METHOD FOR PRODUCING AROMATIC COMPOUND AND DERIVATIVE THEREOF

Abstract

The present invention provides a method for producing an aromatic compound such as salicylic acid and a derivative thereof with high productivity using a microorganism. The present invention provides: a method for producing a microorganism having a sugar metabolic pathway modified, including suppressing the expression of a gene encoding a phosphotransferase system enzyme of the microorganism, suppressing the expression of a gene encoding pyruvate kinase of the microorganism, and introducing, into the microorganism, one or more genes encoding an enzyme that enables the microorganism to synthesize an aromatic compound from chorismic acid or isochorismic acid; a modified microorganism obtained by the method; and a method for producing an aromatic compound and a derivative thereof, including culturing the microorganism, and recovering an aromatic compound or the like from the culture.

Claims

1. A method for producing a microorganism having a sugar metabolic pathway modified, comprising: suppressing the expression of a gene encoding a phosphotransferase system enzyme of the microorganism; suppressing the expression of a gene encoding pyruvate kinase of the microorganism; and introducing, into the microorganism, one or more genes encoding an enzyme that enables the microorganism to synthesize an aromatic compound from chorismic acid or isochorismic acid.

2. The method according to claim 1, further comprising suppressing the expression of a gene encoding an enzyme synthesizing L-phenylalanine from chorismic acid.

3. The method according to claim 1, wherein the aromatic compound is salicylic acid, and a gene encoding isochorismate synthase and a gene encoding isochorismate pyruvate lyase are introduced.

4. The method according to claim 1, wherein the aromatic compound is 4-hydroxybenzoic acid, and a gene encoding chorismate pyruvate lyase is introduced.

5. The method according to claim 1, wherein the aromatic compound is 3-hydroxybenzoic acid, and a gene encoding 3-hydroxybenzoate synthase is introduced.

6. The method according to claim 1, wherein the aromatic compound is 4-aminobenzoic acid, and a gene encoding aminodeoxychorismate synthase and a gene encoding 4-amino-4-deoxychorismate lyase are introduced.

7. The method according to claim 1, wherein the aromatic compound is 2-aminobenzoic acid, and a gene encoding anthranilate synthase is introduced.

8. The method according to claim 1, wherein the aromatic compound is L-tyrosine, and a gene encoding chorismate mutase and a gene encoding prephenate dehydratase are introduced.

9. The method according to claim 1, wherein the aromatic compound is phenol, and a gene encoding tyrosine phenol lyase is introduced.

10. The method according to claim 3, wherein a gene encoding salicylate 1-monooxygenase and a gene encoding catechol 1,2-dioxygenase are further introduced.

11. The method according to claim 5, wherein one or more genes that enable to synthesize gentisic acid, maleylpyruvic acid and/or maleic acid from the 3-hydroxybenzoic acid are further introduced.

12. A microorganism having a sugar metabolic pathway modified obtained by the method according to claim 1.

13. The microorganism according to claim 12, wherein the microorganism is selected from bacteria, yeasts and fungi.

14. A method for producing an aromatic compound or a derivative thereof, comprising: culturing the microorganism according to claim 12; and recovering an aromatic compound or a derivative thereof from the culture.

15. The method according to claim 14, wherein the aromatic compound is salicylic acid, 4-hydroxybenzoic acid, 3-hydroxybenzoic acid, 4-aminobenzoic acid, 2-aminobenzoic acid, L-tyrosine or phenol, and the derivative is muconic acid, gentisic acid, maleylpyruvic acid or maleic acid.

16. The method according to claim 14, wherein only glucose is added as a carbon source.

17. The method according to claim 2, wherein the aromatic compound is salicylic acid, and a gene encoding isochorismate synthase and a gene encoding isochorismate pyruvate lyase are introduced.

18. The method according to claim 17, wherein a gene encoding salicylate 1-monooxygenase and a gene encoding catechol 1,2-dioxygenase are further introduced.

19. A method for producing muconic acid comprising: providing a microorganism having a sugar metabolic pathway modified; culturing the microorganism; and recovering muconic acid from the culture obtained by culturing the microorganism, wherein the expression of a gene encoding a phosphotransferase system enzyme and the expression of a gene encoding pyruvate kinase in the microorganism are suppressed; wherein a gene encoding isochorismate synthase and a gene encoding isochorismate pyruvate lyase, which enable the microorganism to synthesize salicylic acid from chorismic acid or isochorismic acid, are introduced to the microorganism; and wherein a gene encoding salicylate 1-monooxygenase and a gene encoding catechol 1,2-dioxygenase are introduced to the microorganism.

20. The method according to claim 19, wherein the expression of a gene encoding an enzyme synthesizing L-phenylalanine from chorismic acid in the microorganism is also suppressed.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0036] FIG. 1 illustrates metabolic pathways of salicylic acid generation in E. coli.

[0037] FIG. 2 schematically illustrates a structure of a plasmid pCFTdeltain.

[0038] FIG. 3 illustrates culture characteristics of strains CFT01, CFT11, and CFT31. Changes over time in OD.sub.600 (FIG. 3(A)), glucose concentration (FIG. 3(B)), salicylic acid concentration (FIG. 3(C)), and L-phenylalanine concentration are illustrated.

[0039] FIG. 4 illustrates culture characteristics of a strain CFT51. Changes over time in OD.sub.600 (FIG. 4(A)), glucose concentration (FIG. 4(B)), and salicylic acid concentration (FIG. 4(C)) are illustrated.

[0040] FIG. 5 illustrates the yield of salicylic acid and salicylic acid production ability per unit bacterial cell in the strains CFT01, CFT11, CFT31, and CFT51.

[0041] FIG. 6 illustrates culture characteristics of the strains CFT01 and CFT51 in a 2-L jar fermenter, and cell growth (OD.sub.600) (FIG. 6(A)), glucose concentration change (FIG. 6(B)) and salicylic acid concentration change (FIG. 6(C)) in the strain CFT01, and cell growth (OD.sub.600) (FIG. 6(D)), glucose concentration change (FIG. 6(E)) and salicylic acid concentration change (FIG. 6(F)) in the strain CFT51 are illustrated.

[0042] FIG. 7 illustrates pathways though which various aromatic compounds are generated from chorismic acid.

[0043] FIG. 8 illustrates increase in amount of chorismic acid derivatives generated using a strain CFT5. The amounts and the yields of 4-hydroxybenzoic acid (PHBA) (FIG. 8(A)), 3-hydroxybenzoic acid (3HBA) (FIG. 8(B)), 4-aminobenzoic acid (PABA) (FIG. 8(C)), 2-aminobenzoic acid (2ABA) (FIG. 8(D)), L-tyrosine (FIG. 8(E)), and phenol (FIG. 8(F)) generated are respectively illustrated.

[0044] FIG. 9 illustrates a pathway for synthesizing maleic acid from chorismic acid via gentisic acid and maleylpyruvic acid.

[0045] FIG. 10 illustrates culture characteristics of strains CMtS09 and CMtS10. FIGS. 10(A) and 10(B) respectively illustrate changes over time in OD.sub.600 (filled circle) and in glucose concentration (open square) in the strains CMtS09 and CMtS10, and FIGS. 10(C) and 10(D) respectively illustrate amounts of maleic acid (filled circle), 3-hydroxybenzoic acid (filled square) and gentisic acid (filled triangle) generated in the strains CMtS09 and CMtS10.

[0046] FIG. 11 illustrates culture characteristics of strains CMtS091 and CMtS101. FIGS. 11(A) and 11(B) respectively illustrate changes over time in OD.sub.600 (filled circle) and in glucose concentration (open square) in the strains CMtS091 and CMtS101, and FIGS. 11(C) and 11(D) respectively illustrate amounts of maleic acid (filled circle), 3-hydroxybenzoic acid (filled square) and gentisic acid (filled triangle) generated in the strains CMtS091 and CMtS101.

DESCRIPTION OF EMBODIMENTS

[0047] As described above, the present inventors have designed a novel metabolic pathway for overexpressing an aromatic compound in a microorganism.

[0048] Specifically, the present invention provides a method for producing a microorganism having a sugar metabolic pathway modified, including suppressing the expression of a gene encoding a phosphotransferase system enzyme of the microorganism; suppressing the expression of a gene encoding pyruvate kinase of the microorganism; and introducing, into the microorganism, one or more genes encoding an enzyme that allows the microorganism to synthesize an aromatic compound from chorismic acid or isochorismic acid.

[0049] The term sugar metabolic pathway used herein means various reaction systems in vivo for decomposing and converting sugars such as glucose to be used as an energy source and a raw material used in biosynthesis of various compounds, and includes glycolytic pathway, TCA cycle, pentose phosphate pathway, and shikimic acid pathway. For example, biosynthetic pathways of salicylic acid illustrated in FIG. 1 are given for explaining modification of a sugar metabolic pathway by the method of the present invention, and it is noted that the sugar metabolic pathway used herein is not intended to be limited to these pathways. Those skilled in the art can easily think of a sugar metabolic pathway to which the method of the present invention is applicable using a sugar other than glucose, or a degradation product or the like of a sugar.

[0050] As illustrated in FIG. 1, in the method of the present invention, a microorganism is modified such that chorismic acid (Cho) is first converted into isochorismic acid ((Iso)Cho) by isochorismate synthase (ICS), then pyruvic acid (Pyr) is released from isochorismic acid by isochorismate pyruvate lyase (IPL) to generate salicylic acid in a living microorganism. In the latter reaction, pyruvic acid is released from isochorismic acid simultaneously with the synthesis of salicylic acid. Pyruvic acid is an essential compound for a microorganism, and pyruvic acid obtained during the generation of salicylic acid can be used in the glycolytic pathway. In the method of the present invention, a sugar metabolic pathway originally included in a microorganism is modified, for example, so that pyruvic acid is generated only when salicylic acid is generated, and thus, a microorganism suitable for overexpression of an aromatic compound such as salicylic acid can be obtained.

[0051] A gene to be introduced in the method of the present invention can be one that any of microorganisms originally has, but is little or never expressed under usual culture conditions due to various expression control mechanisms and the like. According to the method of the present invention, the amount of a target aromatic compound produced in a microorganism can be dramatically increased.

[0052] Almost all microorganisms have a sugar metabolic pathway intended to be modified in the present invention. Accordingly, the microorganism whose sugar metabolic pathway can be modified by the method of the present invention is not especially limited, and can be any microorganism as long as it can be easily cultured and a target compound can be easily recovered therefrom. Examples of the microorganism suitably used include bacteria including bacteria belonging to the genus Escherichia such as Escherichia coli (E. coli), bacteria belonging to the family Corynebacteriaceae, bacteria belonging to the genus Bacillus such as Bacillus subtillis, and actinomycetes belonging to the genus Streptomyces and the genus Streptococcus; yeasts including yeasts belonging to the genus Saccharomyces such as Saccharomyces cerevisiae and yeasts belonging to the genus Pichia such as Pichia pastoris; and fungi belonging to the genus Aspergillus such as Aspergillus oryzae.

[0053] In the case of using E. coli, an E. coli strain having high phenylalanine productivity is preferred from the viewpoint that chorismic acid can be synthesized with higher productivity because a shikimic acid pathway (a phenylalanine synthetic pathway) is activated therein. Examples of such an E. coli strain include strains ATCC31882, ATCC31883 and ATCC31884, among which the strain ATCC31882 is more preferred.

[0054] The strain ATCC31882 used as a parent strain in Examples of the present invention is an L-phenylalanine overproducing strain, in which feedback inhibition against L-phenylalanine production has been cancelled. The present inventors focused on the availability of phosphoenolpyruvic acid (PEP) in a cell, and examined to increase the amount of PEP usable for the synthesis of salicylic acid. First, in order to reduce PEP consumption, the present inventors replaced a phosphotransferase system (PTS) by a system of a combination of galactose permease (GalP) and glucokinase (Glk). The obtained modified strain of the present invention had a specific growth rate () of 0.55, the growth rate and glucose consumption rate thereof were substantially equivalent to those of the strain ATCC31882, indicating that a PTS-inactivated strain was successfully produced.

[0055] Accordingly, the method of the present invention includes suppressing the expression of a gene encoding a phosphotransferase system enzyme.

[0056] The term gene used herein means a DNA and an RNA having a polynucleotide sequence encoding a protein, particularly an enzyme, and may be a natural gene, a gene obtained by mutating a natural gene, a chemically synthesized gene, or a gene subjected to any of various modifications well known in the field. As long as an enzyme activity of interest is exhibited, the gene includes not only one encoding a full-length protein of an enzyme but also one encoding a functional fragment having the enzyme activity.

[0057] The term phosphotransferase system enzyme used herein means a group of enzymes in a sugar transport system in microorganisms such as bacteria that transfer a phosphate group of PEP to glucose to generate pyruvic acid and convert glucose into glucose-6-phosphate when transporting a sugar such as extracellular glucose into cells. The generated glucose-6-phosphate is metabolized thereafter in a glycolytic system. The phosphotransferase system is sometimes referred to as the phosphoenolpyruvate: sugar phosphotransferase system in this field.

[0058] The phosphotransferase system enzyme includes a plurality of enzymes. In order to prevent the occurrence of an enzyme reaction of the phosphotransferase system enzyme, there is no need to suppress the expression of all the enzymes included in the phosphotransferase system, but expression of a gene encoding one or more of the enzymes, preferably expression of ptsH (for example, NCBI Gene ID: 946886) and ptsI (for example, NCBI Gene ID: 946879) may be suppressed for this purpose.

[0059] The term suppress the expression of a gene used herein means preventing a protein originally encoded by the gene from being expressed, and includes artificially deleting a part of or all the gene by mutating a genomic gene sequence of the microorganism, and inhibiting transcription and/or translation of the gene, and any methods employed in the field may be employed.

[0060] As a method for mutating a gene sequence, gene recombination techniques can be suitably used. A method for deleting a gene is not particularly limited, and for example, a commercially available kit such as Quick & Easy E. coli Gene Deletion Kit (Funakoshi, Tokyo, Japan) can be used as described in Examples (http://www.funakoshi.co.jp/contents/580). PCR may be performed using a gene fragment included in the kit as a template with appropriate primers to disrupt a target gene.

[0061] The vector pCFTdeltain used in Examples can be used, for purposes of simultaneously performing disruption of ptsHI and introduction of GalP-Glk, for producing a fragment in which a disrupted fragment and an introduced gene are fused. A part of the sequence is shown in SEQ ID NO:36.

TABLE-US-00001 SEQIDNO:36 term-P.sub.Alac0-1-FRT-gb2-neo-FRTinpCFTdeltain: GCTAGCCCTAGGTCTAGGGCGGCGGATTTGTCCTACTCAGGAGAGCGTTC ACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTT TCGTTTTATTTGATGCCTCTAGCACGCGGGATCCTTTATCATCGTCGTCT TTATAGTCGATATCAAGCTTGGTCAGTGCGTCCTGCTGATGTGCTCAGTA TCTTGTTATCCGCTCACAATGTCAATTGTTATCCGCTCACAATTAATTAA CCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGGA ACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAACGCAGTCTGGAGC ATGCCCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCT GGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTC TTTGGTGGCCCCTTCGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTT CCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAG CACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAG CGGGTAGGCCTTTGGGCCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTT CTCGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCG GGCTCAGGGGCGGGGCGGCCGCCCGAAGGTCCTCCGGAGGCCCGGCATTC TGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATC TCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGCA TAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGG ATCGGCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGG TGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCT GATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGT CAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGC GGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGAC GTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGG GCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCA TGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCA TTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGA ACCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCG CGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAG GATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGA AAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGG ACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTT GGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCC CGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAG CGGGACTCTGGGGTTCGAATAAAGACCGACCAAGCGACGTCTGAGAGCTC CCTGGCGAATTCGGTACCAATAAAAGAGCTTTATTTTCATGATCTGTGTG TTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCTAGAAAGTATAGGA ACTTCCTCGAGCCCTATAGTGAGTCGTATTAGTCGAC

[0062] As a method for inhibiting transcription/translation of a gene, for example, RNA interference by an antisense RNA or siRNA can be used.

[0063] Those skilled in the art can appropriately design, synthesize or obtain a vector, an antisense RNA or the like to be used for suppressing the expression of a target gene.

[0064] When the expression of a gene encoding a phosphotransferase system enzyme is suppressed in a microorganism to delete the enzyme, a conversion reaction from glucose to glucose-6-phosphate does not occur. Accordingly, for properly generating glucose-6-phosphate, the system is preferably replaced by a system not using PEP and combining galactose permease (GalP) and glucokinase (Glk). Alternatively, another saccharification enzyme or hexokinase can be introduced. An enzyme and an enzyme system to be introduced can be appropriately selected in accordance with a carbon source and the like to be used.

[0065] In order to further increase the productivity of salicylic acid, the present inventors inactivated another PEP consuming reaction, that is, conversion from PEP to pyruvic acid in the glycolytic pathway catalyzed by pyruvate kinase (PykF and PykA). In the glycolytic pathway, PEP is converted into pyruvic acid by PykF and PykA with ADP as a cofactor. By deleting the enzyme catalyzing this reaction, pyruvic acid essential for a microorganism can be generated only when salicylic acid is generated.

[0066] Accordingly, the method of the present invention includes deleting a gene encoding pyruvate kinase or suppressing the expression thereof. The pykF (for example, NCBI Gene ID: 946179) and the pykA (for example, NCBI Gene ID: 946527) both encode pyruvate kinase catalyzing a reaction for generating pyruvic acid from PEP with ADP as a coenzyme. Since both genes complementarily act in a cell of E. coli or the like, the reaction cannot be completely suppressed unless both of these genes are deleted.

[0067] The method of the present invention further includes introducing, into the microorganism, one or more genes encoding an enzyme that enables the microorganism to synthesize an aromatic compound from chorismic acid or isochorismic acid.

[0068] The enzyme that enables to synthesize an aromatic compound from chorismic acid or isochorismic acid differs depending on a target aromatic compound. For example, if salicylic acid is to be synthesized by the microorganism and the method of the present invention, the enzyme that enables to synthesize an aromatic compound from chorismic acid or isochorismic acid is isochorismate synthase (ICS) and isochorismate pyruvate lyase (IPL), as described in detail below.

[0069] In the production of a compound employing the present invention, an enzyme reaction that a microorganism originally has can be used in some cases. Accordingly, there is no need to introduce genes corresponding to all enzymes necessary for the synthesis of a target compound, but a gene encoding an enzyme catalyzing a part of reactions desired to be promoted may be introduced. Two or more genes can be separately, continuously or simultaneously introduced, if necessary, in accordance with a target compound.

[0070] Furthermore, the microorganism and the method of the present invention can be used to synthesize additional compounds from a chorismic acid compound via a specific aromatic compound. Such additional compounds includes a non-aromatic compound, and accordingly, the term derivative of an aromatic compound is used herein to also intend such a compound. Alternatively, the term chorismic acid derivative is herein used in some cases in the sense that the above-described compound including an aromatic compound can be generated through one or more reactions with chorismic acid used as a starting compound.

[0071] An aromatic compound or a derivative thereof that can be synthesized in a microorganism from chorismic acid or isochorismic acid is not especially limited, and examples include salicylic acid, methyl salicylate, acetylsalicylic acid (aspirin), catechol, adipic acid, 1,6-hexanediol, 4-hydroxybenzoic acid (PHBA), 3-hydroxybenzoic acid (3HBA), 2,5-dihydroxybenzoic acid (gentisic acid), maleylpyruvic acid, maleic acid, fumaric acid, 4-aminobenzoic acid (PABA), 2-aminobenzoic acid (2ABA), L-tryptophan, tryptamine, aniline, L-tyrosine, phenol, cis,cis-muconic acid, and trans,trans-muconic acid.

[0072] The method of the present invention has been described above in three steps of: (1) suppressing the expression of a gene encoding a phosphotransferase system enzyme of the microorganism; (2) suppressing the expression of a gene encoding a pyruvate kinase of the microorganism; and (3) introducing, into the microorganism, one or more genes encoding an enzyme that enables the microorganism to synthesize an aromatic compound from chorismic acid or isochorismic acid. However, the description is given not for explaining the order of modification of the microorganism, and it should be understood that these steps may be performed in any order or at the same time.

[0073] When the intracellular availability of PEP is increased by the method of the present invention, the amounts of salicylic acid and L-phenylalanine generated are both increased as compared with those in an original strain. The present inventors have further found that the productivity of salicylic acid can be further increased to increase the yield by inactivating the biosynthetic pathway of L-phenylalanine.

[0074] Accordingly, the method of the present invention further includes deleting a gene encoding an enzyme synthesizing L-phenylalanine from chorismic acid or suppressing the expression of the gene.

[0075] Although not especially restrictive, examples of a gene presumed to be introduced for producing an aromatic compound by employing the method of the present invention will now be described.

[0076] If the target aromatic compound is salicylic acid, the method of the present invention includes introducing a gene encoding isochorismate synthase and a gene encoding isochorismate pyruvate lyase.

[0077] The isochorismate synthase (ICS) is an enzyme converting chorismic acid into isochorismic acid. The gene encoding ICS usable in the present invention is not especially limited, and examples of the genes include menF (NCBI Gene ID: 946712) and entC (NCBI Gene ID: 945511) derived from E. coli, pchA (SEQ ID NO:37) derived from Pseudomonas aeroginosa, AtICS derived from Arabidopsis thaliana, and BrICS derived from Brachypodium distachyon.

TABLE-US-00002 SEQIDNO:37 pchAfromPseudomonasaeruginosa: ATGAGCCGTCTGGCACCGCTGAGCCAGTGTCTGCATGCACTGCGTGGCAC CTTTGAACGTGCAATTGGTCAGGCACAGGCACTGGATCGTCCGGTTCTGG TTGCAGCAAGCTTTGAAATTGATCCGCTGGATCCTCTGCAGGTTTTTGGT GCATGGGATGATCGTCAGACCCCGTGTCTGTATTGGGAACAGCCGGAACT GGCATTTTTTGCATGGGGTTGTGCACTGGAACTGCAGGGTCATGGTGAAC AGCGTTTTGCACGTATTGAAGAAAATTGGCAGCTGCTGTGTGCAGATGCA GTTGTTGAAGGTCCGCTGGCTCCGCGTCTGTGTGGTGGTTTTCGTTTTGA TCCCCGTGGTCCGCGTGAACAACACTCGCAGGCATTTGCAGATGCCAGCC TCATGCTGGCAGGTATTACCGTTCTGCGTGAAGGTGAACGTTATCGTGTT CTGTGTCAGCATCTGGCAAAACCGGGTGAAGATGCACTGGCACTGGCAGC ATATCATTGTAGCGCACTGCTGCGTCTGCGTCAGCCTGCACGTCGTCGTC CGAGTGGTCCGACAGCCGGTGCACAGGGTGATGCAAGCGCACAAGAACGT CGTCAGTGGGAAGCAAAAGTTAGTGATGCAGTTAGCAGCGTTCGTCAGGG TCGTTTTGGTAAAGTTGTTCTGGCACGTACCCAGGCACGTCCGCTGGGTG ATATTGAACCGTGGCAGGTTATTGAACATCTGCGTCTGCAGCATGCCGAT GCACAGCTGTTTGCATGTCGTCGTGGTAATGCATGTTTTCTGGGTGCAAG TCCGGAACGTCTGGTTCGTATTCGTGCCGGTGAAGCACTGACCCATGCAC TGGCAGGCACCATTGCACGTGGTGGTGATGCACAAGAAGATGCACGTCTG GGTCAGGCACTGCTGGATAGCGCAAAAGATCGTCATGAACATCAGCTGGT TGTTGAAGCAATTCGTACCGCACTGGAACCGTTTAGCGAAGTTCTGGAAA TTCCGGATGCACCGGGTCTGAAACGTCTGGCACGTGTTCAGCATCTGAAT ACCCCGATTCGTGCCCGTCTGGCAGATGCCGGTGGTATTCTGCGCCTGCT GCAGGCCCTGCATCCGACACCGGCAGTTGGTGGTTATCCGCGTAGCGCAG CACTGGATTATATTCGTCAGCATGAAGGTATGGATCGTCGTTGGTATGCA GCACCGCTGGGTTGGCTGGATGGTGAAGGTAATGGTGATTTTCTGGTTGC ACTGCGTAGTGCACTGCTGACACCGGGTCGTGGTTACCTGTTTGCAGGTT GTGGTCTGGTTGGTGATAGCGAACCGGCACATGAATATCGTGAAACCTGT CTGAAACTGAGCGCAATGCGTGAAGCCCTGAGCGCCATTGGTGGTCTGGA TGAAGTTCCTCTGCAGCGTGGTGTTGCCTAA

[0078] The isochorismate pyruvate lyase (IPL) is an enzyme promoting depyruvation of isochorismic acid to convert it into salicylic acid. The gene encoding IPL usable in the present invention is not especially limited, and pchB (SEQ ID NO:38) derived from Pseudomonas aeroginosa, MbtI derived from Mycobacterium tuberculosis, and Irp9 derived from Yersinia enterocolitica are preferred, among which pchB is more preferred.

TABLE-US-00003 SEQIDNO:38 pchBfromPseudomonasaeruginosa: ATGAAAACCCCTGAAGATTGTACCGGTCTGGCAGATATTCGTGAAGCAAT TGATCGTATTGATCTGGATATTGTTCAGGCACTGGGTCGTCGTATGGATT ATGTTAAAGCAGCAAGCCGTTTTAAAGCAAGCGAAGCAGCAATTCCGGCA CCGGAACGTGTTGCAGCAATGCTGCCGGAACGCGCACGTTGGGCTGAAGA AAATGGTCTGGATGCACCGTTTGTTGAAGGTCTGTTTGCACAGATTATCC ATTGGTATATTGCCGAGCAGATCAAATATTGGCGTCAGACCCGTGGTGCA GCCTAA

[0079] If the target aromatic compound is 4-hydroxybenzoic acid, the method of the present invention includes introducing a gene encoding chorismate pyruvate lyase.

[0080] The chorismate pyruvate lyase (EC 4.1.3.40) is an enzyme converting chorismic acid into 4-hydroxybenzoic acid and pyruvic acid. The gene usable in the present invention is not especially limited, and an example of the gene includes ubiC (SEQ ID NO:39) derived from E. coli.

TABLE-US-00004 SEQIDNO:39 ubiCfromEscherichiacoli: ATGTCACACCCCGCGTTAACGCAACTGCGTGCGCTGCGCTATTGTAAAGA GATCCCTGCCCTGGATCCGCAACTGCTCGACTGGCTGTTGCTGGAGGATT CCATGACAAAACGTTTTGAACAGCAGGGAAAAACGGTAAGCGTGACGATG ATCCGCGAAGGGTTTGTCGAGCAGAATGAAATCCCCGAAGAACTGCCGCT GCTGCCGAAAGAGTCTCGTTACTGGTTACGTGAAATTTTGTTATGTGCCG ATGGTGAACCGTGGCTTGCCGGTCGTACCGTCGTTCCTGTGTCAACGTTA AGCGGGCCGGAGCTGGCGTTACAAAAATTGGGTAAAACGCCGTTAGGACG CTATCTGTTCACATCATCGACATTAACCCGGGACTTTATTGAGATAGGCC GTGATGCCGGGCTGTGGGGGCGACGTTCCCGCCTGCGATTAAGCGGTAAA CCGCTGTTGCTAACAGAACTGTTTTTACCGGCGTCACCGTTGTACTAA

[0081] If the target aromatic compound is 3-hydroxybenzoic acid, the method of the present invention includes introducing a gene encoding 3-hydroxybenzoate synthase.

[0082] The 3-hydroxybenzoate synthase (EC 4.1.3.45) is an enzyme converting chorismic acid into 3-hydroxybenzoic acid and pyruvic acid. The gene usable in the present invention is not especially limited, and examples of the genes include hyg5 (SEQ ID NO:40) derived from Streptomyces hygroscopicus, and cuv10 (SEQ ID NO:41) derived from Streptomyces sp. LZ35.

TABLE-US-00005 SEQIDNO:40 hyb5fromStreptomyceshygroscopicus: ATGCTGAATCCGAGCAGCCTGGTTCTGAATGGTCTGACCAGCTATTTTGA AAATGGTCGTGCACGTGTTGTTCCGCCTGTTGGTCGTAATATTCTGGGTG TTGTTAATTATGCCAGCGTTTGTGAATATCCGACCCTGGATCATGGTTAT CCGGAACTGGAAATTAACATGGTTGCACCGACCGCAGAACCGTTTGCCGA ACTTTGGGTTACCGATGCAGAAAGCGAACATGGTGAACGTGATGGTATTA CCTATGCACATGATGGCGAATATTTCTTTTGTGCAGGTCGTGTTCCGCCA ACCGGTCGTTATACCGAAGCAACCCGTGCAGCATATGTTACCATGTTTGA ACTGCTGGAAGAATTTGGTTATAGCAGCGTTTTTCGCATGTGGAACTTTA TTGGTGATATCAATCGTGATAATGCCGAAGGCATGGAAGTGTATCGTGAT TTTTGTCGTGGTCGTGCCGAAGCATTTGAACAGTGTCGTCTGGAATTTGA TCAGTTTCCGGCAGCAACCGGTATTGGTAGCCGTGGTGGTGGTATTGCAT TTTATCTGCTGGCATGTCGTAGCGGTGGTCATGTTCATATTGAAAATCCG CGTCAGGTTCCGGCATATCATTATCCGAAACGTTATGGTCCGCGTGCACC GCGTTTTGCACGTGCCACCTATCTGCCGAGCCGTGCAGCCGATGGTGTTG GTGGTCAGGTTTTTGTTAGCGCGACCGCAAGCGTTCTGGGTCATGAAACC GCACATGAAGGTGATCTGGTTAAACAATGCCGTCTGGCACTGGAAAATAT TGAACTGGTTATTAGTGGTGGTAATCTGGCAGCACATGGTATTAGCGCAG GTCATGGCCTGACCGCACTGCGTAACATTAAAGTTTATGTTCGTCGTAGC GAAGATGTTCCGGCAGTTCGTGAAATTTGTCGTGAAGCATTTAGTCCGGA TGCCGATATTGTTTATCTGACCGTTGATGTTTGCCGTAGCGTCTGCTGGT TGAAATTGAAGGTGTTGTGATG SEQIDNO:41 cuv10fromStreptomycessp.LZ35: ATGAATCCGACCAGCCTGGTTCTGAATGGTCTGACCAGCTATTTTGAAAA TGGTCGTGCCGGTGGTGTTCCGCCTGCAGGTCGTAATATTCTGCGTGTTG TTAATTATGCCAGCGTTTGTGAATATCCGACCCTGGATCATGGTTATCCG GAACTGGCCATTAATATGGTTGCACCGACCGCAGAACCGTTTGCCGAAGT TTGGGTTACCGATGCCGAAGCAGAACATGGTGAACGTGATGGTATTACCT ATGCACATGATGGCGAATATTTCTTTTGTGCGGGTCGTGTTCCTCCGACG GGTCGTTATACCGAAGCAACCCGTGCAGCATATGTTACCATGTTTGAACT GCTGGAAGAATTTGGTTATAGCAGCGTTTTTCGCATGTGGAACTTTATTG GTGATATCAATCGTGATAATGCCGAAGGCATGGAAGTGTATCGTGATTTT TGTCGTGGTCGTGCGGAAGCATTTGAACAGTGTCGTCTGGAATTTGATCA GTTTCCGGCAGCAACCGGTATTGGTACCCGTGGTGGTGGTATTGCATTTT ATCTGCTGGCATGTCGTAGCGGTGGTCATGTTCATATTGAAAATCCGCGT CAGGTTCCGGCATATCATTATCCGAAACGTTATGGTCCGCGTGCACCGCG TTTTGCACGTGCCACCTATCTGCCGAGCCGTGCAGCCGATGGCGGTGGTG GTCAGGTTTTTGTTAGCGGCACCGCAAGCGTTCTGGGTCATGAAACCGCA CATGAAGGTGATCTGGTTAAACAATGCCGTCTGGCACTGGAAAATATTGA ACTGGTTATTAGTCGTGGTAATCTGGCAGCACATGGTATTAGCGCAGGTC ATGGCCTGACCGCACTGCGTAACATTAAAGTTTATGTTCGTCGTGCAGAA GATGTTCCGGCAGTTCGTGAAATTTGTCGTGAAGCATTTAGTCCGGATGC CGATATTGTTTATCTGACCGTTGATGTTTGCCGTAGCGATCTGCTGCTTG AAATTCAAGGTGTTGTGATGTAA

[0083] If the target aromatic compound is 4-aminobenzoic acid, the method of the present invention includes introducing a gene encoding aminodeoxychorismate synthase and a gene encoding 4-amino-4-deoxychorismate lyase.

[0084] The aminodeoxychorismate synthase (EC 2.6.1.85) is an enzyme converting chorismic acid and L-glutamine into 4-amino-4-deoxychorismic acid and L-glutamic acid. The 4-amino-4-deoxychorismate lyase (EC 4.1.3.38) is an enzyme converting 4-amino-4-deoxychorismic acid into 4-aminobenzoic acid and pyruvic acid. Examples of the genes encoding these enzymes include, but are not limited to, pabA, pabB and pabC (SEQ ID NO:42) derived from E. coli.

TABLE-US-00006 SEQIDNO:42 pabCfromEscherichiacoli: CTTGATATCGAATTCAAAGACGAGAAACTCCAGATGTTTCTGATCAACGG TCATAAACAAGAAAGCCTGGCAGTTAGCGATCGTGCAACCCAGTTTGGTG ATGGTTGTTTTACCACCGCACGTGTTATTGATGGTAAAGTTAGCCTGCTG AGCGCACATATTCAGCGTCTGCAGGATGCATGCCACCGTCTGATGATTAG CTGTGATTTTTGGCCTCAGCTGGAACAAGAAATGAAAACCCTGGCAGCAG AACAGCAGAATGGTGTTCTGAAAGTTGTTATTAGCCGTGGTAGCGGTGGT CGTGGTTATAGCACCCTGAATAGCGGTCCGGCAACCCGTATTCTGAGCGT TACCGCATATCCGGCACATTACGATCGTCTGCGTAATGAAGGTATTACCC TGGCACTGAGTCCGGTTCGTCTGGGTCGTAATCCGCATCTGGCAGGTATT AAACATCTGAATCGTCTGGAACAGGTTCTGATTCGTAGCCACCTGGAACA GACCAATGCAGATGAACCACTGGTTCTGGATAGCGAACGTTGGGTTACCG AATGTTGTGCAGCAAACCTGTTTTGGCGTAAAGGTAATGTTGTTTATACA CCGCGTCTGGATCAGGCAGGCGTTAATGGTATTATGCGTCAGTTTTGTAT TCGTCTCCTGGCACAGAGCAGCTATCACCTGGTTCAAGTTCAGGCAAGCC TGGAAGAAAGTCTGCAGGCAGATGAAATGGTTATTTGTAATGCACTGATG CCGGTTATGCCGGTGTGTGCATGTGGTGATGTTAGCTTTAGCAGCGCAAC CCTGTATGAATATCTGGCACCGCTGTGTGAACGTCCGAATGAACAGAAAC TGATTAGCGAAGAAGATCTGTAACTGCAGCCCGGGGGA

[0085] If the target aromatic compound is 2-aminobenzoic acid, the method of the present invention includes introducing a gene encoding anthranilate synthase.

[0086] The anthranilate synthase (EC 4.1.3.27) is an enzyme converting chorismic acid and L-glutamine into anthranilic acid, pyruvic acid and L-glutamic acid. Examples of the genes usable in the present invention include trpE (NCBI Gene ID: 945846) and trpG (NCBI Gene ID: 945109, Microbial Cell Factories 2009, 8:19, Doi: 10.1186/1475-2859-8-19) derived from E. coli.

[0087] If the aromatic compound is L-tyrosine, the method of the present invention includes introducing a gene encoding chorismate mutase and a gene encoding prephenate dehydratase.

[0088] The chorismate mutase (EC 5.4.99.5) is an isomerase converting chorismic acid into prephenic acid. The prephenate dehydratase (EC 4.2.1.51) is an enzyme converting prephenic acid into phenylpyruvic acid, water and carbon dioxide. An example of the gene encoding these enzymes includes tyrA.sup.fbr (SEQ ID NO:43) derived from E. coli.

TABLE-US-00007 SEQIDNO:43 tyrA.sup.fbrfromEscherichiacoli: ATTAAAGAGGAGAAAGGTACCATGGTTGCTGAATTGACCGCATTACGCGA TCAAATTGATGAAGTCGATAAAGCGCTGCTGAATTTATTAGCGAAGCGTC TGGAACTGGTTGCTGAAGTGGGCGAGGTGAAAAGCCGCTTTGGACTGCCT ATTTATGTTCCGGAGCGCGAGGCATCTataTTGGCCTCGCGTCGTGCAGA GGCGGAAGCTCTGGGTGTACCGCCAGATCTGATTGAGGATGTTTTGCGTC GGGTGATGCGTGAATCTTACTCCAGTGAAAACGACAAAGGATTTAAAACA CTTTGTCCGTCACTGCGTCCGGTGGTTATCGTCGGCGGTGGCGGTCAGAT GGGACGCCTGTTCGAGAAGATGCTGACCCTCTCGGGTTATCAGGTGCGGA TTCTGGAGCAACATGACTGGGATCGAGCGGCTGATATTGTTGCCGATGCC GGAATGGTGATTGTTAGTGTGCCAATCCACGTTACTGAGCAAGTTATTGG CAAATTACCGCCTTTACCGAAAGATTGTATTCTGGTCGATCTGGCATCAG TGAAAAATGGGCCATTACAGGCCATGCTGGTGGCGCATGATGGTCCGGTG CTGGGGCTACACCCGATGTTCGGTCCGGACAGCGGTAGCCTGGCAAAGCA AGTTGTGGTCTGGTGTGATGGACGTAAACCGGAAGCATACCAATGGTTTC TGGAGCAAATTCAGGTCTGGGGCGCTCGGCTGCATCGTATTAGCGCCGTC GAGCACGATCAGAATATGGCGTTTATTCAGGCACTGCGCCACTTTGCTAC TTTTGCTTACGGGCTGCACCTGGCAGAAGAAAATGTTCAGCTTGAGCAAC TTCTGGCGCTCTCTTCGCCGATTTACCGCCTTGAGCTGGCGATGGTCGGG CGACTGTTTGCTCAGGATCCGCAGCTTTATGCCGACATCATTATGTCGTC AGAGCGTAATCTGGCGTTAATCAAACGTTACTATAAGCGTTTCGGCGAGG CGATTGAGTTGCTGGAGCAGGGCGATAAGCAGGCGTTTATTGACAGTTTC CGCAAGGTGGAGCACTGGTTCGGCGATTACgttCAGCGTTTTCAGAGTGA AAGCCGCGTGTTATTGCGTCAGGCGAATGACAATCGCCAGTAAGGGCCCC CCCTCGAG

[0089] If the target aromatic compound is phenol, the method of the present invention includes introducing a gene encoding tyrosine phenol lyase.

[0090] The tyrosine phenol lyase (TPL, EC 4.1.99.2) is an enzyme catalyzing a reaction for converting L-tyrosine and water into phenol, pyruvic acid and ammonia in a stepwise manner. The gene encoding TPL usable in the present invention is not especially limited, and an example of the gene includes tpl (SEQ ID NO:44) derived from Pasteurella multocida.

TABLE-US-00008 SEQIDNO:44 tplfromPasteurellamultocida: ATTAAAGAGGAGAAAGGTACCATGAGAAACTATCCTGCAGAACCTTATAA AGTCAAAGCTGTTGAACCGATTGCAATGACGACTCGTGAGCAACGTGAAG CCTACATGAAAAAAGCAGGCTACAATACGTTTTTACTCAATTCAGAAGAA GTGTATATTGATTTATTAACCGATAGTGGTACCTCAGCCATGAGTGATAA GCAATGGGCGGGTCTTATGATCGGTGATGAAGCTTATGCAGGTAGCCGTA ACTTCATGCATTTACAAGACGTGGTCAGAGAATATTATGGTTTCAAATAT GTCGTACCAACTCACCAAGGTCGTGGTGCAGAAAACTTACTTTCAACCAT TATGATCAAACCGGGCGATTATGTACCGGGTAATATGTATTTTACTACAA CACGCGCGCACCAAGAGCGTAATGGGGCGACTTTCGTTGATATTATTATT GATGAAGCCCATGATTCACAAATTGATTTACCTTTCAAAGGCAATGTCGA TGTGAAGAAATTACAAAAACTGATTGATGAAGTGGGTGCGGATAAAATTC CTTACATCTGTTTAGCGGTTACCGTAAACTTAGCGGGTGGACAACCTGTG AGTATGGCAAACATGCGTGAAGTAAAAGCATTATGTAGCAAACATGGTAT TAAAGTGATGTTTGATGCCACACGTTGTGTAGAAAATGCGTACTTCATTA AAGAGCGTGAAGCAGAGTATAAAGATGCAACCATCAAAGATATTCTAAAA GAAATGATGAGTTATGCAGATGGTTGTACCATGAGTGGTAAAAAAGACTG TCTTGTGAATATTGGTGGTTTCTTATGTATTAATGATGATGATCTTTATC AACAAGCTTGTGAACTCGTGGTGCTCTTTGAAGGGATGCCATCTTATGGT GGACTAGCTGGTCGTGATATGGAAGCAATGGCAATTGGTATTACGGAATC TGTCGATTTCCACTATATCCAGCACCGTGTTGCACAATGTTACTACCTCG CGGATAAATTAGAAGCGGCGGGTGTGCCGATTGTGAAACCAGTGGGAGGT CATGCGGTATTCTTAGATGCGAAGAAATTCCTTCCACATATTCCACAAGA ACAATTCCCAGCACAGATGCTTGCTGCGCAAATTTATATTGAGGGTGGCG TACGTTCAATGGAACGTGGTATTGTATCGGCGGGTCGTGATAAGAAAACC GGTGCAAACCATACGCCTAAATTAGAATTAGTGCGTTTAACTATCCCACG TCGTGTTTATACTTATGCGCATTTAGATCATGTTGCTGACACCATTATTA AACTCTTTAAACACAGAGATGACATTAAAGGTCTTGATATGGTGTATGAG CCTAAATTATTACGTTTCTTTACGGCGCGTTTTGAACCGAAAGCGTAAGG GCCCCCCCTCGAG

[0091] Besides, when a gene encoding salicylate 1-monooxygenase and a gene encoding catechol 1,2-dioxygenase are further introduced into the microorganism having been modified to be able to synthesize salicylic acid, the microorganism can be caused to synthesize cis,cis-muconic acid.

[0092] The salicylate 1-monooxygenase (SMO, EC1.14.13.1) is an enzyme converting salicylic acid into catechol with NADH used as a coenzyme. The catechol 1,2-dioxygenase (CDO, EC 1.13.11.1) is an enzyme converting catechol into cis,cis-muconic acid. The genes encoding these enzymes are not especially limited, and examples of the genes include nahG.sup.opt (SEQ ID NO:45) derived from Pseudomonas putida TK2440, and catA (SEQ ID NO:46) derived from Pseudomonas putida DOT-T1E.

TABLE-US-00009 SEQIDNO:45 nahG.sup.optfromPseudomonasputidaTK2440: ATTAAAGAGGAGAAAGGTACCATGCAGAACAGTACCAGCGCCCTGAACGT TAGCATCATTGGCGGCGGTATCGCAGGCGTTGCACTGGCCCTGGACTTAT GTCGCCACGCCCACCTGAACGTGCAGCTGTTCGAGGCAGCCCCGGCCTTT GGCGAAGTTGGTGCCGGTGTTAGCTTCGGCGCCAATGCAGTGCGTGCAAT CGCCGGTCTGGGTATCGCAGAGCCGTACGGCAAAATTGCCGACAGTAATC CGGCCCCGTGGCAGGACATCTGGTTCGAATGGCGCAATGGCCGTGATGCC AAATACCTGGGTTGCAGCGTTGCCGAAGGCGTTGGTCAAAGCAGTGTGCA CCGTGCCGATTTCCTGGACGCTCTGGCTTCTCAGCTGCCGGACGGTATCG CTCAGTTCGGTAAACGTGCTCAGCGTGTTGAACAGGACGGTGAGCAAGTG CGTGTGACATTCACAGACGGCAGCGAGCACCGCTGCGATCTGCTGATTGG TGCCGACGGTATCAAGAGTAGCATCCGTGACCACGTGTTACAGGGCCTGA ATCAACCGCTGGCAAGCCCGCGTTTTAGCGGCACCTGCGCCTATCGCGGT CTGATCGATACCCAGCAGCTGCGTGAGGCCTATCGTGCCCGTGGCGTGGA CGAGCATCTGATTGACGTGCCGCAGATGTACCTGGGCCTGGACGGCCACA TCCTGACCTTCCCGGTTAAACAAGGCCGCCTGATCAACGTGGTGGCCTTC ATCAGTGACCGCAGCCAACCGAACCCGGTTTGGCCGAGCGATACACCGTG GGTTCGTAATGCCACCCAAGCCGAGATGCTGGCCGCATTCGAGGGCTGGG ATGATGCAGCCCAAGTGCTGCTGGAGTGCATCCCGACCCCTAGTCTGTGG GCCCTGCACGACCTGGCAGAATTACCGGGCTACGTTCACGGCCGTGTTGG CTTAATCGGCGACGCCGCCCACGCAATGTTACCGCATCAGGGTGCCGGTG CAGGTCAGGGTCTGGAGGATGCCTGGTTACTGGCCCGCCTGCTGGAAGAC CCGAAGGTGCTGGACAAACGCCCGCAGGCAGTGCTGGATGCCTATGACGC CGTTCGTCGTCCTCGTGCCTGCCGTGTGCAGCGTACCAGCTTCGAGGCCG GCGAACTGTATGAGTTCCGTGACCCGGCCGTGTTAGCCGACGAGGAGCGT CTGGGCAAAGTTCTGGCCGAACGCTTTGACTGGCTGTGGAACCACGACAT GCAGGAAGACTTATTACAGGCCCGTGAGCTGCTGGGTTTACGTGCCCAAG CCGCCTAATAGGGGCCCCCCCTCGAG SEQIDNO:46 catAfromPseudomonasputiaDOT-TIE: GTCGACGGTATCGATCATTAAAGAGGAGAAAGGATGACCGTGAAAATTAG CCATACCGCAGATATTCAGGCCTTTTTTAACCGTGTTGCAGGTCTGGATC ATGCAGAAGGTAATCCGCGTTTTAAACAAATTATTCTGCGTGTTCTGCAG GATACCGCACGTCTGATTGAAGATCTGGAAATTACCGAAGATGAATTTTG GCATGCCGTGGATTATCTGAATCGTCTGGGTGGTCGTAATGAAGCAGGTC TGCTGGCAGCCGGTCTGGGTATTGAACATTTTCTGGATCTGCTGCAGGAT GCAAAAGATGCCGAAGCAGGCCTGGGTGGTGGTACACCGCGTACCATTGA AGGTCCGCTGTATGTTGCGGGTGCACCGCTGGCACAGGGTGAAGCACGTA TGGATGATGGCACCGATCCGGGTGTTGTTATGTTTCTGCAGGGTCAGGTT TTTGATGCAGATGGCAAACCTCTGGCAGGCGCAACCGTTGATCTGTGGCA TGCAAATACCCAGGGCACCTATAGCTATTTTGATAGCACCCAGAGCGAAT TTAATCTGCGTCGTCGTATTATTACCGATGCGGAAGGTCGTTATCGTGCA CGTACCATTGTTCCGAGCGGTTATGGTTGTGATCCGCAGGGTCCGACCCA AGAATGTCTGGACCTGCTGGGTCGTCATGGTCAGCGTCCGGCACATGTTC ATTTTTTCATTAGCGCACCGGGTCATCGTCATCTGACCACACAGATTAAC TTTGCCGGTGATAAATATCTGTGGGATGATTTTGCATATGCCACCCGTGA TGGTCTGATTGGTGAACTGCGTTTTGTTGAAGATGCAGCAGCAGCACGTG ATCGTGGTGTTCAGGGTGAACGTTTTGCAGAACTGAGCTTTGATTTTCGC CTGCAGGGTGCCAAAAGTCCGGATGCAGAAGCCCGTAGCCATCGTCCGCG TGCACTGCAAGAAGGTTAATAGGATATCGAATTCGCAGGGTGCCAAAAGT CCGGATGCAGAAGCCCGTAGCCATCGTCCGCGTGCACTGCAAGAAGGTTA ATAGGATATCGAATTCCTG

[0093] Besides, into the microorganism having been modified to be able to synthesize 3-hydroxybenzoic acid, one or more genes encoding an enzyme that enables to synthesize gentisic acid, maleylpyruvic acid and/or maleic acid from the 3-hydroxybenzoic acid can be introduced. Examples of the genes usable for this purpose include a gene encoding 3-hydroxybenzoate 6-hydroxylase, a gene encoding gentisate-1,2-dioxygenase, and a gene encoding maleylpyruvate hydrolase (FIG. 9). The method of the present invention utilizes a biosynthetic pathway that a microorganism originally has, and hence, a gene necessary to be introduced can be varied depending on the type of the microorganism. Alternatively, the above-described genes can be introduced into the microorganism together with a gene encoding the 3-hydroxybenzoate synthase.

[0094] The 3-hydroxybenzoate 6-hydroxylase (3H6H, EC 1.14.13.24) is an enzyme converting 3-hydroxybenzoic acid into gentisic acid. The gene encoding this enzyme is not especially limited, and an example of the gene includes 3hb6h (SEQ ID NO:47) derived from Rhodococcus jostii RHA1.

TABLE-US-00010 SEQIDNO:47 3hb6bfromRhodococcusjostiiRHA1: ATGAGCAATCTGCAGGATGCCCGTATTATCATTGCCGGTGGTGGTATTGG TGGTGCAGCAAATGCACTGGCACTGGCCCAGAAAGGTGCAAATGTTACCC TGTTTGAACGTGCAAGCGAATTTGGTGAAGTTGGTGCAGGTCTGCAGGTT GGTCCGCATGGTGCACGTATTCTGGATAGCTGGGGTGTTCTGGATGATGT TCTGAGCCGTGCATTTCTGCCGAAAAATATCGTTTTTCGTGATGCCATTA CCGCAGAAGTTCTGACCAAAATTGATCTGGGTAGCGAATTTCGTGGTCGT TATGGTGGTCCGTATTTTGTTACCCATCGTAGCGATCTGCATGCAACCCT GGTTGATGCAGCACGTGCAGCCGGTGCAGAACTGCATACCGGTGTTACCG TTACCGATGTTATTACCGAAGGTGATAAAGCAATTGTGAGCACCGATGAT GGTCGTACCCATGAAGCAGATATTGCACTGGGTATGGATGGTCTGAAAAG CCGTCTGCGTGAAAAAATCAGCGGTGATGAACCGGTTAGCAGCGGTTATG CAGCATATCGTGGCACCACCCCGTATCGTGATGTTGAACTGGATGAAGAT ATTGAAGATGTGGTGGGTTATATTGGTCCGCGTTGTCATTTTATTCAGTA TCCGCTGCGTGGTGGTGAAATGCTGAATCAGGTTGCAGTTTTTGAAAGTC CGGGATTCAAAAACGGCATTGAAAATTGGGGTGGTCCGGAAGAACTGGAA CAGGCATATGCACATTGCCATGAAAATGTTCGTCGCGGTATTGATTATCT GTGGAAACATCGTTGGTGCCCGATGTATGATCGTGAACCGATTGAAAACT GGGTTGATGGTCGCATGATTCTGCTGGGTGATGCCGCACATCCGCCTCTG CAGTATCTGGCAAGCGGTGCAGTTATGGCAATCGAAGATGCAAAATGTCT GGCAGATTATGCAGCCGAAGATTTTAGCACCGGTGGTAATAGCGCATGGC CTCAGATTCTGAAAGAAGTTAATACCGAACGCGCACCGCGTTGTAATCGT ATTCTGACCACCGGTCGTATGTGGGGTGAACTGTGGCATCTGGATGGCAC CGCACGTATTGCACGTAATGAACTGTTTCGTACCCGTGATACCAGCAGCT ATAAATACACCGATTGGCTGTGGGGTTATAGCAGCGATCGTGCAAGCTAA

[0095] The gentisate-1,2-dioxygenase (GDO, EC 1.13.11.4) is an enzyme converting gentisic acid into maleylpyruvic acid. The gene (g12d) encoding this enzyme is not especially limited, and an example of the gene includes mps2 (SEQ ID NO:48) derived from Rhodococcus sp. NCIMB 12038.

TABLE-US-00011 SEQIDNO:48 mps2fromRhodococcussp.NCIMB12038: ATTAAAGAGGAGAAAGGTACCATGACCGCAACCGAACCGCATGTTGATGA TGATCCGGCACTGAAACAGCTGTATACCGATTTTGAAGCAGAACATCTGA ATCCGCTGTGGACACAGCTGGGTGATCTGATGCCGATGACCCCGACCAGC CGTGCAGTTCCGTTTGTTTGGAAATGGTCAACCCTGTATCCGCTGGCACA GCGTGCCGGTGATCTGGTTCCGGTTGGTCGTGGTGGTGAACGTCGTGCAA TTGCCCTGGCAAATCCGGGTCTGGGTGGTGTTCCGTATGTTACCCCGACC CTGTGGGCAGCAATTCAGTATCTGGGTCCGAAAGAAGTTGCACCGGAACA TCGTCATGCACAGAATGCATTTCGTTTTGTTGTTGAAGGTGAAGGTGTTT GGACCGTTGTTAATGGTGATCCGGTTGCAATGCGTCGTGGTGATTTTCTG CTGACACCGGGTTGCCATTTTCATGGTCATCATAATGAAACCGATCAGCC GATGCCATGGATTGATGGTCTGGATATCCCGTTTGTTCATTATACCGATA CCGGCTTTTTTGAATTTGGCAGCGAAAATGTTACCGATGATAGCACACCG GATGTTAGCCGTAGCGAACGTCTGTGGGCACATCCTGGTCTGCGTCCGCT GGTTGGCCTGGATGCAAAAACCAGCAGCCCGATTGCAGCATATCGTTGGG AACACACCGATGCAGCACTGCGTGAACAGCTGGCACTGGAAGATGAAGGT TATGCAGCAACCACCGAACCGGGTCATGCAGCAGTTCGTTATACCAATCC GACCACAGGTGGTGATGTTATGCCGACCATTCGTGCAGAATTTCATCGTC TGCGTGCGGGTGCACATACCCGTCCGCGTCGTGATGTTGGTAGCACCGTT TATCAGGTTTTTGAAGGTAGCGGTCGTTTTGTGCTGGGTGGTCAGACCCG TACCGTGGGTAAAGGTGATATGATTGTTGTTCCGAGCTGGACCGAATGGT CAATTGAAGCCGATACCGAATTTGACCTGTTTGCATTTAGTGATGCACCG ATTGTTGAACGTCTGCATTTTCACCGTACCTATATTAGCGAAGGTGCACA TCATCATCATCATCATTAAGGGCCCCCCCTCGAG

[0096] The maleylpyruvate hydrolase (MPH, EC 3.7.1.23) is an enzyme converting maleylpyruvic acid into maleic acid. The gene encoding this enzyme is not especially limited, and an example of the gene includes hbzF (SEQ ID NO:49) derived from Pseudomonas alcaligenes NCIMB 9867.

TABLE-US-00012 SEQIDNO:49 hbzFfromPseudomonasalcaligenesNCIMB9867: GTCGACGGTATCGATTTCATTAAAGAGGAGAAAGGTATGAAAATCTGCGG CTTTAATGAAAATCGTCTGGGTGTTGTTGATGGTGATGAAGTTCTGGATG TTACCGAAGCACTGAGCGTTCTGCCGAGCTATGAATATCCGCTGCCTGGT TATGATCCGCTGATTAAACATCTGGATGCACTGCTGGCACGTATTGAAAC CCTGATTAAAGATGCACCGCGTATTCTGCTGGCAGATGTTCGTCTGCTGA GTCCGGTTGCAAATCCGGGTAAAATCATTGCAGCACCGATTAACTATACC CGTCATCTGCAAGAAGTGCTGGCCGATAGCGCAATTAACAATGGTGTTGC AAGCTTTACCCAGCATATCAAAAAAAGCGGTCTGTTTCTGAAAGCAAATA GCAGCCTGGCTGGTGCCGGTGAAGGTGTTGCACTGAGCCATCAGGATCGT CGTAATGATCATGAAGTTGAACTGGCCATTGTGATTGGTAAAACCGCACG TAATGTTCCGCGTGAAAAAAGCCTGGAATATGTTGCAGGTTATTGCATTG GTATTGATATGACCGTTCGTGGTCCGGAAGAACGTAGCTTTCGTAAAAGT CCGGATAGCTATACCATTCTGGGTCCGTGGCTGGTTACCCGTGATGAAAT TGATAGTCCGGGTGAACTGCAGATGAGCCTGAAAGTTAATGGTGAAGTTC GTCAGAATGCAAATACCAGCGATCTGATTCTGGGTGTGGAAGAACTGGTT GAATTTGCAAGCAGCTTTTATACCCTGCATCCGGGTGATGTGATTATTAG CGGTACACCGGAAGGTGTGGGTCCGGTTAATCCTGCTGATGCCATGCTGG CCGAAATTGAACGTATTGGCACCATGACCATTGCAATTCGTAGCGTTGAC TACAAGGATGACGATGACAAGTAAGATATCGAATTCCTG

[0097] As a gene intended to be introduced into a microorganism, commercially available products from suppliers such as Invitrogen can be suitably used. Information including the nucleotide sequence of the gene can be obtained by accessing, via internet, database published by National Center for Biotechnology Information (NCBI), USA, or the like, and the gene can be chemically synthesized in some cases.

[0098] Each gene can be optionally modified in the nucleotide sequence thereof for retaining or further improving the enzyme activity. Accordingly, as a gene encoding, the isochorismate synthase, for example, a polynucleotide hybridizing, under stringent conditions, to a polynucleotide consisting of a nucleotide sequence as set forth in SEQ ID NO:37, or a polynucleotide consisting of a sequence having a sequence identity of 90% or more, 95% or more, or 99% or more with the nucleotide sequence as set forth in SEQ ID NO:37, can be used.

[0099] For introducing a gene, the gene is preferably amplified by polymerase chain reaction (PCR) using primers suitable for the gene. In this case, two or more genes can be simultaneously amplified in a linked form by selecting a template and primers.

[0100] In introducing a gene into a microorganism, a gene encoding each of the above-described enzymes can be incorporated into a suitable expression vector. In this case, codon usage is preferably optimized in accordance with the microorganism used as a host.

[0101] Those skilled in the art can select an expression vector suitable for gene introduction for using and modifying bacteria, yeasts and fungi in the method of the present invention. An expression vector to be used for gene introduction or modification can be commercially available from suppliers such as Invitrogen, Life Technologies Corporation, and Expressys, or such a commercially available product can be further modified in accordance with purpose.

[0102] The term expression vector used herein means a self-replicating vector, namely, a vector that is present as an independent substance outside a chromosome, and whose replication does not depend on replication of the chromosome, and for example, the vector can be constructed based on a plasmid. Procedures and a method for constructing such an expression vector can be any of those commonly used in the field of genetic engineering.

[0103] In order that a gene is introduced into a microorganism for expressing a target enzyme, the expression vector preferably contains, in addition to a polynucleotide encoding the enzyme, a DNA sequence controlling the expression, a gene marker for selecting transformed E. coli, or the like.

[0104] DNA sequences controlling the expression include a promoter, an enhancer, a terminator, and a ribosome binding sequence (RBS). Besides, in addition to the DNA sequences controlling the expression, DNA sequences inducing the expression may be contained. An example of such DNA sequences inducing the expression includes lactose operon capable of inducing the expression of a gene disposed downstream when isopropyl--D-thiogalactopyranoside (IPTG) is added. A gene marker to be used in the present invention may be appropriately selected in accordance with a method for selecting transformed E. coli, and for example, a gene encoding drug resistance, or a gene complementing auxotrophy can be used.

[0105] In the case where two or more genes are intended to be introduced, two or more expression vectors respectively containing the genes may be simultaneously or separately introduced, or these genes may be tandemly incorporated into one expression vector. The protein may be expressed in the form of a fusion protein with or without a suitable linker.

[0106] In the method of the present invention, the enzyme encoded by the introduced gene can be expressed in a fused form with an additional functional protein or peptide. The additional functional protein or peptide can be fused directly or indirectly to one of or both of the amino terminal or the carboxy terminal of the enzyme. The additional functional protein is not especially limited, and is appropriately selected in accordance with a function required. For example, for purification, detection or the like of a protein, green fluorescent protein (GFP), luciferase protein, Myc-tagged protein, His-tagged protein, hemagglutinin (HA)-tagged protein, FLAG-tagged Protein (Sigma-Aldrich), glutathione-S-transferase (GST) protein and the like can be used.

[0107] The present invention also provides a microorganism having a sugar metabolic pathway modified, obtained by the method of the present invention. The microorganism is selected from bacteria, yeasts and fungi.

[0108] The present invention further provides a method for producing an aromatic compound or a derivative thereof, including culturing the above-described modified microorganism of the present invention, and recovering an aromatic compound or a derivative thereof from the culture.

[0109] Culture conditions for a microorganism are varied depending on the selected microorganism. Those skilled in the art can select appropriate media and culture conditions in accordance with various microorganisms of bacteria, yeasts and fungi, and a medium and culture conditions are not especially limited. For example, culture conditions for E. coli are as described below and in Examples.

[0110] The medium may be a liquid medium or a solid medium, and is preferably a liquid medium from the viewpoint that a product secreted outside the microorganism can be easily recovered. The medium may contain, in addition to components necessary for culturing the microorganism, a carbon source that can be a raw material of biosynthesis of an aromatic compound or the like intended to be highly produced.

[0111] The carbon source is not especially limited, and is preferably glucose, fructose, galactose, mannose, xylose, arabinose, glycerol, glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate, dihydroxyacetone phosphate, glycelaldehyde-3-phosphate, 1,3-bisphosphoglycerate, 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvic acid, pyruvic acid, acetyl CoA or the like, and is more preferably glucose, that is a major component of biomass, for providing a clean production method using, as a raw material, a renewable resource of biomass. In one embodiment of the present invention, glucose can be added as an only carbon source. The amount of the carbon source to be supplemented to the medium can be appropriately adjusted in accordance with the type of the carbon source, the type of the microorganism, and the like, and is usually 20 to 200 g/L, and preferably 20 to 50 g/L.

[0112] Components necessary for culturing the microorganism are not especially limited, and examples include nitrogen sources such as yeast extract, polypeptone, tripeptone, casein and a metabolite thereof, corn steep liquor, soy protein, meat extract, and fish meat extract. Also, a metal salt such as magnesium salt, sodium salt, iron salt, or manganese salt is preferably supplemented. Examples of the metal salt include sodium chloride, sodium dihydrogen phosphate, disodium hydrogen phosphate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium chloride, iron(II) sulfate, iron(III) sulfate, iron(II) chloride, iron(III) chloride, iron citrate, ammonium iron sulfate, calcium chloride dihydrate, calcium sulfate, magnesium sulfate, zinc sulfate, zinc chloride, copper sulfate, copper chloride, manganese sulfate, and manganese chloride. In addition, as necessary, vitamins and nucleic acid related substances or the like such as biotin, nicotinic acid, thiamine, riboflavin, inositol, and pyridoxine, may be supplemented to the medium.

[0113] The medium may be supplemented with a substance for inducing the expression of a protein, such as IPTG, or an antibiotic used for selecting a cell, such as penicillin, fl-lactam, macrolide, chloramphenicol, tetracycline, aminoglycoside, ketolide, polyene macrolide, glycopeptide, nucleic acid-based, and pyridone carboxylic acid-based antibiotics.

[0114] The culture conditions may be any conditions as long as the microorganism can be grown in the medium and the target compound can be biosynthesized, and those skilled in the art can set the conditions in accordance with the type of the microorganism and the medium to be used, etc. by appropriately adjusting the culture temperature, addition of air, oxygen concentration, carbon dioxide concentration, pH of the medium, shaking speed for the culture, culture time, humidity and the like. Culture temperature is usually 25 C. to 40 C., and is preferably 37 C. for E. coli and the like from the viewpoint that a growth rate can be easily maximized. Suitable pH of the medium for culturing E. coli is 7.0, and the shaking speed for the culture is usually 180 to 300 rpm, and preferably 180 to 200 rpm.

[0115] A method for recovering an aromatic compound and/or a derivative from the culture medium may be performed by a method usually employed in this field, and is not especially limited. For example, single one of or a combination of methods of filtration, centrifugation and purification using various chromatography, etc. can be employed as necessary.

[0116] According to the method of the present invention, various aromatic compounds or derivatives thereof, including salicylic acid, methyl salicylate, acetylsalicylic acid (aspirin), catechol, adipic acid, 1,6-hexanediol, 4-hydroxybenzoic acid (PHBA), 3-hydroxybenzoic acid (3HBA), 2,5-dihydroxybenzoic acid (gentisic acid), maleylpyruvic acid, maleic acid, fumaric acid, 4-aminobenzoic acid (PABA), 2-aminobenzoic acid (2ABA), L-tryptophan, tryptamine, aniline, L-tyrosine, phenol, cis,cis-muconic acid, and trans,trans-muconic acid, can be produced.

EXAMPLES

<Cell Line and Plasmid>

[0117] Cell lines and plasmids used in Examples are shown in Tables 1 and 2 below. For cloning a gene, E. coli NovaBlue competent cell (Novagen, Cambridge, Mass.) was used. It is noted that those shown with no supplier in these tables were produced by the present inventors.

TABLE-US-00013 TABLE 1 Cell line Genotype Supplier Nova Blue endA1 hsdR17(rK12-mK12+) supE44 thi-l Novagen gyrA96 relA1 lac recA1/F [proAB+ lacIq ZM15::Tn10(Tetr)]; used for gene cloning. ATCC31882 L-phenylalanine overexpressing strain ATCC CFT1 ATCC31882 ptsHI::P.sub.A1lacO-1-Glk-GalP CFT2 CFT1pykF CFT3 CFT2pykA CFT4 CFT3pheA CFT5 CFT4tyrA CFT00 ATCC31882 harboring pZE12MCS CFT01 ATCC31882 harboring pZE12ml CFT02 ATCC31882 harboring pZE12el CFT03 ATCC31882 harboring pZE12pl CFT04 ATCC31882 harboring pTrcBubiC CFT05 ATCC31882 harboring pZE12pabABC CFT06 ATCC31882 harboring pZA23tyrA.sup.fbr CFT061 CFT06 harboring pTrcBtpl CFT07 ATCC31882 harboring pZE12trpEG CFT08 ATCC31882 harboring pTrcBhyg5 CFT09 ATCC31882 harboring pZA23ml CFT091 CFT09 harboring pZE12nGcA CFT10 CFT1 harboring pZE12MCS CFT11 CFT1 harboring pZE12ml CFT30 CFT3 harboring pZE12MCS CFT31 CFT3 harboring pZE12ml CFT50 CFT5 harboring pZE12MCS CFT51 CFT5 harboring pZE12ml CFT54 CFT5 harboring pTrcBubiC CFT55 CFT5 harboring pZE12pabABC CFT56 CFT5 harboring pZA23tyrA.sup.fbr CFT561 CFT56 harboring pTrcBtpl CFT57 CFT5 harboring pZE12trpEG CFT58 CFT5 harboring pTrcBhyg5 CFT59 CFT5 harboring pZA23ml CFT591 CFT59 harboring pZE12nGcA CFMt1 CFT5 harboring pT2t01 CMtS09 CFMt1 harboring pS09 CMtS10 CFMt1 harboring pS10 CMtS091 CMtS09 harboring pA09 CMtS101 CMtS10 harboring pA09

TABLE-US-00014 TABLE 2 Plasmid Genotype Supplier pZE12MCS P.sub.LlacO1, colE ori, Amp.sup.r Expressys pTrcHis B P.sub.trc, pBR322 ori, Amp.sup.r Life technologies pZA23MCS P.sub.LlacO1, p15A ori, Km.sup.r Expressys pCFTdeltain P.sub.A1lacO-1, FRT-PGK-gb2-neo-FRT, ColE, Amp.sup.r pCFTdeltain-GG pCFTdeltain containing Glk and GalP from E. coli at the donstream of P.sub.A1lacO-1 pZE12l pZE12MCS containing pchB from P. aeruginosa pZE12ml pZE12MCS containing menF from E. coli and pchB from P. aeruginosa pZE12el pZE12MCS containing entC from E. coli and pchB from P. aeruginosa pZE12pl pZE12MCS containing pchA and pchB from P. aeruginosa pZE12pabAB pZE12MCS containing pabA and pabB from E. coli pZE12pabABC pZE12MCS containing pabA, pabB, and pabC from E. coli pZE12trpEG pZE12MCS containing trpE, and trpG from E. coli pZE12nahG pZE12MCS containing nahG.sup.opt from P. putida KT2440. pZE12nGcA pZE12nahG containing catA from P. putida DOT-T1E. pTrcBubiC pTrcHis B containing ubiC from E. coli pTrcBtpl pTrcHis B containing tpl from P. multocida pTrcBhyg5 pTrcHis B containing hyg5 from S. hygroscopicus. pZA23ml pZA23MCS containing menF from E. coli and pchB from P. aeruginosa pZA23tyrA.sup.fbr pZA23MCS containing tyrA.sup.fbr from E. coli pSAK P.sub.AlacO1, SC101 ori, Cm.sup.r pT2t01 pTrcHis B tandemly containing mps2, hbzF, hyg5, and 3hb6h pS09 pSAK containing hyg5 with Ptrc promoter pS10 pSAK tandemly containing hyg5 and 3hb6h with P.sub.trc promoter pA09 pZA23MCS containing hyg5 with Ptrc promoter

<PCR Primer>

[0118] The polymerase chain reaction (PCR) was carried out using KOD FX Neo (TOYOBO, Osaka, Japan) and primer pairs shown in Table 3. Each of the genes was assembled with a corresponding one of the plasmids using Gibson Assembly (New England Biolabs, Ipswich, Mass.). As the vector pCFTdeltain (FIG. 2), a commercially available product was obtained (Invitrogen, San Diego, Calif.).

TABLE-US-00015 TABLE3 Oligo- SEQ nucleotide ID primer Sequence NO. pchB_f 5-GTCGACGGTATCGATAAAGAGGAGAAAAAGCTTATGAAAACCCCTGAAGATTG-3 1 pchB_r 5-CAGGAATTCGATATCTAAATGATGATGATGATGATGGGCTGCACCACGGGTCTGAC-3 2 menF_r 5-ATTAAAGAGGAGAAAGGTACCATGCAATCACTTACTACGGC-3 3 menF_r 5-CTCGAGGGGGGGCCCTTACTTGTCATCGTCATCCTTGTAGTCTTCCATTTGTAATAAAGTAC-3 4 entC_f 5-ATTAAAGAGGAGAAAGGTACCATGGATACGTCACTGGCTGA-3 5 entC_4 5-CTCGAGGGGGGGCCCTTACTTGTCATCGTCATCCTTGTAGYCATGCAATCCAAAAACGTTCA-3 6 pchA_f 5-ATTAAAGAGGAGAAAGGTACCATGAGCCGTCTGGCACCGCT-3 7 pchA_r 5-CTCGAGGGGGGGCCCTTACTTGTCATCGTCATCCTTGTAGTCGGCAACACCACGCTGCAGAG-3 8 ubiC_f 5-GACGATGACGATAAGATGTCACACCCCGCGTTAAC-3 9 ubiC_r 5-TGCAGATCTCGAGCTTTAGTACAACGGTGACGCCGGTA-3 10 pabA_f 5-ATTAAAGAGGAGAAAGGTACCATGATCCTGCTTATAGATAACTACGATTCT-3 11 pabA_r 5-TTACTTGTCATCGTCATCCTTGTAGTCGCGATGCAGGAAATTAGCCA-3 12 pabB_f 5-GACGATGACAAGTAAAAAGAGGAGAAACTCGAGATGAAGACGTTATCTCCCGCTGTGATTACT-3 13 pabB_r 5-CTCGAGGGGGGGCCCTTAATGATGATGATGATGATGCTTCTCCAGTTGCTTCAGGATACGATTAAC-3 14 trpEG_f 5-ATTAAAGAGGAGAAAATGCAAACACAAAAACCGAC-3 15 trpEG_r 5-CTCGAGGGGGGGCCCTTACAGAATCGGTTGCAGCG-3 16 tpl_f 5-CATCATCATCATGGTATGAGAAACTATCCTGCAGAACCTT-3 17 tpl_r 5-TCTCGAGCTCGGATCTTACGCTTTCGGTTCAAAACGCGCC-3 18 hyg5_f 5-CATCATCATCATGGTATGCTGAATCCGAGCAGCCT-3 19 hyg5_r 5-TCTCGAGCTCGGATCTTACATCACAACACCTTCAA-3 20 pTrcB_inv_f 5-ACCATGATGATGATGATGAGAACC-3 21 pTrcB_inv_r 5-GATTCCGAGCTCGAGATCTGCAGCT-3 22 glk_NI_f 5-CAGGACGCACTGACCATGACAAAGTATGCATTAGTCGGTG-3 23 glk_NI_r 5-TCTTTATCGATACCGTCGACTTAATGATGATGATGATGATGCAGAATGTGACCTAAGGTCT-3 24 galP_NI_f 5-GTCGACGGTATCGATAAAGAGGAGAAAAAGCTTATGCCTGACGCTAAAAAACA-3 25 galP_NI_r 5-TGCCTCTAGCACGCGTTACTTGTCATCGTCATCCTTGTAGTCATCGTGAGCGCCTATTTCGC-3 26 delta-ptsHI_ 5-ATGTTCCAGCAAGAAGTTACCATTACCGCTCCGAACGGTCTGCACACCCGCCTAGGTCTAGGGCGGCGGATTTGT-3 27 NI_f delta-ptsHI_ 5-TTAGCAGATTGTTTTTTCTTCAATGAACTTGTTAACCAGCGTCATTAACTTAATACGACTCACTATAGGGCTCGA-3 28 NI_r delta-pykF_f 5-ATGAAAAAGACCAAAATTGTTTGCACCATCGGACCGAAAACCGAATCTGAAATTAACCCTCACTAAAGGGCG-3 29 delta-pykF_r 5-TTACAGGACTGAACAGATGCGGTGTTAGTAGTGCCGCTCGGTACCAGTGTAATACGACTCACTATAGGGCTC-3 30 delta-pykA_f 5-ATGTCCAGAAGGCTTCGCAGAACAAAAATCGTTACCACGTTAGGCCCAGCAATTAACCCTCACTAAAGGGCG-3 31 delta-pykA_r 5-TTACTCTACCGTTAAAATACGCGTGGTATTAGTAGAACCCACGGTACTCATAATACGACTCACTATAGGGCTC-3 32 delta-pheA_f 5-ATGACATCGGAAAACCCGTTACTGGCGCTGCGAGAGAAAATCAGCGCGCTAATTAACCCTCACTAAAGGGCG-3 33 delta-pheA_r 5-TCAGGTTGGATCAACAGGCACTACGTTCTCACTTGGGTAACAGCCCAATATAATACGACTCACTATAGGGCTC-3 34 delta-tyrA_r 5-AGCCGCTTTGGACTGCCTATTTATGTTCCGGAGCGCGAGGCATCTATGTTTAATACGACTCACTATAGGGCTC-3 35 3hb6h_f 5-ATCTGCAGCTGGTACTTAAAGAGGTATATAATGAGCAATCTGCAGGATGC-3 50 3hb6h_R 5-ATTCCCATATGGTACTTAGCTTGCACGATCGCTGC-3 51

<Culture Conditions>

[0119] For production of salicylic acid in a 5 mL test tube, an M9 minimal medium was used. The M9 minimal medium contains, per liter, 20 g of glucose, 0.5 g of NaCl, 17.1 g of Na.sub.2HPO.sub.4.12H.sub.2O, 3 g of KH.sub.2PO.sub.4, 2 g of NH.sub.4Cl, 246 mg of MgSO.sub.4.7H.sub.2O, 14.7 mg of CaCl.sub.2.2H.sub.2O, 2.78 mg of FeSO.sub.4.7H.sub.2O, 10 mg of thiamine hydrochloride, 40 mg of L-tyrosine and 40 mg of L-tryptophan (ATCC31882 exhibits L-tyrosine and L-tryptophan auxotrophy). As necessary, ampicillin, kanamycin and/or chloramphenicol were added to respective final concentrations of 100, 50, and 15 g/mL. In culturing a strain CFT5, L-phenylalanine was added to a final concentration of 100 mg/L. Besides, in pre-culturing strains CFT3 and CFT5, 0.2% sodium pyruvate was supplemented to the medium for promoting the growth. A pre-culture medium was inoculated in the M9 medium put in the 5 mL test tube at an initial optical density (OD.sub.600) of 0.05. The test tube culture was carried out at 37 C. with shaking at 180 rpm. The medium was first supplemented with 0.1 mM IPTG.

[0120] Production of PHBA, PABA, 2ABA, L-tyrosine, 3HBA, phenol, MA and maleic acid was carried out by 5 mL test tube culture. The production of PHBA and L-tyrosine was performed in an M9 medium supplemented with 0.1% sodium pyruvate, the production of 2ABA and maleic acid was performed in an M9Y medium supplemented with 0.5% yeast extract, and the production of PABA, 3HBA, phenol and muconic acid was performed in an M9Y medium supplemented with 0.1% sodium pyruvate and 0.5% yeast extract. Each of the pre-culture medium was inoculated in the medium put in a 5 mL test tube at an initial optical density (OD.sub.600) of 0.05. The test tube culture was carried out at 37 C. with shaking at 180 rpm.

[0121] Batch culture was carried out by a method usually employed in this field in consideration of the above-described culture conditions. The batch culture of salicylic acid will be more specifically described in Example 5 below.

<Analysis of Various Products>

[0122] Glucose concentration in a culture supernatant was measured using Glucose CII test Wako (Wako, Kyoto, Japan). In the case where sodium pyruvate was added, not only an amount of glucose consumed but also an amount of sodium pyruvate consumed was taken into consideration for evaluating the yield ([amount of compound generated]mol/[amounts of glucose and pyruvic acid consumed]mol %).

[0123] GC-MS was carried out using GCMS-QP2010 Ultra (Shimadzu, Kyoto, Japan) equipped with a CP-Sil 8 CB-MS capillary column (30 m0.25 mm0.25 m; Agilent). Helium was used as a carrier gas, and a flow rate of 2.1 ml/min was retained. An injection amount was set to 1 l (split ratio of 1:10).

[0124] The amounts of salicylic acid and muconic acid generated were quantitatively determined as follows. An initial temperature of an oven was set to and retained for 1 minute at 150 C., and the temperature was increased up to 240 C. at 12 C./min, further increased up to 300 C. at 120 C./min, and retained at 300 C. for 3 minutes. The total measurement time was set to 10 minutes. Other setting conditions were: an interface temperature of 250 C., an ion source temperature of 200 C., and an electron ionization voltage (EI) of 70 eV.

[0125] Dried salicylic acid and muconic acid were derivatized for analysis, in 50 L of N-methyl-N-trimethylsilyltrifluoroacetamide (MSTFA) and 20 L of pyridine at 80 C. for 60 minutes. Pimelic acid was used as an internal standard.

[0126] The amounts of PHBA, L-phenylalanine, and L-tyrosine generated were quantitatively determined as follows. An initial temperature of an oven was set to and retained for 5 minutes at 150 C., and the temperature was increased up to 300 C. at 10 C./min, and retained at 300 C. for 5 minutes. The total measurement time was set to 25 minutes. Other setting conditions were: an interface temperature of 250 C., an ion source temperature of 200 C., and an electron ionization voltage (EI) of 70 eV.

[0127] 4-Hydroxybenzoic acid, 4-aminobenzoic acid, L-phenylalanine, and L-tyrosine were derivatized for analysis, in 30 L of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide (MTBSTFA) and 30 L of N,N-dimethylformamide at 80 C. for 60 minutes. Cycloleucine was used as an internal standard.

[0128] Concentrations of 2ABA, PABA, 3HBA and phenol were measured by high-performance liquid chromatography (HPLC; Shimadzu, Kyoto, Japan) using a 5C.sub.18-AR-II column (Nacalai Tesque, Kyoto, Japan). Measurement conditions of 30 C. and a flow rate of 1.2 ml/min were employed. As a solvent system, phosphoric acid aqueous solution (50 mM, pH 2.5) was used as Solvent A, and acetonitrile was used as Solvent B. Concentration gradient was started from 70% Solvent A and 30% Solvent B, a 50:50 mixture of Solvents A and B was used from 3 min to 7 min, and a 70:30 mixture of Solvents A and B was subsequently used from 7 min to 10 min.

[0129] The concentrations of 2ABA, PABA and 3HBA were measured using a 254 nm UV absorbance detector (SPD-20AV, Shimadzu, Kyoto, Japan). For phenol, absorbance at 270 nm was detected. A culture supernatant was obtained by centrifuging a culture fluid at 21,880g for 20 minutes, and the resultant was used in the HPLC. As an internal standard for the measurement of 2ABA, PABA and 3HBA, benzoic acid was used, and for phenol, 2ABA was used.

[0130] Concentration of maleic acid was measured in the same manner as described above using a culture supernatant separated by centrifuging a culture fluid at 21,880g for 20 minutes. The culture supernatant was analyzed by the high-performance liquid chromatography (HPLC; Shimadzu, Kyoto, Japan) using a 5C.sub.18-PAQ column (Nacalai Tesque, Kyoto, Japan). A column was operated at 30 C., and a flow rate was set to 1.2 ml/min. As a solvent system, phosphoric acid aqueous solution (50 mM, pH 2.5) was used as Solvent A, and acetonitrile was used as Solvent B. Concentration gradient was started from 100% Solvent A (0 min to 3 min), Solvent A was gradually changed to a 50:50 mixture of Solvents A and B (3 min to 6 min), and the 50:50 mixture of Solvents A and B was maintained (6 min to 7 min), and was subsequently gradually changed to 100% Solvent A (7 min to 13 min). The concentration of a product was measured by detecting 210 nm UV absorbance (SPD-20AV, Shimadzu, Kyoto, Japan). Fumaric acid was used as an internal standard.

[Example 1] Production of Gene-Deletion Cell Line

[0131] For producing a chorismic acid derivative, attempts were made to transform E. coli. As a parent strain, L-phenylalanine overproducing strain (ATCC31882) of E. coli was used.

[0132] Gene fragments encoding GalP and Glk were amplified by the PCR using a genomic DNA of E. coli MG1655 (ATCC700926) as a template, and using glk_NI_f (SEQ ID NO:23) and glk_NI_r (SEQ ID NO:24), and galP_NI_f (SEQ ID NO:25) and galP_NI_r (SEQ ID NO:26) as respective primers. The amplified fragments were tandemly inserted into the HindIII and BamHI sites of the pCFTdeltain (FIG. 2). The obtained plasmid was designated as pCFTdeltain-GG.

[0133] A gene deletion operation was carried out using Quick & Easy E. coli Gene Deletion Kit (Funakoshi, Tokyo, Japan) according to a protocol provided in instructions thereof.

[0134] A fragment for disrupting ptsHI and introducing P.sub.allacO-1-Glk-Galp was obtained through amplification by PCR using pCFTdeltain-GG as a template, and using delta-ptsHI_NI_f (SEQ ID NO:27) and delta-ptsHI_NI_r (SEQ ID NO:28) as primers. Fragments for inactivating pykF, pykA and pheA genes were similarly obtained through amplification by PCR using the genomic DNA of E. coli MG1655 as a template, and primers shown in Table 3 (SEQ ID NOS:29 to 34).

[0135] A gene fragment for deletion and a recombinase were introduced into a cell by electroporation using Gene Pulser II (Bio-Rad Laboratories). Gene inactivated cell lines obtained based on the strain ATCC31882 are herein referred to as strains CFT1 to CFT5.

[0136] As shown in Table 1, the strain CFT1 has genes encoding Glk and GalP, and contains ptsHI deletion. Accordingly, in the strain CFT1, originally contained PTS is replaced by a system of a combination of galactose permease (GalP) and glucokinase (Glk).

[0137] The strain CFT2 lacks pykF in addition to the mutation in the strain CFT1. The strain CFT3 lacks pykA in addition to the mutation in the strain CFT2. Both pykF and pykA encode pyruvate kinase catalyzing a reaction for generating pyruvic acid from PEP with ADP as a coenzyme, and since both genes complementarily act in a cell of E. coli or the like, the reaction cannot be completely suppressed unless both of these genes are deleted. In the strain CFT3, two reaction pathways producing pyruvic acid are blocked.

[0138] The strain CFT4 lacks pheA in addition to the mutation in the strain CFT3. Accordingly, the strain CFT4 is modified such that not only the reaction producing pyruvic acid is deleted but also a phenylalanine synthesis reaction cannot be performed. The strain CFT5 lacks tyrA in addition to the mutation in the strain CFT4, and is modified such that a tyrosine synthesis reaction cannot be performed. The synthesis of phenylalanine can be completely suppressed, only when both genes are disrupted.

[Example 2] Production of Salicylic Acid Synthesizing Cell Line

[0139] The strain ATCC31882 was used for introducing genes encoding ICS and IPL to increase salicylic acid synthetic ability thereof. In this example, menF, entC and pchA were used as genes encoding ICS, and pchB was used as a gene encoding IPL.

[0140] As pchA and pchB gene fragments derived from P. aeruginosa, commercially available products (SEQ ID NOS:37 and 38, Invitrogen) were obtained, and codon usage of pchA and pchB was optimized for E. coli.

[0141] A gene fragment encoding pchB was amplified by PCR using a synthetic gene fragment resulting from codon optimization as a template, and using pchB_f (SEQ ID NO:1) and pchB_r (SEQ ID NO:2) as primers. The amplified fragment was inserted into the HindIII site of pZE12MCS (Expressys). The obtained plasmid was designated as pZE12I.

[0142] Gene fragments encoding menF and entC were respectively amplified by PCR using the genomic DNA of E. coli MG1655 as a template, and using menF_f (SEQ ID NO:3) and menF r (SEQ ID NO:4), and entC f (SEQ ID NO:5) and entC r (SEQ ID NO:6) as respective primers. Each of the amplified fragments was inserted into the KpnI site of the pZE12I containing the gene encoding pchB. The thus obtained plasmids were designated as pZE12mI and pZE12eI.

[0143] A gene fragment encoding pchA was amplified by PCR using the synthetic gene fragment resulting from codon optimization as a template, and using pchA_f (SEQ ID NO:7) and pchA_r (SEQ ID NO:8) as primers. The amplified fragment was inserted into the KpnI site of pZE12I containing the gene encoding pchB. The obtained plasmid was designated as pZE12pI.

[0144] A gene fragment encoding menF-pchB (fusion protein of menF and pchB) was amplified by PCR using pZE12mI as a template, and using menF_f (SEQ ID NO:3) and pchB_r (SEQ ID NO:2) as primers. The amplified fragment was inserted into the KpnI site of pZA23MCS (Expressys). The obtained plasmid was designated as pZA23mI.

[0145] Transformation of strains using each plasmid was carried out using Gene Pulser II (Bio-Rad, Hercules, Calif.). As necessary, 100 g/L ampicillin and 50 g/L kanamycin were added to the medium.

[0146] Transformants obtained by introducing the above-described plasmids pZE12mI, pZE12eI, pZE12pI and pZA23mI into the strain ATCC31882 were herein designated as strains CFT01, CFT02, CFT03, and CFT09, respectively. Each of these transformants was cultured in an M9 minimal medium containing glucose as a carbon source. IPTG was added to an initial medium (OD.sub.600=0.05).

[0147] The culture characteristics of the strain CFT01 are shown in FIG. 3. The amounts of salicylic acid and L-phenylalanine generated by the strain CFT01 having menF and pchB were as large as 210 and 350 mg/L, respectively, and thus, salicylic acid could be produced using glucose as an only carbon source. These amount values were larger than those obtained in the strains CFT02, CFT03 and CFT09. Accordingly, it was determined that menF was to be used as the gene encoding ICS in the subsequent experiments.

[Example 3] Introduction of Salicylic Acid Biosynthetic Pathway

[0148] Each plasmid produced in Example 2 was introduced into the mutant strains produced in Example 1 instead of the strain ATCC31882 for examining salicylic acid generation ability.

[0149] pZE12mI was introduced into the strain CFT1 having genes encoding Glk and GalP and containing ptsHI deletion so as to produce a strain capable of expressing menF and pchB. The obtained strain is herein designated as a strain CFT11.

[0150] The strain CFT11 was cultured for evaluation in an M9 minimal medium containing glucose as an only carbon source, in the same manner as the strain CFT01. The culture characteristics of the strain CFT11 are illustrated in FIG. 3. The amounts of salicylic acid and L-phenylalanine generated were as large as 311 and 358 mg/L, respectively. Although the productivity of salicylic acid was increased by 1.5 times as compared with that in the strain CFT01, the productivity of L-phenylalanine was substantially the same.

[0151] Next, the pZE12mI was introduced into the strain CFT3 containing both pykF and pykA deletion in addition to the mutation in the strain CFT1 so as to produce a strain capable of expressing menF and pchB. The obtained strain is herein designated as a strain CFT31.

[0152] The strain CFT31 was cultured in an M9 minimal medium containing glucose as an only carbon source, and as a result, the amounts of salicylic acid and L-phenylalanine generated were as large as 603 and 694 mg/L, respectively, as illustrated in FIG. 3. As shown in FIGS. 3(A) and 3(B), the cell growth and the glucose consumption rate of the strain CFT31 tended to be slightly lower than those of the strains CFT01 and CFT11, but the amount of salicylic acid generated in the strain CFT31 was larger than those in the other strains.

[Example 4] Inactivation of L-Phenylalanine Production Ability

[0153] The pZE12mI was introduced into the strain CFT5 containing pheA and tyrA deletion in addition to the mutation in the strain CFT3 so as to produce a strain capable of expressing menF and pchB. The obtained strain is herein designated as a strain CFT51.

[0154] The strain CFT51 was cultured in an M9 minimal medium containing glucose as an only carbon source. FIG. 4 illustrates the culture characteristics of the strain CFT51. As a result, the amount of salicylic acid generated was as large as 1,480 mg/L (about 1.5 g/L) after the culture for 48 hours. This amount value was increased by about 7.5 times as compared with that of the strain CFT01, which is capable of expressing menF and pchB but not subjected to the operation for blocking other pathways. On the other hand, generation of L-phenylalanine was not observed (data is now shown).

[0155] In order to examine the amount of byproducts generated except for salicylic acid and L-phenylalanine in each of the produced cell lines, amounts of major byproducts of E. coli culture, organic acids in a culture supernatant, were measured (Table 4).

TABLE-US-00016 TABLE 4 Amount of organic acids generated (mM) Strain Time (h) Pyruvic acid Lactic acid Formic acid Acetic acid Malic acid CFT01 24 9.26 0.45 4.93 0.87 0.19 0.04 18.49 0.5 ND 96 9.22 0.74 6.06 0.97 0.23 0.02 19.51 0.48 ND CFT11 24 5.93 1.32 1.12 0.08 0 23.27 3.8 ND 96 4.58 0.92 0.37 0.00 0.06 0.1 30.6 3.31 ND CFT31 24 ND ND ND ND ND 96 ND ND 1.02 0.15 6.7 0.24 1.06 0.06 CFT51 24 ND ND ND ND ND 96 ND 0.28 0.19 0.30 0.05 7.4 0.51 0.32 0.04

[0156] As shown in Table 4, acetic acid and pyruvic acid were principally generated in the strains CFT01 and CFT11, and the amounts of generated acetic acid were as large as 19.5 and 30.6 mM (1.17 and 1.84 g/L), respectively. On the other hand, although a small amount of acetic acid was generated in the strains CFT31 and CFT51, no pyruvic acid was accumulated in the culture supernatants, and the generation of pyruvic acid was reduced due to disruption of the reaction converting PEP into pyruvic acid. A total amount of organic acids generated in each of the strains CFT31 and CFT51 was less than 8.5 mM, and was dramatically reduced as compared with that in the strains CFT01 and CFT11.

[0157] Based on the above results, it is presumed, that the production of the byproduct organic acids is suppressed in the strains CFT31 and CFT51, and glucose is efficiently converted into salicylic acid. This is probably because pyruvic acid is mildly supplied due to the inactivation of pykF and pykA, and because the production of organic acids such as lactic acid and acetic acid derived from pyruvic acid is reduced.

[0158] FIG. 5 illustrates yields in the generation of salicylic acid from glucose and salicylic acid production ability per OD.sub.600 in the strains CFT01, CFT11, CFT31 and CFT51. The yield of salicylic acid and the production ability per OD.sub.600 in the strain CFT51 are increased by 6.2 times and 7.6 times, respectively, as compared with those in the strain CFT01, and thus, it was proved that the productivity of salicylic acid was dramatically increased.

[Example 5] Production of Salicylic Acid by Batch Culture

[0159] The obtained cell lines were used for producing salicylic acid by mass culture.

[0160] Batch culture was carried out in a 2.0 L jar fermenter (working volume of 400 mL). For production of salicylic acid in the jar fermenter, an M9Y medium consisting of an M9 medium containing 0.4% yeast extract was used. 4 mL of a pre-culture medium was put in the jar fermenter having been charged with 400 mL of the medium. In order to maintain the pH at 7.0 during the culture, NH.sub.4OH was automatically added. Dissolved oxygen (DO) concentration was retained at 3.0 ppm or higher by automatically controlling the stirring speed and supplying oxygen at 37 C. The initial glucose concentration was 40 g/L. After the culture for 5 hours, 0.1 mM IPTG was supplemented to the medium.

[0161] FIG. 6 illustrates culture characteristics of the strains CFT01 and CFT51. The cell growth and the glucose consumption rate in the strain CFT51 were improved as compared with those in the strain CFT01 (FIGS. 6(A), 6(B), 6(D) and 6(E)). After the culture for 48 hours, the amount of salicylic acid generated in the strain CFT01 was as small as 0.9 g/L, but the amount of salicylic acid generated in the strain CFT51 was as large as about 11 g/L (FIGS. 6(C) and 6(F)).

[0162] The productivity beyond 10 g/L in the strain CFT51 is at the world's highest level (14 times as high as that of the original strain) in an aromatic compound production test performed by batch culture using E. coli. The production of salicylic acid using glucose as an only carbon source has not been reported, and the production amount was higher than the past reported production amount using glucose and glycerol as carbon sources.

[Example 6] Generation Promotion of 4-Hydroxybenzoic Acid

[0163] It was presumed that chorismic acid is accumulated in a cell in the strain CFT5 corresponding to the parent strain of the strain CFT51. Accordingly, the present inventors next attempted to produce another chorismic acid derivative based on the strain CFT5, and could verify the versatility of this strain, and construct a platform for producing aromatic compounds.

[0164] First, generation of a structural isomer of salicylic acid, 4-hydroxybenzoic acid (PHBA), was examined. In order to enable PHBA to be generated from chorismic acid, a gene (SEQ ID NO:39, ubiC) encoding chorismate pyruvate lyase (EC 4.1.3.40) derived from E. coli was introduced.

[0165] A gene fragment encoding ubiC was amplified by the PCR using the genomic DNA of E. coli MG1655 as a template, and using ubiC_f (SEQ ID NO:9) and ubiC_r (SEQ ID NO:10) as primers. The amplified fragment was inserted into the BamHI site of pTrcHis B (Life Technologies Corporation). The obtained plasmid was designated as pTrcBubiC. The plasmid pTrcBubiC was introduced into the strain CFT5 produced in Example 1 to produce a strain CFT54.

[0166] FIG. 8(A) illustrates the amount and the yield of PHBA generated in a culture of the strain CFT54. The amount of PHBA generated in the strain CFT54 was as large as 1,820 mg/L after the culture for 96 hours. The yield of PHBA was increased by 15.8 times as compared with that in a strain CFT04, that is, a control strain obtained by introducing pTrcBubiC into the strain ATCC31882.

[Example 7] Generation Promotion of 3-Hydroxybenzoic Acid

[0167] In the same manner as in Example 6, generation of a structural isomer of salicylic acid, 3-hydroxybenzoic acid (3HBA), was examined. In order to enable 3HBA to be generated from chorismic acid, a gene (SEQ ID NO:40, Hyg5) encoding 3-hydroxybenzoate synthase (EC 4.1.3.45) derived from S. hygroscopicus was introduced.

[0168] A gene fragment encoding hyg5 was amplified by PCR using a synthetic gene fragment as a template, and using hyg5_f (SEQ ID NO:19) and hyg5 r (SEQ ID NO:20) as primers. The resultant gene fragment was assembled together with a fragment of pTrcHis B (Life Technologies Corporation) using Gibson Assembly (New England BioLabs, Inc.). The obtained plasmid was designated as pTrcBhyg5. The plasmid pTrcBhyg5 was introduced into the strain CFT5 produced in Example 1 to produce a strain CFT58.

[0169] FIG. 8(B) illustrates the amount and the yield of 3HBA generated in a culture of the strain CFT58. The amount of 3HBA generated in the strain CFT58 was as large as 2,180 mg/L after the culture for 72 hours. The yield of 3HBA was increased by 310 times as compared with that in a strain CFT08, that is a control strain obtained by introducing pTrcBhyg5 into the strain ATCC31882.

[Example 8] Generation Promotion of 4-Aminobenzoic Acid

[0170] Generation of 4-aminobenzoic acid (PABA) was examined using the cell line of the present invention. In order to produce PABA from chorismic acid, aminodeoxychorismate synthase (EC 2.6.1.85) and 4-amino-4-deoxychorismate lyase (EC 4.1.3.38) (PabA, PabB and PabC) derived from E. coli were used.

[0171] Gene fragments encoding pabA and pabB were amplified by the PCR using the genomic DNA of E. coli MG1655 as a template, and using pabA_f (SEQ ID NO:11) and pabA_r (SEQ ID NO:12), and pabB_f (SEQ ID NO:13) and pabB r (SEQ ID NO:14) as respective primers. The thus amplified fragments were tandemly inserted into the KpnI site of pZE12MCS (Expressys). The obtained plasmid was designated as pZE12pabAB. A gene fragment of pabC derived from E. coli was purchased from Invitrogen (SEQ ID NO:42). This gene fragment was directly inserted into the PstI site of pZE12pabAB. The obtained plasmid was designated as pZE12pabABC. The plasmid pZE12pabABC was introduced into the strain CFT5 produced in Example 1 to produce a strain CFT55.

[0172] FIG. 8(C) illustrates the amount and the yield of PABA generated in a culture of the strain CFT55. The amount of PABA generated after the culture for 48 hours was 2,880 mg/L. The yield of PABA was increased by 32.1 times as compared with that in a strain CFT05, that is, a control strain obtained by introducing pZE12pabABC into the strain ATCC31882.

[Example 9] Generation Promotion of 2-Aminobenzoic Acid

[0173] Generation of 2-aminobenzoic acid (2ABA) in the cell lines of the present invention was examined. In order to produce 2ABA from chorismic acid, a part of L-tryptophan biosynthetic pathway of E. coli can be used, and genes (trpE and trpG) encoding anthranilate synthase (EC 4.1.3.27) derived from E. coli were introduced.

[0174] A gene fragment encoding trpEG was amplified by the PCR using the genomic DNA of E. coli MG1655 as a template, and using trpEG_f (SEQ ID NO:15) and trpEG_r (SEQ ID NO:16) as primers. The amplified fragment was inserted into the KpnI site of the pZE12MCS (Expressys). The obtained plasmid was designated as pZE12trpEG. The plasmid pZE12trpEG was introduced into the strain CFT5 produced in Example 1 to produce a strain CFT57.

[0175] FIG. 8(D) illustrates the amount and the yield of 2ABA generated in a culture of the strain CFT57. The amount of 2ABA generated after the culture for 48 hours was 1,830 mg/L. The yield of 2ABA was increased by 46.5 times as compared with that in a strain CFT07, that is a control strain obtained by introducing pZE12trpEG into the strain ATCC31882.

[Example 10] Generation Promotion of L-Tyrosine

[0176] The strain CFT5 was used for producing an E. coli strain capable of producing L-tyrosine. In order to produce L-tyrosine from chorismic acid, a gene (SEQ ID NO:43, tyrA.sup.fbr) encoding chorismate mutase/prephenate dehydratase (EC 5.4.99.5 and EC 4.2.1.51) derived from E. coli was introduced.

[0177] As a gene fragment of tyrA.sup.fbr derived from E. coli, a commercially available product was obtained (Invitrogen). The gene fragment was directly inserted into the KpnI site of the pZA23MCS (Expressys). The obtained plasmid was designated as pZA23tyrA.sup.fbr. The plasmid pZA23tyrA.sup.fbr was introduced into the strain CFT5 produced in Example 1 to produce a strain CFT56.

[0178] FIG. 8(E) illustrates the amount and the yield of L-tyrosine generated in a culture of the strain CFT56. The amount of L-tyrosine generated was as large as 1,620 mg/L after the culture for 96 hours, and the yield was increased by 10.8 times as compared with that in a strain CFT06, that is a control strain obtained by introducing pZA23tyrA.sup.fbr into the strain ATCC31882.

[Example 11] Generation Promotion of Phenol

[0179] The L-tyrosine overproducing strain obtained in Example 10 was used for producing a strain producing phenol that can be synthesized from L-tyrosine by tyrosine phenol lyase (TPL) [EC 4.1.99.2].

[0180] A gene fragment encoding tpl was amplified by PCR using a gene fragment synthesized based on a gene sequence (SEQ ID NO:44, tpl) encoding TPL derived from Pasteurella multocida as a template, and using tpl_f (SEQ ID NO:17) and tpl_r (SEQ ID NO. 18) as primers. A gene fragment of pTrcHis B was also amplified by PCR using pTrcHis B (Life Technologies Corporation) as a template, and using pTrc_inv_f (SEQ ID NO:21) and pTrc_inv_r (SEQ ID NO:22) as primers. These fragments were assembled using Gibson Assembly (New England BioLabs, Inc.). The obtained plasmid was designated as pTrcBtpl. The plasmid pTrcBtpl was introduced into the strain CFT56 produced in Example 10 to produce a strain CFT561.

[0181] FIG. 8(F) illustrates the amount and the yield of phenol generated in a culture of the strain CFT561. The amount of phenol generated was as large as 1,100 mg/L after the culture for 96 hours, and remarkably higher phenol generation ability than that of a strain CFT061, that is a control strain obtained by introducing pTrcBtpl into the strain CFT06, was exhibited.

[Example 12] Generation Promotion of Muconic Acid

[0182] Muconic acid can be generated from salicylic acid through a reaction catalyzed by salicylate 1-monooxygenase (SMO) and catechol 1,2-dioxygenase (CDO) (FIG. 7).

[0183] As gene fragments of SMO (SEQ ID NO:45, nahG.sup.opt) derived from Pseudomonas putida KT2440 and CDO (SEQ ID NO:46, catA) derived from Pseudomonas putida DOT-T1E, commercially available products (Invitrogen) were used. The gene fragment of nahG.sup.opt was directly inserted into the KpnI site of pZE12MCS (Expressys), and the resultant was designated as pZE12nahG. Subsequently, the gene fragment of catA was inserted into the HindIII site of pZE12nahG. The obtained plasmid was designated as pZE12nGcA. The plasmid pZE12nGcA was introduced, together with pZA23mI, into the strain CFT5 to produce a strain CFT591.

[0184] After the culture for 96 hours, the amount of muconic acid generated from glucose used as an only carbon source was as large as 830 mg/L in a culture of the strain CFT591, and remarkably higher muconic acid generation ability was exhibited, than that of a strain CFT091, that is a control strain obtained by introducing pZE12nGcA into the strain CFT09 produced in Example 2.

[Example 13] Generation Promotion of Maleic Acid

[0185] The cell line of the present invention was used to produce a strain generating maleic acid from chorismic acid via 3-hydroxybenzoic acid, gentisic acid and maleylpyruvic acid (FIG. 9).

[0186] Into the strain CFT5 produced in Example 1, a gene encoding 3-hydroxybenzoate synthase, a gene encoding 3-hydroxybenzoate 6-hydroxylase, a gene encoding gentisate-1,2-dioxygenase, and a gene encoding maleylpyruvate hydrolase were introduced.

[0187] As gene fragments of hyg5 (SEQ ID NO:40) derived from S. hygroscopicus, 3hb6h (SEQ ID NO:47) derived from Rhodococcus jostii RHA1, mps2 (SEQ ID NO:48) derived from Rhodococcus sp. NCIMB 12038, and hbzF (SEQ ID NO:49) derived from Pseudomonas alcaligenes NCIMB 9867, used in this example, commercially available products (Invitrogen) were used.

[0188] A gene fragment encoding 3H6H was amplified by PCR using the above-described 3hb6h gene fragment as a template, and using 3hb6h_f (SEQ ID NO:50) and 3hb6h r (SEQ ID NO:51) as primers. Similarly, mps2 gene fragment and hbzF gene fragment were respectively used to amplify a gene fragment encoding GDO and a gene fragment encoding MPH.

[0189] The amplified mps2, hbzF, hyg5 and 3hb6h gene fragments were tandemly inserted into pTrcHisB (Life Technologies Corporation), and the obtained plasmid was designated as pT2t01. The plasmid pT2t01 was introduced into the strain CFT5 produced in Example 1 to produce a strain CFMt1. As a result, although the generation of maleic acid was not found in the strain CFT5 without introducing the gene, the amount of maleic acid generated in the strain CFMt1 was as large as 1,210 mg/L after the culture for 144 hours, and it was confirmed that the amount of maleic acid generated was remarkably increased.

[0190] Next, in order to obtain a cell line having further improved maleic acid generation ability, further gene introduction was examined. Two plasmids pS09 and pA09 each containing the hyg5 gene fragment together with a Ptrc promoter, and a plasmid pS10 containing the hyg5 and 3hb6h gene fragments together with a Ptrc promoter were respectively produced (see Table 2). Each of the plasmids pS09 and pS10 was introduced into the above-described strain CFMt1 to produce strains CMtS09 and CMtS10, respectively. Further, the plasmid pA09 was introduced into each of the strains CMtS09 and CMtS10 to produce strains CMtS091 and CMtS101 (see Table 1).

[0191] FIG. 10 illustrates the amounts of maleic acid generated in cultures of the strains CMtS09 and CMtS10, and FIG. 11 illustrates the amounts of maleic acid generated in cultures of the strains CMtS091 and CMtS101. As illustrated, these cell lines have much higher maleic acid generation ability than the strain CFMt1, and the amount of maleic acid generated was as large as 2,000 mg/L after the culture of the strain CFMtS101 for 72 hours (FIG. 11(D)). Although generation of 3-hydroxybenzoic acid and gentisic acid was also found in these cell lines, generation of maleylpyruvic acid was little, suggesting rapid conversion into maleic acid in the cell lines used.

INDUSTRIAL APPLICABILITY

[0192] The present invention provides various microorganisms having sugar metabolic pathways modified. By increasing the availability of PEP in a cell of microorganisms and blocking the flow of a carbon source to L-phenylalanine and L-tyrosine, the amount and the yield of salicylic acid generated from a carbon source such as glucose can be largely increased. Besides, a microorganism of the present invention can be used to produce various aromatic compounds derived from chorismic acid. The present invention can also provide a platform cell line to be used for synthesizing an aromatic compound. According to the present invention, various aromatic compounds can be obtained with high productivity using microorganisms with glucose, that is a major component of biomass, used as a carbon source.

[0193] All the publications, patents and patent applications cited herein are hereby incorporated by reference.