COMPOSITIONS AND METHODS FOR REGULATION OF GENE EXPRESSION WITH, AND DETECTION OF, FOLINIC ACID AND FOLATES
20180237781 ยท 2018-08-23
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
International classification
Abstract
Aptamers that specifically bind to ligands of folinic acid, a folate, and derivatives thereof (which may be referred to herein as ligands) are provided, and compositions and methods of use thereof. The aptamers and switches of the invention provide biological sensing capability for detecting the ligands, and are effective in sensing in vitro and in vivo. By specific sensing of the ligand, the aptamers of the invention provide a means of engineering an inducible gene regulatory system that enables dose-dependent control over gene expression in response to the ligand, in vivo and in vitro.
Claims
1. An aptamer that specifically binds to a ligand of folinic acid, a folate, or a derivative thereof.
2. The aptamer of claim 1, wherein the aptamer is an RNA of up to 80 nucleotides in length.
3. The aptamer of claim 1, wherein the aptamer is an RNA of from 15 to 80 nucleotides in length.
4. The aptamer of claim 1, wherein the ligand is selected from (6S)-folinic acid; (6R)-folinic acid; a diastereomeric mixture of (6R)- and (6S)-folinic acid; tetrahydrofolic acid; (6R)-tetrahydrobiopterin; folic acid; dihydrofolic acid; 5-formiminotetrahydrofolate; 10-formyltetrahydrofolate; 5,10-methenyltetrahydrofolate; 5,10-methylenetetrahydrofolate; levomefolic acid; technetium (99mTc) etarfolatide; tetrahydrofolic acid; vintafolide; methotrexate; pemetrexed; tetrahydrofolic acid; (6R)-tetrahydrobiopterin; (6R,S)-5-methyl-5,6,7,8-tetrahydrofolic acid; (6R)-5-methyl-5,6,7,8-tetrahydrofolic acid; (6S)-5-methyl-5,6,7,8-tetrahydrofolic acid; (6R,S)-5-formyl-5,6,7,8-tetrahydropteroic acid; (6R)-5-formyl-5,6,7,8-tetrahydropteroic acid; (6S)-5-formyl-5,6,7,8-tetrahydropteroic acid; a tagged derivative thereof; and any combination thereof.
5. The aptamer of claim 1, wherein the ligand is selected from (6S)-folinic acid; (6R)-folinic acid; a diastereomeric mixture of (6R)- and (6S)-folinic acid; and a tagged derivative thereof.
6. The aptamer of claim 1, wherein the aptamer comprises a nucleotide sequence set forth in any one of
7-10. (canceled)
11. The aptamer of claim 6, wherein the aptamer comprises a truncated sequence or a sequence having at least 90% identity to the truncated sequence.
12. The aptamer of claim 1, which specifically binds (6R)-folinic acid and comprises a sequence having at least 70% identity sequence to FAt8-4, FAt8-11, FAt8-3, FAt6-8, or FAt8-16.
13. The aptamer of claim 1, which specifically binds (6S)-folinic acid and comprises a sequence having at least 70% identity sequence to FAt8-18, FAt10-7, or FAt8-14.
14. The aptamer of claim 1, comprising a sequence selected from: TABLE-US-00013 (i) N.sub.1N.sub.2GN.sub.3UGCGUGGUACGUUAUAUUCCGN.sub.4N.sub.5, where N.sub.1 and N.sub.5 are any complementary pair of nucleotides; N.sub.2 and N.sub.4 are any complementary pair of nucleotides; and N3 is any nucleotide; TABLE-US-00014 (ii) N.sub.1N.sub.2UGCN.sub.3UGGUACGUUAUAUUCRGN.sub.4N.sub.5, where N.sub.1 and N.sub.5 are any complementary pair of nucleotides; N.sub.2 and N.sub.4 are any complementary pair of nucleotides; N.sub.3 is any nucleotide; and R is an A or G nucleotide; TABLE-US-00015 (iii) CGUCUGGUCACGACCN.sub.1N.sub.2-N.sub.3N.sub.4CCCUCGAAAUCACGAG GGRGACRAGAY, where N.sub.1 and N.sub.4 are any complementary pair of nucleotides; N.sub.2 and N.sub.3 are any complementary pair of nucleotides; R is an A or G nucleotide; Y is a C or U nucleotide; and the dash indicates any intervening sequence of nucleotides or two separate nucleotide strands; and TABLE-US-00016 (iv) N.sub.1N.sub.2GGCGAAGAGUCAAAGCAUCCCCN.sub.3-N.sub.4GGGCCCN.sub.5N.sub.6, where N.sub.1 and N.sub.6 are any complementary pair of nucleotides; N.sub.2 and N.sub.5 are any complementary pair of nucleotides; N.sub.3 and N.sub.4 are any complementary pair of nucleotides; and the dash indicates any intervening sequence of nucleotides or two separate nucleotide strands.
15-17. (canceled)
18. The aptamer of claim 1, wherein the aptamer specifically binds to a ligand with a K.sub.D of up to 300 nM.
19. The aptamer of claim 1, operably linked to an actuator to generate an aptamer-regulated device.
20. The aptamer-regulated device of claim 19, wherein the actuator is a ribozyme.
21. The aptamer-regulated device of claim 20, wherein the ribozyme is a hammerhead ribozyme.
22. The aptamer-regulated device of claim 20, wherein, comprising a sequence set forth in Table 5.
23. The aptamer-regulated device of claim 19, wherein the actuator is selected from microRNAs, antisense RNAs, RNAi, CRISPR, splicing, small RNAs, ribosome binding sites, internal ribosome entry sites, aptamers, and any combination thereof.
24. An aptamer-regulated device, the device comprising an aptamer operably linked to an actuator, wherein the actuator is a hammerhead ribozyme and the aptamer and stem III of the hammerhead ribozyme comprise one or more shared base pairs.
25-26. (canceled)
27. The aptamer-regulated device claim 24, wherein the aptamer-regulated device comprises a hammerhead ribozyme intervening sequence of nucleotides within the aptamer sequence.
28-29. (canceled)
30. A DNA sequence encoding an aptamer or aptamer-regulated device according to claim 1.
31-33. (canceled)
34. A method of regulating gene expression or RNA expression in a cell, the method comprising introducing into the cell an aptamer-regulated device, or vector encoding the device according to claim 24, under conditions where an actuator acts on a genetic sequence of interest expressed by the cell; and providing the cell with a ligand of the aptamer to regulate gene expression.
35-52. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. It is emphasized that, according to common practice, the various features of the drawings are not to-scale. On the contrary, the dimensions of the various features are arbitrarily expanded or reduced for clarity. Included in the drawings are the following figures.
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
DETAILED DESCRIPTION OF THE INVENTION
[0054] Engineered biological systems hold promise in addressing pressing human needs in chemical processing, energy production, materials construction, and maintenance and enhancement of human health and the environment. However, significant advancements in the ability to engineer biological systems have been limited by the foundational tools available for reporting on, responding to, and controlling intracellular components in living systems. In particular, sensors that respond to clinically useful ligands in vivo are needed.
[0055] The present invention provides an aptamer-regulated framework for engineering ligand-controlled gene-regulatory systems. An aptamer of the invention is provided as a stand-alone entity, in a device coupled to an actuator, or in a device coupled to a transmitter component and an actuator, which actuator includes without limitation ribozymes, miRNA, etc. A variety of modes of standardized information transmission between the ligand, aptamer and actuator can be employed. For example, these switch platforms may be applied to the construction of transgenic regulatory control systems that are responsive to folinic acid, a folate, or derivatives thereof. In regulating sets of functional proteins, these switches can act to rewire information flow through cellular networks and reprogram cellular behavior in response to changes in the ligand concentration. In regulating reporter proteins, the aptamer-regulated devices can serve as synthetic cellular sensors to monitor temporal and spatial fluctuations in ligand levels. Due to their general applicability, these platforms offer broad utility for applications in synthetic biology, biotechnology, and health and medicine.
[0056] The limited set of available aptamers with validated function in vivo is dominated by only a few ligands and is an acute bottleneck in preventing the wider application of RNA-based control devices. In contrast are numerous approaches for constructing synthetic regulatory switches from existing aptamers, including rational design, in vitro selection, genetic screens and selections, fluorescence-activated cell sorting (FACS), cell motility, and in silico computational approaches, and the diversity of regulatory mechanisms available such as transcription, splicing, RNA stability, RNA interference, translation, and post-translational activity.
[0057] De novo generation of RNA aptamer sensors through in vitro selection processes is a particularly powerful approach for constructing novel inducible gene expression systems but has remained a considerable challenge. Likely reasons so few in vitro selected aptamers have validated function in regulatory switches in vivo are that in vitro selected components often exhibit reduced activity when transferred to an intracellular environment and that aptamers must be amenable to physical integration into a regulatory platform, without compromising their binding activity. In vivo usage presents additional challenges as it requires high aptamer affinity and specificity, low ligand toxicity, sufficient ligand solubility and membrane permeability for exogenously supplied ligands, minimal ligand metabolism or degradation, lack of interference from intracellular molecules and RNAs, and functional aptamer binding at physiological conditions (e.g., temperature, pH, and salt concentrations, particularly Mg.sup.2+ levels). These difficulties have resulted in only a handful of in vitro selected aptamers being consistently used and successfully incorporated into cellular gene-regulatory devices, even with the abundance of regulatory switch platforms developed.
[0058] Riboswitches and devices are described in, for example, U.S. Pat. Nos. 8,603,996; 8,604,176; and 8,772,464, each herein specifically incorporated by reference.
Definitions
[0059] Folinic acid, folates, and derivatives thereof. The aptamers of the present invention are responsive to folinic acid and related compounds as ligands. Shown in
[0060] Folates include, without limitation, derivatives with altered specific functionalities of folinic acid, which is composed of pterin, para-aminobenzoate, glutamate, and formyl moieties (
[0061] For screening and monitoring purposes, the chemical functional groups present within folinic acid are amenable for covalent coupling, e.g. to columns, reporter molecules, radioactive labels, and the like. Since the glutamate moiety of folinic acid is not necessary for ligand binding, tagged derivatives of folinic acid can be synthesized, using the glutamate residue of folinic acid or the benzoic acid of 5-formyl-5,6,7,8-tetrahydropteoric acid as a chemical handle to couple a cargo such as a fluorophore tag. The availability of diverse folate analogues can also be mined to test the effect of different oxidation states of the carbon atoms in the 5, 6, 7, or 8 positions or ligand conformation through derivatives that bridge the 5 and 10 nitrogens.
[0062] Ligand: Ligand or analyte or grammatical equivalents herein is meant to refer to any folinic acid, folate, or derivative thereof, including tagged derivatives, to be detected and that can interact with an aptamer of the invention.
[0063] The terms nucleic acid molecule and polynucleotide refer to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The term RNA (such as the RNA comprising one or more aptamers) refers to ribonucleic acid, preferably in single-stranded form. Unless specifically limited, the terms encompass nucleic acids/RNAs containing known analogues of natural nucleotides which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. The terms may also encompass nucleic acids/RNAs containing chemical modifications, such as modifications at the base moiety, sugar moiety, and/or phosphate backbone, that tend to increase stability or half-life of the molecules in vivo. For example, these molecules may have naturally occurring phosphodiester linkages, as well as those having non-naturally occurring linkages, e.g., for stabilization purposes, or for enhancing hydrophobic interaction with protein ligands. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, expression vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a detectable label.
[0064] Aptamer. As used herein, the terms aptamer(s) or aptamer sequence(s) are meant to refer to single stranded nucleic acids (RNA or DNA) whose distinct nucleotide sequence determines the folding of the molecule into a unique three dimensional structure, allowing it to bind to a ligand of the invention at a high affinity. Aptamers comprising 15 to 120 nucleotides can be selected from a pool of oligonucleotides. It will be understood by one of skill in the art that an aptamer sequence can be encoded and expressed from an expression construct, using vectors and promoters known in the art.
[0065] Aptamers have specific binding regions which are capable of binding the ligand in an environment wherein other substances in the same environment are not bound to the nucleic acid. The specificity of the binding is defined in terms of the comparative dissociation constants (K.sub.d) of the aptamer for its ligand as compared to the dissociation constant of the aptamer for other materials in the environment or unrelated molecules in general. A ligand is one which binds to the aptamer with greater affinity than to unrelated material. Typically, the K.sub.d for the aptamer with respect to its ligand will be at least about 10-fold less than the K.sub.d for the aptamer with unrelated material or accompanying material in the environment. Even more preferably, the K.sub.d will be at least about 50-fold less, more preferably at least about 100-fold less, and most preferably at least about 200-fold less. An aptamer will typically be between about 10 and about 100 nucleotides in length. More commonly, an aptamer will be between about 15 and about 50 nucleotides in length, and truncated aptamer binding moieties disclosed herein are typically from about 15-75 nucleotides in length, and may be about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or 85 nt. in length.
[0066] Although not necessary, an aptamer may include at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxytriethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil; beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Exemplary modified sugar moiety may be selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose. Exemplary modified ribose sugar moiety may be selected from the group including but not limited to 2-fluoro, 2-O-methyl, and 2-O-alkyl. Exemplary neutral peptide-like backbone modification include: peptide nucleic acid (PNA) (see, e.g., in Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93:14670 and in Eglom et al. (1993) Nature 365:566), locked nucleic acid (LNA), bridged nucleic acid (BNA), or modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
[0067] The aptamer of the invention can be comprised entirely of RNA. In other embodiments of the invention, however, the aptamer can instead be comprised entirely of DNA, or partially of DNA, or partially of other nucleotide analogs. Such aptamer RNAs may be introduced into a cell as a DNA that encodes the aptamer such that transcription results in the aptamer-regulated RNA. Alternatively, an aptamer-regulated RNA itself can be introduced into a cell.
[0068] High affinity aptamers useful in the invention include those set forth in
[0069] Aptamers of the invention can comprise a degenerate sequence, and can further comprise fixed sequences flanking the degenerate sequence. Within the truncated sequence, certain residues are required for binding, while others can be mutated, as shown in
[0070] Exemplary is the truncated form of FA8-4, where the truncated form can be designated FAt8-4. The original FA8-4 sequence is (shown in
TABLE-US-00001 GGGACUUCUGCCCGCCUCCUUCCUGCUCGUGUCAAAAUGAAUGGCGCUC GGCGUUGCGUGGUACGUUAUAUUCCGGCCAAGCAGCCAUUCAUGGGAGA CGAGAUAGGCGGACAC
From this initial sequence, the truncated form FAt8-4 is obtained (shown underlined). The C shown in bold was also mutated to a U in FAt8-4, to give the truncated sequence: GCUUGGCGUUGCGUGGUACGUUAUAUUCCGGCCAAGC Through stem mutations, it is shown that the nucleotides that provide binding activity are: GUUGCGUGGUACGUUAUAUUCCG. The minimally required sequence for binding is:
TABLE-US-00002 N.sub.1N.sub.2GN.sub.3UCCGUGGUACGUUAUAUUCCGN.sub.4N.sub.5,
[0071] where N.sub.1 and N.sub.5 are any complementary pair of nucleotides; N.sub.2 and N.sub.4 are any complementary pair of nucleotides; and N.sub.3 is any nucleotide.
[0072] For FAt8-11, the minimal required sequence is:
TABLE-US-00003 N.sub.1N.sub.2UGCN.sub.3UGGUACGUUAUAUUCRGN.sub.4N.sub.5,
where N.sub.1 and N.sub.5 are any complementary pair of nucleotides; N.sub.2 and N.sub.4 are any complementary pair of nucleotides; N.sub.3 is any nucleotide; and R is an A or G nucleotide.
[0073] For FAt8-3, the minimal required sequence is:
TABLE-US-00004 CGUCUGGUCACGACCN.sub.1N.sub.2-N.sub.3N.sub.4CCCUCGAAAUCACGAGGGRG ACRAGAY,
where N.sub.1 and N.sub.4 are any complementary pair of nucleotides; N.sub.2 and N.sub.3 are any complementary pair of nucleotides; R is an A or G nucleotide; Y is a C or U nucleotide; and the dash indicates any intervening sequence of nucleotides or two separate nucleotide strands.
[0074] For FAt10-7, the minimal required sequence is:
TABLE-US-00005 N.sub.1N.sub.2GGCGAAGAGUCAAAGCAUCCCCN.sub.3-N.sub.4GGGCCCN.sub.5N.sub.6,
where N.sub.1 and N.sub.6 are any complementary pair of nucleotides; N.sub.2 and N.sub.5 are any complementary pair of nucleotides; N.sub.3 and N.sub.4 are any complementary pair of nucleotides; and the dash indicates any intervening sequence of nucleotides or two separate nucleotide strands.
[0075] Aptamers of the invention may be substantially homologous (or substantially similar) to the provided sequences, particularly with respect to the truncated sequences provided in
[0076] Aptamer sequences can be provided as an isolated nucleic acid, e.g. as a single stranded RNA; can be provided as the encoding DNA sequence, which may be single stranded or double stranded; or may be operably joined to one or both of an actuator component and a transmitter component.
[0077] Actuator. An actuator is a component of aptamer-regulated devices of the invention that provides for an activity, e.g. splicing activity; ribozyme activity; transcription; RNA stability; RNA interference; translation; post-translational activity; transcription termination; RNA polymerase recruitment; splice site accessibility; position-dependent splicing; branch point sequence accessibility; ribozyme self-cleavage; Rnt1p enzymatic processing; Drosha pri-miRNA processing; ribozyme-mediated pri-miRNA folding; Dicer shRNA processing; ribosomal binding site (RBS) accessibility; 16S ribosomal RNA; RBS accessibility; ribozyme-mediated RBS accessibility; ribozyme-mediated tRNA; tRNA; mRNA; ribosome binding, scanning, or assembly; antisense RNA binding to start codon; TetR activity; promoter activity; terminator activity; riboswitches; ribozymes; microRNAs; siRNAs; antisense RNAs; RNAi; clustered regularly interspaced short palindromic repeats (CRISPR); CRISPR-Cas9; CRISPR targeting RNA (crRNA); trans-activating crRNA (tracrRNA); guide RNA (gRNA); splicing; small RNAs; ribosome binding sites; internal ribosome entry sites; aptamer; etc. In some specific embodiments the actuator is a ribozyme, including without limitation a hammerhead ribozyme. In some embodiments, the actuator is an aptamer. In other embodiments the actuator is an ampliswitch, as defined in U.S. Pat. No. 8,772,464, herein specifically incorporated by reference. Other actuators of interest include ligand-responsive, microRNA (miRNA) switches that modulate Drosha processing. These switches integrate an aptamer into the basal segments of a miRNA. Internal loop size contained within the basal segments affects Drosha processing and therefore the levels of miRNA-mediated gene silencing. By integrating an aptamer within the basal segments, unbound aptamer can remain relatively unstructured, while ligand binding can sequester nucleotides involved in binding and inhibit Drosha processing. Aptamer-regulated devices include, but are not limited to, RNA switches, ribozyme switches, microRNA switches, an aptamer operably joined or linked to another aptamer, an aptamer operably joined or linked to an actuator, and any combination thereof.
[0078] Ribozyme: Ribozymes are RNA molecules with a catalytic activity. Frequently, although not necessarily, the activity is cleavage of a nucleic acid. Other ribozymes may catalyze other chemical reactions and have their catalytic activity controlled using a similar type of switch.
[0079] Ribozyme types include, without limitation, hairpin ribozymes, hepatitis delta virus and hepatitis delta virus-like ribozymes, CPEB3 ribozymes, Varkud satellite ribozymes, twister ribozymes, group I and group II introns, and hammerhead ribozymes. Ribozymes have been targeted to a wide variety of substrates and tested in biological systems to achieve the inhibition of cellular gene expression or viral replication. Target specificity may be achieved, for example, by flanking a ribozyme motif with antisense sequences, complementary to the target RNA.
[0080] A hammerhead ribozyme contains a core, three stems that extend from the core, referred to herein as stem I, stem II, and stem III, and at least one loop, which is located on the opposite end of a stem from the core. Hammerhead ribozymes can be type I, type II, or type III depending on which stem the ribozyme is integrated through into the transcript
[0081] As used herein, a cis-cleaving hammerhead ribozyme is a hammerhead ribozyme that, prior to cleavage, is comprised of a single polynucleotide. A cis-cleaving hammerhead ribozyme is capable of cleaving itself.
[0082] As used herein, a trans-cleaving hammerhead ribozyme is a hammerhead ribozyme that, prior to cleavage, is comprised of at least two polynucleotides. One of the polynucleotides is the target sequence that is cleaved.
[0083] Ribozyme switches. A molecule that can adopt at least two different conformational states, where each state is associated with a different activity of the molecule. Often a ligand can bind to one or more conformations of the switch, such that the presence of the ligand shifts the equilibrium distribution across the adoptable conformations and therefore regulates the activity of the switch molecule. As used here, switch generally refers to an RNA molecule that can adopt different structures that correspond to different gene-regulatory activities. An RNA switch is then a ligand-controlled gene-regulatory system.
[0084] Switching Strand: The nucleic acid sequence within a strand displacement domain that is bound to the general transmission region of the switch when the sensor domain is in the disrupted conformation (i.e., in the absence of ligand). The switching strand is displaced by the competing strand in the presence of ligand.
[0085] Strand displacement mechanism is demonstrated herein for architectures with aptamer integration off of the hammerhead loop II, and integration into the transcript through hammerhead helix III (
[0086] Aptamer integration through helix III requires two integration stems on the aptamer: one for ribozyme helix III integration and another for transcript integration. In this architecture, the ribozyme sequence does not need to be altered, and therefore the native tertiary loop-loop interactions are maintained, with the goal of achieving lower basal activity and eliminating the need to rescue impaired tertiary interactions.
[0087] An alternative switch architecture based on ribozyme loop replacement relies on the observation that natural hammerhead ribozymes possess many sequence solutions for maintaining tertiary loop-loop interactions that are crucial for stringent regulatory silencing (
[0088] The highest performing switches demonstrated up to 25.2-fold activation ratios (ratio of GFP expression in the presence of ligand to expression in the absence of ligand) in the presence of 3 mM (6R)-folinic acid and dynamic ranges of up to 43.6% (difference between GFP expression in the presence and absence of ligand).
[0089] Stem: A stem is a nucleic acid motif that extends from the ribozyme core, at least a portion of which is double-stranded. In certain embodiments, there is a loop at the opposite end of the stem from the ribozyme core, and this loop connects the two strands of the double-stranded stem. In certain embodiments, a stem comprises 2 to 20 complementary base pairs. In certain embodiments, a stem comprises 3, 4, 5, 6, 7, 8, or 9 complementary base pairs. Stems are numbered according to where they extend from the core sequence. In certain embodiments, a hammerhead ribozyme contains three stems, which are referred to as stem I stem II, and stem III.
[0090] In certain embodiments, at least 30% of the nucleotides in a stem are part of a complementary base pair. The remaining base pairs may be mismatched, non-complementary base pairs, or may be part of a bulge. In certain embodiments, at least 40% of the nucleotides in a stem are part of a complementary base pair. In certain embodiments, at least 50% of the nucleotides in a stem are part of a complementary base pair. In certain embodiments, at least 60% of the nucleotides in a stem are part of a complementary base pair. In certain embodiments, at least 70% of the nucleotides in a stem are part of a complementary base pair. In certain embodiments, at least 80% of the nucleotides in a stem are part of a complementary base pair. In certain embodiments, at least 90% of the nucleotides in a stem are part of a complementary base pair. In certain embodiments, at least 95% of the nucleotides in a stem are part of a complementary base pair. In certain embodiments, at least 99% of the nucleotides in a stem are part of a complementary base pair. In certain embodiments, 100% of the nucleotides in a stem are part of a complementary base pair.
[0091] Loop: A loop is a sequence of nucleotides that is not paired with another strand and is located at the distal end of a stem that is opposite the core. In certain embodiments, a loop is between 1 to 20 nucleotides long. In certain embodiments, a loop is between 2 and 10 nucleotides long. In certain embodiments, a loop is between 3 and 8 nucleotides long. The loop is numbered according to the stem to which it is attached. Therefore, loop I is located at the end of stem I opposite the core, loop II is located at the end of stem II opposite the core, and loop III is located at the end of stem III opposite the core.
[0092] As used herein, a stem/loop refers to the entire stem, along with any bulges within that stem, and the loop at the end of the stem. For example, stem/loop I includes stem I, including any bulges within stem I, and loop I. If a stem lacks a loop, then stem/loop refers to the stem, along with any bulges within that stem.
[0093] Bulge: As used herein, a bulge is a sequence of nucleotides that is not paired with another strand and is flanked on both sides by double-stranded nucleic acid sequences. In certain embodiments, a bulge is located within a stem. When a bulge is located within a stem, the nucleotides of the bulge are considered to be part of the stem. In certain embodiments, a hammerhead ribozyme comprises more than one bulge. In certain embodiments, a bulge within a stem is located two base pairs from the core. In certain embodiments, one or both strands of the stem contain a bulge.
[0094] Directly Coupled: As used herein, an aptamer is directly coupled to an actuator, e.g., a loop of a ribozyme where the loop, relative to active ribozyme structure in the absence of the aptamer, is interrupted at only one backbone phosphodiester bond between two residues of the loop, the backbone phosphodiester bond being replaced with phosphodiester bonds to the 5 and 3 ends of the aptamer. In the active form of the aptamer-regulated ribozyme, the 5 and 3 residues of the information transmission domain are based paired to one another to form a duplex region in order to preserve the structure of the otherwise interrupted loop.
[0095] Information Transmission Domain: A switch domain that encodes the function of transmitting information between the sensor domain and the actuator domain.
[0096] Information Transmission Mechanism: A general mechanism for transmitting information between the sensor domain and the actuator domain of a switch. As used here, this mechanism regulates the activity of the actuator domain in response to the binding state of the sensor domain.
[0097] Strand Displacement Mechanism: An information transmission mechanism that is based on the rational design of an information transmission domain that functions through a strand displacement event. Such a strand displacement event utilizes competitive binding of two nucleic acid sequences (the competing strand and the switching strand) to a general transmission region of the switch (the base stem of the aptamer) to result in disruption or restoration of the actuator domain in response to restoration of the sensor domain.
[0098] For convenient detection, aptamers, aptamer-regulated devices, polynucleotides, or compounds disclosed herein can be conjugated to a detectable label. Suitable detectable labels can include any composition detectable by photochemical, biochemical, spectroscopic, immunochemical, electrical, optical, or chemical means. A wide variety of appropriate detectable labels are known in the art, which include fluorescent labels, chemiluminescent labels, radioactive isotope labels, enzymatic labels, and ligands. The detection methods used to detect or quantify the label will typically depend upon the label selected. For example, radiolabels (e.g., radioactive isotope labels) may be detected using Positron Emission Topography (PET), photographic film, or a phosphoimager. Fluorescent labels (e.g., fluorescent dyes, fluorescent proteins) may be detected and quantified using a photodetector to detect emitted light. In some embodiments, each of a plurality of aptamers, aptamer-regulated devices, polynucleotides, or compounds is conjugated to a different detectable label (e.g., fluorescent dyes with different emission spectra), such that the signal corresponding to different targets can be differentiated. Enzymatic labels are typically detected by providing the enzyme with a substrate and measuring the reaction product produced by the action of the enzyme on the substrate. Colorimetric labels are typically detected by visualizing the colored label or are quantified using a spectrophotometer.
[0099] In certain embodiments, the aptamers, aptamer-regulated devices, polynucleotides, or compounds disclosed herein are isotopically labeled. Isotopically-labeled aptamers, polynucleotides, or compounds (e.g., an isotopologue) may have one or more atoms replaced by an atom having a different atomic mass or mass number. Non-limiting examples of isotopes that can be incorporated into the disclosed compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, sulfur, fluorine, chlorine, and iodine, such as .sup.2H, .sup.3H, .sup.11C, .sup.13C, .sup.14C, .sup.13N, .sup.15N, .sup.15O, .sup.17O, .sup.18O, .sup.31P, .sup.32P, .sup.35S, .sup.18F, .sup.36Cl, .sup.123I, and .sup.125I, respectively. Certain isotopically-labeled aptamers, polynucleotides, or compounds, for example, those incorporating a radioactive isotope, are useful in drug and/or substrate tissue distribution studies. The radioactive isotopes tritium (.sup.3H) and carbon-14 (.sup.14C) are particularly useful for this purpose in view of their ease of incorporation and ready means of detection. These radiolabeled compounds could be useful to help determine or measure the effectiveness of the compounds, by characterizing, for example, the site or mode of action, or binding affinity to a pharmacologically important site of action. Substitution with heavier isotopes such as deuterium (.sup.2H) may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements, and hence are preferred in some circumstances. Substitution with positron emitting isotopes, such as .sup.11C, .sup.18F, .sup.15O and .sup.13N, can be useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein using an appropriate isotopically-labeled reagent in place of the non-labeled reagent.
[0100] In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide binds to a ligand with a K.sub.d of about 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600 pM, 700 pM, 800 pM, 900 pM, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 15 nM, 20 nM, 25 nM, 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 M, 2 M, 3 M, 4 M, 5 M, 6 M, 7 M, 8 M, 9 M, 10 M, 15 M, 20 M, 25 M, 30 M, 35 M, 40 M, 45 M, 50 M, 55 M, 60 M, 65 M, 70 M, 75 M, 80 M, 85 M, 90 M, 95 M, 100 M, 150 M, 200 M, 250 M, 300 M, 350 M, 400 M, 450 M, 500 M, or more than 500 M. In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide binds to a ligand with a K.sub.d of up to about 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600 pM, 700 pM, 800 pM, 900 pM, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 15 nM, 20 nM, 25 nM, 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 M, 2 M, 3 M, 4 M, 5 M, 6 M, 7 M, 8 M, 9 M, 10 M, 15 M, 20 M, 25 M, 30 M, 35 M, 40 M, 45 M, 50 M, 55 M, 60 M, 65 M, 70 M, 75 M, 80 M, 85 M, 90 M, 95 M, 100 M, 150 M, 200 M, 250 M, 300 M, 350 M, 400 M, 450 M, or 500 M. In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide binds to a ligand with a K.sub.d of at least about 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600 pM, 700 pM, 800 pM, 900 pM, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 15 nM, 20 nM, 25 nM, 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 M, 2 M, 3 M, 4 M, 5 M, 6 M, 7 M, 8 M, 9 M, 10 M, 15 M, 20 M, 25 M, 30 M, 35 M, 40 M, 45 M, 50 M, 55 M, 60 M, 65 M, 70 M, 75 M, 80 M, 85 M, 90 M, 95 M, 100 M, 150 M, 200 M, 250 M, 300 M, 350 M, 400 M, 450 M, or 500 M. In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide binds to a ligand with a K.sub.d within the range from 100 pM-100 M, from 100 pM-10 M, from 100 pM-1 M, from 100 pM-900 nM, from 100 pM-800 nM, from 100 pM-700 nM, from 100 pM-600 nM, from 100 pM-500 nM, from 100 pM-400 nM, from 100 pM-300 nM, from 100 pM-200 nM, from 100 pM-100 nM, or from 100 pM-50 nM. In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide binds to a ligand with a K.sub.d of up to about 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, or 1 M.
[0101] In some embodiments, an aptamer-regulated device achieves a half-maximal regulatory response at a concentration of a ligand of about 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600 pM, 700 pM, 800 pM, 900 pM, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 15 nM, 20 nM, 25 nM, 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 M, 2 M, 3 M, 4 M, 5 M, 6 M, 7 M, 8 M, 9 M, 10 M, 15 M, 20 M, 25 M, 30 M, 35 M, 40 M, 45 M, 50 M, 55 M, 60 M, 65 M, 70 M, 75 M, 80 M, 85 M, 90 M, 95 M, 100 M, 150 M, 200 M, 250 M, 300 M, 350 M, 400 M, 450 M, 500 M, or more than 500 M. In some embodiments, an aptamer-regulated device achieves a half-maximal regulatory response at a concentration of a ligand of up to about 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600 pM, 700 pM, 800 pM, 900 pM, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 15 nM, 20 nM, 25 nM, 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 M, 2 M, 3 M, 4 M, 5 M, 6 M, 7 M, 8 M, 9 M, 10 M, 15 M, 20 M, 25 M, 30 M, 35 M, 40 M, 45 M, 50 M, 55 M, 60 M, 65 M, 70 M, 75 M, 80 M, 85 M, 90 M, 95 M, 100 M, 150 M, 200 M, 250 M, 300 M, 350 M, 400 M, 450 M, or 500 M. In some embodiments, an aptamer-regulated device achieves a half-maximal regulatory response at a concentration of a ligand of at least about 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600 pM, 700 pM, 800 pM, 900 pM, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 15 nM, 20 nM, 25 nM, 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 M, 2 M, 3 M, 4 M, 5 M, 6 M, 7 M, 8 M, 9 M, 10 M, 15 M, 20 M, 25 M, 30 M, 35 M, 40 M, 45 M, 50 M, 55 M, 60 M, 65 M, 70 M, 75 M, 80 M, 85 M, 90 M, 95 M, 100 M, 150 M, 200 M, 250 M, 300 M, 350 M, 400 M, 450 M, or 500 M. In some cases, a regulatory response may include, but is not limited to, RNA expression, protein expression, gene expression, fluorescence, binding, cell viability, cell proliferation, cell motility, and any combination thereof.
[0102] In some embodiments, the ratio of a regulatory response in the presence of a ligand to the regulatory response in the absence of the ligand of an aptamer-regulated device is about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some embodiments, the ratio of a regulatory response in the presence of a ligand to the regulatory response in the absence of the ligand of an aptamer-regulated device is at least about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some embodiments, the ratio of a regulatory response in the presence of a ligand to the regulatory response in the absence of the ligand of an aptamer-regulated device is up to about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some cases, a regulatory response is an activation ratio. In some cases, the aptamer-regulated device is modulating RNA expression, protein expression, gene expression, or any combination thereof.
[0103] In some embodiments, the ratio of a regulatory response in the absence of a ligand to the regulatory response in the presence of the ligand of an aptamer-regulated device is about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some embodiments, the ratio of a regulatory response in the absence of a ligand to the regulatory response in the presence of the ligand of an aptamer-regulated device is at least about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some embodiments, the ratio of a regulatory response in the absence of a ligand to the regulatory response in the presence of the ligand of an aptamer-regulated device is up to about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some cases, a regulatory response is an activation ratio. In some cases, the aptamer-regulated device is modulating RNA expression, protein expression, gene expression, or any combination thereof.
[0104] In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide binds to a ligand with a specificity of about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide binds to a ligand with a specificity of at least about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide binds to a ligand with a specificity of up to about 1.0; 1.1; 1.2; 1.3; 1.4; 1.5; 1.6; 1.7; 1.8; 1.9; 2.0; 2.5; 3.0; 3.5; 4.0; 4.5; 5.0; 5.5; 6.0; 6.5; 7.0; 7.5; 8.0; 8.5; 9.0; 9.5; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000. In some cases, specificity is calculated as (K.sub.d of the aptamer to the ligand)/(K.sub.d of the aptamer to a reference compound). In some cases, the reference compound is a compound that is not the ligand and is selected from (6S)-folinic acid; (6R)-folinic acid; a diastereomeric mixture of (6R)- and (6S)-folinic acid; tetrahydrofolic acid; (6R)-tetrahydrobiopterin; folic acid; dihydrofolic acid; 5-formiminotetrahydrofolate; 10-formyltetrahydrofolate; 5,10-methenyltetrahydrofolate; 5,10-methylenetetrahydrofolate; levomefolic acid; technetium (99mTc) etarfolatide; tetrahydrofolic acid; vintafolide; methotrexate; pemetrexed; tetrahydrofolic acid; (6R)-tetrahydrobiopterin; (6R,S)-5-methyl-5,6,7,8-tetrahydrofolic acid; (6R)-5-methyl-5,6,7,8-tetrahydrofolic acid; (6S)-5-methyl-5,6,7,8-tetrahydrofolic acid; (6R,S)-5-formyl-5,6,7,8-tetrahydropteroic acid; (6R)-5-formyl-5,6,7,8-tetrahydropteroic acid; (6S)-5-formyl-5,6,7,8-tetrahydropteroic acid; and any combination thereof. In some cases, specificity is calculated as (K.sub.d of the aptamer to (6R)-folinic acid)/(K.sub.d of the aptamer to (6S)-folinic acid) or (K.sub.d of the aptamer to (6S)-folinic acid)/(K.sub.d of the aptamer to (6R)-folinic acid). In some cases, specificity is calculated as (K.sub.d of the aptamer to (6R)-folinic acid)/(K.sub.d of the aptamer to (6R,S)-5-methyl-5,6,7,8-tetrahydrofolic acid) or (K.sub.d of the aptamer to (6S)-folinic acid)/(K.sub.d of the aptamer to (6R,S)-5-methyl-5,6,7,8-tetrahydrofolic acid). In some cases, specificity is calculated as (K.sub.d of the aptamer to (6R)-folinic acid)/(K.sub.d of the aptamer to (6R,S)-5-formyl-5,6,7,8-tetrahydropteroic acid) or (K.sub.d of the aptamer to (6S)-folinic acid)/(K.sub.d of the aptamer to (6R,S)-5-formyl-5,6,7,8-tetrahydropteroic acid).
[0105] In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide has a length of about 1; 2; 3; 4; 5; 6; 7; 8; 9; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; 10,000; or more than 10,000 nucleotides. In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide has a length of up to 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; 100; 200; 300; 400; 500; 1,000; or 2,000 nucleotides. In some embodiments, an aptamer has a length of up to 50; 55; 60; 65; 70; 75; 80; 85; 90; 95; or 100 nucleotides.
[0106] In some embodiments, an aptamer, aptamer-regulated device, or polynucleotide comprises a sequence selected from FAt8-4, FAt8-11, FAt8-3, FAt6-8, FAt8-16, FAt8-18, FAt10-7, and FAt8-14. In some cases, an aptamer, aptamer-regulated device, or polynucleotide comprises a sequence having about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from FAt8-4, FAt8-11, FAt8-3, FAt6-8, FAt8-16, FAt8-18, FAt10-7, and FAt8-14. In some cases, an aptamer, aptamer-regulated device, or polynucleotide comprises a sequence having at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from FAt8-4, FAt8-11, FAt8-3, FAt6-8, FAt8-16, FAt8-18, FAt10-7, and FAt8-14. In some cases, an aptamer, aptamer-regulated device, or polynucleotide comprises a sequence having up to about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from FAt8-4, FAt8-11, FAt8-3, FAt6-8, FAt8-16, FAt8-18, FAt10-7, and FAt8-14.
[0107] In some cases, an aptamer, aptamer-regulated device, or polynucleotide comprises a sequence having about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to single-stranded regions of a sequence selected from FAt8-4, FAt8-11, FAt8-3, FAt6-8, FAt8-16, FAt8-18, FAt10-7, and FAt8-14 as determined by the secondary structure (e.g., as shown in
Delivery
[0108] RNA or nucleic acid molecules of the invention can be delivered to target cells in vivo, through any convenient mechanism, including without limitation transfection, infection, electroporation, etc. Target cells may include plant cells, animal cells, prokaryotes, fungi, etc. Target cells may include bacteria, fungi, plant protoplasts and chloroplasts, and mammalian cell lines. Cells may include, but are not limited, to S. cerevisiae, HeLa, CTLL-2, primary human T.sub.CM, HEK293, U2OS, SK-MEL-28, A549, Colo 829, NCH89, Vero, SK-MEL-28, Capan-1, A549, CHO, HepG2, X. laevis, A. baumannii, A. baylyi, A. tumefaciens, B. subtilis, E. coli, M. magneticum, M. smegmatis, S. pyogenes, Cucumber protoplast, M. tuberculosis, M. smegmatis, S. coelicolor, S. elongatus, N. tabacum chloroplasts, Francisella. Vectors of interest include, without limitation, viral vectors, mini-circle vectors, plasmids and include episomal vectors that replicate autonomously, as well as vectors that are integrated into a chromosome of the cell. The initial introduction of the nucleic acid can be performed in vitro, in vivo, or ex vivo, as required for the specific use.
[0109] Vectors can be plasmid, viral, or others known in the art, used for replication and expression in cells, e.g. mammalian cells, plant cells, etc. A promoter may be operably linked to the sequence encoding the subject RNA. Expression of the subject encoded sequences can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon, Nature 290:304-310 (1981)), the promoter contained in the 3 long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797 (1980)), the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. USA 78:1441-1445 (1981)), the regulatory sequences of the metallothionine gene (Brinster et al, Nature 296:3942 (1982)), etc. Any type of plasmid, cosmid, YAC, mini-circle or viral vector can be used to prepare the recombinant DNA construct that can be introduced directly into the tissue site. Alternatively, viral vectors can be used which selectively infect the desired tissue, in which case administration may be accomplished by another route (e.g., systematically).
[0110] Another approach utilizes a recombinant DNA construct in which the RNA or other aptamer-containing nucleic acid is placed under the control of a strong pol III or pol II promoter. The use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of the subject RNA. For example, a vector or expression construct can be introduced in vivo such that it is taken up by a target cell and directs the transcription of a subject RNA. Such a vector or expression construct can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired product. Such vectors can be constructed by recombinant DNA technology methods standard in the art.
[0111] Thus the invention also provides an expression vector or construct having a coding sequence that is transcribed to produce one or more transcriptional products that produce a subject RNA in the treated cells. Expression vectors appropriate for producing an aptamer-regulated nucleic acid are well-known in the art. For example, the expression vector is selected from an episomal expression vector, an integrative expression vector, and a viral expression vector.
[0112] In certain embodiments, the expression vector can be designed to include one or more subject RNA an RNA transcript, such as in the 3 untranslated region (3-UTR), so as to regulate transcription, stability and/or translation of that RNA transcript in a manner dependent on the ligand. To further illustrate, the expression construct can include a coding sequence for a polypeptide such that the mRNA transcript includes both the polypeptide coding sequence as well as one or more of the RNA of the invention. In this way, expression of the polypeptide can be rendered dependent on the ligand(s) to which the aptamer(s) bind.
[0113] An aptamer, aptamer-regulated device, or polynucleotide described herein can be obtained using chemical synthesis, molecular cloning or recombinant methods, DNA or gene assembly methods, artificial gene synthesis, PCR, or any combination thereof. Methods of chemical polynucleotide synthesis are well known in the art and need not be described in detail herein. One of skill in the art can use the sequences provided herein and a commercial DNA synthesizer to produce a desired DNA sequence. For preparing polynucleotides using recombinant methods, a polynucleotide comprising a desired sequence can be inserted into a suitable cloning or expression vector, and the cloning or expression vector in turn can be introduced into a suitable target cell for replication and amplification, as further discussed herein. Polynucleotides may be inserted into target cells by any means known in the art. Cells may be transformed by introducing an exogenous polynucleotide, for example, by direct uptake, endocytosis, transfection, F-mating, chemical transformation, or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrated expression vector (such as a plasmid) or integrated into the target cell genome. The polynucleotide so amplified can be isolated from the target cell by methods well known within the art. Alternatively, PCR allows reproduction of DNA sequences.
[0114] RNA can be obtained by using the isolated DNA in an appropriate expression vector and inserting it into a suitable target cell. When the cell replicates and the DNA is transcribed into RNA, the RNA can then be isolated using methods well known to those of skill in the art. Alternatively, RNA can be obtained by transcribing the isolated DNA, for example, by an in vitro transcription reaction using an RNA polymerase. Alternatively, RNA can be obtained using chemical synthesis.
[0115] Suitable cloning vectors may be constructed according to standard techniques, or may be selected from a large number of cloning vectors available in the art. While the cloning vector selected may vary according to the target cell intended to be used, useful cloning vectors will generally have the ability to self-replicate, may possess a single target for a particular restriction endonuclease, and/or may carry genes for a marker that can be used in selecting clones containing the expression vector. Suitable examples include plasmids and bacterial viruses, e.g., pUC18, pUC19, Bluescript (e.g., pBS SK+) and its derivatives, mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage DNAs, and shuttle vectors such as pSA3 and pAT28. These and many other cloning vectors are available from commercial vendors such as BioRad, Strategene, and Invitrogen.
[0116] In one aspect, the disclosure provides an expression vector comprising any of the aptamers, aptamer-regulated devices, or polynucleotides disclosed herein described herein. An aptamer, aptamer-regulated device, or polynucleotide disclosed herein may be located in an expression vector. An expression vector may be a construct, which is capable of delivering, and preferably expressing, one or more gene(s) or sequence(s) of interest in a target cell. Examples of expression vectors include, but are not limited to, viral vectors (e.g., adenoviruses, adeno-associated viruses, and retroviruses), naked DNA or RNA expression vectors, plasmids, cosmids, phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. An expression vector may allow easy and efficient replication, cloning, and/or selection. Accordingly, an expression vector may additionally include nucleic acid sequences that permit it to replicate in the target cell, such as an origin of replication, one or more therapeutic genes and/or selectable marker genes and other genetic elements known in the art such as regulatory elements directing transcription, translation and/or secretion of the encoded protein. Expression vector components may generally include, but are not limited to, one or more of the following: a signal sequence; an origin of replication; one or more marker genes; and suitable transcriptional controlling elements (such as promoters, enhancers and terminator). For expression (e.g., translation), one or more translational controlling elements are also usually required, such as ribosome binding sites, translation initiation sites, internal ribosome entry site, and stop codons. The expression vector may be used to transduce, transform or infect a cell, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell. The expression vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a viral particle, liposome, protein coating or the like. Numerous types of appropriate expression vectors are known in the art for protein expression, by standard molecular biology techniques. Such expression vectors are selected from among conventional vector types including insects, e.g., baculovirus expression, or yeast, fungal, bacterial or viral expression systems. Other appropriate expression vectors, of which numerous types are known in the art, can also be used for this purpose. Methods for obtaining cloning and expression vectors are well-known (see, e.g. Green and Sambrook, Molecular Cloning: A Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, New York (2012)).
[0117] In one aspect, the disclosure provides a target cell comprising any of the aptamers, aptamer-regulated devices, or polynucleotides described herein. In one aspect, the disclosure provides a target cell comprising any of the expression vectors described herein. Any target cell capable of over-expressing heterologous DNA can be used. Suitable target cells include, but are not limited to, mammalian (e.g., human such as HEK, HEK293, HEK293T, HeLa, U205, SK-MEL-28, A549, Colo 829, NCH89, Hep G2, Capan-1, T cell, B cell, or primary human T.sub.CM; mouse such as a 3T3, CTLL-2, or cells derived from Swiss, BALB/c or NIH mice; hamster such as CHO; monkey such as COS or Vero), bacterial (e.g., Escherichia coli, Bacillus subtilis, Pseudomonas, Streptomyces, A. baumannii, A. baylyi, A. tumefaciens, M. magneticum, M. smegmatis, S. pyogenes, M. tuberculosis, M. smegmatis, S. coelicolor, Francisella), algae, cyanobacteria (e.g., S. elongatus), fungal (e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis), amphibian (e.g., Xenopus laevis), plant (e.g., Arabidopsis, Cucumber protoplast, N. tabacum chloroplasts), or insect (e.g., Drosophila melanogaster, High Five, Spodoptera frugipedera Sf9) target cells. A target cell may include, but is not limited to, a cell from a mammal, human, non-human mammal, domesticated animal (e.g., laboratory animals, household pets, or livestock), non-domesticated animal (e.g., wildlife), dog, cat, rodent, mouse, hamster, cow, bird, chicken, fish, pig, horse, goat, sheep, rabbit, and any combination thereof. In some cases, a target cell is from a human.
[0118] The target cells can be transfected, e.g. by conventional means such as electroporation with at least one expression vector of the disclosure. The expression vectors containing the polynucleotides of interest can be introduced into a target cell by any of a number of appropriate means, including electroporation, chemical transformation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; lipofection; and infection (e.g., where the vector is an infectious agent such as vaccinia virus). The choice of introducing vectors or polynucleotides will often depend on features of the target cell. The transfected or transformed target cell may then be cultured under conditions that allow expression of the polynucleotide.
Formulations
[0119] The subject RNA or nucleic acids may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, polymers, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. The subject RNA or nucleic acids can be provided in formulations also including penetration enhancers, carrier compounds and/or transfection agents.
[0120] Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations which can be adapted for delivery of the subject RNA or nucleic acid molecules include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756.
[0121] The subject RNA or nucleic acids may also encompass any pharmaceutically acceptable salts, esters or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to RNAs or nucleic acids and pharmaceutically acceptable salts, and other bioequivalents.
[0122] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium potassium, magnesium, calcium, and the like. Examples of suitable amines are N,NI-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., Pharmaceutical Salts, J. of Pharma Sci., 1977, 66, 1-19). The base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention.
[0123] As used herein, a pharmaceutical addition salt includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids. Preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, lithium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.
Uses
[0124] The subject RNA or nucleic acids can further be used to engineer novel regulatory pathways and control loops for applications in metabolic engineering and synthetic circuit design by enabling a cell to sense and respond to folinic acid levels. Because the activity of the subject RNA or nucleic acids may be tunable over a range of ligand concentrations, the system can be designed to inhibit or activate genes only when certain triggering ligands have exceeded or gone below certain threshold concentrations. Balancing heterologous gene expression in biosynthetic pathways to maximize product yield can be achieved with the subject RNA or nucleic acids that regulate expression of any gene of interest in response to any pre-determined pathway intermediates, including any disease markers. Synthetic gene circuits have recently been used to understand and model cellular networks and to achieve cellular control as a step towards programmable cell behavior. Gene circuits can be built using combinations of the subject RNA or nucleic acids as regulators for precise control schemes. The subject RNA or nucleic acids are useful in building and characterizing circuits.
[0125] Finally, aptamer-regulated nucleic acids present tools for cellular imaging (by, for example, using a fluorescent reporter gene as the gene of interest), measuring, and detection strategies enabling programmable concentration-specific detection of ligands. The subject RNA or nucleic acids offer a unique platform to generate tailor-made cellular sensors and smart regulators that can target any gene in response to the ligand, creating new avenues for cellular control and engineering.
EXPERIMENTAL
Example 1
Programmable and Conditional Gene Control by a Clinical Drug
[0126] Natural biological systems rely on the ability to sense and respond to molecular and environmental stimuli through dynamic regulation of gene expression. Engineering synthetic biological systems similarly requires comparable sensing and control capabilities, particularly for effector ligands orthogonal to those found in nature or suitable for specialized applications such as clinical therapeutics. The construction of synthetic RNA regulatory switches responsive to the clinical drug folinic acid (leucovorin) is described herein. RNA aptamer sensors that bind with high specificity and affinity to either the (6R)- or (6S)-diastereomers of folinic acid were generated de novo through in vitro selection. Selection design principles were applied to favor discovery of high affinity aptamers that function under intracellular conditions, requiring as few as 21 nucleotides and with dissociation constants as low as 19.2 nM and ligand specificities up to 70,000-fold over structurally similar molecules. To engineer synthetic RNA switches that induce gene expression in vivo, a library of hammerhead ribozyme-based switches based on a transmitter strand displacement mechanism was designed and screened for functional gene regulatory activity in yeast. The successful construction of folinic acid-responsive switches demonstrates the in vivo application of these aptamers, which increases the number of orthogonal input signals available for inducible gene expression and provides a much needed clinically relevant ligand for advancing cellular and RNA-based therapeutics. This system combines design considerations, control parameters, and validation measurements to demonstrate a streamlined process for constructing RNA switches to desired molecular targets that can extend their use in varied synthetic biology applications.
[0127] A general and integrated process for generating inducible, RNA-based gene expression systems is described herein. A series of design principles, control parameters, and validation measurements were developed for the de novo, in vitro selection of RNA aptamer sensors that increase the likelihood of enriching and isolating binding sequences that function in vivo (
Materials and Methods
[0128] Selection column preparation. Positive selection columns functionalized with folinic acid and negative selection columns without folinic acid were prepared using EAH Sepharose 4B beads (GE Healthcare, Uppsala, Sweden). 0.5 mL beads per selection column were rinsed sequentially with water (pH 4.5) and 500 mM NaCl. For conjugation reaction, (6R,S)-Folinic acid (Sigma-Aldrich, St. Louis, Mo.) was coupled through its carbon/late groups to amino-functionalized beads using an amide bond-forming carbodiimide coupling reaction (
[0129] Validation and quantification of coupling reaction. Folinic acid conjugation was validated and quantified by liquid chromatography mass spectrometry (LC-MS). For conjugation validation, 5 mM folinic acid was coupled to 5 mM n-butylamine (Sigma-Aldrich) in conjugation buffer with 0.02 M NHS and 0.1 M EDC for 2 hours at room temperature, and 5 L of the reaction mixture (diluted 50-fold) was separated on a Zorbax SB-Aq column (3.050 mm, 1.8 M particle size) (Agilent Technologies). For conjugation quantification, beads from conjugation reactions were pelleted by centrifugation, and 5 L of the reaction supernatant (diluted 10-fold for 1 mM folinic acid reactions) was separated on the Zorbax column. The column was equilibrated with water, 0.1% acetic acid, and 0.1% methanol (Solvent A), and samples were eluted with a mobile phase of methanol and 0.1% acetic acid (Solvent B) in the following sequence: 0-1 min. at 100% A, 1-4 min. 0-25% B, 4-7 min. at 25% B, followed by steps to clean the column with 100% B and re-equilibrate in A. The flow rate was held constant at 0.6 mL/min. Eluted reaction products were identified by UV absorbance at 274 nm or on an Agilent 6320 Ion Trap mass spectrometer. For validation, extracted ion chromatograms of major reaction products were consistent with masses of expected coupling products (
[0130] De novo, in vitro aptamer selection. Selection library N70 antisense template DNA oligonucleotide 5-GTGTCCGCCTATCTCGTCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGGAGGCGGGCAGAAGTCCCT ATAGTGAGTCGTATTAGAA was synthesized by Integrated DNA Technologies. Initial RNA library for first selection round covered 1.2*10.sup.15 unique sequences and was transcribed by annealing 2 mol DNA template with 2.5 mol primer N70-T7-fwd (5-TTCTAATACGACTCACTATAGGGACTTCTGCCCGCCTCCTTCC) to form a partially double stranded template for run-off transcription using a MEGAshortscript T7 transcription kit (Life Technologies), supplemented with 0.5 Ci -.sup.32P-GTP (MP Biomedicals, Solon, Ohio), according to manufacturer's instructions. RNA libraries for subsequent selection rounds used double stranded DNA template generated from PCR amplification. Unincorporated nucleotides were removed using NucAway Spin Columns (Life Technologies), according to manufacturer's instructions. Purified RNA was resuspended in selection buffer, denatured at 65 C. for 5 min, and cooled to room temperature directly before use.
[0131] Selection columns were equilibrated at room temperature with 5 mL selection buffer, supplemented with 10 g/mL yeast tRNA (Ambion) to saturate nonspecific RNA binding sites. For selection rounds 1 and 2, RNA library was added to the positive selection column, which was then washed with appropriate volume of selection buffer supplemented with 10 g/mL yeast tRNA (
[0132] Positive selection column was washed with 6 column volumes of selection buffer supplemented with appropriate folinic acid concentration (
[0133] Elution volumes were pooled together, and RNA was concentrated using Amicon Ultra-0.5 Centrifugal Filter Units with Ultracel-10 membranes (EMD Millipore, Billerica, Mass.). Concentrated RNA was reverse transcribed using Superscript III Reverse Transcriptase (Life Technologies) with primer N70-rev according to manufacturer's instructions, and cDNA product was PCR amplified using primers N70-fwd-short and N70-rev. Unincorporated nucleotides were removed using NucAway Spin Columns. Purified PCR product was used as template for RNA transcription reaction for next selection round.
[0134] Individual sequences from selection rounds 6, 8, and 10 were isolated by PCR amplifying selection round libraries with primers GAP-N70-AvrII-fwd-short and GAP-N70-XhoI-rev and cloning into plasmid pCS1748 (1) via homologous recombination gap-repair transformation into yeast using standard lithium acetate heat shock to generate single colonies. Individual yeast colonies were incubated at 99 C. for 10 min in 20 mM NaOH to lyse cells, and 5 L of mixture were used at template in PCR with primers CS653 and CS654. PCR product was purified using EconoSpin columns (Epoch) and sequenced using primer CS653 (Elim).
[0135] Full length sequences were amplified off of sequencing PCR products using primers N70-fwd-short and Biacore-N70-rev to append a poly(A) tail. Truncated or mutated sequences were synthesized by Integrated DNA Technologies or the Protein and Nucleic Acid facility (Stanford, Calif.).
[0136] Surface plasmon resonance characterization of aptamer binding properties. Nucleic acid aptamer preparation. RNA aptamers were prepared by PCR amplification of DNA template sequences (Table 4, Integrated DNA Technologies, Coralville, Iowa) using forward and reverse primers Biacore-fwd and Biacore-rev, respectively, followed by transcription of the PCR product using the MEGAshortscript T7 transcription kit (Life Technologies) and purification of the transcription product using the RNA Clean & Concentrator kit (Zymo Research, Irvine, Calif.), according to the manufacturers' instructions. Aptamers were resuspended in selection buffer, denatured at 65 C. for 5 min, and cooled to room temperature directly before use.
[0137] Sensor chip surface generation. Experiments were performed on a Biacore X100 instrument (GE Healthcare) at 25 C. A CM5 sensor chip (GE Healthcare) was equilibrated with HBS-N buffer. The DNA linker strand (5-AmMC6-TTTTTTTTTTTTTTTTTTTTTTTT) (Integrated DNA Technologies), with an amino modified 6-carbon linker on the 5 end, was immobilized to the chip surface. The carboxymethylated dextran surface of the CM5 chip was activated for 7 min at a flow rate of 10 l/min using a 1:1 volume ratio of 0.4 M 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (GE Healthcare) and 0.1 M N-hydroxysuccinimide (GE Healthcare). A molar ratio of 1:30 of DNA strand to hexadecyltrimethylammonium bromide (Sigma-Aldrich, St. Louis, Mo.) was diluted in 10 mM HEPES buffer (Sigma-Aldrich) to a final concentration of 20 M and 0.6 mM, respectively, and injected over the activated surface for 10 min at a flow rate of 5 L/min. Excess activated groups were blocked by an injection of 1 M ethanolamine (GE Healthcare), pH 8.5, for 7 min at a flow rate of 10 L/min. The immobilization reaction was performed sequentially on both flow cells (FC1, FC2) and yielded approximately 4,000 RU of the DNA strand.
[0138] Aptamer binding assay. The Biacore X100 instrument was primed three times with running buffer prior to all binding assays. For each assay, three startup cycles were performed to stabilize the sensorgram baseline. For each startup cycle, the aptamer (40-70 ng/L, 3 M) was captured onto the sample flow cell (FC2) for 40 s at a flow rate of 5 L/min. 25 mM NaOH (GE Healthcare) was injected for 30 s at a flow rate of 30 L/min over both flow cells to regenerate the sensor surface. A dilution series of (6R)- or (6S)-folinic acid (Schircks Laboratories, Jona, Switzerland) was prepared in selection buffer and filtered through a 0.2 m membrane (Pall Corporation, Port Washington, N.Y.). For each concentration sample, the aptamer was captured onto the sample flow cell (FC2) for 40 s at a flow rate of 5 L/min, the folinic acid solution was injected over both flow cells at a flow rate of 30 L/min to monitor target association, and selection buffer was injected over both flow cells at a flow rate of 30 L/min to monitor target dissociation. Association and dissociation phase lengths used were chosen based on time needed to reach equilibrium. Aptamer and folinic acid were removed from the sensor surface by injecting 25 mM NaOH for 30 s at a flow rate of 30 L/min over both flow cells.
[0139] Data processing and analysis were performed using Biacore X100 Evaluation Software version 2.0 (GE Healthcare). A double-referencing method was performed to process all datasets. Data from the sample flow cell (FC2) were referenced first by subtracting data from the reference flow cell (FC1) to correct for bulk refractive index changes, nonspecific binding, injection noise, matrix effects, and baseline drift. Reference-subtracted data (FC2FC1) were double-referenced with a blank injection of running buffer to account for any systematic drift over the course of the injection. Double-referenced data were fit to a 1:1 binding model for kinetic analysis or steady-state affinity model for thermodynamic analysis. Reported values are the mean and standard deviation of at least three independent experiments.
[0140] Plasmid and strain construction. Standard molecular biology cloning techniques were used to construct all plasmids. DNA synthesis was performed by Integrated DNA Technologies (Coralville, Iowa) or the Protein and Nucleic Acid Facility (Stanford, Calif.). All enzymes, including restriction enzymes and ligases, were obtained through New England Biolabs (Ipswich, Mass.). Ligation products were electroporated with a GenePulser XCell (BioRad, Hercules, Calif.) into an E. coli DH10B strain (Invitrogen, Carlsbad, Calif.), where cells harboring cloned plasmids were maintained in Luria-Bertani media containing 50 g/mL ampicillin (EMD Chemicals, Philadelphia, Pa.). All cloned constructs were sequence verified by Elim Biopharmaceuticals (Hayward, Calif.).
[0141] The two-color screening plasmid pCS1748; single-color plasmids harboring GFP (pCS1585) and mCherry (pCS1749) for use as compensation controls; and no-color plasmid pCS4, containing no fluorescence reporter gene, was used as the negative-control construct. Ribozyme-based devices and appropriate controls were inserted into the 3 untranslated region (UTR) of yEGFP3 in pCS1748 through appropriate restriction endonuclease and ligation-mediated cloning. DNA fragments encoding the ribozyme-based devices and controls were PCR amplified using forward and reverse primers L1-2-fwd and L1-2-rev, respectively, and inserted into pCS1748 via the unique restriction sites AvrII and XhoI, which are located 3 nts downstream of the yEGFP3 stop codon. Cloned plasmids were transformed into the budding yeast Saccharomyces cerevisiae strain W303 (MAT his3-11, 15 trp1-1 leu2-3 ura3-1 ade2-1) through a standard lithium acetate method. All yeast strains harboring cloned plasmids were maintained on synthetic complete media with a uracil dropout solution containing 2% dextrose (SC-URA) and grown at 30 C. All plasmids constructed in this study are summarized in Table 3.
[0142] Cell sorting screen for functional ligand-responsive RNA switches. Device libraries (
[0143] Two-color FACS-based screen. Cells harboring the RNA device libraries and control constructs were washed, resuspended in FACS buffer (1% BSA in PBS), and stained with a DAPI viability dye (Invitrogen). The cell suspension was filtered through a 40 m cell strainer (BD Systems, San Jose, Calif.) prior to analysis on a FACSAria II cell sorter (BD Systems). GFP was excited at 488 nm and measured with a splitter of 505 nm and bandpass filter of 525/50 nm. mCherry was excited at 532 nm and measured with a splitter of 600 nm and a bandpass filter of 610/20 nm. DAPI was excited at 355 nm and measured with a bandpass filter of 450/50 nm. A scatter gate was set based on the forward and side-scatter area of cells harboring the negative-control plasmid (pCS4) to exclude debris, followed by a DAPI-() viability gate to exclude dead cells in the DAPI-(+) gate from the analysis. Cells harboring the single-color control plasmids (pCS1585, pCS1749) were analyzed to compensate spillover from GFP to the mCherry detector. A general sorting strategy was followed in which cells harboring devices with targeted gene-regulatory activities were analyzed to set a sorting gate on a two-dimensional scatter plot that correlates GFP and mCherry fluorescence. Cells within this gate were collected into SC-URA media and propagated to sufficient density for further screening or analysis.
[0144] Device characterization through flow cytometry analysis. Enriched device libraries from FACS were grown overnight in SC-URA liquid media and then plated onto SC-URA solid medium. Individual colonies were screened and characterized for gene-regulatory activity of the devices based on flow cytometry analysis. The GFP fluorescence was measured on a MACSQuant VYB flow cytometer (Miltenyi Biotec, Bergisch Gladbach, Germany). DAPI was excited at 405 nm and measured with a filter of 450/50 nm. GFP was excited at 488 nm and measured with a filter of 525/50 nm. mCherry was excited at 561 nm and measured with a filter of 615/20 nm. Cells harboring the mCherry-only plasmid (pCS1749) were analyzed to measure cellular autofluorescence in the GFP channel. Gene-regulatory activities were reported as relative GFP expression levels and were determined as the median of the GFP fluorescence using FlowJo (Tree Star), and normalized to the median of the GFP fluorescence of a positive control (sTRSV Contl, a noncleaving sTRSV ribozyme with a scrambled core) that is grown under identical ligand conditions, run in the same experiment, and set to 100%.
[0145] Devices that exhibited desired activities were amplified by colony PCR using forward and reverse primers CS653 (5-GGTCACAAATTGGAATACAACTATAACTCT) and CS654 (5-CGGAATTAACCCTCACTAAAGGG), respectively, and sequenced. The recovered devices were resynthesized and recloned into the vector backbone to confirm the observed activity. DNA oligos were synthesized and amplified for insertion into pCS1748 using forward and reverse primers L1-2-fwd and L1-2-rev, respectively. The resynthesized devices were inserted into pCS1748 via the unique restriction sites AvrII and XhoI. The reconstructed device plasmids were transformed into the W303 yeast strain through a standard lithium acetate method. Cells harboring the selected devices and appropriate controls were prepared as described above for the sorting experiments and analyzed to characterize the gene-regulatory activity of each device. FlowJo was used to process all flow cytometry data. Gene-regulatory activities in the absence or presence of ligand were determined as the median of the GFP fluorescence based, and normalized to the median of the GFP fluorescence of a positive control (sTRSV Contl, a noncleaving sTRSV ribozyme with a scrambled core) in the absence or presence of ligand, respectively, to correct for any nonspecific effects of ligand on the measured fluorescence (
Results and Discussion
[0146] De novo, in vitro selection enriches RNA aptamer sensors to folinic acid. A distinct limitation in the implementation of synthetic RNA regulatory switches is the lack of clinically relevant small molecule ligands that are nontoxic and readily bioavailable and display favorable pharmacokinetic properties. The lack of clinically suitable effectors restricts the development of genetically controlled cellular therapeutics and limits potential animal or human studies. For instance, theophylline-responsive switches have been implemented in proof-of-concept studies for regulating T cell proliferation for adoptive transfer therapy and viral replication and infectivity for gene therapy, cancer treatment, or vaccine development. However, its toxicity and narrow therapeutic index make theophylline unsuitable for clinical use.
[0147] One promising candidate for clinical use is the folate derivative folinic acid (
[0148] A continuous N70 randomized region was chosen as the basis for the selection library to provide sufficient sequence diversity and length as many previously validated in vitro selected, small molecule binding aptamers range in length from 30-60 nucleotides. Previous studies have suggested N70 as being a particularly favorable length that increases the frequency that a given motif could occur while avoiding potential inhibitory effects of excess sequence that could interfere with proper folding of a functional sequence, and more compact sequences are preferred for engineering synthetic switches. Constant regions flanking the randomized region were included as primer binding sites for RNA transcription, reverse transcription, and PCR amplification and reproduced from a previous study (29). The initial RNA library pool of 1.210.sup.15 unique sequences was generated through run-off transcription to prevent PCR amplification bias.
[0149] With the desired goal of functioning intracellularly, selection conditions were chosen to mimic physiological environments, with pH of 7.4 and moderate divalent magnesium concentration of 5 mM that would promote RNA folding and binding. The selection buffer was limited to only four components, Na.sup.+, Mg.sup.2+, Cl.sup., and HEPES, to minimize binding dependence on the presence of a particular buffer component and to maintain consistent selection and characterization conditions.
[0150] A recent aptamer selection meta-analysis observed correlation between selection immobilization concentration used during in vitro selection and resulting aptamer binding affinities, with aptamers with dissociation constants under 1 M having immobilization concentrations of 400-500 M. A sub-micromolar binding affinity was targeted for in vivo applications, with a preferred goal of under 100 nM. Most in vitro selections use a constant immobilization concentration throughout the selection process. High concentrations of immobilized ligand decrease the chance that functional binders will be lost but generally yield lower affinity aptamers; low concentrations of immobilized ligand increase the chance that binding sequences will be lost before they can be enriched but yield higher affinity aptamers. A high concentration of immobilized ligand (2 mM) was used at the start to provide more available ligand for the initial RNA library to bind to and to prevent being too stringent initially and losing rare sequences but to steadily decrease immobilization concentration down to 2 M to favor high affinity binders over weakly binding sequences (
[0151] Selection stringency was controlled through multiple parameters and steadily increased throughout the selection rounds. 2 mM folinic acid was conjugated onto the column beads, and the concentration of immobilized ligand was decreased 10-fold every other round, reaching 2 M folinic acid on the beads by round 7 and held constant through round 10. Wash volume was increased progressively from 6 column volumes in round 1, by an additional 3 column volumes each round (
[0152] Binding enrichment, as measured by percentage of RNA eluted, generally increased among successive rounds when ligand immobilization concentration on beads was held constant and dropped when ligand concentration decreased (
[0153] Aptamer screening and truncation using surface plasmon resonance isolates unique functional sequences. After 10 rounds of in vitro selection, binding of the library pool to a column derivatized with folinic acid was observed (
[0154] Individual library sequences were isolated and sequenced after cloning into a sequencing plasmid in a yeast host by homologous recombination. Individual sequences were then amplified from sequencing plasmids, transcribed into RNA, and screened by SPR for binding and specificity. Aptamer sequences were truncated to identify minimal sequences necessary for ligand binding and predicted, functional secondary structures (
[0155] For aptamers where rational truncations did not produce functional binders, serial truncations were performed where 5 to 10 nucleotides were systematically removed from either the 5 or 3 ends. However, systematic truncations often produced false negatives, where sequences that contained the final truncated aptamer, and therefore would be expected to be capable of binding, displayed no binding, presumably due to improper folding. Exploring suboptimal predicted secondary structures revealed alternative folding structures that were tested to reveal functional aptamer conformations (
[0156] Characterization of aptamer kinetic and equilibrium binding properties observes high aptamer affinity and specificity. Binding properties of truncated aptamer sequences to both (6R)- and (6S)-folinic acid were characterized using a label-free, surface plasmon resonance-based method (
[0157] Folinic acid aptamers exhibit k.sub.on rates among the fastest of characterized natural or in vitro selected aptamers, k.sub.off rates slower than most in vitro selected aptamers characterized and within the range observed for natural aptamers, and K.sub.D values below most in vitro selected aptamers characterized and within the range observed for natural aptamers (
TABLE-US-00006 TABLE 1 Kinetic and equilibrium binding properties of aptamers for (6R)- and (6S)-folinic acid. (6R)-Folinic Acid (6S)-Folinic Acid Aptamer k.sub.a (M.sup.1s.sup.1) k.sub.d (s.sup.1) K.sub.D (M) k.sub.a (M.sup.1s.sup.1) k.sub.d (s.sup.1) K.sub.D (M) Selectivity (6R)-FA tFA8-4 2.69E+05 5.15E03 1.92E08 2.11E+04 1.05E01 4.98E06 260 specific tFA8-11 1.16E+05 4.68E03 4.05E08 6.56E+03 2.27E01 3.46E05 855 tFA8-3 4.59E+05 2.17E02 4.73E08 2.86E05 606 tFA6-8 7.79E+04 1.76E02 2.25E07 2.33E+03 2.97E01 1.28E04 567 tFA8-16 3.30E+04 6.02E02 1.82E06 6.82E+02 8.50E01 1.25E03 684 (6S)-FA tFA8-18 9.40E+01 3.55E03 3.77E05 3.61E+04 2.27E03 6.28E08 600 specific tFA10-7 7.44E05 5.36E+04 7.75E03 1.44E07 515 tFA8-14 1.02E02 8.92E+04 1.28E02 1.44E07 71,100
TABLE-US-00007 TABLE 2 Equilibrium binding properties of aptamers for folate derivatives. Tetrahydrofolic (6R)-Tetrahydro- Dihydrofolic acid (THF) biopterin (THB) acid (DHF) Aptamer K.sub.D (M) K.sub.D (M) K.sub.D (M) tFA8-4 (1.7-2.5)E06 N.D. (2.6-6.6)E06 tFA8-11 (1.4-3.3)E06 N.D. (7.2-19.7)E06 tFA8-3 (2.2-2.6)E06 1.6E06 (1.1-3.5)E06 tFA8-18 N.D. N.D. N.D. N.D. refers to non-detectable levels of binding at conditions tested.
[0158] Aptamer Sequence-Activity Relationships Identify Suitable Switch Integration Site.
[0159] Aptamer mutations were studied to assess their effect on ligand binding to better understand which nucleotides were involved in or necessary for binding and to identify sequence flexibility that could be leveraged during switch design. In particular, integration into regulatory switch platforms generally requires one or more stems through which to couple the aptamer to the actuator. Thus, identifying potential integration stems whose sequence can be modified for facile switch integration while not affecting ligand binding is a critical step in switch design. Two predicted stems in the FAt8-4 truncated aptamer, the highest affinity (6R)-specific aptamer identified, were assayed for sequence flexibility by shuffling nucleotide identify (A to C, C to A, G to U, and U to G to maintain U-G base pairing) (
[0160] With the identity of at most 23 nucleotides fixed, the FAt8-4 aptamer encodes extraordinarily high ligand affinity and specificity in a short, compact sequence. A means for quantifying and comparing the binding capacities of different aptamers is calculated through their information content, defined as the amount of information (i.e., bits) necessary to specify the identity of each nucleotide position. A simple measure of information content adds two bits of information for invariant positions, one bit for two-base varying positions such as base-paired nucleotides, and zero bits for unconstrained four-base varying positions. Thus, the information content of FAt8-4 has an upper limit of approximately 60 bits (23 invariant positions and 14 base-paired positions), with fewer base pairs likely required to stabilize the stem and possibly other positions that may not be entirely invariant. Compared to other characterized aptamers, the information content necessary to encode folinic acid binding is consistent with the few other high-affinity aptamers analyzed.
[0161] Ribozyme-based switch transmitter screen in yeast. Synthetic ribozyme-based switches have been shown to regulate gene expression in a dose-dependent and reversible manner and exhibit a number of key properties: scalability, with their modular architecture allowing interchangeable sensor and gene choice for programmable ligand input-gene output combinations; tunability, with tunable gene-regulatory activities and directionality with switches either increasing or decreasing gene expression in the presence of input ligand; and portability, with switches demonstrated in vitro and in viral, bacterial, fungal, and mammalian systems.
[0162] A transmitter library was screened for functional switches in Saccharomyces cerevisiae. An N11 transmitter library with 4.2 million device variants was generated by randomizing 11 out of 15 positions in a transmitter component joining the folinic acid aptamer FAt8-4 to the sTRSV hammerhead ribozyme (
[0163] Screening of isolated cells yielded folinic acid-responsive switches with activation ratios up to 6.1-fold in 3 mM (6R)-folinic acid (
[0164] Switches may upregulate or downregulate gene expression in response to ligand. Switches may be present in different genetic contexts (e.g., different promoters, regulated genes, genomic integration vs. plasmid expression).
[0165] In vitro selection methods enable de novo generation of RNA sensing capabilities, potentially allowing genetic switches to any desired molecular target. However, challenges associated with generating sensor components that are amenable to subsequent switch integration and that function in vivo have limited available sensing capabilities and possible applications. By applying selection design principles that favor the selection of aptamers that bind with high affinity and specificity under physiologically relevant conditions, a panel of RNA aptamers was generated that bind the clinical drug folinic acid with binding affinities as low as 19.2 nM and specificities over 70,000-fold against structurally similar compounds. Through library screening, folinic acid-responsive RNA switches were engineered that activate gene expression in vivo. Ribozyme-based switches have previously been demonstrated to transfer from yeast or bacterial systems to mammalian systems. In addition, the modular construction of these switches enables facile substitution of folinic acid aptamers into previously developed theophylline-responsive switches implemented in clinically relevant proof-of-concept studies regulating T cell proliferation for adoptive transfer therapy (see Chen et al. (2010) PNAS 107(19):8531-8536) and viral replication for gene therapy and vaccine development. The limited toxicity of folinic acid observed in clinical use indicates that these sensing and regulatory capabilities are broadly applicable and provide a general, nontoxic small molecule effector for controlling gene expression in bacterial, fungal, and mammalian systems and for more sensitive clinical applications. In addition to previously mentioned applications in T cell proliferation and gene therapy, additional potential clinical applications include bacterial probiotic treatments including pathogen seeking and killing, tumor invasion, and living diagnostics.
[0166] The in vitro selected folinic acid aptamers can be compared to the recently discovered natural tetrahydrofolate riboswitch. Although also able to bind folinic acid, the tetrahydrofolate riboswitch exhibits much lower affinity (10-20 M), low specificity between diastereomers (<1.5-fold) and against purines (with certain purines even binding more tightly than the cognate ligand), long length (90 nt), and multiple ligand binding sites, rendering it more challenging for incorporating into a synthetic regulatory switch and unsuitable for clinical applications due to its low specificity and affinity (Ames et al. (2010) Chemistry & Biology 17(7):681-685).
[0167] Applications for these aptamers include gene regulatory devices across cell and organism types and in therapeutic applications. In vivo biosensors for folate derivatives may be constructed from (6S)-folinic acid specific aptamers and used to monitor intracellular folate metabolism, to engineer folate central metabolism of this critical cofactor, or to engineer strains to overproduce these compounds. These aptamers can be evolved to bind to other folate analogues, both natural and unnatural such as the antifolate drugs methotrexate or pemetrexed. The different pharmacokinetic properties of the two diastereomers of folinic acid enable switches with different temporal control to be designed: one with a fast-acting and short-lived pulse of gene expression and a second with a longer, sustained pulse.
[0168] Aptamers and synthetic RNA regulatory switches provide a powerful approach for generating novel biological sensing and control capabilities with which to program gene expression and cellular behavior. Coupling de novo, in vitro selection with regulatory switch construction methods holds promise for greatly expanding the ligand chemical diversity of inducible gene expression systems. Historically, not many aptamer selections have been conducted with the primary intent of in vivo function. To increase the likelihood of generating sensing capabilities that function in vivo and are readily integrated into regulatory switch platforms, a system of design, control, and validation was applied to the process of generating a novel inducible gene expression system. By rigorously controlling design parameters and quantitatively validating the processes of ligand immobilization, aptamer selection, aptamer screening, and switch construction, this system provides a strategy for identifying, prototyping, and carrying forward promising ligand, aptamer, and switch candidates and combines the strengths of in vitro and in vivo methods. This systematized process can serve as a template and model to guide the development of other RNA-based inducible gene regulatory systems and expand their possible applications in engineering increasingly sophisticated biological systems.
TABLE-US-00008 TABLE 3 Selection Round 1 2 3 4 5 6 7 8 9 10 [FA] on Column 2 mM 2 mM 200 M 200 M 20 M 20 M 2 M 2 M 2 M 2 M Buffer Wash 1 0.01% 0.02% 0.00% 0.07% 0.06% 0.13% 0.02% 0.03% 0.06% 0.07% Buffer Wash 2 52.33% 58.84% 0.05% 0.07% 0.06% 0.13% 0.04% 0.03% 0.06% 0.28% Buffer Wash 3 42.16% 28.25% 28.01% 16.16% 17.64% 6.34% 24.63% 26.25% 16.88% 23.38% Buffer Wash 4 4.36% 4.71% 50.03% 35.02% 50.41% 43.09% 47.01% 52.50% 51.93% 55.02% Buffer Wash 5 0.44% 1.41% 16.51% 13.47% 18.90% 22.81% 22.39% 12.83% 18.18% 11.69% Buffer Wash 6 0.17% 0.71% 2.50% 5.39% 6.30% 8.87% 2.69% 3.21% 2.99% 2.20% Buffer Wash 7 0.42% 0.60% 4.71% 2.27% 4.06% 0.85% 0.88% 1.43% 1.03% Buffer Wash 8 0.33% 0.25% 3.37% 1.26% 2.53% 0.40% 0.58% 0.65% 0.55% Buffer Wash 9 0.24% 0.20% 3.03% 0.63% 1.77% 0.18% 0.47% 0.52% 0.41% Buffer Wash 10 0.15% 2.15% 0.38% 1.27% 0.13% 0.29% 0.45% 0.34% Buffer Wash 11 2.02% 0.32% 1.27% 0.09% 0.23% 0.39% 0.34% Buffer Wash 12 1.75% 0.19% 0.76% 0.07% 0.23% 0.32% 0.28% Buffer Wash 13 1.48% 0.19% 0.63% 0.06% 0.18% 0.32% 0.28% Buffer Wash 14 0.51% 0.06% 0.16% 0.32% 0.21% Buffer Wash 15 0.51% 0.04% 0.15% 0.26% 0.21% Buffer Wash 16 0.51% 0.04% 0.15% 0.32% 0.21% Buffer Wash 17 0.12% 0.26% 0.21% Buffer Wash 18 0.12% 0.19% 0.21% Buffer Wash 19 0.09% 0.19% 0.14% Buffer Wash 20 0.14% Buffer Wash 21 0.14% Buffer Wash 22 0.14% Sum Buffer 99.48% 94.93% 98.30% 88.69% 98.61% 95.18% 98.70% 98.48% 95.75% 97.46% Washes [FA] in Elutions 20 mM 20 mM 20 mM 20 mM 2 mM 2 mM 200 M 200 M 200 M 200 M FA Elution 1 0.12% 0.19% 0.15% 1.35% 0.19% 0.51% 0.04% 0.09% 0.23% 0.14% FA Elution 2 0.17% 0.38% 0.30% 8.08% 0.38% 2.28% 0.09% 0.20% 1.17% 0.62% FA Elution 3 0.03% 0.14% 0.15% 0.81% 0.13% 0.51% 0.04% 0.09% 0.45% 0.21% FA Elution 4 0.03% 0.06% 0.10% 0.20% 0.06% 0.25% 0.07% 0.18% 0.91% 0.41% FA Elution 5 0.01% 0.05% 0.05% 0.13% 0.06% 0.13% 0.04% 0.09% 0.32% 0.14% FA Elution 6 0.01% 0.02% 0.05% 0.07% 0.06% 0.13% 0.02% 0.06% 0.13% 0.07% Sum FA 0.38% 0.84% 0.80% 10.64% 0.88% 3.80% 0.31% 0.70% 3.21% 1.58% Elutions Blocked 0.60% 0.40% 0.32% 0.63% 0.81% 0.53% 0.78% 0.76% Negative Selection Column FA Conjugated 0.15% 4.24% 0.30% 0.27% 0.19% 0.38% 0.18% 0.29% 0.26% 0.21% Column In vitro selection design, stringency, and progress. Steady increases in selection stringency are incorporated into selection through gradual increases in buffer wash volume, decreases in concentration of folinic acid conjugated onto solid support beads, and decreases in concentration of folinic acid in elution. Selection progress is monitored through RNA retention profile. Percentage of .sup.32P-radiolabeled RNA in each fraction is measured using a Geiger counter. Volume of all columns, buffer washes, and elutions is 0.5 mL. Blocked negative selections columns are used in selection rounds 3 through 10. Input RNA library is added to negative selection column and flows into folinic acid conjugated selection column with addition of buffer washes, shifting RNA retention profile by one wash (i.e., peak RNA fractions are buffer washes 2 and 3 for rounds 1 and 2 but shifts to buffer washes 3 and 4 for remaining rounds since RNA must travel through an additional volume of beads in second column). Negative selection columns are removed after four buffer washes, and remaining buffer washes and elutions are added directly to selection column.
TABLE-US-00009 TABLE4 Sequencesoffolinicacidaptamers. Invitroselection AntisenseDNAsequence N70library 5- SEQIDNO:1 GTGTCCGCCTATCTCGTCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGGAGGCGGGCAGA AGTCCCTATAGTGAGTCGTATTAGAA Aptamers Full-lengthRNAsequencefrominvitroselection (6R)-FAspecific aptamers FA8-4 5- SEQIDNO:2 GGGACUUCUGCCCGCCUCCUUCCUGCUCGUGUCAAAAUGAAUGGCGCUCGGCGU UGCGUGGUACGUUAUAUUCCGGCCAAGCAGCCAUUCAUGGGAGACGAGAUAGGC GGACAC FA8-3 5- SEQIDNO:3 GGGACUUCUGCCCGCCUCCUUCCGCUGAGGACUCGGCACCGAAUUUGCCAACGU CUGGUCACGACCGUAGUACACUACCCCUCGAAAUCACGAGGGAGACGAGAUAGG CGGACAC FA8-11 5- SEQIDNO:4 GGGACUUCUGCCCGCCUCCUUCCGCUUACCGGACGCCUUAAGGCAUCAGCAUGC AGUGCUUGGUACGUUAUAUUCAGCUGCAACUCGGGAUGCGGAGACGAGAUAGGC GGACAC FA6-8 5- SEQIDNO:5 GGGACUUCUGCCCGCCUCCUUCCGCUAUAAGUCGGACUUCCCGUCAGGUACGUU AUAUUCGGGGGAGUACGGUUAAAGCAGAUUUGUUGAAUGGAGACGAGAUAGGCG GACAC FA8-16 5- SEQIDNO:6 GGGACUUCUGCCCGCCUCCUUCCGGUGACCUGGACGUUAUUUCCGGCCGAAGGG AGACGAGAUAGGCGGACAC (6S)-FAspecific aptamers FA8-18 5- SEQIDNO:7 GGGACUUCUGCCCGCCUCCUUCCUACUCCCGACUCGUCAAUGCAUAUGUAACGU UAACGGCGCUACCUGUACAAUGCACGUUCCGAGCGCCCGGAGACGAGAUAGGCG GACAC FA10-7 5- SEQIDNO:8 GGGACUUCUGCCCGCCUCCUUCCCCGACACGGCGAAGAGUCAAAGCAUCCCCUG CAUGGAGCCAACAAGCCCUGCCUCCACGCAGGGCCCGUGGGAGACGAGAUAGGC GGACAC FA8-14 5- SEQIDNO:9 GGGACUUCUGCCCGCCUCCUUCCGCGCAAGUGCAUUAACGGUGACACCGAAAGC UGGAAAGCCUGACAUCGAACGCAAAAGGCUGCGUGGCAUGGAGACGAGAUAGGC GGACAC Truncated Aptamers DNAsequenceforSPR (6R)-FAspecific aptamers FAt8-4 5- SEQIDNO:10 TTCTAATACGACTCACTATAGGGGCTTGGCGTTGCGTGGTACGTTATATTCCGG CCAAGCCCCCAAAAAAAAAAAAAAAAAAAAAAAA FAt8-3 5- SEQIDNO:11 TTCTAATACGACTCACTATAGGGTTTGCCAACGTCTGGTCACGACCGTAGTACA CTACCCCTCGAAATCACGAGGGAGACGAGATAGGCGGACCCCAAAAAAAAAAAA AAAAAAAAAAAA FAt8-11 5- SEQIDNO:12 TTCTAATACGACTCACTATAGGGTGCAGTGCTTGGTACGTTATATTCAGCTGCA CCCCAAAAAAAAAAAAAAAAAAAAAAAA FAt6-8 5- SEQIDNO:13 TTCTAATACGACTCACTATAGGGTTCCCGTCAGGTACGTTATATTCGGGGGACC CCAAAAAAAAAAAAAAAAAAAAAAAA FAt8-16 5- SEQIDNO:14 TTCTAATACGACTCACTATAGGGCTCCTTCCGGTGACCTGGACGTTATTTCCGG CCGAAGGGAGCCCCAAAAAAAAAAAAAAAAAAAAAAAA (6S)-FAspecific aptamers FAt8-18 5- SEQIDNO:15 TTCTAATACGACTCACTATAGGGCTCGTCAATGCATATGTAACGTTAACGGCGC TACCTGTACAATGCACGTTCCGAGCGCCCGGAGACGAGCCCCAAAAAAAAAAAA AAAAAAAAAAAA FAt10-7 5- SEQIDNO:16 TTCTAATACGACTCACTATAGGGACGGCGAAGAGTCAAAGCATCCCCTGCGAAA GCAGGGCCCGTCCCCAAAAAAAAAAAAAAAAAAAAAAAA FAt8-14 5- SEQIDNO:17 TTCTAATACGACTCACTATAGGGCCGCGCAAGTGCATTAACGGTGACACCGAAA GCTGGAAAGCCTGACATCGAACGCAAAAGGCTGCGTGGCCCCAAAAAAAAAAAA AAAAAAAAAAAA Truncated Aptamers RNAsequence (6R)-FAspecific aptamers FAt8-4 5-GCUUGGCGUUGCGUGGUACGUUAUAUUCCGGCCAAGC SEQIDNO:18 FAt8-3 5- SEQIDNO:19 UUUGCCAACGUCUGGUCACGACCGUAGUACACUACCCCUCGAAAUCACGAGGGA GACGAGAUAGGCGGA FAt8-11 5-UGCAGUGCUUGGUACGUUAUAUUCAGCUGCA SEQIDNO:20 FAt6-8 5-UUCCCGUCAGGUACGUUAUAUUCGGGGGA SEQIDNO:21 FAt8-16 5-CUCCUUCCGGUGACCUGGACGUUAUUUCCGGCCGAAGGGAG SEQIDNO:22 (6S)-FAspecific aptamers FAt8-18 5- SEQIDNO:23 CUCGUCAAUGCAUAUGUAACGUUAACGGCGCUACCUGUACAAUGCACGUUCCGA GCGCCCGGAGACGAG FAt10-7 5-ACGGCGAAGAGUCAAAGCAUCCCCUGCGAAAGCAGGGCCCGU SEQIDNO:24 FAt8-14 5- SEQIDNO:25 CCGCGCAAGUGCAUUAACGGUGACACCGAAAGCUGGAAAGCCUGACAUCGAACG CAAAAGGCUGCGUGG MutatedAptamer DNAsequenceforSPR FAt8-4-stem1 5- SEQIDNO:26 TTCTAATACGACTCACTATAGGGTAGGTTCGTTGCGTGGTACGTTATATTCCGG AACCTACCCCAAAAAAAAAAAAAAAAAAAAAAAA FAt8-4-stem2 5- SEQIDNO:27 TTCTAATACGACTCACTATAGGGTAGGTTAGTTGCGTGGTACGTTATATTCCGT AACCTACCCCAAAAAAAAAAAAAAAAAAAAAAAA FAt8-4-stem3 5- SEQIDNO:28 TTCTAATACGACTCACTATAGGGGCTTGGCGTTGCGTGCAGTGAGCCTACTGGT ACGTTATATTCCGGCCAAGCCCCCAAAAAAAAAAAAAAAAAAAAAAAA FAt8-4-stem4 5- SEQIDNO:29 TTCTAATACGACTCACTATAGGGGCTTGGCGTTGCGTGGCAGTGAGCCTACTGT ACGTTATATTCCGGCCAAGCCCCCAAAAAAAAAAAAAAAAAAAAAAAA Primers DNAsequence N70-fwd 5-TTCTAATACGACTCACTATAGGGACTTCTGCCCGCCTCCTTCC SEQIDNO:30 N70-fwd-short 5-TTCTAATACGACTCACTATAGGGACTTCTGCCCGCCTC SEQIDNO:31 N70-rev 5-GTGTCCGCCTATCTCGTCTCC SEQIDNO:32 GAP-N70-AvrII-fwd- 5- short TCCATGGTATGGATGAATTGTACAAATAAAGCCTAGGGGGACTTCTGCCCGCCT SEQIDNO:33 GAP-N70-XhoI-rev 5- SEQIDNO:34 AAGAAATTCGCTTATTTAGAAGTGGCGCGCCCTCTCGAGAGTGTCCGCCTATCT CGTCTCC Biacore-N70-rev 5-TTTTTTTTTTTTTTTTTTTTTTTTGGGGGTGTCCGCCTATCTCGTCTCC SEQIDNO:35 Biacore-fwd 5-TTCTAATACGACTCACTATAGGG SEQIDNO:36 Biacore-rev 5-TTTTTTTTTTTTTTTTTTTTTTTTGGGG SEQIDNO:37
TABLE-US-00010 TABLE5 Sequencesfortransmitter-baseddevicelibraryandisolatedfolinicacid-responsive switches. RNASwitches DNAsequence FA8-4-sTRSVN11 5- transmitterlibrary AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTNNNCGTT SEQIDNO:38 GCGTGGTACGTTATATTCCGGNNNNNNNNGGAGGACGAAACAGCAAAAAGAAAAATA AAAA (6R)-FA-switch1 5- SEQIDNO:39 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGGTCGTT GCGTGGTACGTTATATTCCGGGCCGAACGGGAGGACGAAACAGCAAAAAGAAAAATA AAAA (6R)-FA-switch2 5- SEQIDNO:40 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGCTCGTT GCGTGGTACGTTATATTCCGGGGCGAACGGAGGACGAAACAGCAAAAAGAAAAATAA AAA sTRSV 5- SEQIDNO:41 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGA AACAGCAAAAAGAAAAATAAAAA sTRSVContl 5- SEQIDNO:42 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTACGTGAGGTCCGTGAGGACAG AACAGCAAAAAGAAAAATAAAAA L2b8 5- SEQIDNO:43 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGTCCATA CCAGCATCGTCTTGATGCCCTTGGCAGGGACGGGACGGAGGACGAAACAGCAAAAAG AAAAATAAAAA Primers DNAsequence GAP-N70-AvrII-fwd- 5- short TCCATGGTATGGATGAATTGTACAAATAAAGCCTAGGGGGACTTCTGCCCGCCTC SEQIDNO:44 GAP-N70-XhoI-rev 5- SEQIDNO:45 AAGAAATTCGCTTATTTAGAAGTGGCGCGCCCTCTCGAGAGTGTCCGCCTATCTCGT CTCC GAP-L1-2-fwd 5- SEQIDNO:46 TCCATGGTATGGATGAATTGTACAAATAAAGCCTAGGAAACAAACAAAGCTGTCACC GAP-L1-2-rev 5- SEQIDNO:47 AAGAAATTCGCTTATTTAGAAGTGGCGCGCCCTCTCGAGTTTTTATTTTTCTTTTTG CTGTTTCG L1-2-fwd 5-GACCTAGGAAACAAACAAAGCTGTCACC SEQIDNO:48 L1-2-rev 5-GGCTCGAGTTTTTATTTTTCTTTTTGCTGTTTCG SEQIDNO:49 CS653 5-GGTCACAAATTGGAATACAACTATAACTCT SEQIDNO:50 CS654 5-CGGAATTAACCCTCACTAAAGGG SEQIDNO:51 Plasmids PlasmidNumber sTRSV pCS1750 sTRSVContl pCS1751 GFP pCS1585 mCherry pCS1749 nocolor pCS4 L2b8 pCS1753 GFP-mCherry pCS1748
Example 2
[0169] Aptamer mutations were studied to assess their effect on ligand binding to better understand which nucleotides were involved in or necessary for binding and to identify sequence flexibility that could be leveraged during switch design. In particular, integration into regulatory switch platforms generally requires one or more stems through which to couple the aptamer to the actuator. Thus, identifying potential integration stems whose sequence can be modified for facile integration while not affecting ligand binding is a critical step in switch design.
[0170] Aptamer stems were assayed for sequence flexibility or constraints by shuffling nucleotide identify (A to C, C to A, G to U, and U to G to maintain U-G basepairing). If shuffled stem sequences retained binding ability, stems were labeled as sequence unconstrained without testing all six possible base pairs (A-U, U-A, C-G, G-C, U-G, G-U). Terminal stem loop lengths were tested to minimize stem length, and individual point mutations were rationally picked and tested (
[0171] Next, particular functional groups of folinic acid that were important for aptamer binding were tested. With many natural and unnatural folate analogues available, binding of two derivatives were characterized that altered specific functionalities of folinic acid, which is composed of pterin, para-aminobenzoate, glutamate, and formyl moieties (
TABLE-US-00011 TABLE 6 (6R,S)-5-methyl-THF (6R,S)-5-formyl-THPteroic Acid Aptamer k.sub.a (M.sup.1s.sup.1) k.sub.d (s.sup.1) K.sub.D (M) k.sub.a (M.sup.1s.sup.1) k.sub.d (s.sup.1) K.sub.D (M) 8-4 3.35E+04 2.11E01 6.29E06 1.35E+05 4.94E03 3.66E08 8-11 1.43E+04 1.95E01 1.36E05 7.50E+05 5.68E03 7.57E08 8-3 1.58E07 3.05E+05 2.92E02 9.57E08 8-18 4.47E04 5.32E+04 6.33E03 1.19E07 10-7 8.18E05 3.52E+04 6.97E03 1.98E07 Kinetic and equilibrium binding properties of aptamers for folinic acid derivatives. (6R,S)-5-methyl-THF and (6R,S)-5-formyl-THPteroic acid are mixtures of both (6R) and (6S) diastereomers; thus, when comparing binding to the specific folinic acid diastereomer, k.sub.a and K.sub.D values should be adjusted accordingly.
[0172] More detailed structural information on aptamer-ligand binding can be obtained through chemical probing experiments such as SHAPE, crystallography, or nuclear magnetic resonance imaging. More detailed information on the energy binding landscape could be obtained through single-molecule force and folding studies or high-throughput mutational and affinity measurements such as RNA-MITOMI. In addition, since the glutamate moiety of folinic acid is not necessary for ligand binding, tagged derivatives of folinic acid can be synthesized, using the glutamate residue of folinic acid or the benzoic acid of 5-formyl-5,6,7,8-tetrahydropteoric acid as a chemical handle to couple a cargo such as a fluorophore tag to. The availability of diverse folate analogues can also be mined to test the effect of different oxidation states of the carbon atoms in the 5, 6, 7, or 8 positions or ligand conformation through derivatives that bridge the 5 and 10 nitrogens.
[0173] Applications for these aptamers include gene-regulatory devices across cell and organism types and in therapeutic applications. In vivo biosensors for folate derivatives may be constructed from (6S)-folinic acid specific aptamers and used to monitor intracellular folate metabolism, to engineer folate central metabolism of this critical cofactor, or to engineer strains to overproduce these compounds. These aptamers may be evolved to bind to other folate analogues, both natural and unnatural such as the antifolates methotrexate or pemetrexed.
Example 3
[0174] Rational design of ribozyme-based switches in yeast. Folinic acid-responsive switches were first rationally designed to demonstrate aptamer in vivo activity. The strand displacement mechanism previously used to rationally design theophylline- and tetracycline-responsive switches was tested on two different switch architectures: aptamer integration off of the hammerhead loop II and integration through hammerhead helix III (
[0175] Helix III integration represents an alternate switch architecture that has not previously been reported. Aptamer integration through helix III requires two integration stems on the aptamer: one for ribozyme helix III integration and another for transcript integration. In this architecture, the ribozyme sequence does not need to be altered, and therefore the native tertiary loop-loop interactions are maintained, with the goal of achieving lower basal activity and eliminating the need to rescue impaired tertiary interactions. However, this integration method could potentially be kinetically unfavorable, as the entire ribozyme sequence is transcribed before the aptamer is, possibly reducing the time for ligand binding to prevent ribozyme cleavage. This integration design is partially inspired by reported in vitro aptameric sensors that couple two aptamer domains, in vivo miRNA and Rnt1p switch designs, and Spinach-based sensors. However, these sensors and switches operate through conformational changes upon ligand binding that stabilize connecting stems (e.g., communication modules) or sequester aptamer nucleotides from enzymatic recognition and processing, thus making the use of a transmitter junction a novel switch architecture.
[0176] Switches achieved activation ratios up to 2.4-fold, while retaining specificity for (6R)-folinic acid over (6S)-folinic acid (
Example 4
Ribozyme Loop Replacement Screen in Yeast
[0177] An alternative switch architecture based on ribozyme loop replacement has recently been demonstrated to generate theophylline-responsive switches that function in vivo. This strategy relies on the observation that natural hammerhead ribozymes possess many sequence solutions for maintaining tertiary loop-loop interactions that are crucial for stringent regulatory silencing (
[0178] Fourteen device libraries based on ribozyme loop replacement were synthesized and pooled together for cell sorting (
[0179] Four rounds of cell sorting were conducted, using sorting collection gates based off of two previously characterized theophylline switches with activities of 3.5% for the negative sorting gate in the absence of folinic acid and 36.7% for the positive sorting gate in the presence of folinic acid (
[0180] Isolated cells were screened for switching activity, sequenced, and re-cloned from synthesized oligonucleotides into a fresh plasmid backbone for characterization. Interestingly, only a single switch, FA-22, with an aptamer replacing loop II of the ribozyme was identified. This lack of functional solutions with aptamers replacing loop II could reflect fewer natural examples of hammerhead ribozymes with a larger loop II relative to loop I. In addition, aptamer integration within loop I may be kinetically favored, as the aptamer would be fully transcribed before the ribozyme, providing more time for ligand binding before ribozyme cleavage. As the sorts were designed to isolated functional switches and not solely functional ribozymes, it is possible that aptamer integration in loop II could produce active ribozymes but were unfavorable switches compared to loop I integration. Three other families of switches were identified (
[0181] More switches incorporating aptamer FA8-11 were isolated. One hypothesis is that aptamer FA8-11 may facilitate greater conformational changes upon ligand binding. The required U-G base pair in this aptamer is necessary for ligand binding; these two nucleotides are also present in aptamer FA8-4 but not contained within a base stem. This base pair, while base paired in the absence of ligand, may open up and form contacts with the ligand upon binding. If true, ligand binding would not only cause local conformation changes within the aptamer but would also disrupt a base pair in a stem of the ribozyme, further impairing tertiary interactions between the two ribozyme loops. This hypothesis can be tested using chemical probing techniques such as SHAPE to assess changes in RNA structure in the absence and presence of folinic acid.
Example 5
Rational Design of microRNA-Based Switches in Mammalian Cells
[0182] Ligand-responsive, microRNA (miRNA) switches have been developed that modulate Drosha processing. These switches integrate an aptamer into the basal segments of a miRNA. Internal loop size contained within the basal segments affects Drosha processing and therefore the levels of miRNA-mediated gene silencing. By integrating an aptamer within the basal segments, unbound aptamer can remain relatively unstructured, while ligand binding can sequester nucleotides involved in binding and inhibit Drosha processing.
[0183] Aptamer integration into this switch platform requires two integration stems; therefore, aptamer FA8-3 was chosen. Separate studies on using this aptamer in a transmitter-based switch observe that an internal loop within the aptamer could be expanded while retaining ligand binding ability. This loop was expanded to the previously identified optimal loop size and integrated into the miRNA switch that targets GFP. A single copy of the miRNA switch enables up to 2.1-fold change in GFP expression (
TABLE-US-00012 TABLE7 SequencesforrationallydesignedandmiRNA-basedfolinicacid-responsiveswitches andfordevicelibrariesbasedonribozymeloopreplacementstrategyandisolated folinicacid-responsiveswitches. Rationally designed switches DNAsequence FA8-4-switch4 5- SEQIDNO:52 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGCTGGCGTT GCGTGGTACGTTATATTCCGGCCAGTTCAGCGGAGGACGAAACAGCAAAAAGAAAAATA AAAA FA8-3-switch9 5- SEQIDNO:53 AAACAAACAAATTTGCCAACGTCTGGTCACGACCGCTGTCACCGGATGTGCTTTCCGGT CTGATGAGTCCGTGAGGACGAAACAGCACAGCCCCTCGAAATCACGAGGGAGACGAGAT AGGCGGAAAAAAGAAAAATAAAAA 8-3-switch1 5- SEQIDNO:54 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGTCCCAACG TCTGGTCACGACCGTAGTACACTACCCCTCGAAATCACGAGGGAGACGAGATAGGGACG GGACGGAGGACGAAACAGCAAAAAGAAAAATAAAAA 8-3-switch3 5- SEQIDNO:55 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGAGTCAACG TCTGGTCACGACCGTAGTACACTACCCCTCGAAATCACGAGGGAGACGAGATAGACTGA TTACGGAGGACGAAACAGCAAAAAGAAAAATAAAAA 8-3-switch4 5- SEQIDNO:56 AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGCTGCAACG TCTGGTCACGACCGTAGTACACTACCCCTCGAAATCACGAGGGAGACGAGATAGCAGTT CAGCGGAGGACGAAACAGCAAAAAGAAAAATAAAAA miRNA-based switches DNAsequence FA8-3-miRNA 5- SEQIDNO:57 AATAACCGGTGCGATCGCGAACGGGTCCTCACTACCCCTCGAAATCACGAGGGAGACGA GATAAGAGCGACGGCGGAGCGAGCACAAGCTGGAGTACAACTATAGTGAAGCCACAGAT GTATAGTTGTACTCCAGCTTGTGCCCGCCTTGCCAACCATAACGTCTGGTCACGACCGT AGTAAGGGCCCGTTTTTAATTAAATCGATTATT Devicelibraries Sequence 6bpL1N6/4bpL2FA8-4 CCTAGGAAACAAACAAAGCTGTCACCGGANNNNNNTCCGGTCTGATGAGTC SEQIDNO:58 CGNTGCGTGGTACGTTATATTCCGGGACGAAACAGCAAAAAGAAAAATAAA AACTCGAG 6bpL1N7/4bpL2FA8-4 CCTAGGAAACAAACAAAGCTGTCACCGGANNNNNNNTCCGGTCTGATGAGT SEQIDNO:59 CCGNTGCGTGGTACGTTATATTCCGGGACGAAACAGCAAAAAGAAAAATAA AAACTCGAG 6bpL1FA8-4/3bpL2N6 CCTAGGAAACAAACAAAGCTGTCACCGGAGNTGCGTGGTACGTTATATTCC SEQIDNO:60 GTCCGGTCTGATGAGTCNNNNNNGACGAAACAGCAAAAAGAAAAATAAAAA CTCGAG 6bpL1FA8-4/3bpL2N7 CCTAGGAAACAAACAAAGCTGTCACCGGAGNTGCGTGGTACGTTATATTCC SEQIDNO:61 GTCCGGTCTGATGAGTCNNNNNNNGACGAAACAGCAAAAAGAAAAATAAAA ACTCGAG 6bpL1FA8-4/4bpL2N6 CCTAGGAAACAAACAAAGCTGTCACCGGAGNTGCGTGGTACGTTATATTCC SEQIDNO:62 GTCCGGTCTGATGAGTCCNNNNNNGGACGAAACAGCAAAAAGAAAAATAAA AACTCGAG 6bpL1N6/4bpL2FA8-11 CCTAGGAAACAAACAAAGCTGTCACCGGANNNNNNTCCGGTCTGATGAGTC SEQIDNO:63 TGCNTGGTACGTTATATTCRGGACGAAACAGCAAAAAGAAAAATAAAAACT CGAG 6bpL1N7/4bpL2FA8-11 CCTAGGAAACAAACAAAGCTGTCACCGGANNNNNNNTCCGGTCTGATGAGT SEQIDNO:64 CTGCNTGGTACGTTATATTCRGGACGAAACAGCAAAAAGAAAAATAAAAAC TCGAG 6bpL1FA8-11/3bpL2N6 CCTAGGAAACAAACAAAGCTGTCACCGGTGCNTGGTACGTTATATTCRGCC SEQIDNO:65 GGTCTGATGAGTCNNNNNNGACGAAACAGCAAAAAGAAAAATAAAAACTCG AG 6bpL1FA8-11/3bpL2N7 CCTAGGAAACAAACAAAGCTGTCACCGGTGCNTGGTACGTTATATTCRGCC SEQIDNO:66 GGTCTGATGAGTCNNNNNNNGACGAAACAGCAAAAAGAAAAATAAAAACTC GAG 6bpL1FA8-11/4bpL2N6 CCTAGGAAACAAACAAAGCTGTCACCGGTGCNTGGTACGTTATATTCRGCC SEQIDNO:67 GGTCTGATGAGTCCNNNNNNGGACGAAACAGCAAAAAGAAAAATAAAAACT CGAG 5bpL1FA8-4/3bpL2N7 CCTAGGAAACAAACAAAGCTGTCACCGGGNTGCGTGGTACGTTATATTCCG SEQIDNO:68 CCGGTCTGATGAGTCNNNNNNNGACGAAACAGCAAAAAGAAAAATAAAAAC TCGAG 3bpL1N7/5bpL2FA8-4 CCTAGGAAACAAACAAAGCTGTCACCNNNNNNNGGTCTGATGAGTCCCGNT SEQIDNO:69 GCGTGGTACGTTATATTCCGGGGACGAAACAGCAAAAAGAAAAATAAAAAC TCGAG 5bpL1FA8-11/3bpL2N7 CCTAGGAAACAAACAAAGCTGTCACCGTGCNTGGTACGTTATATTCRGCGG SEQIDNO:70 TCTGATGAGTCNNNNNNNGACGAAACAGCAAAAAGAAAAATAAAAACTCGA G 3bpL1N7/5bpFA8-11 cCTAGGAAACAAACAAAGCTGTCACCNNNNNNNGGTCTGATGAGTCCTGCN SEQIDNO:71 TGGTACGTTATATTCRGGGACGAAACAGCAAAAAGAAAAATAAAAACTCGA G Loopreplacement switch Sequence FA-4 AAACAAACAAAGCTGTCACCGGTGCATGGTACGTTATATTCAGCCGGTCTG SEQIDNO:72 ATGAGTCCTGGGGGGACGAAACAGCAAAAAGAAAAATAAAAA FA-6 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:73 ATGAGTCTTGAGGAGACGAAACAGCAAAAAGAAAAATAAAAA FA-7 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:74 ATGAGTCCACAGAGGGACGAAACAGCAAAAAGAAAAATAAAAA FA-9 AAACAAACAAAGCTGTCACCGGAGATGCGTGGTACGTTATATTCCGTCCGG SEQIDNO:75 TCTGATGAGTCCAGAGGGACGAAACAGCAAAAAGAAAAATAAAAA FA-11 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:76 ATGAGTCTTGGAGAGACGAAACAGCAAAAAGAAAAATAAAAA FA-12 AAACAAACAAAGCTGTCACCGGAGTTGCGTGGTACGTTATATTCCGTCCGG SEQIDNO:77 TCTGATGAGTCCAAAGGGGACGAAACAGCAAAAAGAAAAATAAAAA FA-14 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:78 ATGAGTCTTGAAGAGACGAAACAGCAAAAAGAAAAATAAAAA FA-18 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:79 ATGAGTCTTCAAGAGACGAAACAGCAAAAAGAAAAATAAAAA FA-19 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:8- ATGAGTCCAAAGGGGGACGAAACAGCAAAAAGAAAAATAAAAA FA-22 AAACAAACAAAGCTGTCACCGGAGGTGTAGTCCGGTCTGATGAGTCCGTTG SEQIDNO:81 CGTGGTACGTTATATTCCGGGACGAAACAGCAAAAAGAAAAATAAAAA FA-27 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:82 ATGAGTCCTGGAGGGACGAAACAGCAAAAAGAAAAATAAAAA FA-32 AAACAAACAAAGCTGTCACCGGAGTTGCGTGGTACGTTATATTCCGTCCGG SEQIDNO:83 TCTGATGAGTCTAGAAGAGACGAAACAGCAAAAAGAAAAATAAAAA FA-34 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:84 ATGAGTCTTAAAGAGACGAAACAGCAAAAAGAAAAATAAAAA FA-58 AAACAAACAAAGCTGTCACCGGTGCTTGGTACGTTATATTCAGCCGGTCTG SEQIDNO:85 ATGAGTCCATAGAGGGACGAAACAGCAAAAAGAAAAATAAAAA Ribozymecontrols Sequence sTRSVConti AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTACGTGAGGTCCGTGA SEQIDNO:86 GGACAGAACAGCAAAAAGAAAAATAAAAA sTRSV AAACAAACAAAGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGA SEQIDNO:87 GGACGAAACAGCAAAAAGAAAAATAAAAA
[0184] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.