

[0069] FIG. 28C is a graph showing % CD4.sup.+CD25.sup.+ cells following vaccination;

[0070] FIG. 28D is a graph showing % IFN producing cells;

[0071] FIG. 28E is a graph showing % IFN producing cells;

[0072] FIG. 28F is a graph showing % IFN producing cells;

[0073] FIG. 29A is a graph showing the levels of viral load in the serum samples following vaccination; pigs were vaccinated with PBSA, null plasmid, pORF7, or pORF7t on d0 and d21, and challenged with US-PRRSV (strain 01NP1) on d35 (0 dpi). Serum, lung, and tracheobronchial lymph node samples were collected at the indicated days, and subjected for determination of the quantity of PRRSV genome by quantitative RT-PCR (as described by Egli et al., 2001. J. Virol. Methods. 98: 63-75);

[0074] FIG. 29B is a graph of viral load in lung at 10 and 21 dpi;

[0075] FIG. 29C is a graph of viral load in lymph node at 10 and 21 dpi;

DETAILED DESCRIPTION

[0076] The present invention concerns a vaccination method against PRRSV, comprising the step of administration essentially in the dermis and the hypodermis of an animal of the suidae family an efficient amount of a PRRSV DNA vaccine using a liquid jet needle-free injector, which administration elicits a safe and protective immune response against PRRSV. Essentially means that some portion of the vaccine may also be found in the epidermis or in the muscles.

[0077] A protective immune response is characterized by a significant reduction of the antigenemia after challenge or by significant neutralizing antibody titers. A safe immune response is characterized by the limitation of the side effects linked to the vaccine administration, notably by a significant reduction or by the absence of local injection site reaction and by a significant reduction or by the absence of symptoms, like anorexia and depression following vaccine administration.

[0078] As used herein, the term pig refers to an animal of porcine origin, in other words, an animal of the suidae family. The term boar refers to an entire male pig over six months of age destined as a sire. The term gilt refers to a young female pig who has not produced first litter up to first farrowing. The term hog refers to a castrated male pig. The term piglet refers to a young pig. The term porker refers to a breed of pig breed for good pork meat cuts. The term stores refers to a pig which may be about 10-12 weeks old. The term sow refers to a female of reproductive age and capability or a female pig after she has had her first litter. The term weaned piglet or weaner refers to a young pig which may be about 11 to about 24 days of age, about two to three weeks of age, about three to five weeks of age or about five to eight weeks old weeks of age.

[0079] As used herein, the term virulent means an isolate that retains its ability to be infectious in an animal host.

[0080] As used herein, the term inactivated vaccine means a vaccine composition containing an infectious organism or pathogen that is no longer capable of replication or growth. The pathogen may be bacterial, viral, protozoal or fungal in origin. Inactivation may be accomplished by a variety of methods including freeze-thawing, chemical treatment (for example, treatment with thimerosal or formalin), sonication, radiation, heat or any other convention means sufficient to prevent replication or growth of the organism while maintaining its immunogenicity.

[0081] As used herein, the term immune response refers to a response elicited in an animal. An immune response may refer to cellular immunity (CMI); humoral immunity or may involve both. The present invention also contemplates a response limited to a part of the immune system. For example, a vaccine composition of the present invention may specifically induce an increased gamma interferon response.

[0082] As used herein, the term antigen or immunogen means a substance that induces a specific immune response in a host animal. The antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing a polynucleotide encoding an immunogen, capable of inducing an immune response upon presentation to a host animal; a protein, a polypeptide, a peptide, an epitope, a hapten, or any combination thereof.

[0083] As used herein, the term multivalent means a vaccine containing more than one antigen from different genera or species of microorganisms (for example, a vaccine comprising antigens from Pasteurella multocida, Salmonella, Escherichia coli, Haemophilus somnus and Clostridium).

[0084] As used herein, the term adjuvant means a substance added to a vaccine to increase a vaccine's immunogenicity. The mechanism of how an adjuvant operates is not entirely known. Some adjuvants are believed to enhance the immune response by slowly releasing the antigen, while other adjuvants present the immunogen to the host immune system more efficiently or effectively or stimulate the production of specific cytokines.

[0085] As used herein, the terms pharmaceutically acceptable carrier and pharmaceutically acceptable vehicle are interchangeable and refer to a fluid vehicle for containing vaccine antigens that can be injected into a host without adverse effects. Suitable pharmaceutically acceptable carriers known in the art include, but are not limited to, sterile water, saline, glucose, dextrose, or buffered solutions. Carriers may include auxiliary agents including, but not limited to, diluents, stabilizers (i.e., sugars and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, viscosity enhancing additives, colors and the like.

[0086] As used herein, the term vaccine composition includes at least one antigen or immunogen in a pharmaceutically acceptable vehicle useful for inducing an immune response in a host. Vaccine compositions can be administered in dosages and by techniques well known to those skilled in the medical or veterinary arts, taking into consideration such factors as the age, sex, weight, species and condition of the recipient animal, and the route of administration. The route of administration can be percutaneous e.g. intradermal, intramuscular, subcutaneous. Vaccine compositions can be administered alone, or can be co-administered or sequentially administered with other treatments or therapies. The compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, adjuvants, or viscosity enhancing additives, preservatives, colors, and the like, depending upon the route of administration and the preparation desired. Standard pharmaceutical texts, such as Remington's Pharmaceutical Sciences, 1990 may be consulted to prepare suitable preparations, without undue experimentation.

[0087] The invention further encompasses at least one PRRSV immunogen contained in a vector molecule or an expression vector and operably linked to a promoter element and optionally to an enhancer. In an embodiment the vector is pMASIA.

[0088] In an embodiment, the promoter is the promoter of the cytomegalovirus (CMV) immediate early gene. In another advantageous embodiment, the promoter and/or enhancer elements are oxygen-inducible. Examples of oxygen-inducible promoters and/or enhancers that can be used in the methods of the present invention include, but are not limited to, early growth response-1 (Egr1) promoter (see, e.g., Park et al., J Clin Invest. 2002 August; 110(3):403-1), hypoxia-inducible factor (HIF) inducible enhancers (see e.g., Cuevas et al., Cancer Res. 2003 October 15; 63(20):6877-84) and Mn-superoxide dismutase (Mn-SOD) promoters (see, e.g., Gao et al., Gene. 1996 October 17; 176(1-2):269-70).

[0089] In another embodiment, the enhancers and/or promoters include various cell or tissue specific promoters (e.g., muscle, endothelial cell, liver, somatic cell or stem cell), various viral promoters and enhancers and various PRRSV immunogen sequences isogenically specific for each animal species. Examples of muscle-specific promoters and enhancers have been described are known to one of skill in the art (see, e.g., Li et al., Gene Ther. 1999 December; 6(12):2005-11; Li et al., Nat Biotechnol. 1999 March; 17(3):241-5 and Loirat et al., Virology. 1999 July 20; 260(1):74-83; the disclosures of which are incorporated by reference in their entireties).

[0090] Promoters and enhancers that may be employed in the present invention include, but are not limited to LTR or the Rous sarcoma virus, TK of HSV-1, early or late promoter of SV40, adenovirus major late (MLP), phosphoglycerate kinase, metallothionein, -1 antitrypsin, albumin, collagenase, elastase I, -actin, -globin, -globin, -fetoprotein, muscle creatine kinase.

[0091] A vector refers to a recombinant DNA or RNA plasmid or virus that comprises a heterologous polynucleotide to be delivered to a target cell, either in vitro or in vivo. The heterologous polynucleotide may comprise a sequence of interest for purposes of therapy, and may optionally be in the form of an expression cassette. As used herein, a vector need not be capable of replication in the ultimate target cell or subject. The term includes cloning vectors also included are viral vectors.

[0092] The term recombinant means a polynucleotide of semisynthetic or synthetic origin which either does not occur in nature or is linked to another polynucleotide in an arrangement not found in nature.

[0093] Heterologous means derived from a genetically distinct entity from the rest of the entity to which it is being compared. For example, a polynucleotide may be placed by genetic engineering techniques into a plasmid or vector derived from a different source, and is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence other than the native sequence is a heterologous promoter.

[0094] The polynucleotides of the invention may comprise additional sequences, such as additional encoding sequences within the same transcription unit, controlling elements such as promoters, ribosome binding sites, polyadenylation sites, additional transcription units under control of the same or a different promoter, sequences that permit cloning, expression, homologous recombination, and transformation of a host cell, and any such construct as may be desirable to provide embodiments of this invention.

[0095] The present invention encompasses a vector expressing a PRRSV immunogen or variants or analogues or fragments. Elements for the expression of a PRRSV immunogen are advantageously present in an inventive vector. In minimum manner, this comprises, consists essentially of, or consists of an initiation codon (ATG), a stop codon and a promoter, and optionally also a polyadenylation sequence for certain vectors such as plasmid and certain viral vectors, e.g., viral vectors other than poxviruses. When the polynucleotide encodes a polyprotein fragment, e.g. a PRRSV immunogen, advantageously, in the vector, an ATG is placed at 5 of the reading frame and a stop codon is placed at 3. Other elements for controlling expression may be present, such as enhancer sequences, stabilizing sequences, such as intron and signal sequences permitting the secretion of the protein.

[0096] Methods for making and/or administering a vector or recombinants or plasmid for expression of gene products of genes either in vivo or in vitro can be any desired method, e.g., a method which is by or analogous to the methods disclosed in, or disclosed in documents cited in: U.S. Pat. Nos. 4,603,112; 4,769,330; 4,394,448; 4,722,848; 4,745,051; 4,769,331; 4,945,050; 5,494,807; 5,514,375; 5,744,140; 5,744,141; 5,756,103; 5,762,938; 5,766,599; 5,990,091; 5,174,993; 5,505,941; 5,338,683; 5,494,807; 5,591,639; 5,589,466; 5,677,178; 5,591,439; 5,552,143; 5,580,859; 6,130,066; 6,004,777; 6,130,066; 6,497,883; 6,464,984; 6,451,770; 6,391,314; 6,387,376; 6,376,473; 6,368,603; 6,348,196; 6,306,400; 6,228,846; 6,221,362; 6,217,883; 6,207,166; 6,207,165; 6,159,477; 6,153,199; 6,090,393; 6,074,649; 6,045,803; 6,033,670; 6,485,729; 6,103,526; 6,224,882; 6,312,682; 6,348,450 and 6; 312,683; U.S. patent application Ser. No. 920,197, filed Oct. 16, 1986; WO 90/01543; WO91/11525; WO 94/16716; WO 96/39491; WO 98/33510; EP 265785; EP 0 370 573; Andreansky et al., Proc. Natl. Acad. Sci. USA 1996; 93:11313-11318; Ballay et al., EMBO J. 1993; 4:3861-65; Felgner et al., J. Biol. Chem. 1994; 269:2550-2561; Frolov et al., Proc. Natl. Acad. Sci. USA 1996; 93:11371-11377; Graham, Tibtech 1990; 8:85-87; Grunhaus et al., Sem. Virol. 1992; 3:237-52; Ju et al., Diabetologia 1998; 41:736-739; Kitson et al., J. Virol. 1991; 65:3068-3075; McClements et al., Proc. Natl. Acad. Sci. USA 1996; 93:11414-11420; Moss, Proc. Natl. Acad. Sci. USA 1996; 93:11341-11348; Paoletti, Proc. Natl. Acad. Sci. USA 1996; 93:11349-11353; Pennock et al., Mol. Cell. Biol. 1984; 4:399-406; Richardson (Ed), Methods in Molecular Biology 1995; 39, Baculovirus Expression Protocols, Humana Press Inc.; Smith et al. (1983) Mol. Cell. Biol. 1983; 3:2156-2165; Robertson et al., Proc. Natl. Acad. Sci. USA 1996; 93:11334-11340; Robinson et al., Sem. Immunol. 1997; 9:271; and Roizman, Proc. Natl. Acad. Sci. USA 1996; 93:11307-11312. Thus, the vector in the invention can be any suitable recombinant virus or virus vector, such as a poxvirus (e.g., vaccinia virus, avipox virus, canarypox virus, fowlpox virus, raccoonpox virus, swinepox virus, etc.), adenovirus (e.g., human adenovirus, canine adenovirus), herpesvirus (e.g. canine herpesvirus), baculovirus, retrovirus, etc. (as in documents incorporated herein by reference); or the vector can be a plasmid. The herein cited and incorporated herein by reference documents, in addition to providing examples of vectors useful in the practice of the invention, can also provide sources for non-PRRSV immunogens, e.g., non-PRRSV immunogens, non-PRRSV immunogens peptides or fragments thereof, cytokines, etc. to be expressed by vector or vectors in, or included in, the compositions of the invention.

[0097] The present invention also relates to preparations comprising vectors, such as expression vectors, e.g., therapeutic compositions. The preparations can comprise, consist essentially of, or consist of one or more vectors, e.g., expression vectors, such as in vivo expression vectors, comprising, consisting essentially or consisting of (and advantageously expressing) one or more of PRRSV immunogens. Advantageously, the vector contains and expresses a polynucleotide that includes, consists essentially of, or consists of a coding region encoding one or more PRRSV immunogens a pharmaceutically or veterinarily acceptable carrier, excipient or vehicle. Thus, according to an embodiment of the invention, the other vector or vectors in the preparation comprises, consists essentially of or consists of a polynucleotide that encodes, and under appropriate circumstances the vector expresses one or more other proteins of a PRRSV immunogen or a fragment thereof.

[0098] According to another embodiment, the vector or vectors in the preparation comprise, or consist essentially of, or consist of polynucleotide(s) encoding one or more proteins or fragment(s) thereof of a PRRSV immunogen, the vector or vectors have expression of the polynucleotide(s). The inventive preparation advantageously comprises, consists essentially of, or consists of, at least two vectors comprising, consisting essentially of, or consisting of, and advantageously also expressing, advantageously in vivo under appropriate conditions or suitable conditions or in a suitable host cell, polynucleotides from different PRRSV isolates encoding the same proteins and/or for different proteins, but advantageously for the same proteins. Preparations containing one or more vectors containing, consisting essentially of or consisting of polynucleotides encoding, and advantageously expressing, advantageously in vivo, PRRSV peptide, fusion protein or an epitope thereof.

[0099] According to one embodiment of the invention, the expression vector is a DNA vector, in particular an in vivo expression vector.

[0100] In one particular embodiment the viral vector is a poxvirus, e.g. a vaccinia virus or an attenuated vaccinia virus, (for instance, MVA, a modified Ankara strain obtained after more than 570 passages of the Ankara vaccine strain on chicken embryo fibroblasts; see Stickl & Hochstein-Mintzel, Munch. Med. Wschr., 1971, 113, 1149-1153; Sutter et al., Proc. Natl. Acad. Sci. U.S.A., 1992, 89, 10847-10851; available as ATCC VR-1508; or NYVAC, see U.S. Pat. No. 5,494,807, for instance, Examples 1 to 6 and et seq of U.S. Pat. No. 5,494,807 which discuss the construction of NYVAC, as well as variations of NYVAC with additional ORFs deleted from the Copenhagen strain vaccinia virus genome, as well as the insertion of heterologous coding nucleic acid molecules into sites of this recombinant, and also, the use of matched promoters; see also WO96/40241), an avipox virus or an attenuated avipox virus (e.g., canarypox, fowlpox, dovepox, pigeonpox, quailpox, ALVAC or TROVAC; see, e.g., U.S. Pat. Nos. 5,505,941, 5,494,807), swinepox, raccoonpox, camelpox, or myxomatosis virus.

[0101] According to another embodiment of the invention, the poxvirus vector is a canarypox virus or a fowlpox virus vector, advantageously an attenuated canarypox virus or fowlpox virus. In this regard, is made to the canarypox available from the ATCC under access number VR-111. Attenuated canarypox viruses are described in U.S. Pat. No. 5,756,103 (ALVAC) and WO01/05934. Numerous fowlpox virus vaccination strains are also available, e.g. the DIFTOSEC CT strain marketed by MERIAL and the NOBILIS VARIOLE vaccine marketed by INTERVET; and, reference is also made to U.S. Pat. No. 5,766,599 which pertains to the attenuated fowlpox strain TROVAC.

[0102] For information on the method to generate recombinants thereof and how to administer recombinants thereof, the skilled artisan can refer documents cited herein and to WO90/12882, e.g., as to vaccinia virus mention is made of U.S. Pat. Nos. 4,769,330, 4,722,848, 4,603,112, 5,110,587, 5,494,807, and 5,762,938 inter alia; as to fowlpox, mention is made of U.S. Pat. Nos. 5,174,993, 5,505,941 and U.S. Pat. No. 5,766,599 inter alia; as to canarypox mention is made of U.S. Pat. No. 5,756,103 inter alia; as to swinepox mention is made of U.S. Pat. No. 5,382,425 inter alia; and, as to raccoonpox, mention is made of WO00/03030 inter alia.

[0103] When the expression vector is a vaccinia virus, insertion site or sites for the polynucleotide or polynucleotides to be expressed are advantageously at the thymidine kinase (TK) gene or insertion site, the hemagglutinin (HA) gene or insertion site, the region encoding the inclusion body of the A type (ATI); see also documents cited herein, especially those pertaining to vaccinia virus. In the case of canarypox, advantageously the insertion site or sites are ORF(s) C3, C5 and/or C6; see also documents cited herein, especially those pertaining to canarypox virus. In the case of fowlpox, advantageously the insertion site or sites are ORFs F7 and/or F8; see also documents cited herein, especially those pertaining to fowlpox virus. The insertion site or sites for MVA virus area advantageously as in various publications, including Carroll M. W. et al., Vaccine, 1997, 15 (4), 387-394; Stittelaar K. J. et al., J. Virol., 2000, 74 (9), 4236-4243; Sutter G. et al., 1994, Vaccine, 12 (11), 1032-1040; and, in this regard it is also noted that the complete MVA genome is described in Antoine G., Virology, 1998, 244, 365-396, which enables the skilled artisan to use other insertion sites or other promoters.

[0104] Advantageously, the polynucleotide to be expressed is inserted under the control of a specific poxvirus promoter, e.g., the vaccinia promoter 7.5 kDa (Cochran et al., J. Virology, 1985, 54, 30-35), the vaccinia promoter I3L (Riviere et al., J. Virology, 1992, 66, 3424-3434), the vaccinia promoter HA (Shida, Virology, 1986, 150, 451-457), the cowpox promoter ATI (Funahashi et al., J. Gen. Virol., 1988, 69, 35-47), the vaccinia promoter H6 (Taylor J. et al., Vaccine, 1988, 6, 504-508; Guo P. et al. J. Virol., 1989, 63, 4189-4198; Perkus M. et al., J. Virol., 1989, 63, 3829-3836), inter alia.

[0105] In an embodiment the viral vector is an adenovirus, such as a human adenovirus (HAV) or a canine adenovirus (CAV).

[0106] In one embodiment the viral vector is a human adenovirus, in particular a serotype 5 adenovirus, rendered incompetent for replication by a deletion in the E1 region of the viral genome, in particular from about nucleotide 459 to about nucleotide 3510 by reference to the sequence of the hAd5 disclosed in Genbank under the accession number M73260 and in the referenced publication J. Chroboczek et al Virol. 1992, 186, 280-285. The deleted adenovirus is propagated in E1-expressing 293 (F. Graham et al J. Gen. Virol. 1977, 36, 59-72) or PER cells, in particular PER.C6 (F. Falloux et al Human Gene Therapy 1998, 9, 1909-1917). The human adenovirus can be deleted in the E3 region, in particular from about nucleotide 28592 to about nucleotide 30470. The deletion in the E1 region can be done in combination with a deletion in the E3 region (see, e.g. J. Shriver et al. Nature, 2002, 415, 331-335, F. Graham et al Methods in Molecular Biology Vol 0.7: Gene Transfer and Expression Protocols Edited by E. Murray, The Human Press Inc, 1991, p 109-128; Y. Ilan et al Proc. Natl. Acad. Sci. 1997, 94, 2587-2592; U.S. Pat. No. 6,133,028; U.S. Pat. No. 6,692,956; S. Tripathy et al Proc. Natl. Acad. Sci. 1994, 91, 11557-11561; B. Tapnell Adv. Drug Deliv. Rev. 1993, 12, 185-199; X. Danthinne et al Gene Thrapy 2000, 7, 1707-1714; K. Berkner Bio Techniques 1988, 6, 616-629; K. Berkner et al Nucl. Acid Res. 1983, 11, 6003-6020; C. Chavier et al J. Virol. 1996, 70, 4805-4810). The insertion sites can be the E1 and/or E3 loci (region) eventually after a partial or complete deletion of the E1 and/or E3 regions. Advantageously, when the expression vector is an adenovirus, the polynucleotide to be expressed is inserted under the control of a promoter functional in eukaryotic cells, such as a strong promoter, preferably a cytomegalovirus immediate-early gene promoter (CMV-IE promoter), in particular the enhancer/promoter region from about nucleotide 734 to about nucleotide +7 in M. Boshart et al Cell 1985, 41, 521-530 or the enhancer/promoter region from the pCI vector from Promega Corp. The CMV-IE promoter is advantageously of murine or human origin. The promoter of the elongation factor 1 can also be used. In one particular embodiment a promoter regulated by hypoxia, e.g. the promoter HRE described in K. Boast et al Human Gene Therapy 1999, 13, 2197-2208), can be used. A muscle specific promoter can also be used (X. Li et al Nat. Biotechnol. 1999, 17, 241-245). Strong promoters are also discussed herein in relation to plasmid vectors. In one embodiment, a splicing sequence can be located downstream of the enhancer/promoter region. For example, the intron 1 isolated from the CMV-IE gene (R. Stenberg et al J. Virol. 1984, 49, 190), the intron isolated from the rabbit or human -globin gene, in particular the intron 2 from the b-globin gene, the intron isolated from the immunoglobulin gene, a splicing sequence from the SV40 early gene or the chimeric intron sequence isolated from the pCI vector from Promega Corp. comprising the human -globin donor sequence fused to the mouse immunoglobulin acceptor sequence (from about nucleotide 890 to about nucleotide 1022 in Genbank under the accession number CVU47120). A poly(A) sequence and terminator sequence can be inserted downstream the polynucleotide to be expressed, e.g. a bovine growth hormone gene, in particular from about nucleotide 2339 to about nucleotide 2550 in Genbank under the accession number BOVGHRH, a rabbit -globin gene or a SV40 late gene polyadenylation signal.

[0107] In another embodiment the viral vector is a canine adenovirus, in particular a CAV-2 (see, e.g. L. Fischer et al. Vaccine, 2002, 20, 3485-3497; U.S. Pat. No. 5,529,780; U.S. Pat. No. 5,688,920; PCT Application No. WO95/14102). For CAV, the insertion sites can be in the E3 region and/or in the region located between the E4 region and the right ITR region (see U.S. Pat. No. 6,090,393; U.S. Pat. No. 6,156,567). In one embodiment the insert is under the control of a promoter, such as a cytomegalovirus immediate-early gene promoter (CMV-IE promoter) or a promoter already described for a human adenovirus vector. A poly(A) sequence and terminator sequence can be inserted downstream the polynucleotide to be expressed, e.g. a bovine growth hormone gene or a rabbit -globin gene polyadenylation signal.

[0108] In another particular embodiment the viral vector is a herpesvirus such as a canine herpesvirus (CHV) or a porcine herpesvirus (FHV). For CHV, the insertion sites may be in particular in the thymidine kinase gene, in the ORF3, or in the UL43 ORF (see U.S. Pat. No. 6,159,477). In one embodiment the polynucleotide to be expressed is inserted under the control of a promoter functional in eukaryotic cells, advantageously a CMV-IE promoter (murine or human). In one particular embodiment a promoter regulated by hypoxia, e.g. the promoter HRE described in K. Boast et al Human Gene Therapy 1999, 13, 2197-2208), can be used. A poly(A) sequence and terminator sequence can be inserted downstream the polynucleotide to be expressed, e.g. bovine growth hormone or a rabbit -globin gene polyadenylation signal.

[0109] According to a yet further embodiment of the invention, the expression vector is a plasmid vector or a DNA plasmid vector, in particular an in vivo expression vector. In a specific, non-limiting example, the pVR1020 or 1012 plasmid (VICAL Inc.; Luke C. et al., Journal of Infectious Diseases, 1997, 175, 91-97; Hartikka J. et al., Human Gene Therapy, 1996, 7, 1205-1217, see, e.g., U.S. Pat. Nos. 5,846,946 and 6,451,769) can be utilized as a vector for the insertion of a polynucleotide sequence. The pVR1020 plasmid is derived from pVR1012 and contains the human tPA signal sequence. In one embodiment the human tPA signal comprises from amino acid M(1) to amino acid S(23) in Genbank under the accession number HUMTPAl4. In another specific, non-limiting example, the plasmid utilized as a vector for the insertion of a polynucleotide sequence can contain the signal peptide sequence of equine IGF1 from amino acid M(24) to amino acid A(48) in Genbank under the accession number U28070. Additional information on DNA plasmids which may be consulted or employed in the practice are found, for example, in U.S. Pat. Nos. 6,852,705; 6,818,628; 6,586,412; 6,576,243; 6,558,674; 6,464,984; 6,451,770; 6,376,473 and 6,221,362.

[0110] The term plasmid covers any DNA transcription unit comprising a polynucleotide according to the invention and the elements necessary for its in vivo expression in a cell or cells of the desired host or target; and, in this regard, it is noted that a supercoiled or non-supercoiled, circular plasmid, as well as a linear form, are intended to be within the scope of the invention.

[0111] Each plasmid comprises or contains or consists essentially of, in addition to the polynucleotide encoding the PRRSV immunogen or a variant, analog or fragment thereof, operably linked to a promoter or under the control of a promoter or dependent upon a promoter. In general, it is advantageous to employ a strong promoter functional in eukaryotic cells. The preferred strong promoter is the immediate early cytomegalovirus promoter (CMV-IE) of human or murine origin, or optionally having another origin such as the rat or guinea pig. The CMV-IE promoter can comprise the actual promoter part, which may or may not be associated with the enhancer part Reference can be made to EP-A-260 148, EP-A-323 597, U.S. Pat. Nos. 5,168,062, 5,385,839, and 4,968,615, as well as to PCT Application No WO87/03905. The CMV-IE promoter is advantageously a human CMV-IE (Boshart M. et al., Cell., 1985, 41, 521-530) or murine CMV-IE.

[0112] In more general terms, the promoter has either a viral or a cellular origin. A strong viral promoter other than CMV-IE that may be usefully employed in the practice of the invention is the early/late promoter of the SV40 virus or the LTR promoter of the Rous sarcoma virus. A strong cellular promoter that may be usefully employed in the practice of the invention is the promoter of a gene of the cytoskeleton, such as e.g. the desmin promoter (Kwissa M. et al., Vaccine, 2000, 18, 2337-2344), or the actin promoter (Miyazaki J. et al., Gene, 1989, 79, 269-277).

[0113] Functional sub fragments of these promoters, i.e., portions of these promoters that maintain an adequate promoting activity, are included within the present invention, e.g. truncated CMV-IE promoters according to PCT Application No. WO98/00166 or U.S. Pat. No. 6,156,567 can be used in the practice of the invention. A promoter in the practice of the invention consequently includes derivatives and sub fragments of a full-length promoter that maintain an adequate promoting activity and hence function as a promoter, preferably promoting activity substantially similar to that of the actual or full-length promoter from which the derivative or sub fragment is derived, e.g., akin to the activity of the truncated CMV-IE promoters of U.S. Pat. No. 6,156,567 to the activity of full-length CMV-IE promoters. Thus, a CMV-IE promoter in the practice of the invention can comprise or consist essentially of or consist of the promoter portion of the full-length promoter and/or the enhancer portion of the full-length promoter, as well as derivatives and sub fragments.

[0114] Preferably, the plasmids comprise or consist essentially of other expression control elements. It is particularly advantageous to incorporate stabilizing sequence(s), e.g., intron sequence(s), preferably the first intron of the hCMV-IE (PCT Application No WO89/01036), the intron II of the rabbit b-globin gene (van Ooyen et al., Science, 1979, 206, 337-344).

[0115] As to the polyadenylation signal (polyA) for the plasmids and viral vectors other than poxviruses, use can more be made of the poly(A) signal of the bovine growth hormone (bGH) gene (see U.S. Pat. No. 5,122,458), or the poly(A) signal of the rabbit b-globin gene or the poly(A) signal of the SV40 virus.

[0116] According to another embodiment of the invention, the expression vectors are expression vectors used for the in vitro expression of proteins in an appropriate cell system. The expressed proteins can be harvested in or from the culture supernatant after, or not after secretion (if there is no secretion a cell lysis typically occurs or is performed), optionally concentrated by concentration methods such as ultrafiltration and/or purified by purification means, such as affinity, ion exchange or gel filtration-type chromatography methods.

[0117] Host cells that can be used in the present invention include, but are not limited to, muscle cells, keratinocytes, myoblasts, Chinese Hamster ovary cells (CHO), vero cells, BHK21, sf9 cells, and the like. It is understood to one of skill in the art that conditions for culturing a host cell varies according to the particular gene and that routine experimentation is necessary at times to determine the optimal conditions for culturing an PRRSV depending on the host cell. For example, the vector encoding an PRRSV immunogen can be transformed into myoblasts (which can be obtained from muscle tissue from the animal in need of treatment), and the transformed myoblasts can be transplanted to the animal. In another example, keratinocytes can also be transformed with a vector encoding a PRRSV immunogen and transplanted into the animal, resulting in secretion of a PRRSV immunogen into circulation.

[0118] A host cell denotes a prokaryotic or eukaryotic cell that has been genetically altered, or is capable of being genetically altered by administration of an exogenous polynucleotide, such as a recombinant plasmid or vector. When referring to genetically altered cells, the term refers both to the originally altered cell and to the progeny thereof.

[0119] Polynucleotides comprising a desired sequence can be inserted into a suitable cloning or expression vector, and the vector in turn can be introduced into a suitable host cell for replication and amplification. Polynucleotides can be introduced into host cells by any means known in the art. The vectors containing the polynucleotides of interest can be introduced into the host cell by any of a number of appropriate means, including direct uptake, endocytosis, transfection, f-mating, electroporation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; lipofection; and infection (where the vector is infectious, for instance, a retroviral vector). The choice of introducing vectors or polynucleotides will often depend on features of the host cell.

[0120] In an advantageous embodiment, the invention provides for the administration of a therapeutically effective amount of a formulation for the delivery and expression of a PRRSV immunogen in a target cell. Determination of the therapeutically effective amount is routine experimentation for one of ordinary skill in the art. In one embodiment, the formulation comprises an expression vector comprising a polynucleotide that expresses a PRRSV immunogen and a pharmaceutically or veterinarily acceptable carrier, vehicle or excipient. In an advantageous embodiment, the pharmaceutically or veterinarily acceptable carrier, vehicle or excipient facilitates transfection and/or improves preservation of the vector or protein.

[0121] The pharmaceutically or veterinarily acceptable carriers or vehicles or excipients are well known to the one skilled in the art. For example, a pharmaceutically or veterinarily acceptable carrier or vehicle or excipient can be a 0.9% NaCl (e.g., saline) solution or a phosphate buffer. Other pharmaceutically or veterinarily acceptable carrier or vehicle or excipients that can be used for methods of this invention include, but are not limited to, poly-(L-glutamate) or polyvinylpyrrolidone. The pharmaceutically or veterinarily acceptable carrier or vehicle or excipients may be any compound or combination of compounds facilitating the administration of the vector (or protein expressed from an inventive vector in vitro); advantageously, the carrier, vehicle or excipient may facilitate transfection and/or improve preservation of the vector (or protein). Doses and dose volumes are herein discussed in the general description and can also be determined by the skilled artisan from this disclosure read in conjunction with the knowledge in the art, without any undue experimentation.

[0122] The cationic lipids containing a quaternary ammonium salt which are advantageously but not exclusively suitable for plasmids, are advantageously those having the following formula:

##STR00001##

in which R1 is a saturated or unsaturated straight-chain aliphatic radical having 12 to 18 carbon atoms, R2 is another aliphatic radical containing 2 or 3 carbon atoms and X is an amine or hydroxyl group, e.g. the DMRIE. In another embodiment the cationic lipid can be associated with a neutral lipid, e.g. the DOPE.

[0123] Among these cationic lipids, preference is given to DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propane ammonium; WO96/34109), advantageously associated with a neutral lipid, advantageously DOPE (dioleoyl-phosphatidyl-ethanol amine; Behr J. P., 1994, Bioconjugate Chemistry, 5, 382-389), to form DMRIE-DOPE.

[0124] Advantageously, the plasmid mixture with the adjuvant is formed extemporaneously and advantageously contemporaneously with administration of the preparation or shortly before administration of the preparation; for instance, shortly before or prior to administration, the plasmid-adjuvant mixture is formed, advantageously so as to give enough time prior to administration for the mixture to form a complex, e.g. between about 10 and about 60 minutes prior to administration, such as approximately 30 minutes prior to administration.

[0125] When DOPE is present, the DMRIE:DOPE molar ratio is advantageously about 95:about 5 to about 5:about 95, more advantageously about 1:about 1, e.g., 1:1.

[0126] The DMRIE or DMRIE-DOPE adjuvant:plasmid weight ratio can be between about 50:about 1 and about 1:about 10, such as about 10:about 1 and about 1:about 5, and advantageously about 1:about 1 and about 1:about 2, e.g., 1:1 and 1:2.

[0127] The polymers of acrylic or methacrylic acid are preferably crosslinked, in particular with polyalkenyl ethers of sugars or polyalcohols. These compounds are known under the term carbomer (Pharmeuropa vol. 8, No. 2, June 1996). Persons skilled in the art can also refer to U.S. Pat. No. 2,909,462 describing such acrylic polymers crosslinked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced with unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are those containing 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyl. The products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly appropriate. They are crosslinked with an allyl sucrose or with allylpentaerythritol. Among them, there may be mentioned CARBOPOL 974P, 934P and 971P.

[0128] Among the copolymers of maleic anhydride and of alkenyl derivative, the EMA copolymers (Monsanto) which are copolymers of maleic anhydride and of ethylene, which are linear or crosslinked, for example crosslinked with divinyl ether, are preferred. Reference may be made to J. Fields et al., Nature, 186: 778-780, Jun. 4, 1960.

[0129] The proportions of adjuvant which are useful are well known and readily available to the one skilled in the art. By way of example, the concentration of polymers of acrylic or methacrylic acid or of anhydride maleic and alkenyl copolymers in the final vaccine composition will be from 0.01% to 1.5% W/V, more particularly from 0.05 to 1% W/V, preferably from 0.1 to 0.4% W/V.

[0130] Optionally the vaccine used according to the method of the invention may contain a cytokine. The cytokine may be present as a protein or as a gene encoding this cytokine inserted into a recombinant viral vector. The cytokines may be selected among the porcine cytokines, e.g. porcine interleukin 18 (fIL-18) (Taylor S. et al., DNA Seq., 2000, 10(6), 387-394), fIL-16 (Leutenegger C. M. et al., DNA Seq., 1998, 9(1), 59-63), fIL-12 (Fehr D. et al., DNA Seq., 1997, 8(1-2), 77-82; Imamura T. et al., J. Vet. Med. Sci., 2000, 62(10), 1079-1087) and porcine GM-CSF (Granulocyte-Macrophage Colony-Stimulating Factor) (GenBank AF053007).

[0131] In a specific embodiment, the pharmaceutical composition is directly administered in vivo, and the encoded product is expressed by the vector in the host. The methods of in vivo delivery a vector encoding a PRRSV immunogen can be modified to deliver the PRRSV immunogen of the present invention to a porcine. The in vivo delivery of a vector encoding the PRRSV immunogen described herein can be accomplished by one of ordinary skill in the art given the teachings of the above-mentioned references.

[0132] Advantageously, the pharmaceutical and/or therapeutic compositions and/or formulations according to the invention comprise or consist essentially of or consist of an effective quantity to elicit a therapeutic response of one or more expression vectors and/or polypeptides as discussed herein; and, an effective quantity can be determined from this disclosure, including the documents incorporated herein, and the knowledge in the art, without undue experimentation.

[0133] In the case of therapeutic and/or pharmaceutical compositions based on a plasmid vector, a dose can comprise, consist essentially of or consist of, in general terms, about in 1 mg to about 2000 mg, advantageously about 50 mg to about 1000 mg and more advantageously from about 100 g to about 800 g of plasmid expressing a PRRSV immunogen. When the therapeutic and/or pharmaceutical compositions based on a plasmid vector is administered with electroporation the dose of plasmid is generally between about 0.1 g and 1 mg, advantageously between about 1 g and 100 g, advantageously between about 2 g and 50 g. The dose volumes can be between about 0.1 and about 2 ml, advantageously between about 0.2 and about 1 ml. These doses and dose volumes are suitable for the treatment of felines and other mammalian target species such as equines and canines.

[0134] The therapeutic and/or pharmaceutical composition contains per dose from about 10.sup.4 to about 10.sup.11, advantageously from about 10.sup.5 to about 10.sup.10 and more advantageously from about 10.sup.6 to about 10.sup.9 viral particles of recombinant adenovirus expressing a PRRSV immunogen. In the case of therapeutic and/or pharmaceutical compositions based on a poxvirus, a dose can be between about 10.sup.2 pfu and about 10.sup.9 pfu. The pharmaceutical composition contains per dose from about 10.sup.5 to 10.sup.9, advantageously from about 10.sup.6 to 10.sup.8 pfu of poxvirus or herpesvirus recombinant expressing a PRRSV immunogen.

[0135] The dose volume of compositions for target species that are mammals, e.g., the dose volume of porcine compositions, based on viral vectors, e.g., non-poxvirus-viral-vector-based compositions, is generally between about 0.1 to about 2.0 ml, preferably between about 0.1 to about 1.0 ml, and more preferably between about 0.5 ml to about 1.0 ml.

[0136] t should be understood by one of skill in the art that the disclosure herein is provided by way of example and the present invention is not limited thereto. From the disclosure herein and the knowledge in the art, the skilled artisan can determine the number of administrations, the administration route, and the doses to be used for each injection protocol, without any undue experimentation.

[0137] The present invention contemplates at least one administration to an animal of an efficient amount of the therapeutic composition made according to the invention. The animal may be male, female, pregnant female and newborn. This administration may be via various routes including, but not limited to, intramuscular (IM), intradermal (ID) or subcutaneous (SC) injection or via intranasal or oral administration. The therapeutic composition according to the invention can also be administered by a needleless apparatus (as, for example with a Pigjet, Biojector or Vitajet apparatus (Bioject, Oregon, USA)). Another approach to administer plasmid compositions is to use electroporation (see, e.g. S. Tollefsen et al. Vaccine, 2002, 20, 3370-3378; S. Tollefsen et al. Scand. J. Immunol., 2003, 57, 229-238; S. Babiuk et al., Vaccine, 2002, 20, 3399-3408; PCT Application No. WO99/01158). In another embodiment, the plasmid is delivered to the animal by gene gun or gold particle bombardment. In an advantageous embodiment, the animal is a vertebrate. In a more advantageous embodiment, the vertebrate is a cat.

[0138] Liquid jet needle-free injectors are devices performing injections of a certain amount of liquid under high pressure through a minute orifice. Mechanical specifications of the injector may be adjusted or selected in order to control the depth of penetration into tissues. Administrations of a liquid using a syringe or a needle-free injector end up in a different distribution of the liquid in the tissues. Using a syringe end up in a localized bolus or pool. Using an injector end up in a diffused distribution in the layers of the targeted tissues, as illustrated in WO-A-01/13975.

[0139] The depth of penetration is mainly controlled by the liquid pressure. This liquid pressure is depending upon the mechanical specifications of the injector, such as the strength of spring or any other propulsion means and the diameter of the piston and the nozzle orifice. This is readily available to the one skilled in the art.

[0140] The depth of injection may be easily determined by the dissection of the tissue at the injection site (corresponding preferably to the location where the vaccine is going to be administered, and the test is advantageously performed on an animal of the same species and age than the population to be vaccinated) after the administration of a colored liquid having preferably the same viscosity than the intended vaccine. This test may be performed directly with the intended vaccine containing further a dye. This test allows the one skilled in the art to adjust the mechanical specifications of an injector.

[0141] The needle-free injector may be equipped with a head comprising one or several nozzles. The use of several nozzles allows to increase the dispersion pattern of the vaccine over a larger area. There can be from 1 to 10 nozzles, preferably from 1 to 6.

[0142] Several injectors are available in the commerce. The Vitajet3 (Bioject Inc.) is particularly adapted to the method according to the invention.

[0143] It is advantageous to use an injector equipped with means allowing to fit to the injector directly a standard vial or ampoule. In addition, the vaccine vial may comprise several vaccine doses allowing several shots of vaccine and/or vaccination of several animals using the injector and the same vial. Thus, the injector is preferably able to perform successive injections from a same vial.

[0144] The invention also relates to a method to stimulate the immune response of a vertebrate. In one embodiment, the vertebrate is a bird, cat, cow, dog, fish, goat, horse, human, mouse, monkey, pig, rat or sheep. In a more advantageous embodiment, the vertebrate is a cat.

[0145] In one aspect of the invention, vaccination against PRRSV can be associated with a vaccination against another porcine disease. The vaccine comprises the DNA vector according to the invention and a vaccine component able to protect against other porcine pathogens including, but not solely, Mycoplasma hyopneumoniae and PCV2.

[0146] The volume of dose injected may be from about 0.1 ml to about 1.0 ml, preferably about 0.1 ml to about 0.8 ml, more preferably from about 0.2 ml to about 0.5 ml, and in a preferred use the volume of dose injected may be 0.25 ml. By definition, the volume of one dose means the total volume of vaccine administered at once to one animal.

[0147] The vaccine may contain from about 10.sup.4.5 to about 10.sup.8.0 TCID.sub.50/dose (50% tissue culture infective dose per dose of vaccine) and preferably from about 10.sup.5.5 to about 10.sup.6.5 TCID.sub.50/dose.

[0148] Optionally, the administration can be repeated, as booster administration, at suitable intervals if necessary or desirable, e.g. about from 2 to about 8 weeks after the first administration, and preferably about from 3 to about 5 weeks after the first administration. A booster administration can also be repeated every year.

[0149] Another object of the invention is the use of an efficient amount of a DNA vector encoding and expressing at least one PRRSV immunogen as described above and of an acceptable vehicle or diluent, for the preparation of a liquid DNA vector vaccine designed to be administered essentially in the dermis and the hypodermis of an animal of the suidae family using a liquid jet needle-free injector as described above, and resulting in eliciting a safe and protective immune response against PRRSV.

[0150] Another object is a vaccination kit or set, comprising such a liquid jet needle-free injector and at least one vaccine vial containing a PRRSV vaccine based on a DNA vector as described above, operatively assembled to perform the administration of the vaccine to an animal of the suidae family. The distribution of the vaccine is essentially done in the dermis and the hypodermis.

[0151] Such vaccination kit or set is able to elicit a safe and protective immune response against PRRSV.

[0152] The long-term efficacy and safety of a novel formulation specifically designed to be administered transdermally using the Derma-Vac NF Transdermal Vaccinator System is presented in Example 4. Needle-free administration has the potential to address both safety and quality aspects of these objectives as well as to provide an optimized presentation of the vaccine to the immune system (see, e.g., Charreyre C., F. Milward, R. Nordgren and G. Royer, 2005, Demonstration of efficacy in pigs of Mycoplasma hyopneumoniae experimental vaccines by an innovative needle-free route, Proceedings of the American Association of Swine Veterinarians).

ADDITIONAL REFERENCES

[0153] Albina, E. 1997. Epidemiology of porcine reproductive and respiratory syndrome (PRRS): An overview. Veterinary Microbiology 55: 309-316. [0154] Bautista, E. M., Morrison, R. B., Goyal, S. M., Collins, J. E. and Annelli, J. F. 1993. Seroprevalence of PRRS virus in the United States. Swine Health Prod. 1(6): 4-7. [0155] Bautista, E. M., Suarez P., Molitor T. W. 1999. T cell response to the structural polypeptides of porcine reproductive and respiratory syndrome virus. Arch. Virol. 144:117-134. [0156] Benfield, D. A., Nelson, E. A., Collins, J. E., Harris, L., Goyal, S. M., Robinson, D., Christianson, W. T., Morrison, R. B., Gorcyca, D. and Chladek, D. 1992. Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate ATCC VR-2332). J. Vet. Diagn. Invest. 4: 127-133. [0157] Brierley, I. 1995. Ribosomal frameshifting on viral RNAs. J. Gen. Virol. 76: 1885-1892. [0158] Brun A., Vaganay, A., Tardy, M. C., Noe, T., Vandeputte, J., Schirvel, C. and Lacoste, F. 1992. Evaluation of etio logical elements in the P. R. R. S. in pigs. In Proceedings of the 12* Congress of the International Pig Veterinary Society, The Hague, Netherlands, 17-20 August, p. 108. [0159] Carlson, J. 1992. Encephalomyocarditis virus (EMCV) as a cause of reproductive and respiratory disease in swine. American Association of Swine Practitioners Newsletter. 4: 23. [0160] Cavanagh, D. 1997. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch Virol. 142 (3): 629-633. [0161] Cho, S. H., Freese, W. R., Yoon, I. J., Trigo, A. V. and Joo, H. S. 1993. Seroprevalence of indirect fluorescent antibody to porcine reproductive and respiratory syndrome virus in selected swine herds. J. Vet. Diagn. Invest. 5: 259-260. [0162] Collins, J. E., Benfield, D. A., Christianson, W. T., Harris, L., Hennings, J. C., Shaw, D. P., Goyal, S. M., McCulloygh, S., Morrisson, R. B., Joo, H. S., Gorcyca, D. and Chladek, D. W. 1992. Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs. J. Vet. Diagn. Invest. 4: 117-126. [0163] Conzelmann, K. K., Visser, N., van Woensel, P. and Tiel, H. J. 1993. Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the Arterivirus group. Virology 193: 329-339. [0164] Den Boon, J. A., Snijder, E. J., Chirnside, E. D., de Vries, A. A. F., Horzinek, M. C. and Spaan, W. 1991. Equine arteritis virus is not a togavirus but belongs to the coronavirus superfamily. J. Virol. 65: 2910-2920. [0165] De Vries, A. A. F., Horzinek, M. C, Rottier, P. J. M. and de Groot, R. J. 1997. The genome organization of the Nidovirales: Similiarities and differences between Arteri-, Toro-, and Coronaviruses. Seminars in Virology 8: 33-47. [0166] Dewey C E, Wilson S, Buck P, Leyenaar J K. 1999. The reproductive performance of sows after PRRS vaccination depends on stage of gestation. Prev Vet Med 40:233-241. [0167] Done, S. H. and Paton, D. J. 1995. Porcine reproductive and respiratory syndrome: clinical disease, pathology and immunosuppression. Veterinary Record 136: 32-35. [0168] Done, S. H., Paton, D. J. and White, M. E. C. 1996. Porcine Respiratory and Reproductive Syndrome (PRRS): A review, with emphasis on pathological, virological and diagnostic aspects. British Veterinary Journal 152 (2): 153-174. [0169] Drew, T. W., Meulenberg, J. J. M., Sands, J. J. and Paton, D. J. 1995. Production, characterization and reactivity of monoclonal antibodies to porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 76: 1361-1369. [0170] Edbauer, C, R. Weinberg, J. Taylor, A. Rey-Senelonge, J. F. Bouquet, P. Desmettre and E. Paoletti, Virology 179, 901-904 (1990). [0171] Faaberg, K. S. and Plagemann, P. G. W. 1995. The envelope proteins of lactate dehydrogenase-elevating virus and their membrane topography. Virology 212: 512-525. [0172] Faaberg, K. S., Even, C, Palmer, G. A. and Plagemann, P. G. W. 1995. Disulfide bonds between two envelope proteins of lactate dehydrogenase-elevating virus are essential for viral infectivity. J. Virol. 69: 613-617. 1. Galina, L., Pijoan, C, Sitjar, M., Christianson, W. T., Rossow, K. and Collins, J. E. 1994. Interaction between Streptococcus suis serotype 2 and porcine reproductive and respiratory syndrome virus in specific pathogen-free piglets. Vet. Record. 134: 60-64. [0173] Godeny, E. K., Chen, L., Kumar, S. N., Methven, S. L., Koonin, E. V., and Brinton, M. A. 1993. Complete genomic sequence and phylogenetic analysis of the lactate dehydrogenase elevating virus (LDV). Virology 192: 585-596. [0174] Goebel, S. J., G. P. Johnson, M. E. Perkus, S. W. Davis, J. P. Winslow, E. Paoletti, Virology 179, 247-266, 517-563 (1990). [0175] Gonin P, Mardassi H., Gagnon C A, Massie B., Dea S. 1999. A nonstructural and antigenic glycoprotein is encoded by ORF3 of the IAF-Klop strain of porcine reproductive and respiratory syndrome virus. Arch. Virol. 143:1927-1940. [0176] Gonin P, Pirzadeh B, Gagnon C A, Dea S. 1999. Seroneutralization of porcine reproductive and respiratory syndrome virus correlates with antibody response to the GP5 major envelope glycoprotein. J Vet Diagn Invest 11:20-26. [0177] Gorcyca, D., Schlesinger, K., Chladek, D. and Behan, W. 1995. RespPRRS: a new tool for the prevention and control of PRRS in pigs. In Proceedings of the American Association of Swine Practitioners, pp1-22 [0178] Guo, P., S. Goebel, S. Davis, M. E. Perkus, B. Languet, P. Desmettre, G. Allen, and E. Paoletti, J. Virol. 63, 4189-4198 (1989). [0179] Halbur, P. G., Paul, P. S., Meng, X. and Andrews, J. J. 1992. Comparative pathology of porcine reproductive and respiratory syndrome in SPF pigs. Iowa State University Swine Research Reports, p137. Cooperative Extension Service, Iowa State University, Ames, Iowa, 50011. [0180] Halbur, P. G., Paul, P. S. and Janke, B. H. 1993. Viral contributors to the porcine respiratory disease complex. In Proceedings of the 24.sup.th Annual meeting of the American Association of Swine Practitioners, Kansas City, Mo., USA, pp343-350. [0181] Halbur, P. G., Paul, P. S., Frey, M. L., Landgraf, J., Eernisse, K., Meng, X.-J., Lum, M. A., Andrews, J. J. and Rathje, J. A. 1995. Comparison of the pathology of two U.S. porcine reproductive and respiratory syndrome virus isolates with the Lelystad virus. Vet. Pathol. 32:648-660. [0182] Heinen E, Herbst W, Schmeer N. 1998. Isolation of a cytopathogenic virus from a case of porcine reproductive and respiratory syndrome (PRRS) and its characterization as parainfluenza virus type 2. Arch Virol 143:2233-2239 [0183] Hill, H. 1990. Overview and history of mystery swine disease (swine infertility and respiratory syndrome). In. Proceedings of the Mystery Swine Disease Committee Meeting, Denver, Colo., 1990. Livestock Conservation Institute, Madison, Wis., pp 29-30. [0184] Kwang J, Zuckermann F, Ross G, Yang S, Osorio F, Liu W, Low S. 1999. Antibody and cellular immune responses of swine following immunisation with plasmid DNA encoding the PRRS virus ORF's 4, 5, 6 and 7. Res Vet Sci 67:199-201. [0185] Lager K M, Mengeling W L, Brockmeier S L. 1999. Evaluation of protective immunity in gilts inoculated with the NADC-8 isolate of porcine reproductive and respiratory syndrome virus (PRRSV) and challenge-exposed with an antigenically distinct PRRSV isolate. Am J Vet Res 60:1022-1027. [0186] Le Potier, M. F., Blanquefort, P., Morvan, E. and Albina, E. 1995. Results of a control program for PRRS in the French area Pays de Loire. Proc. of the 2.sup.nc Int. Symposium on PRRS, Copenhagen, Denmark, 9-10 August, p34. [0187] Mardassi, H., Mounir, S. and Dea, S. 1995. Molecular analysis of the ORFs 3 to 7 of porcine reproductive and respiratory syndrome virus, Quebec reference strain. Arch. Virol. 140: 1405-1418. [0188] Mardassi, H., Massie, B. and Dea, S. 1996. Intracellular synthesis, processing, and transport of proteins encoded by ORFs 5 to 7 of porcine reproductive and respiratory syndrome. Virology 221: 98-112. [0189] Meng, X.-J., Paul, P. S., Halbur, P. G. and Lunn, M. A. 1995a. Phylogenetic analysis of the putative M (ORF6) and N(ORF7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): implications for the existence of two genotypes of PRRSV in the USA and Europe. Arch. Virol. 140: 745-755. 39. Meng, X.-J., Paul, P. S., Halbur, P. G. and Morozov, I. 1995b. Sequence comparison of open reading frames 2 to 5 of low and high virulence United States isolates of porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 76: 3181-3188. [0190] Meng, X.-J., Paul, P. S., Morozov, I. And Halbur, P. G. 1996. A nested set of six or seven subgenomic mRNAs is formed in cells infected with different isolates of porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 77; 1265-1270. [0191] Mengeling W L, Vorwald A C, Lager K M, Clouser D F, Wesley P J D. 1999a. Identification and clinical assessment of suspected vaccine-related field strains of porcine reproductive and respiratory syndrome virus. Am J Vet Res 60:334-340. [0192] Mengeling W L, Lager K M, Vorwald A C. 1999b. Safety and efficacy of vaccination of pregnant gilts against porcine reproductive and respiratory syndrome. Am J Vet Res 60:796-801. [0193] Mengeling W L, Lager K M, Vorwald A C. 1998. Clinical consequences of exposing pregnant gilts to strains of porcine reproductive and respiratory syndrome (PRRS) virus isolated from field cases of atypical PRRS. Am J Vet Res 59:1540-1544. [0194] Meulenberg, J. J. M., Hulst, M. M., de Meijer, E. J., Moonen, P. J. L. M., den Besten, A., de Kluyver, E. P., Wensvoort, G. and Moormann, R J. M. 1993a. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 192: 62-72. [0195] Meulenberg, J. J. M., de Meijer, E. J. and Moormann, R J. M. 1993b. Subgenomic RNAs of Lelystad virus contain a conserved junction sequence. J. Gen. Virol. 74: 1697-1701. [0196] Meulenberg, J. J. M., den Besten, A. P., De Kluyver, E. P., Moormann, R. J. M., Schaaper, W. M. M. and Wensvoort, G. 1995. Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology 206: 155-163. [0197] Meulenberg, J. J. M. and Petersen-Den Besten, P.-D. 1996. Identification and characterization of a sixth structural protein of Lelystad virus: The glycoprotein GP.sub.2 encoded by ORF 2 is incorporated in virus particles. Virology 225: 44-51. [0198] Murtaugh, M. P., Elam, M. and Kakach, L. T. 1995 Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of PRRS virus. Arch. Virol. 140: 1451-1460. [0199] Nakamine M, Kono Y, Abe S, Hoshino C, Shirai J, Ezaki T. 1998. Dual infection with enterotoxigenic Escherichia coli and porcine reproductive and respiratory syndrome virus observed in weaning pigs that died suddenly. J Vet Med Sci 60:555-561. [0200] Nelsen C J, Murtaugh M P, Faaberg K S. 1999. Porcine reproductive and respiratory syndrome virus comparison: divergent evolution on two continents. J Virol 73:270-280. [0201] Nelson, E. A., Christopher-Hennings, Drew, T., Wensvoort, G., Collins, G. and Benfield, D. A. 1993. Differentiation of US and European isolates of porcine reproductive and respiratory syndrome virus by monoclonal antibodies. J. Clin. Micro. 31: 3184-3189. [0202] Ohlinger, V., Haas, B., Saalmuller, A., Beyer, J., Teuffert, J., Visser, N. and Weiland, F. 1992. In vivo and in vitro studies on the immunobiology of PRRS. Proc. of American Assoc. Swine Practitioners1.sup.st Int. PRRS Symp., 4(4): 24. [0203] Ohlinger V F. 1995. The respiratory syndrome: studies on PRRSV-replication and immune response. Int. Symp. PRRS 2:12. [0204] Panicali, D. and E. Paoletti, Proc. Natl. Acad. Sci. USA 79, 4927-4931 (1982). [0205] Pirzadeh B, Dea S. 1998a. Immune response in pigs vaccinated with plasmid DNA encoding ORF5 of porcine reproductive and respiratory syndrome virus. J Gen Virol 79:989-999. [0206] Pirzadeh B, Gagnon C A, Dea S. 1998b. Genomic and antigenic variations of porcine reproductive and respiratory syndrome virus major envelope GP5 glycoprotein. Can J Vet Res 62:170-177 [0207] Paoletti, E., B. R. Lipinskaks, C. Samsonoff, S. Mercer, and D. Panicali, Proc. Natl. Acad. Sci. U.S.A. 81, 193-197 (1984). 58. Paton, D. J., Brown, I. H., Edwards, S. and Wensvoort, G. 1991. Blue ear disease of pigs. Vet. Rec. 128: 617. [0208] Perkus, M. E., K. Limbach, and E. Paoletti, J. Virol. 63, 3829-3836 (1989). [0209] Piccini, A., M. E. Perkus, and E. Paoletti, In Methods in Enzymology, Vol. 153, eds. Wu, R, and Grossman, L., (Academic Press) pp. 545-563 (1987). [0210] Pirzadeh, B. and Dea, S. 1997. Monoclonal antibodies to the ORF5 product of porcine reproductive and respiratory syndrome virus define linear neutralizing determinants. J. Gen. Virol. 78: 1867-1873. [0211] Plagemann, P. G. W. 1996. Lactate dehydrogenase-elevating virus and related viruses. In Virology (B. N. Fields, D. M. Knipe and P. M. Howley, Eds.) 3.sup.rd ed., pp1 105-1120. Raven Press, New York. [0212] Plana-Duran J, Bastons M, Urniza A, Vayreda M, Vila X, Mane H. 1997. Efficacy of an inactivated vaccine for prevention of reproductive failure induced by porcine reproductive and respiratory syndrome virus. Vet Microbiol 55:361-370. [0213] Plana Duran, J., Climent, I., Sarraseca, J., Urniza, A., Cortes, E., Vela, C. and Casal, I. 1997. Baculovirus expression of proteins of porcine reproductive and respiratory syndrome virus strain Olot/91. Involvement of ORF3 and ORF5 proteins in protection. Virus Genes 14: 19-29. [0214] Rossow K. D. 1998. Porcine reproductive and respiratory syndrome (review article). Vet Pathol. 35:1-20. [0215] Sirinarumitr T, Zhang Y, Kluge J P, Halbur P G, Paul P S. 1998. A pneumo-virulent United States isolate of porcine reproductive and respiratory syndrome virus induces apoptosis in bystander cells both in vitro and in vivo. J Gen Virol 79:2989-2995. [0216] Snijder E., van Tol H., Pedersen K. W., Raamsman M. J. B., and de Vries A. A. F. 1999. Identification of a novel structural protein of arteri viruses. J. Virol. 73, 6335-6345. [0217] Suarez, P., Diaz-Guerra, M., Prieto, C, Esteban, M., Castro, J. M., Nieto, A. and Ortin, J. 1996. Open reading frame 5 of porcine reproductive and respiratory syndrome virus as a cause of virus-induced apoptosis. J. Virol. 70: 2876-2882. 69. Sur J H, Doster A R, Osorio F A. 1998. Apoptosis induced in vivo during acute infection by porcine reproductive and respiratory syndrome virus. Vet Pathol 35:506-514. [0218] Thacker E L, Halbur P G, Ross R F, Thanawongnuwech R, Thacker B J. 1999. Mycoplasma hyopneumoniae potentiation of porcine reproductive and respiratory syndrome virus-induced pneumonia. J Clin Microbiol 37:620-627. [0219] Van Nieuwstadt, A. P., Meulenberg, J. J. M., van Essen-Zandbergen, A., Petersen-den Besten, A., Bende, R. J., Moorman, R J. M. and Wensvoort, G. 1996. Proteins encoded by open reading frames 3 and 4 of the genome of Lelystad virus (Arteriviridae) are structural proteins of the virion. J. Virol. 70: 4767-4772. [0220] van Woensel P A, Liefkens K, Demaret S. 1998a. Effect on viraemia of an American and a European serotype PRRSV vaccine after challenge with European wild-type strains of the virus. Vet Rec 142:510-512. 81. van Woensel P A, Liefkens K, Demaret S. 1998b. European serotype PRRSV vaccine protects against European serotype challenge whereas an American serotype vaccine does not. Adv Exp Med Biol 440:713-718. [0221] Weiland E, Wieczorek-Krohmer M, Kohl D, Conzelmann K K, Weiland F. 1999. Monoclonal antibodies to the GP5 of porcine reproductive and respiratory syndrome virus are more effective in virus neutralization than monoclonal antibodies to the GP4. Vet Microbiol 66:171-186 [0222] Wensvoort, G. C., Terpstra, J. M. A., Pol, E. A., ter Laak, M., Bloemraad, E. P., de Kluyver, C, Kragten, C, van Buiten, A., den Besten, F., Wagenaar, J. M., Broekhuysen, P. L. J. M., Moonen, T., Zetstra, E. A., de Boer, H J., Tibben M. F., de Jong, P., van't Veld, G. J. R., Greenland, A., van Gennep, M. T., Voets, J. H. M., Verheyden, J. H. M. and Braamskamp, J. 1991. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Vet Q. 13: 121-130. [0223] Wensvoort, G., de Kluyver, E. P., Luijtze, E. A., den Besten, A., Harris, L., Collins, J. E., Christianson, J. E. and Chladek, D. 1992. Antigenic comparison of Lelystad virus and swine infertility and respiratory syndrome (SIRS) virus. J. Vet. Diagn. Invest. 4: 134-138. [0224] Yeager, M. J., Prieve, T., Collins, J., Christopher-Hennings, J., Nelson, E. and Benfield, D. 1993. Evidence for the transmission of porcine reproductive and respiratory syndrome (PRRS) virus in boar semen. Swine Health Prod. 1(5): 7-9. [0225] Yoon, K.-J., Zimmermann, J. J., Swenson, S. L., Wills, R. W., Hill, H. T. and Platt, K. B. 1994. Assessment of the biological significance of antibody dependent enhancement (ADE) of porcine epidemic abortion and respiratory syndrome (PEARS) virus infection in passively immunized pigs. Proc. 13 Int. Pig Vet. Soc. Congress, p69. [0226] Yoon, K.-J., Zimmerman, J. J., Swenson, S. L., McGinley, M. J., Eernisse, K. A., Brevik, A., Rhinehart, L. L., Frey, M. L., Hill, H. T. and Platt, K. B. 1995. Characterization of the humoral immune response to porcine reproductive and respiratory syndrome (PRRS) virus infection. J. Vet. Diagn. Invest. 7: 305-312. Zimmermann, J. J., Yoon, K.-J., Wills, R. W. and Swenson, S. L. 1997. General Overview of PRRSV: A perspective from the United States. Veterinary Microbiology 55: 187-196.

[0227] The invention will now be further described by way of the following non-limiting examples.

Example 1: Construction and Characterization of the Plasmids Encoding for Nucleocapsid Gene (ORF7)

[0228] The PRRSV ORF7 gene (SEQ ID NO:1) and the genetically modified truncated ORF7 (ORF7t) gene (SEQ ID NO:3), with a stop codon after amino acid 112, were PCR amplified from the vector pBAD-ORF7 (SEQ ID NO:13) containing the nucleocapsid gene (ORF7) of the US-genotype Thai PRRSV isolate (01NP1), using the primer sets indicated in Table 1.

TABLE-US-00001 TABLE1 PRRSV-ORF7andtruncatedORF7(ORF7t)genecloningprimers SEQ Amplicon ID Name Sequence Target length(bp) NO ORF7US-F 5-AAAAAAGAATTCATGCCAAATAACAACGGCAAG-3 1-21 384 5 ORF7US-R 5 AAAAAAGAATTCTCATGCTGAGGGTGATGCTGTG3 372-351 6 ORF7US-F 5 AAAAAAGAATTCATGCCAAATAACAACGGCAAG3 1-21 351 5 US-11R 5 AAAAAAGAATTCTCACACAGTATGATGCGTAGGC3 336-318 7 Stopcodon Note: Italic cases indicate the EcoRI restriction sites

[0229] The ORF7 and ORF7t fragments were then cut with EcoRI and cloned into the EcoRI cut pMASIA vector (SEQ ID NO:8). The cloned plasmids were transformed into the competent cells, E. coli strain JM109. The obtained constructs were referred as pORF7 (SEQ ID NO:9) and pORF7t (SEQ ID NO:10), respectively (FIGS. 1A-1B). The orientation of the inserted ORF genes was initially confirmed by PCR analysis, using the primer sets indicated in Table 2. The selected plasmids were further subjected to sequence analyses of the ORF7 gene. All of the sequence analyses confirmed the correct insertion of the ORF7 gene, with identical sequences to the original ORF7 sequences from the original vector (pBAD-RF7) and the 01NP1-PRRSV (Genbank, Q056373, SEQ ID NO:13), (FIG. 2).

TABLE-US-00002 TABLE2 TheprimersusedforanalysesoftheorientationoftheinsertedORF7genes Amplicon SEQ length ID Name Sequence Target (bp) NO pMASIAF 5-CAGTGTAGTCTGAGCAGTACT-3 4100-4120 564 11 ORF7US-F 5-AAAAAAGAATTCATGCCAAATAACAACGGCAAG-3 1-21 5 pMASIAF 5-CAGTGTAGTCTGAGCAGTACT-3 4100-4120 564 11 ORF7US-R 5-AAAAAAGAATTCTCATGCTGAGGGTGATGCTGTG-3 372-351 6 pMASIAF 5-CAGTGTAGTCTGAGCAGTACT-3 4100-4120 531 11 US-11R 5-AAAAAAGAATTCTCACACAGTATGATGCGTAGGC-3 336-318 7

[0230] The expression of the ORF7 genes by the plasmid constructs, was verified by in vitro transfection of the freshly isolated porcine peripheral blood mononuclear cells (PBMC) with the pORF7 or pORF7t. Briefly, the PBMC were transfected with pORF7 or pORF7t, using Effectene Transfection reagent (Qiagen, Germany), according to the manufacturer's protocol. The cells were further incubated for 48 hrs, in a 5%, CO2 incubator. Following incubation, the PBMC samples were harvested, and subjected for total RNA isolation using the commercial RNA extraction kit (Macherey-Nagel, Germany). Contaminated DNA was removed by addition of DNase I supplied with the kit. The expression of the ORF7 gene in the transfected PBMC was determined by the cDNA synthesis using random hexamers, followed by the PCR reaction, using the previously described primer sets (Table 1). The result confirmed the expression of the ORF7 mRNA from both pORF7 and pORF7t, as shown in FIG. 3.

[0231] In addition, when subcloned into an expression vector (pQE31, SEQ ID NO:18), the ORF7 and ORF7t genes could correctly produce the recombinant proteins with a correct molecular weight (approx. 15 kDa), and could be detected using porcine anti-PRRSV hyperimmune serum (FIG. 4). The recombinant proteins were subjected to 15% SDS-PAGE, and transferred to the PVDF membrane. The presence of PRRSV protein was determined using porcine anti-PRRSV hyperimmune serum. (U; unpurified protein, P; purified protein, +; with IPTG, ; without IPTG; M; Molecular weight marker).

[0232] For preparation of the DNA vaccine, the E. coli transformants were propagated and subjected to plasmid purification, using the commercial plasmid purification column (NucleoBond endotoxinfree plasmid purification, Macherey-Nagel). The confirmation of the purified plasmids was performed by restriction analyses, using the restriction enzyme NcoI (FIG. 5). The concentration of the plasmid was determined by spectrophotometer. The OD260/OD280 ratios obtained from each preparation ranged between 1.625-1.69.

Example 2: The Immunomodulatory Effects of the PRRSV DNA Vaccine in the Challenged Model

[0233] Experimental design (FIG. 6). To determine the immunomodulatory effects of the PRRSV DNA vaccine, four-week-old, PRRSV-seronegative, crossbred pigs (4-6 pigs/group) were immunized with 500 g of pORF7t or pORF7 diluted in 200 l Ca2+, Mg2+-free PBS (referred as PBSA), of the plasmids twice at 4 weeks interval (d0, d28). The plasmid was intradermally injected into the skin of both ears (250 l/side), using a tuberculin syringe (FIGS. 7A-7B). The control groups receiving the same amount of PBS or null plasmid (pMASIA) were also included in the study. Four weeks following the second vaccination (d56), the pigs were intranasally challenged with 5 ml (2.5 ml/nostril) of the virulent PRRSV (01NP1) at the concentration of 10.sup.5.5 TCID.sub.50/ml. The immunological parameters and clinical signs were monitored every 2 weeks and at 0, 5, and 10 days post infection (dpi). The pigs were sacrificed at 10 dpi and subjected to pathological examination and virological studies.

[0234] Virological and Pathological Studies.

[0235] There were no clinical signs, nor adverse reactions observed following DNA immunization process. Following the challenge, the presence of PRRSV in the pooled samples was initially determined by RT-PCR using the ORF1-specific primer set. PRRSV was detected in the samples of the groups immunized with pORF7, Null plasmid and PBSA, at 5 dpi (serum), and 10 dpi (lung tissues). However, PRRSV was not detected in the group immunized with pORF7t at any time of this study (FIGS. 8A-8B). In addition, the presence of PRRSV in the lung tissues of individual pigs was assessed by RT-PCR. The presence of PRRSV genome was determined by RT-PCR using the ORF1-specific primer sets, which would give the 107 bp PCR product in the positive sample (Gilbert et al., J Clin Microbiol. 1997. 35:264-7). +ve; positive control (PRRSV-US genotype), ve; negative control (ddH20), L; 100 bp ladder. Consistent to the results from pooled samples, PRRSV could be detected in all groups except the group immunized with pORF7t (Table 3).

TABLE-US-00003 TABLE 3 Vaccination groups and results indicating the presence of PRRSV in the lung tissue samples of the pigs at 10 dpi Sample % positive Group ID Results samples pORF7t H4811 0 H4831 H4841 H4853 H4849 H4809 pORF7 H4843 + 33 H4875 + H4871 H4827 H4823 H4813 Null H4867 50 plasmid H4923 + H4893 H4859 + H4897 + H4861 PBSA H4863 + 50 H4865 H4895 H4869 +

TABLE-US-00004 TABLE 4 Percentage of pigs in each group presenting pathological changes in the respiratory tract at 10 dpi. Experimental group Pathological lesions PBSA.sup.a Null.sup.b pORF7.sup.b pORF7tl.sup.b Pneumonia 75.0 33.2 33.2 50.0 Lymphadenopathy 50.0 16.6 0 16.6 (Tracheobronchial Ln.) Fibrinous pleuritis 0 16.6 16.6 0 .sup.an = 4; .sup.bn = 6
However, there were no significant differences in the number of experimental pigs with pathological changes in the respiratory tract at 10 dpi (Table 4). The data suggested that immunization with pORF7t could enhance viral clearance in the experimentally challenged pigs.

[0236] Study of Humoral Immune Responses.

[0237] The PRRSV-specific antibody response was determined by the commercial ELISA test kit (HerdChek PRRS, IDEXX, Germany). It should be pointed out that nucleocapsid protein is the major epitope recognized by the anti-PRRSV antibody determined by IDEXX HerdChek ELISA assay (Plagemann, 2006. J Virol Methods. 134: 99-118). The pigs were PRRSV-seronegative at the beginning of the experiment. The seroconversion was only observed in the group that received pORF7 on the challenge day (1 pig), and at 10 dpi (3 pigs), suggesting the priming of anti-PRRSV antibody response by pORF7 immunization. However, no seroconversion was observed in the pigs immunized with pORF7t or the controls throughout the experiment (Table 5).

TABLE-US-00005 TABLE 5 Anti-PRRSV antibody responses in the experimental pigs during the experiment Mean S/P ratio (% seroconversion.sup.a) Group d0 d56 (0 dpi) d61 (5 dpi) d66 (10 dpi) ORF7t 0.08 (0) 0.02 (0) 0.02 (0) 0.03 (0) ORF7 0.07 (0) 0.15 (16.6) 0.04 (0) 0.46 (50) Null 0.11 (0) 0.04 (0) 0.01 (0) 0.02 (0) PBSA 0.06 (0) 0.03 (0) 0.02 (0) 0.01 (0) .sup.aS/P ratio 0.4 = positive

[0238] Study of the Viral-Specific Cytokine Production in the PBMC.

[0239] There were no significant differences in the PRRSV-specific IFN and IL-10 producing cells among the groups prior to the challenge. Following the challenge, increased numbers of PRRSV-specific IFN and IL-10 producing cells were observed in all groups (FIGS. 9A-9B). Pigs were immunized with the vaccine indicated in the legend twice on d0 and d28, and received PRRSV inoculation on d56. The freshly isolated porcine PBMCs were cultured in vitro with 0.08 m.o.i. of the virulent US-PRRSV (strain 01NP1), or mock infected MARC-145 lysate for 48 hrs prior to harvesting for fluorescent staining and flow cytometric analyses. The data represents mean percentage (SEM) of the cytokine-producing cells from the pigs in the same group, which was calculated from % cytokine producing cells obtained from the PRRSV-cultured PBMC% cytokine-producing cells obtained from the mock-cultured PBMC.

[0240] Study of the Viral-Specific CD4+ CD25+ and CD4+ CD25+ Foxp3+ Cells in the PBMC.

[0241] Following the first immunization, the pigs immunized with pORF7t exhibited significantly higher number of the PRRSV-specific CD4+ C25+ cells (activated Th lymphocytes) than the other groups (p<0.05, ANOVA followed by Newman Keuls test), (FIG. 10A). The enhanced number of the CD4+ CD25+ was also observed in the pORF7t immunized group following the challenge (d66). Interestingly, the numbers of PRRSV-specific CD4+ CD25+ Foxp3+ cells (regulatory T cells; Treg) in the group receiving the pORF7t and pORF7 were significantly lower than the control groups (p<0.05, ANOVA followed by Newman Keuls) at d28. Following the viral challenge, all groups exhibited increased numbers of CD4+ CD25+ Foxp3+ cells in the PBMCs (FIG. 10B). The data represents mean percentage (SEM) of the lymphocyte subpopulation from the pigs in the same group, which was calculated from % of the lymphocyte subpopulation obtained from the PRRSV-cultured PBMC% of the lymphocyte subpopulation obtained from the mock-cultured PBMC. a indicates significant difference from the other treatments. b indicates significant difference between the groups receiving the DNA vaccine (pORF7t or pORF7) and the controls (null or PBSA). Further, the data indicated that the 2 plasmids could modulate the immune responses against PRRSV, by reduction of the viral-specific Treg, and that pORF7t could enhance the numbers of viral-specific responder Th cells in the pigs following immunization and the challenge.

[0242] Conclusion.

[0243] The data from this challenge experiment indicates that the DNA immunization with plasmid encoding ORF7 (pORF7t or pORF7) could significantly modulate the anti-PRRSV immunity. The pORF7t, but not pORF7, induced higher numbers of the viral-specific responder Th cells and viral clearance following the challenge, without the evidence of priming of anti-PRRSV antibody response. Although pORF7 could prime the pigs for the anti-PRRSV antibody response, the plasmid did not enhance anti-viral immunity or viral clearance in the immunized pigs (Table 6). The result emphasized the important role of anti-PRRSV cell-mediated immunity on the anti-PRRSV immunity. In addition, the data from this experiment suggested the superior immunomodulatory effects of the pORF7t compared to the pORF7, therefore, the plasmid pORF7t was selected for the subsequent experiment.

TABLE-US-00006 TABLE 6 Summary of the effects of plasmid immunization on anti-PRRSV immunity CD4.sup.+CD25.sup.+ Enhanced CD4.sup.+CD25.sup.+ FoxP3.sup.+ Sero- viral IFN- IL-10 lymphocytes cells conversion clearance Pre-challenge Null na.sup.c pORF7t .sup.a .sup.b na pORF7 .sup.b na Post-Challenge Null pORF7t .sup.a yes pORF7 yes .sup.asignificant difference from the other treatments (p < 0.05) .sup.bsignificant difference between the groups receiving the DNA vaccine (pORF7t or pORF7) and the controls (null or PBSA), (p < 0.05) .sup.cnot applicable

Example 3: The Immunomodulatory Effects of pORF7t in the Pigs in the Commercial Farm (Long-Term Study)

[0244] The objective was to study the immunomodulatory effects of pORF7t in the PRRSV-positive, commercial farm. Specific Aims: 1. To investigate the immunomodulatory effect of the DNA vaccine on the anti-PRRSV immunity, when immunized prior to infection (priming exp.); 2. To investigate the immunomodulatory effects of the DNA vaccine on the anti-PRRSV immunity, when immunized at the time of infection (treatment exp.); 3. To investigate the effect of DNA immunization on the growth and performance of the immunized pigs

[0245] Experimental Design

[0246] The selected farm for the long-term study was a PRRSV-positive farm with known PRRSV serological status during the past 2 years. The farm was situated approximately 160 km from Bangkok. It had approximately 3,000 sows, and employed a continuous flow rearing system. Generally, the piglets were weaned at 4 weeks old, and kept at the nursery at the same site (unit 1) until 11 weeks old and subsequently moved to the finisher (unit 2), situated approximately 20 km from the nursery. It is during this time (i.e. 4-11 weeks) that most of the pigs become infected with PRRSV. The pigs were kept at finisher (unit 2) until 26-28 weeks old.

[0247] Experimental Pig:

[0248] six week-old, male weanling pigs were randomly grouped into 5 groups (30 pigs/group) according to scheme presented in Table 7. Additional details of the experiment are illustrated in FIG. 11A.

TABLE-US-00007 TABLE 7 Details of the experimental groups Expected Vaccination No. Culled No. @ Group Age @ start @ 8 dpm slaughter 1. Control (PBSA) 6, 11 wk 30 6 24 2. pORF7t-prime 6 wk 30 6 24 3. Null-prime 6 wk 30 6 24 4. pRF7t-Tx 11 wk 30 30 5. Null-Tx 11 wk 30 30

[0249] The DNA priming (DNA-P): the pigs were intradermally immunized with 500 g of pORF7t at 6 wks old (d0). The pigs receiving the same amount of null plasmid (pMASIA), or PBSA were included as the controls. At 8 days post moving (8 dpm, d43), the pigs (6/group) were euthanized and subjected for pathological and virological studiesThe DNA treatment (DNA-T): The pigs were immunized with 500 g of pORF7t at the time of moving (wk 11, d35). The control groups included the group immunized with the null plasmid or PBSA.Blood samples were collected every 2 wks. The numbers of PRRSV-specific Treg, IL-10 and IFN producing cells in the PBMC were determined by flow cytometry. Serum samples were collected for determining of the anti-PRRSV antibody and the presence of PRRSV. Clinical signs and performance indexes were monitored until the end of a finishing period (FIG. 11B).

[0250] Immunomodulatory Effects of the DNA Vaccine when Immunized Prior to PRRSV Exposure (Priming Experiment)

[0251] All groups had comparable levels of cytokine producing cells at the beginning of the experiment. After moving to the finisher (d43), all the groups exhibited significantly increased numbers of PRRSV-specific IL-10+ cells, possibly due to the natural exposure to PRRSV at the finisher. The levels of the numbers of IL-10+ producing cells gradually decreased after d56. Interestingly, the groups receiving either pORF7t or the null plasmid had significantly lower number of PRRSV-specific IL-10+ cells than the control PBSA at d70 (p<0.05, ANOVA followed by Tukey's multiple comparison tests). However, only the group immunized with pORF7t exhibited gradual decreased of the PRRSV-specific IL-10+ cells through the end of the observation period. By d112, the pigs vaccinated with pORF7t had significantly lower number of the IL-10+ lymphocytes than the other groups (p<0.05, ANOVA followed by Tukey's multiple comparison tests), (FIG. 12A, B). Following the DNA vaccination (d14), the pigs receiving pORF7t exhibited significant increase in the number of PRRSV-specific IFN+ lymphocytes. The number of the PRRSV-specific IFN+ cells remained higher than other groups until d70 (FIG. 12C, D). Pigs were vaccinated with pORF7t, null plasmid, or PBSA on d0, and moved to the finisher unit on d35. The freshly isolated porcine PBMC samples had been cultured with 0.1 m.o.i. of US-PRRSV (strain 01NP1), or mock-infected MARC-145 lysate for 48 hrs prior to fluorescent staining and flow cytometric analyses. All groups had comparable numbers of PRRSV-specific CD4+ CD25+ Foxp3+ cells (Treg) at the beginning of the experiment. Following vaccination, the pigs receiving pORF7t exhibited significantly lower numbers of the PRRSV-specific Treg than the other control groups (p<0.05, ANOVA followed by Tukey's multiple comparison tests). Following the movement (d43), the numbers of PRRSV-specific Treg increased in every group, possibly due to the PRRSV exposure. However, the number of the PRRSV-specific Treg in the pORF7t vaccinated group remained lower than the other groups throughout the experiment (FIG. 13A, B). The result from this experiment indicated that the DNA vaccine could modulate the anti-PRRSV immune responses in the pigs, by enhancing the production of viral-specific IFN and reducing the viral-specific IL-10 and Treg production in the vaccinated pigs following the viral exposure.

[0252] Immunomodulatory Effect of the DNA Vaccine when Immunized at the Time of PRRSV Exposure (Treatment Experiment).

[0253] All the pigs exhibited increased PRRSV-specific IL-10+ cells in the PBMC following the movement into the finisher unit (d43). However, the pigs receiving pORF7t exhibited faster reduction of the PRRSV-specific IL-10+ cells and had lower levels of PRRSV-specific IL-10+ cells than the other control groups until the end of the observation period (FIG. 14A, B). Immunization with pORF7t resulted in an enhanced induction of PRRSV-specific IFN+ cells. Furthermore, the numbers of the PRRSV-specific IFN cells in the pORF7t group remained higher than the other groups throughout the end of the experiments (FIG. 14C, D). Furthermore, the pigs received pORF7t exhibited significantly lower numbers of PRRSV-specific CD4+ CD25+ Foxp3+ cells than the control groups throughout the experiment (FIGS. 15A-B). The results suggested that pORF7t could modulate the PRRSV-specific immune responses that should be benefit to the anti-PRRSV immunity.

[0254] The Effect of DNA Immunization on Antibody Responses

[0255] Some of the pigs contained maternal-derived PRRSV-specific antibody in their serum at the beginning of the experiment. The level of MDA gradually reduced until 8 wks old (d14). However, 80-100% of the pigs in every groups exhibited seroconversion at the time of moving (d35), suggesting that the natural infection actually occurred at the end of the nursery period. There were no significant different in the pattern of antibody responses, measured by ELISA, among the experimental groups (Table 8, FIG. 16).

TABLE-US-00008 TABLE 8 PRRSV-specific antibody determined by IDEXX ELISA Mean S/P ratio.sup.a (% seropositive pigs.sup.b) Group d0 d14 d35 d43 d56 d70 d82 d112 PBSA 0.25 (33.3) 0.21 (33.3) 1.31 (100) 2.28 (100) 1.99 (80) 2.29 (100) 1.42 (100) 1.36 (100) pORF7t-P 0.17 (16.7) 0.09 (0) 1.24 (100) 1.35 (100) 1.15 (100) 1.26 (80) 1.02 (100) 1.26 (100) Null-P 0.30 (33.3) 0.24 (0) 1.22 (100) 0.93 (100) 2.16 (100) 1.36 (100) 1.01 (80) 1.00 (60) pORF7t-T nd nd 1.19 (80) 1.29 (100) 1.16 (100) 1.09 (100) 1.65 (100) 1.29 (100) Null-T nd nd 0.96 (80) 1.07 (80) 0.98 (80) 1.72 (80) 0.83 (100) 1.21 (100) .sup.amean OD values from 5 pigs/group .sup.bS/P ratio 0.4 = seropositive

[0256] The virological studies. The virological studies by RT-PCR and quantitative RT-PCR confirmed presence of the US genotype PRRSV in the lung samples of the experimental pigs that were sacrificed at 8 dpm (d43), Table 9. However, there were no different in the number of viral load in the serum at d43 (FIG. 17). The pathological studies of the respiratory tracts at d43 revealed viral infection with secondary complication in the lungs of the pigs.

TABLE-US-00009 TABLE 9 The number of experimental pigs with positive PRRSV in the lung at d43 Treatment Positive animal/total examined (%.sup.a) 1) Control (PBSA) 3/6 (50) 2) pORF7t-prime 3/6 (50) 3) Null plasmid 5/6 (83.33) .sup.a% positive samples from 6 pigs/group

Example 4: The Immunomodulatory Effects of PRRSV DNA Vaccine Delivered Using Transdermal Technology

[0257] Inventors have observed the unexpected and surprising result that significantly improved efficacy was achieved when the inventive plasmids were delivered using transdermal technologies, specifically the DERMAVAC device. In the above examples, the novel PRRSV-DNA vaccine was developed and tested for its immunoprophylaxis and immunotherapeutic properties against PRRSV. The results indicated that the prototype DNA vaccine, when intradermally immunized into the experimental pigs, was capable of modulating anti-PRRSV immune responses and enhanced viral clearance in the vaccinated-challenged pigs. Since intradermal injection technique was not routinely practiced in pig farms, the inventors explored the potential use of a needle-free device for delivering of the inventive DNA vaccine into pigs. It is contemplated by the inventors that inventive vaccines should additionally demonstrate efficacy in, for example, but not solely, fattening pigs and replacement gilts.

[0258] Materials and Methods.

[0259] Plasmid Immunization.

[0260] The PRRSV-DNA vaccine (pORF7t) containing the genetically modified ORF7 gene, encoding for the linearized N protein, derived from the US-genotype, Thai PRRSV isolate (01 NP1), and null plasmid (pMASIA) were used for DNA immunization. The needleless injectors; Pulse50 (Pulse Needle-Free System, USA), and Dermavac (Merial, France) were tested and optimized for intradermal inoculation prior to the animal experiment (FIG. 18). Animal Experiment Four-week-old, crossbred pigs (8 pigs/group) were immunized with 200 g or 500 g of the indicated plasmid at day 0 (DO) using conventional intradermal injection, Dermavac or Pulse50 needleless injector. The immunological parameters were monitored every 2 weeks, at day 0, 14, 28, 42 and 56 post immunization. The pigs were kept at the commercial farm throughout the experiment. In vitro activation with PRRSV Freshly isolated porcine peripheral blood mononuclear cells (PBMCs) were cultured in vitro in the presence of the Thai isolated, US genotype, PRRSV (01 NP1 strain) or the control, MARC-145 infected cell lysate for 48 hours prior to harvesting and fluorescent labelings. The numbers of PRRSV-specific Treg, IL-10, and IFN producing cells in different lymphocyte subpopulation were determined by flow cytometry.

[0261] Results.

[0262] Both needleless injectors provided effective DNA immunization in 4-week-old pigs. Following a single plasmid immunization (d0), the pig immunized with Dermavac exhibited significantly better patterns of controlled PRRSV-specific immunoinhibitory parameters (Treg and IL-10), and enhanced PRRSV-specific immunostimulatory parameters (IFN production), (FIG. 19). Interestingly, immunization with both injectors, at the dose of 500 g, could enhance numbers of PRRSV-specific CDS+IFN-+ cells, compared to the conventional intradermal injection (FIG. 20).

Example 5: PRRSV-DNA Vaccine Challenge Study (PRRSV-Positive Farm)

[0263] Objective.

[0264] This study was designed to evaluate the efficacy of the prototype DNA vaccine in the fattening pigs raised in PRRSV-positive farm

[0265] Methods.

[0266] Four weeks old pigs from a commercial PRRSV-positive farm were randomly grouped (30 pigs/gr) and immunized twice, at 4 (d0) and 7 (d21) weeks old with DERMAVAC system. Pigs were moved to PRRSV-positive fattening site at 9 weeks old (d35). Group 1 was given PBSA (500 l/dose); Group 2 received Null plasmid (pMASIA) at 500 g/500 l/dose); and Group 3 received the DNA vaccine (pORF7t) at 500 g/500 Heparinized blood samples were collected (6 pigs/gr) for isolation of the PBMC and analysis of PRRSV-specific IL-10 and IFN producing cells and the numbers of PRRSV-specific CD4+ CD25+ Foxp3+ lymphocytes (Treg) on d0, 21, 35, 49, 84, 112, and 147. Serum samples were collected for determination of PRRSV-specific antibody (IDEXX ELISA) at the same time of whole blood collection. Monitoring of clinical signs and assessing lung score were performed at the slaughter house.

[0267] Results.

[0268] No vaccine adverse reaction was observed following DNA immunization. The pigs receiving DNA vaccine tended to have lower numbers of PRRSV-specific CD4+ CD25+ Foxp3+ Treg than the control groups, particularly after moving to the fattening site. The increases in Treg numbers were observed in both control groups following moving (d49), but not in the DNA vaccinated group (FIG. 22A). There were not statistical differences in the numbers of IL-10 producing cells throughout the experiment.

[0269] There was an increase in the numbers of PRRSV-specific CD4+ CD25+ lymphocyte (activated effector T cells) in the DNA vaccinated group following moving, (FIG. 22C), consistent with an increase in the numbers of PRRSV-specific IFN producing cells. The number of PRRSV-specific IFN- producing cells in DNA vaccinated group was significantly higher than the control groups on d84 (FIG. 22D). The number of IFN producing memory T cells (CD4+ CD8+ IFN-+ cells) of the DNA vaccinated group remained at a higher level, compared to the controls, through the end of the observatory period (FIG. 22F). It should be noted that the data variation within the study groups was quite high in this experiment. In addition, the immunomodulatory effects of the null plasmid were also observed.

[0270] On day 84, all groups exhibited PRRSV-seroconversion following moving into the PRRSV-positive fattening site. On d112, all pigs were seroconverted with the similar pattern of S/P ratios (FIG. 23). There was no significant difference in clinical sign among the groups during fattening period. Interestingly, the group receiving DNA vaccine exhibited lower lung scores, than the control group (p<0.05, student t-test), (FIG. 24).

[0271] Summary.

[0272] The DNA vaccine modulated the PRRSV-specific immune responses as shown by enhanced immunostimulatory parameters and reduced immunoinhibitory parameters during the fattening period (Table 10). There were no significant differences in the patterns of anti-PRRSV humoral responses among the experimental groups. In addition, the DNA vaccination pigs exhibited significantly lower lung pathological changes than the control pigs.

TABLE-US-00010 TABLE 10 Summary for % seropositive animals % seropositive* (No. of positive/tested animals) Group d0 d21 d49 d84 d112 PBSA 0 0 0 57.14 100 (0/7) (0/7) (0/7) (4/7) (8/8) Null 0 0 0 100 100 (0/7) (0/7) (0/7) (6/6) (7/7) pORF7t 0 0 0 100 100 (0/7) (0/7) (0/7) (6/6) (8/8) *S/P ratio > 0.4

Example 6: PRRSV-DNA Vaccine Challenge Study (PRRSV-Negative Farm)

[0273] Methods. Four week-old pigs in a PRRSV-seronegative commercial farm were randomly grouped (30 pigs/gr) and vaccinated at 4 weeks (d0) and 7 weeks old (d21), using Dermavac system. The pigs were all moved to the PRRSV-negative fattening site at approximately 9 weeks old. The treatment groups were as follows: Gr. 1 (PBSA, 500 l/dose); Gr. 2 (Null plasmid, 500 g/500 l/dose); and Gr. 3 (pORF7t DNA vaccine 500 g/500 l/dose). Heparinized blood samples were collected (6 pigs/gr) for isolation of the PBMC and analysis of PRRSV-specific IL-10 and IFN producing cells and the numbers of PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocytes (Treg) on d0, 21, 35, 49, and 63. Serum samples were collected for determination of PRRSV-specific antibody (IDEXX ELISA) at the same time of whole blood collection.

[0274] Results.

[0275] No vaccine adverse reaction was observed throughout the experiment. The immunomodulatory effects of the prototype DNA vaccine were depicted in FIGS. 25A-25F. Following the second vaccination, the group vaccinated with pORF7t exhibited significantly lower immunoinhibitory parameters than the control groups, and the numbers of PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ and CD4.sup.+CD25.sup.+Foxp3.sup.+IL-10.sup.+ lymphocytes were lower than the control groups throughout the experiment, especially at day 35 (FIGS. 25A & 25B). In addition, the DNA immunized group tended to have higher numbers of immunostimulatory parameters than the control groups. There were quite high data variations within the experimental groups. However, the group receiving DNA vaccine had significantly higher numbers of PRRSV-specific CD8.sup.+IFN.sup.+ lymphocytes (CTL) than the control groups at d35 (FIG. 25F). In addition, the immunomodulatory effects of the null plasmid were also observed in this study. No seroconverion was observed in the pigs throughout the experiment, and there was no obvious difference in the clinical signs among the groups. In summary, the immunized pigs exhibited significantly better PRRSV-specific cell-mediated immune responses and lower immunoinhibitory parameters, with no evidence of enhance anti-PRRSV antibody response.

Example 7. Challenge Study (PRRSV-Seronegative Farm)

[0276] Methods.

[0277] Four week old pigs in a PRRSV-seronegative farm were randomly grouped (10-12 pigs/gr) and vaccinated at 4 weeks (d0) and 7 weeks old (d21), using Dermavac: Gr. 1 (PBSA, 500 l/dose); Gr. 2 (Null plasmid, 500 g/500 l/dose); Gr. 3 (pORF7t, 500 g/500 l/dose); and Gr. 4 (pORF7, 500 g/500 l/dose). Prior to the age of 9 weeks old, pigs were moved to the isolation unit, and following acclimatization, the pigs were intranasally challenged with 5 ml (2.5 ml/nostril) of 10.sup.5.5 TCID.sub.50/ml of the virulent, US genotype PRRSV (strain 01NP1). The clinical signs were monitored following the challenge until the end of the experiment. Pigs (5-6 pigs/gr) were euthanized at 10 days post infection (dpi) and 21 dpi, and subjected for virological and pathological studies. Heparinized blood samples were collected (5 pigs/gr) for isolation of the PBMC and analysis of PRRSV-specific IL-10 and IFN producing cells and the numbers of PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocytes (Treg) on the vaccination days (d0, d21) and at 0, 7, 14, and 21 dpi.

[0278] Results.

[0279] The pORF7t vaccinated group exhibited significantly lower number of the PRRSV-specific Treg, while there were increases in the numbers of the Foxp3.sup.+ cells in the control groups throughout the observatory period (FIGS. 26A-26C). On the challenge day (0 dpi), the numbers of Foxp3.sup.+ lymphocytes from the DNA vaccinated group were lower than those of the controls (FIGS. 26B-26C). Following the challenge the numbers of Foxp3.sup.+ cells in the pORF7t vaccinated group remained lower than the control groups throughout the experiment. At the end of the observatory period (21 dpi), the pORF7t vaccinated group had significant lower Treg number than the control groups (FIGS. 26A-26C). Following the challenge, there were increases in the numbers of IL-10 producing cells in every experimental group. However, the pORF7t vaccinated group exhibited slower increase and faster reduction in the number of IL-10 producing cells (FIG. 26D). The pORF7t vaccinated group tended to have higher immunostimulatory parameters than the control groups. All challenge pigs exhibited clinical signs of PRRSV infection including depression in appetite, fever, swollen eyes, coughing. The pORF7t Group animals exhibited fewer clinical signs, and responded to external stimuli better than the other groups.

[0280] Following the challenge, PRRSV was detected from 3 dpi, peaked at 7-10 dpi and gradually decreased till the end of the experiment (FIGS. 29A-29C). The pORF7t vaccinated group was less viremic and recovered faster than the control groups (FIG. 29A). There was a trend of lower levels of viral genome in the lungs and tracheobronchial lymph nodes of the DNA vaccinated pigs (FIG. 29B). However, due to high data variation within the group, there was no statistical difference among the experimental groups. PRRSV seroconversion could be detected 2 weeks following the challenge. There were more seroconverted animals in the pORF7t vaccinated group at 21 dpi, however, no significant difference in the levels of S/P ratio was observed among the group. In addition, no PRRSV-specific neutralizing antibody was detected in any group, at 21 dpi.

[0281] Pathological studies at 10 dpi revealed the PRRSV induced pathological changes in the lungs from all groups (Table 12). There were more degree of macroscopic pathological changes in the lungs and lymph nodes of the control groups. At 21 dpi, the observed pathological changes were comparable among the groups (Table 13).

[0282] Summary.

[0283] This study demonstrated that the prototype PRRSV-DNA vaccine could modulate the PRRSV-specific immune responses in the vaccinated-challenged pigs as expected. The reduced number of Treg and enhanced immunostimulatory parameters were observed in the DNA vaccinated group, in particular, following the challenge. At 10 dpi, the pORF7t vaccinated pigs were less viremic, exhibited better clinical signs and less pathological changes than the control groups.

TABLE-US-00011 TABLE 11 Percent Seropositive % seropositive* (No. of positive/tested animals) Group 0 dpi 7 dpi 14 dpi 21 dpi PBSA 0 (0/5) 0 (0/5) 0 (0/5) 40 (2/5) Null 0 (0/5) 0 (0/5) 0 (0/5) 0 (0/5) pORF7t 0 (0/5) 0 (0/5) 20 (1/5) 60 (3/5) *positive: S/P ratio > 0.4

Example 8. Vaccine Efficacy in Replacement Gilts in the PRRSV-Positive Farm

[0284] Methods.

[0285] Nineteen week old, replacement gilts from a PRRSV-negative commercial farm were randomly grouped (30 pigs/gr) and immunized twice, at 20 (d0) and 23 (d21) weeks old with Dermavac system. Pigs were moved to PRRSV-positive production site at 9 weeks old (d35). The immunization groups were as followed; Gr. 1 PBSA (500 l/dose); Gr. 2 Null plasmid (pMASIA, 500 g/500 l/dose); Gr. 3 DNA vaccine (pORF7t, 500 g/500 l/dose. At 25 weeks old, the gilts were moved to PRRSV-positive farm where they would be exposed to the local PRRSV strain during the acclimatization in the recipient farm. The recipient farm has low level of losses from PRDC and PRRSV. Heparinized blood samples were collected (6 pigs/gr) for isolation of the PBMC and analysis of PRRSV-specific IL-10 and IFN producing cells and the numbers of PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocytes (Treg) on d0, 21, 35, 42, 49, 56, 70, and 98. Methods were generally performed as in previous example.

[0286] Results.

[0287] No evidence of vaccine adverse reaction was observed in the vaccinated gilts. Following vaccination, the vaccinated gilts exhibited a tendency of reduced PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ Treg and IL-10 producing cells, and enhanced PRRSV-specific memory effector T cells and IFN producing cells, compared to the controls throughout the experiment. The DNA-vaccinated gilts contained significantly lower numbers of PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocyte (Treg), and higher numbers of PRRSV-specific IFN producing cells than the pigs received PBSA on the day they were moved to the positive production site. It should be noted that there was quite high data variation within the experimental groups.

[0288] Prior to moving, the baseline levels of PRRSV genome in all groups were comparable, but following the move, PRRSV infection became apparent in all groups, as indicated by increases in PRRSV viral loads in the serum. The viremic stages were observed from 3 days post moving (dpm), peaked around 10-14 dpm, and lasted approximately 2 weeks. The pORF7t vaccinated gilts tended to have slower increases in viral loads and lower copy numbers of detected PRRSV genome in their serum samples.

[0289] Summary.

[0290] The pORF7t DNA vaccine exhibited immunomodulatory activities as in previous studies. Following PRRSV exposure in the farm, there was a trend of lower level of PRRSV viremia, and less culling in the DNA vaccinated gilts, as compared to controls.

[0291] Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.