MORTIERELLA ALPINE URACIL AUXOTROPH WITH URA5 GENE KNOCKED OUT THROUGH HOMOLOGOUS RECOMBINATION
20180237789 ยท 2018-08-23
Assignee
Inventors
- Haiqin Chen (Wuxi, CN)
- Wei Chen (Wuxi, CN)
- Yongquan Chen (Wuxi, CN)
- Guangfei HAO (Wuxi, CN)
- Xin Tang (Wuxi, CN)
- Zhennan Gu (Wuxi, CN)
- Jianxin Zhao (Wuxi, CN)
- Hao Zhang (Wuxi, CN)
Cpc classification
C12Y204/0201
CHEMISTRY; METALLURGY
International classification
Abstract
It relates to a Mortierella alpine ATCC32222 uracil auxotroph strain and a construction method thereof. In the present invention, Mortierella alpine ATCC32222 is used as a material and undergoes gene knockout through an Agrobacterium tumefaciens mediated genetic manipulation technology, to obtain the Mortierella alpine uracil auxotroph. The method is of great significance for the basic theoretic researches of the oil producing fungus Mortierella alpine ATCC32222 and product development.
Claims
1. A method of constructing a Mortierella alpina ATCC 32222 uracil auxotroph strain, which is generated by inactivating the ura5 encoding orotate phosphoribosyltransferase (OPRTase), in which the inactivation is achieved through the deletion of the 18 bp (from 213 bp to 230 bp) of the 654 bp ura5 genome DNA having a nuclei acid sequence shown as SEQ ID NO: 2, characterized in that it inactivates ura5 gene through the deletion of the 18 bp (from 213 bp to 230 bp) of the 654 bp in Mortierella alpina by homologous recombination, in which the homologous DNA sequences are the 1393 bp (from ?1180 bp to +212 bp) up-stream and the 1362 bp (from +231 bp to +1592 bp) down-stream of the M. alpina ura5 genome DNA sequence having a nuclei acid sequence shown as SEQ ID NO: 3, the steps of the said method are as follows: acquisition of the up- and down-stream sequences of ura5 gene; construction of knockout plasmid pBIG4KOura5; transformation of Agrobacterium tumefaciens C58C1 with plasmid pBIG4KOura5; transformation of M. alpina with the A. tumefaciens C58C1 (harboring pBIG4KOura5) using the Agrobacterium tumefaciens-mediate transformation (ATMT) method, then screening and identifying the uracil auxotroph to obtain the uracil auxotrophic stain of M. alpine; wherein the uracil auxotrophic stain of M. alpine is Mortierella alpina MAU1 deposited at the General Microbiology Culture Collection Center of China Committee for Culture Collection of Microorganisms under accession number CGMCC No. 8414.
2. The method according to claim 1, characterized in that the starting plasmid of Agrobacterium tumefaciens used for gene knockout is pBIG2RHPH2 having a nuclei acid sequence shown as SEQ ID NO: 1.
3. The method according to claim 2, characterized in that construction of the gene knockout plasmid comprises: (a) amplifying MCS DNA fragment by PCR using plasmid pBluescript II SK+ as template; (b) digesting MCS DNA fragment and plasmid pBIG2RHPH2 by EcoRI and XbaI, and ligating them together at the EcoRI and XbaI sites to form the plasmid pBIG4; (c) PCR amplifying the up- and down-stream arms of ura5 gene and ligating them together by using fusion PCR to form knockout DNA sequence; (d) digesting the KOura5 knockout DNA sequence and pBIG4 by EcoRI and KpnI, and ligating them together to form plasmid pBIG4KOura5.
4. The method according to claim 3, characterized in that the knockout DNA sequence in step (c) is constructed as the following steps: designing the primers according to the sequence data of NCBI: TABLE-US-00008 P1: (SEQIDNO:5) GACCGGAATTCCGACGCTGACATTACACATTTATCC P2: (SEQIDNO:6) TGACGGTGGTGCAGGCCAGAGGGCCAAAGATGATGTCGTGCTCAATG P3: (SEQIDNO:7) TTGAGCACGACATCATCTTTGGCCCTCTGGCCTGCACCACCGTCATT P4: (SEQIDNO:8) TGCGGGGTACCCATGCGAATCACAGATATGG subsequently, PCR amplifying up- and down-stream DNA fragments by using P1/P2 and P3/P4 with M. alpina ATCC 32222 genome DNA as template, then performing fusion PCR by using P1/P4 with up- and down-stream DNA fragments as templates to amplify the KOura5 knockout DNA sequence.
5. The method according to claim 4, characterized in that the following primers are designed according to the sequence of pBluescript II SK+: TABLE-US-00009 MCSF: (SEQIDNO:9) TTTCGCTAGCACGACGTTGTAAAACGACGGCCAGT MCSR: (SEQIDNO:10) AACAACAATTGGGGCTCCACCGCGGTGGCGGCCG then the MCS DNA fragment in step (a) is amplified by PCR using primer pair MCSF/MCSR with pBluescript II SK.sup.+ as template.
6. The method according to claim 5, characterized in that the A. tumefaciens mediated gene knockout method consists in using the ATMT method to transform M. alpina, specified as follows: mixing equal volume of A. tumefaciens and M. alpina spores, then spreading on the cellophane membrane placed on the IM solid medium, after co-cultivation, screening and obtaining the uracil auxotrophic strains of M. alpina.
Description
DESCRIPTION OF THE ATTACHED DRAWINGS
[0037]
[0038]
[0039]
EMBODIMENTS
[0040] The following Embodiments further illustrate the present invention. The experimental methods without indicating specific conditions in the following examples will be performed generally in accordance with the manual of molecular cloning experiments.
Example 1: The Bioinformatics Analysis of M. alpina Genome
[0041] Compare the protein coding sequence, which was predicted based on the M. alpina ATCC 32222 genome (DDBJ/EMBL/GenBank accession ADAG00000000, first version ADAG01000000), to the database NR (www.ncbi.nlm.nih.gov), KOGs and COGs, KEGG, Swiss-Prot, UniRef100, and BRENDA using BLAST (E-value 1E-5). Search InterProScan against protein domain databases with default parameter settings. Predict the 654 bp ura5 gene coding sequence and find no intron exists. Search the M. alpina genome sequence with the sequence of ura5 gene for the up- and down-stream sequence.
Example 2: Obtaining the KOura5 DNA Fragment
[0042] Find the conserved active site of the protein sequence of M. alpina OPRTase (
[0043] First, design primers based on the bioinformatics analysis.
TABLE-US-00003 P1: GACCGGAATTCCGACGCTGACATTACACATTTATCC P2: TGACGGTGGTGCAGGCCAGAGGGCCAAAGATGATGTCGTGCTCAATG P3: TTGAGCACGACATCATCTTTGGCCCTCTGGCCTGCACCACCGTCATT P4: TGCGGGGTACCCATGCGAATCACAGATATGG
[0044] Introduce EcoRI and KpnI into the 5 site of P1 and P4. PCR amplify the up- and down-stream fragments of ura5 gene with M. alpina genome as template, followed by a gel purification. Ligate the two fragments using fusion PCR with primer pair P1/P4 using the up- and down-stream fragments as templates.
Example 3: Construction of the Knockout Plasmid pBIG4KOura5
[0045] Design primers according to the sequence of plasmid pBluescript II SK+:
TABLE-US-00004 MCSForward: TTTCGCTAGCACGACGTTGTAAAACGACGGCCAGT MCSReverse: AACAACAATTGGGGCTCCACCGCGGTGGCGGCCG
[0046] MCS DNA fragment was amplified from plasmid pBluescript II SK+.
[0047] Digest the MCS fragment and plasmid pBIG2RHPH2 with EcoRI and XbaI, followed by a gel purification and ligation. The 10 ?L ligation mixtures consisted of: MCS DNA fragment 2 ?L, plasmid 2 ?L, 10?T4 ligase buffer 1 ?L, T4 ligase 1 ?L and H.sub.2O 4 ?L. Ligate at the temperature of 4? C. for 12 h.
[0048] Directly transform the ligation product into Escherichia coli TOP10 competent cell. The electro transformation comprises:
[0049] (a) Take out 100 ?L competent cells under sterile conditions, add 1 to 2 ?L ligation product and mix.
[0050] (b) Transfer the mixture of step (a)(1) into cuvette, avoiding to make air bubbles.
[0051] (c) Transfer the cuvette into the Bio-Rad electroporation device, select the appropriate program and click pulse.
[0052] (d) Transfer the pulsed competent cell into 900 ?L SOC medium and incubate at the temperature of 37? C. at 150 rpm for 1 h.
[0053] (e) Transfer 200 ?L of the culture onto YEP plate (containing 100 ?g/mL kanamycin) and spread with a sterile stick. Inverted incubate overnight at the temperature of 37? C.
[0054] Select the positive transformants and extract the plasmid. Analyze the sequence by ABI PRISM 3730. The resulted plasmid is named as pBIG4.
[0055] Digest KOura5 DNA fragment and plasmid pBIG4 with Nhe/MunI and EcoRI/KpnI, followed by the gel purification and ligation. Ligate with the ligase T4. Transform the reaction mixture into TOP10 competent, select positive clone and analysis of the DNA sequence proves ligation successful. The resulted plasmid is named as pBIG4KOura5.
[0056] The SOC medium was composed of 20 g/L Tryptone, 5 g/L yeast extract, 0.5 g/L NaCl, 2.5 mM KCl, 10 mM MgCl.sub.2 and 20 mM glucose; The YEP solid medium was composed of 10 g/L Tryptone, 10 g/L yeast extract, 5 g/L NaCl and 20 g/L agar.
Example 4: ATMT of M. alpina
[0057] The transformation was optimized according to the method referred to the open accessed articles, the detailed steps are as follows:
[0058] (i) Take out the A. tumefaciens C58C1 (harboring pBIG4KOura5) preserved at the temperature of ?80? C. and separate by stripping on the TEP solid plate (containing 100 ?g/mL rifampicin and 100 ?g/mL kanamycin) to obtain single clone by cultured at the temperature of 30? C. for 48 h.
[0059] (ii) Transfer a single clone to 20 mL YEP medium (containing 100 ?g/mL rifampicin and 100 ?g/mL kanamycin) and cultured at the temperature of 30? C. for 48 h with shaking at 200 rpm in the dark.
[0060] (iii) Collect A. tumefaciens by centrifuging at 4000?g for 5 min. After remove the suspension, suspend pellet by 5 mL of IM medium, followed by a centrifugation at 4000?g for 5 min. After remove the suspension, add 2 mL of IM medium to suspend the bacterium.
[0061] (iv) Adjust the concentration of the bacterium suspension to OD600=0.9, followed by a dark cultivation at the temperature of 30? C. to OD600=1.5;
[0062] (v) Collect the M. alpina spores and count the number, then adjust the spore concentration to 10.sup.6/100 ?L;
[0063] (vi) Mix equal volume of 100 ?L of A. tumefaciens and spores and spread on the cellophane membrane placed on the IM solid medium, then incubate at the temperature of 23? C. for 48 to 96 h in a dark incubator;
[0064] (vii) Transfer the cellophane membrane onto GY plate containing 100 ?g/mL cefotaxime, 100 ?g/mL spectinomycin and 0.05 g/L uracil, then incubate at the temperature of 25? C. to 30? C. until spores appears.
[0065] Wherein, the liquid YEP medium was composed of 10 g/L Tryptone, 10 g/L yeast extract and 5 g/L NaCl.
Example 5: Screening and Identification of M. alpina Uracil Auxotroph
[0066] (a) Scour the surface of the co-cultured template with 3 mL of saline solution. Collect the solution with 1.5 mL tube and filter with 25 ?m membrane.
[0067] (b) Spread 200 ?L of the solution onto GY plate (containing 1 mg/mL 5-FOA, 100 ?g/mL spectinomycin, 100 ?g/mL cefotaxime and 0.05 g/L uracil).
[0068] (c) Incubate the plate at the temperature of 25? C. for 5 to 10 days in the dark.
[0069] (d) Transfer the visible mycelium onto GY plate (containing 1 mg/mL 5-FOA, 100 ?g/mL spectinomycin, 100 ?g/mL cefotaxime and 0.05 g/L uracil), and cultivate at the temperature of 25? C. for 2 to 4 days in a dark incubator.
[0070] (e) Transfer the well grown mycelium in step (d) separately onto the SC plate containing uracil and the SC plate without uracil. Cultivate at the temperature of 25? C. for 2 to 4 days.
[0071] (f) Observe the growth of the mycelium on the two SC plates. Select the mycelium only grown on the SC plate containing uracil and then transfer them onto the GY medium slant containing 0.5 mg/mL 5-FOA.
[0072] (g) Culture the M. alpina spores of step (f) for 3 generations on GY medium slant containing 0.5 mg/mL 5-FOA. Repeat the experiment described in step (e) each generation.
[0073] (h) Identify the genetic stable strains as uracil auxotrophic phenotype and preserve on GY medium slant containing 0.5 mg/mL 5-FOA.
[0074] (i) Extract the genome of the uracil auxotroph and PCR for ura5 gene with the primers below:
TABLE-US-00005 Forward: ATGACCATCAAGGATTACCAGCGCG Reverse: ATCCTTAAACACCGTACTTCTCGCG
[0075] Purify the PCR product and analyze sequence by ABI PRISM 3730. Identify the gene as loss of 213 bp to 230 bp.
Example 6: Extraction and Analysis of the Fatty Acids of M. alpina Uracil Auxotroph
[0076] (a) Culture the M. alpina prototrophic strain and three M. alpina uracil auxotroph strains screened in Example 5 in ferment medium (adding extra 0.05 g/L uracil for auxotroph strains) at the temperature of 25? C. at 200 rpm for 7 to 14 days.
[0077] Wherein, the ferment medium is available on the market, and is composed of 50 g/L glucose, 2.0 g/L L-Ammonium tartrate, 7.0 g/L KH.sub.2PO.sub.4, 2.0 g/L Na.sub.2HPO.sub.4, 1.5 g/L MgSO.sub.4.7H.sub.2O, 1.5 g/L Yeast extract, 0.1 g/L CaCl.sub.2.2H.sub.2O, 8 mg/L FeCl.sub.3.6H.sub.2O, 1 mg/L ZnSO.sub.4.7H.sub.2O, 0.1 mg/L CuSO.sub.4.5H.sub.2O, 0.1 mg/L Co(NO.sub.3).sub.2.6H.sub.2O and 0.1 mg/L MnSO.sub.4.5H.sub.2O.
[0078] (b) Collect mycelia and freeze-dry.
[0079] (c) Mix 100 mg mycelia (dry weight) with 2 mL of 4 mol/L HCl.
[0080] (d) Water bath at 80? C. for 0.5 h, then at ?80? C. for 15 min. Repeat once. Then water bath at 80? C. for 0.5 h.
[0081] (e) Cool down the mixture to room temperature, add 1 mL methanol and well mix.
[0082] (f) Add 1 mL chloroform and shake for 10 min, followed by centrifuge at 6000?g for 3 min. Collect the chloroform.
[0083] (g) Repeat step (f) for two times.
[0084] (h) Combine chloroform (3 mL), add 1 mL saturated NaCl solution, mix well and centrifuge at 3000?g for 3 min. Transfer the chloroform into a new tube. Add 1 mL chloroform in the residual liquid, followed by centrifugation at 3000?g for 3 min. Combine all the chloroform (4 mL)
[0085] (i) After drying by nitrogen blow, add 1 mL ethyl ether. Transfer the solution to a clean and weighed tube, followed by drying by nitrogen blow, then weigh it to obtain total fatty acid weight. The total fatty acid content of prototrophic and three uracil auxotroph M. alpina are listed in Table 1.
TABLE-US-00006 TABLE 1 The total fatty acid of prototrophic and three uracil auxotroph M. alpina Dry Weight Fatty Acid Content Strains (mg) (%) MA 46.2 30.64 ? 0.035 MAU1 49.0 30.56 ? 0.026 MAU2 50.5 30.72 ? 0.036 MAU3 52.1 30.60 ? 0.029
[0086] (j) Analyze the fatty acids by GC
[0087] The total fatty acid composition of prototrophic and three uracil auxotroph M. alpina are listed in Table 2.
TABLE-US-00007 TABLE 2 The total fatty acid composition of prototrophic and three uracil auxotroph M. alpina Fatty Acid Composition (%) Strains 16:0 18:0 18:1 18:2 18:3 20:3 20:4 22:0 24:0 MA 14.98 10.73 8.91 15.60 2.61 1.97 34.53 1.27 1.79 MAU1 13.59 10.98 9.40 17.17 2.59 1.81 34.50 1.21 1.57 MAU2 14.4 11.35 9.67 16.83 2.56 1.90 34.84 1.26 1.62 MAU3 13.56 10.48 9.17 16.43 2.43 1.66 34.16 1.20 1.54
[0088] The results of experiments show that the uracil auxotrophic M. alpina that constructed according to the method of the experiments has genetic stability after cultured for multiple generations, and its fatty acid analysis shows no distinguished difference between that of prototrophic M. alpina strains. The strain constructed according to the method of the present invention could be taken as the recipient strain for genetic engineering.
[0089] Above-mentioned preferred embodiments are not intended to limit the present invention. Those skilled in the art, without departing from the spirit and scope of the present invention, can make a variety of variations and modifications. Therefore, the protection scope of the present invention shall be based on the claims.