LIBRARIES FOR MUTATIONAL ANALYSIS

20220356463 · 2022-11-10

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided herein are compositions and methods for identifying genomic variants. Further provided herein are standards useful for determining the analytical sensitivity and/or accuracy of instruments configured to measure nucleic acid variant frequencies.

    Claims

    1. A polynucleotide library comprising: a sample polynucleotide set comprising at least 100 polynucleotides derived from genomic sequences; and a background set comprising background polynucleotides, wherein the background set comprises cell-free DNA (cfDNA), wherein each of the least 100 polynucleotides of the sample polynucleotide set comprises at least one variant, wherein the at least one variant comprises one or more changes compared to a background polynucleotide; and at least 2 polynucleotides of the at least 100 polynucleotides are tiled across each of the at least one variant.

    2. (canceled)

    3. The library of claim 1, wherein the sample polynucleotide set comprises at least 150 variants.

    4.-9. (canceled)

    10. The library of claim 1, wherein the sample polynucleotide set comprises no more than 10% of the total amount of polynucleotides in the library.

    11. The library of claim 1, wherein the at least one variant is present at a frequency of 0.01-5% relative to a wild-type genomic sequence.

    12. (canceled)

    13. (canceled)

    14. The library of claim 1, wherein at least 90% of the at least one variants is present at a frequency of no more than 10% relative to the frequency of other variants.

    15.-19. (canceled)

    20. The library of claim 1, wherein the at least one variant comprises an insertion, deletion, fusion, duplication, frameshift, repeat expansion, or substitution.

    21.-26. (canceled)

    27. The library of claim 1, wherein the at least one variant is located in one or more of genes ABL1, ABL2, AKT1, ALK, APC, AR, ARAF, ARID1A, ATM, ATR, BAP1, BRAF, BRCA1, BRCA2, CCND1, CDC6, CDH1, CDK12, CDK4, CDX2, CTNNB1, DDR2, EGFR, EML4, ERBB2, ERBB3, ERG, ESR1, EZH2, FBXW7, FGFR1, FGFR2, FGFR3, FLT3, FOXA1, FOXL2, GATA3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, IDH2, JAK2, KDM5C, KDM6A, KIF5B, KIT, KRAS, MAP2K1, MAPK1, MET, MIR4728, ERBB2, MLH1, MPL, MYCN, MYD88, NCOA4, NF1, NF2, NFE2L2, NOTCHI, NPM1, NRAS, PBRM1, PDGFRA, PIK3CA, PTEN, PTPN11, RET, RHEB, RHOA, RIT1, ROS1, SETD2, SMAD4, SMO, SPOP, TERT, TMPRSS2, TP53, TPR, TSC1, and VHL.

    28. The library of claim 27, wherein the at least one variant is located in ten or more of genes ABL1, ABL2, AKT1, ALK, APC, AR, ARAF, ARID1A, ATM, ATR, BAP1, BRAF, BRCA1, BRCA2, CCND1, CDC6, CDH1, CDK12, CDK4, CDX2, CTNNB1, DDR2, EGFR, EML4, ERBB2, ERBB3, ERG, ESR1, EZH2, FBXW7, FGFR1, FGFR2, FGFR3, FLT3, FOXA1, FOXL2, GATA3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, IDH2, JAK2, KDM5C, KDM6A, KIF5B, KIT, KRAS, MAP2K1, MAPK1, MET, MIR4728, ERBB2, MLH1, MPL, MYCN, MYD88, NCOA4, NF1, NF2, NFE2L2, NOTCHI, NPM1, NRAS, PBRM1, PDGFRA, PIK3CA, PTEN, PTPN11, RET, RHEB, RHOA, RIT1, ROS1, SETD2, SMAD4, SMO, SPOP, TERT, TMPRSS2, TP53, TPR, TSC1, and VHL.

    29.-31. (canceled)

    32. The library of claim 1, wherein the background polynucleotide set comprises wild-type regions corresponding to locations of the at least one variant.

    33. The library of claim 32, wherein the wild-type regions are represented within 10% of the variant frequency of the variant set.

    34.-36. (canceled)

    37. The library of claim 1, wherein at least 90% of the polynucleotides in the background set are mononucleosomal or dinucleosomal.

    38.-42. (canceled)

    43. The library of claim 1, wherein at least one background polynucleotide comprises a variant present at a frequency of 0.001%, 0.01%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence.

    44. A kit for measuring variant detection limits comprising: a. The library of claim 1; b. instructions for use of the kit; and c. packaging configured to hold and describe the kit contents.

    45.-47. (canceled)

    48. A method of preparing the library of claim 1 comprising: a. providing the background polynucleotide set; b. synthesizing the sample polynucleotide set from predetermined sequences; and c. mixing the variant set and the background set in a buffer.

    49.-54. (canceled)

    55. The method of claim 48, further comprising determining the variant frequency in the background polynucleotide set, where the variants correspond to the at least one variant in the sample polynucleotide set.

    56.-57. (canceled)

    58. A method of preparing a nucleic acid test sample useful for determining the detection limit of genomic variants comprising: a. providing a library of claim 1; b. obtaining at least one test sample from a patient suspected of having a disease or condition; c. detecting the presence or absence of the one or more variants in the library of claim 1; and d. detecting the presence or absence of the one or more variants in the at least one test sample.

    59.-60. (canceled)

    61. The method of claim 58, wherein detecting comprises sequencing by synthesis, nanopore sequencing, or SMRT sequencing.

    62.-75. (canceled)

    76. The method of claim 58, wherein detecting comprises addition of one or more adapters to at least some sample polynucleotides in the library.

    77. The method of claim 76, wherein the one or more adapters comprise at least one barcode.

    78. (canceled)

    79. The method of claim 77, where at least one adapter of the one or more adaptors comprises a duplex adapter.

    80.-83. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0009] FIG. 1A depicts a design of synthetic ctDNA to target a variant site. Multiple overlapping or “tiled” polynucleotides are configured to contain the variant site (indicated with a star). The x-axis is labeled genome coordinate from 0-300 at 100 unit intervals; the y-axis is labeled oligos.

    [0010] FIG. 1B depicts a distribution of indel sizes for a synthetic ctDNA library, including short, medium (5-10 bp), and large size variants (˜30 bp). Positive numbers are insertions, and negative numbers are deletions. The y-axis is labeled number of variants from 0 to 40 at 20 unit intervals; the x-axis is labeled indel size (bp) from −30 to 10 at 10 unit intervals.

    [0011] FIG. 1C depicts a plot of signal (representative of abundance) vs. size for background cell-free DNA (cfDNA). The background cfDNA was obtained from healthy donor plasma. The y-axis is labeled fluorescence units (FU) from 0 to 400 at 50 unit intervals; the x-axis is labeled base pairs (bp) at 35, 100, 150, 200, 300, 400, 500, 600, 1000, 2000, 10380. Peak 1 and peak 2 are labeled.

    [0012] FIG. 2 depicts an image of a plate having 256 clusters, each cluster having 121 loci with polynucleotides extending therefrom.

    [0013] FIG. 3A depicts a plot of polynucleotide representation (polynucleotide frequency versus abundance, as measured absorbance) across a plate from synthesis of 29,040 unique polynucleotides from 240 clusters, each cluster having 121 polynucleotides.

    [0014] FIG. 3B depicts a plot of measurement of polynucleotide frequency versus abundance absorbance (as measured absorbance) across each individual cluster, with control clusters identified by a box.

    [0015] FIG. 4 illustrates a computer system.

    [0016] FIG. 5 is a block diagram illustrating an architecture of a computer system.

    [0017] FIG. 6 is a diagram demonstrating a network configured to incorporate a plurality of computer systems, a plurality of cell phones and personal data assistants, and Network Attached Storage (NAS).

    [0018] FIG. 7 is a block diagram of a multiprocessor computer system using a shared virtual address memory space.

    [0019] FIG. 8A-1 depicts a cfDNA library target (white region “GACCTGG”) in a genomic region. Figure discloses SEQ ID NO: 78.

    [0020] FIG. 8A-2 depicts a cfDNA library design without the flanks added, to show the location of each of the variants (white regions) across each molecule in the library. The dashed line separates the left and right sections of the figure. Figure discloses SEQ ID NO: 79.

    [0021] FIG. 8B depicts sequencing results for original and expanded cfDNA libraries as a function of reads vs. template length. Data series are Supplier_v1_noexpansion; Supplier_v2; v2_1_exoIII; and v_2_2. The y-axis is labeled number of reads from 0 to 60,000 at 10,000 unit intervals; the x-axis is labeled template length from 100-600 at 100 unit intervals.

    [0022] FIG. 8C depicts sequencing results for original and expanded cfDNA libraries as a function of the percent of reads with no soft-clipping. The y-axis is labeled percent of reads with no soft-clip; the x-axis is labeled sample name (left to right): Supplier_v2; v_2_2; v2_1_exoIII; and Supplier vi No expansion.

    [0023] FIG. 9A depicts a graph showing the size distribution of cfDNA fragments generated using uracil-containing adapters. The y-axis is labeled fluorescence units (FU) from 0 to 400 at 50 unit intervals; the x-axis is labeled base pairs (bp) at 35, 100, 150, 200, 300, 400, 500, 600, 1000, 2000, 10380. Peak 1 and peak 2 are labeled.

    [0024] FIG. 9B depicts a graph showing the size distribution of cfDNA fragments generated using uracil-containing adapters having a 3′ phosphorothioate bond. The y-axis is labeled fluorescence units (FU) from 0 to 400 at 50 unit intervals; the x-axis is labeled base pairs (bp) at 35, 100, 150, 200, 300, 400, 500, 600, 1000, 2000, 10380. Peak 1 and peak 2 are labeled.

    [0025] FIG. 9C depicts a graph showing the size distribution of cfDNA fragments generated using uracil-containing adapters having three 3′ phosphorothioate bonds. The y-axis is labeled fluorescence units (FU) from 0 to 400 at 50 unit intervals; the x-axis is labeled base pairs (bp) at 35, 100, 150, 200, 300, 400, 500, 600, 1000, 2000, 10380. Peak 1 and peak 2 are labeled.

    [0026] FIG. 10A depicts a workflow for attachment of adapters comprising unique molecular identifiers (UMIs) to a polynucleotide to form an adapter-ligated polynucleotide.

    [0027] FIG. 10B depicts a workflow for amplification of adapter-ligated polynucleotides to form a library for sequencing.

    [0028] FIG. 10C depicts a workflow for synthesis of a polynucleotide adapter comprising a UMI.

    [0029] FIG. 10D depicts a workflow for synthesis of a polynucleotide adapter comprising a UMI, wherein the method comprises PCR extension of one strand of the adapter.

    [0030] FIG. 10E depicts a workflow for synthesis of a polynucleotide adapter comprising a UMI, wherein the method comprises PCR extension of one strand of the adapter, followed by restriction enzyme cleavage.

    [0031] FIG. 10F depicts a workflow for synthesis of a polynucleotide adapter comprising a UMI, wherein the method comprises restriction enzyme cleavage.

    [0032] FIG. 11 depicts a workflow for duplex sequencing analysis to identify variants. “*” indicates potential errors introduced by PCR or sequencing, and “+” indicates true variants.

    [0033] FIG. 12 depicts a plot of UMI performance (32 UMIs) for a ctDNA sample. Two different UMI sources were used.

    [0034] FIG. 13A depicts a plot of UMI performance for each UMI barcode. Two different UMI sources were used.

    [0035] FIG. 13B depicts a plot of UMI performance for each UMI barcode. Two different UMI sources were used, for two different runs (circles vs. squares).

    [0036] FIG. 14A depicts a plot of UMI performance using Fold-80 base penalty. Two different runs were conducted.

    [0037] FIG. 14B depicts a plot of UMI performance using HS library size. Two different runs were conducted.

    [0038] FIG. 14C depicts a plot of UMI performance using percent off bait. Two different runs were conducted.

    [0039] FIG. 15A depicts a plot of UMI performance using percent duplex family size for a number of samples.

    [0040] FIG. 15B depicts a plot of UMI performance using family size for a first experiment.

    [0041] FIG. 15C depicts a plot of UMI performance using family size for a second experiment.

    [0042] FIG. 15D depicts a plot of UMI performance using family size for a first UMI library source.

    [0043] FIG. 15E depicts a plot of UMI performance using family size for a second UMI library source.

    [0044] FIG. 16 depicts a plot of UMI duplex efficiency as a function of different UMI blends.

    [0045] FIG. 17A depicts plots of precision (left) and recall (right) with filtering recurrent variants.

    [0046] FIG. 17B depicts plots of precision (left) and recall (right) without filtering recurrent variants.

    [0047] FIG. 17C depicts a plot of recall for single base substitution variants (SBS).

    [0048] FIG. 17D depicts plots of precision (left) and recall (right) with a 2-1-1 filter.

    [0049] FIG. 18 depicts a plot of recall for single base substitution variants (SBS). The left set of bars in each set are variant calls (Mutect2) and the right set are raw pileups.

    [0050] FIG. 19A depicts a plot of recall using 20000× downsampling and a 2-2-1 filter. The left set of bars in each set are calls and the right set are pileups.

    [0051] FIG. 19B depicts a plot of recall using no downsampling and a 1-0-0 filter. The left set of bars in each set are calls and the right set are pileups.

    [0052] FIG. 19C depicts a plot of variant calls for unfiltered reads for various indel lengths.

    [0053] FIG. 19D depicts a plot of raw pileups for unfiltered reads and various indel lengths (left to right for each set: 0, 1, 2-4, 5-9, 10+).

    [0054] FIG. 19E depicts a plot of variant calls for various indel lengths (left to right for each set: 0, 1, 2-4, 5-9, 10+) using no downsampling and a 1-1-0 filter.

    [0055] FIG. 19F depicts a plot of raw pileups for various indel lengths (left to right for each set: 0, 1, 2-4, 5-9, 10+) using 20000× downsampling and a 1-1-0 filter.

    DETAILED DESCRIPTION

    [0056] Described herein are compositions and methods for identification of genomic variants. Further provided herein are polynucleotide libraries configured as references or controls to measure detection sensitivity. Further described herein are methods of identifying variants using adapters which comprise unique molecular identifiers (UMIs). UMIs in some instances provide for uniquely identification of individual members of a polynucleotide library, which enables molecular counting and identification of potential errors generated during preparation of a polynucleotide library prior to sequencing.

    Definitions

    [0057] Throughout this disclosure, numerical features are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiments. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention, unless the context clearly dictates otherwise.

    [0058] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items.

    [0059] Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers +/−10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.

    [0060] As used herein, the terms “preselected sequence”, “predefined sequence” or “predetermined sequence” are used interchangeably. The terms mean that the sequence of the polymer is known and chosen before synthesis or assembly of the polymer. In particular, various aspects of the invention are described herein primarily with regard to the preparation of nucleic acids molecules, the sequence of the oligonucleotide or polynucleotide being known and chosen before the synthesis or assembly of the nucleic acid molecules.

    [0061] The term nucleic acid encompasses double- or triple-stranded nucleic acids, as well as single-stranded molecules. In double- or triple-stranded nucleic acids, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). Nucleic acid sequences, when provided, are listed in the 5′ to 3′ direction, unless stated otherwise. Methods described herein provide for the generation of isolated nucleic acids. Methods described herein additionally provide for the generation of isolated and purified nucleic acids. The length of polynucleotides, when provided, are described as the number of bases and abbreviated, such as nt (nucleotides), bp (bases), kb (kilobases), Mb (megabases) or Gb (gigabases).

    [0062] Provided herein are methods and compositions for production of synthetic (i.e. de novo synthesized or chemically synthesizes) polynucleotides. The term oligonucleic acid, oligonucleotide, oligo, and polynucleotide are defined to be synonymous throughout. Libraries of synthesized polynucleotides described herein may comprise a plurality of polynucleotides collectively encoding for one or more genes or gene fragments. In some instances, the polynucleotide library comprises coding or non-coding sequences. In some instances, the polynucleotide library encodes for a plurality of cDNA sequences. Reference gene sequences from which the cDNA sequences are based may contain introns, whereas cDNA sequences exclude introns. Polynucleotides described herein may encode for genes or gene fragments from an organism. Exemplary organisms include, without limitation, prokaryotes (e.g., bacteria) and eukaryotes (e.g., mice, rabbits, humans, and non-human primates). In some instances, the polynucleotide library comprises one or more polynucleotides, each of the one or more polynucleotides encoding sequences for multiple exons. Each polynucleotide within a library described herein may encode a different sequence, i.e., non-identical sequence. In some instances, each polynucleotide within a library described herein comprises at least one portion that is complementary to sequence of another polynucleotide within the library. Polynucleotide sequences described herein may be, unless stated otherwise, comprise DNA or RNA. A polynucleotide library described herein may comprise at least 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 30,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, or more than 1,000,000 polynucleotides. A polynucleotide library described herein may have no more than 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 30,000, 50,000, 100,000, 200,000, 500,000, or no more than 1,000,000 polynucleotides. A polynucleotide library described herein may comprise 10 to 500, 20 to 1000, 50 to 2000, 100 to 5000, 500 to 10,000, 1,000 to 5,000, 10,000 to 50,000, 100,000 to 500,000, or 50,000 to 1,000,000 polynucleotides. A polynucleotide library described herein may comprise about 370,000; 400,000; 500,000 or more different polynucleotides.

    [0063] Libraries of Variants

    [0064] Provided herein are polynucleotide libraries configured to measure the sensitivity of variant measurements. In some instances, these libraries are used as references or controls. Known methods of generating such libraries may comprise isolating nucleic acids from biological sources (blood, plasma, cells, or patients) with an established disease or condition. However, such methods in some instances provide libraries which contain contamination from their biological source. In some instances, libraries are produced from biological samples to mimic cell-free DNA (cfDNA) by restriction digestion, sonication, or other method of generating short nucleic acid fragments. These methods may not mimic the natural fragmentation profile of cfDNA. Additionally, low abundance variants may not be detected from biologically-derived libraries. Provided herein are methods comprising design and de-novo synthesis of polynucleotide libraries (or sample sets) which are useful for measuring variant frequencies. Such libraries in some instances provide enhanced accuracy for diagnosing diseases or conditions, and are substantially free of biological contamination. Synthetic polynucleotide libraries in some instances provide additional control over library content, reliability/reproducibility, lack of reliance on fragmentation methods, or provide other advantages over traditional cell-derived libraries. These libraries (sample libraries or variant libraries) are in some instances mixed with control nucleic acids (e.g., cfDNA) to generate reference standards at specific VAFs (variant allele frequencies). In some instances, a polynucleotide library comprises a sample polynucleotide set comprising polynucleotides derived from genomic sequences. In some instances, a polynucleotide library comprises a background set comprising background polynucleotides, wherein the background set comprises cell-free DNA (cfDNA). In some instances, at least some of the polynucleotides of the sample polynucleotide set comprise at least one variant, wherein the at least one variant comprises one or more changes compared to a background polynucleotide. In some instances, at least some of the polynucleotides of the sample set are tiled across each of the at least one variant. In some instances, background cfDNA is obtained, derived, or expanded from a cell line or patient sample.

    [0065] Provided herein are libraries of polynucleotides comprising pre-determined variant sequences (e.g., variants). In some instances, libraries comprise at least 1, 5, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 750, 1000, or at least 2000 variants. In some instances, libraries comprise about 1, 5, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 750, 1000, or about 2000 variants. In some instances, libraries comprise no more than 1, 5, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 750, 1000, or no more than 2000 variants. In some instances, libraries comprise 1-500, 5-500, 10-500, 10-2000, 10-150, 15-500, 20-1000, 50-500, 50-750, 50-1000, 100-1000, 100-500, 100-750, 250-800, 400-1000, or 400-2000 variants.

    [0066] Polynucleotides provided herein may be tiled across a nucleic acid region. In some instances tiling describes the design of polynucleotides (or complements or reverse complements thereof) which cover or span a target area (such as a variant). An example of a tiling arrangement is shown in FIG. 1A. In some instances, tiling results in increases in sensitivity for detection either for probes targeting the variant, or in the design of corresponding standards, controls, or references. This is in some instances beneficial for regions of low abundance or comprising difficult sequences to sequence (repeating, high/low GC, or other challenge). In some instances, tiled polynucleotides for a target region are each different. Such tiling designs in some instances comprise about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 27, 30, 32, 35, 40, 45, or about 50 polynucleotides tiled across a region (e.g., variant). Tiling designs in some instances comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, or at least 50 polynucleotides tiled across a region. Tiling designs in some instances comprise 10-100, 5-50, 2-50, 25-50, 30-40, or 30-60 polynucleotides tiled across a region. In some instances, tiled polynucleotides comprise at least one overlap region with another polynucleotide. In some instances, both 5′ and 3′ termini of a tiled polynucleotide overlap with an adjacent tiled polynucleotide. In some instances, one or more tiled polynucleotides are tiled with an offset value, such that a first polynucleotide starts at a different position than the next tiled polynucleotide. In some instances, the offset is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, 25, or 30 bases. In some instances, the offset is 1-30, 1-20, 1-10, 1-8, or 2-5 bases. In some instances, the length of at least some of the polynucleotides is 20-500, 50-500, 75-500, 100-200, 100-500, 200-500, 100-250, 100-200, 100-1000, 250-500, or 250-1000. In some instances, the length of at least some of the polynucleotides is about 50, 75, 100, 125, 150, 155, 160, 165, 170, 175, 180, 190, 200, or 225 bases. In some instances, the length of at least 80% of the polynucleotides is 20-500, 50-500, 75-500, 100-200, 100-500, 200-500, 100-250, 100-200, 100-1000, 250-500, or 250-1000. In some instances, the length of at least 80% of the polynucleotides is about 50, 75, 100, 125, 150, 155, 160, 165, 170, 175, 180, 190, 200, or 225 bases. In some instances, the length of at least 90% of the polynucleotides is 20-500, 50-500, 75-500, 100-200, 100-500, 200-500, 100-250, 100-200, 100-1000, 250-500, or 250-1000. In some instances, the length of at least 90% of the polynucleotides is about 50, 75, 100, 125, 150, 155, 160, 165, 170, 175, 180, 190, 200, or 225 bases. In some instances, at least some of the polynucleotides are double stranded. In some instances, at least 50%, 60%, 70%, 75%, 80%, 90%, 95%, or at least 98% of the polynucleotides are double stranded.

    [0067] Variants may be present at a predetermined frequency relative to other variants in a library (e.g., sample library). In some instances, at least 80% of the at least one variants are present at frequencies that differ by no more than 20%, 15%, 12%, 10%, 8% or no more than 5% relative to the expected frequency for uniformly pooled variants. In some instances, at least 90% of the at least one variants are present at frequencies that differ by no more than 20%, 15%, 12%, 10%, 8% or no more than 5% relative to the expected frequency for uniformly pooled variants. In some instances, at least 95% of the at least one variants are present at frequencies that differ by no more than 20%, 15%, 12%, 10%, 8% or no more than 5% relative to the expected frequency for uniformly pooled variants. In some instances, at least 99% of the at least one variants are present at frequencies that differ by no more than 20%, 15%, 12%, 10%, 8% or no more than 5% relative to the expected frequency for uniformly pooled variants.

    [0068] Compositions described herein may comprise a background set (or library) of polynucleotides. The background set in some instances mimics the background cfDNA that would be present in a patient sample. In some instances, background polynucleotides are mixed with sample polynucleotides (e.g., polynucleotides comprising variants, variant polynucleotide libraries) to generate reference standards or controls. Standards or controls in some instances comprise variants having a VAF of 0%, 0.1% 0.25%, 0.5%, 1%, 2%, 5%, 10%, 15%, or 20% relative to a wild-type genomic sequence. In some instances, the background polynucleotide set comprises wild-type regions corresponding to locations of the at least one variant. In some instances, wild-type sequences are derived from a reference database or sample. In some instances, the background polynucleotide set comprises wild-type regions corresponding to locations of the at least 1, 2, 5, 10, 15, 20, 25, 50, 75, 100, 125, 150, 200, 250, 300, 350, 400, 450, 500, or at least 500 variants. In some instances, the wild-type regions are represented within 30%, 25%, 20%, 15%, 12%, 10%, 9%, 8%, 7%, or within 5% of the variant frequency of the variant set. In some instances, the background set comprises a low level amount of variations. In some instances, least one background polynucleotide comprises a variant present at a frequency of 0.001%, 0.01%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. In some instances, least 1% of the background polynucleotides comprise a variant present at a frequency of 0.001%, 0.01%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. In some instances, a background set is synthesized from pre-determined sequences. In some instances, the pre-determined sequences reflect desired variant frequencies. In some instances, synthetic background sets are used to calibrate instruments or methods by providing control over variant frequencies. In some instances, synthetic background sets are configured to mimic variant frequencies corresponding to specific samples or disease states.

    [0069] In some instances, a background set comprises background polynucleotides. In some instances, a background set comprises background polynucleotides which substantially consist of wild-type sequences. In some instances, background sets are derived or isolated from healthy individuals. In some instances, the individual is a male. In some instances, the individual is a female. In some instances, the individual is no more than 40, 35, 30, 25, 20, or 15 years old. In some instances, background sets are obtained from a biological sample. In some instances, the biological sample comprises blood, plasma, or other source of nucleic acids. In some instances, the background set comprises cfDNA. In some instances, background sets comprises at least 2, 5, 10, 100, 200, 500, 1000, 10,000, 100,000, 500,000 polynucleotides, 1 million, 5 million, 10 million, 50 million, 100 million, 200 million, or more than 500 million polynucleotides. In some instances, the highest abundance of polynucleotides in the background set are 100-500, 50-500, 75-250, 50-750, 50-300, 100-300, 100-200, 125-300, 150-175, 150-185, or 125-200 bases in length. In some instances, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 97% of the polynucleotides in the background set are mononucleosomal or dinucleosomal. In some instances, the ratio of mononucleosomal to dinucleosomal is 50:50 to 90:10, 60:40 to 90:10, 60:40 to 95:5, 70:30 to 95:5, 70:30 to 90:10, or 80:20 to 95:5.

    [0070] Polynucleotide libraries described herein may be mixed to form standards. In some instances, a (reference) standard comprises both a sample (variant) polynucleotide set and control polynucleotide. In some instances, standards comprising both a sample (variant) polynucleotide set and control polynucleotide set further comprise a liquid buffer. In some instances, the buffer comprises TE or TBE buffer. In some instances, standards comprise no more than 50%, 40%, 30%, 25%, 20%, 15%, or no more than 10% sample (variant) polynucleotides relative to background polynucleotides. Standards or controls in some instances comprise variants having a VAF of 0%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. In some instances, a standard is subjected to one or more quality control operations including one or more of fluorescence/UV DNA quantification, electrophoretic size analysis, sequencing, ddPCR analysis, or other analysis technique. In some instances, a sample polynucleotide set is subjected to one or more quality control operations including one or more of fluorescence/UV DNA quantification, electrophoretic size analysis, sequencing, ddPCR analysis, or other analysis technique prior to mixing with a background polynucleotide set. In some instances, adapters comprising UMIs are ligated to sample polynucleotides.

    [0071] Synthetic libraries (e.g., sample libraries/sets) comprising variants may have fewer contaminants (less contamination) than libraries derived from biological samples. A lower level of contaminants in some instances results in improved performance as a reference standard. In some instances, contamination includes but is not limited to cellular components, lipids, RNA, proteins, or other biomolecules derived from the biological source. In some instances, the biological source comprises plasma, cells, blood, or other source of nucleic acids. In some instances, synthetic libraries are prepared or stored in a buffer. In some instances, a synthetic library is at least 95%, 96%, 97%, 98%, 99%, 99.5%, or at least 99.7% free from biological contaminants.

    [0072] Genomic Variants

    [0073] Genetic variants (“variants” in nucleic acids) among populations of individuals may provide information regarding risk for diseases, identification of individuals, response to drug treatments, or susceptibility to environmental factors such as toxins. Compositions described herein in some instances involve synthesis of polynucleotide libraries which contain these variants. In some instances variants comprise a single nucleotide polymorphism (SNP), a single nucleotide variation (SNV), an indel, a copy number variation, a translocation, fusion, inversion, or structural variant. In some instances, a SNP differs between individuals in the same population. In some instance, an SNP differs between individuals in a different population. In some instances, an SNV comprises a variation in a single nucleotide without any limitations of frequency. Polynucleotide libraries (e.g., probe libraries) described herein are in some instances used to identify such variants after sequencing. In some instances, polynucleotide libraries are configured to enrich for nucleic acids (e.g., fragments of a genome) which comprise variants. Such nucleic acids in some instances are captured using the polynucleotide libraries and sequenced for calling variants. In some instances, variant calls may be assessed comparing to known variants using metrics such as recall and/or precision for one or all of the variants. In some instances, an SNP or SNV is heterozygous. In some instances, an SNP or SNV is homozygous. In some instances, an SNP or SNV is homozygous in matching a reference sequence. In some instances a variant is homozygous for a state other than that observed in the human reference genome. In some instances, variants are identified after sequencing by comparison to a reference database. In some instances the reference database comprises GiAB, dbSNP, DoGSD, dbGaP, clinvar, ncbi, refseq, refSNP, COSMIC, or other database which comprises known variants. In some instances, variants comprise an insertion, deletion, fusion, duplication, frameshift, repeat expansion, or substitution. In some instances, variants comprise a copy number variant (CNV), microsatellite instability, loss of heterozygosity (LOH), DNA methylation, premature stop codon, trinucleotide repeat, translocation, somatic rearrangement, allelomorph, single nucleotide variant (SNV), indel, splice variant, regulator variant, copy number variant, or fusion. In some instances indels are 1-50, 1-25, 1-20, 1-15, 2-20, 5-25, 5-15, or 5-10 bases in length. In some instances indels are not more than 1, 2, 3, 5, 7, 8, 10, 12, 15, 17, 20, 25, or no more than 50 bases in length. In some instances, a variant described herein is located in a gene. In some instances, a library described herein comprises variants found in at least 2, 5, 10, 15, 20, 25, 30, 50, 60, 75, 100, 125, 150, 200, 250, 300, 400, or at least 500 genes. In some instances, a library described herein comprises variants found in about 2, 5, 10, 15, 20, 25, 30, 50, 60, 75, 100, 125, 150, 200, 250, 300, 400, or about 500 genes. In some instances, a library described herein comprises variants found in 5-500, 5-100, 5-50, 10-200, 10-100, 25-500, 25-250, 25-150, 50-150, 50-250, 50-500, or 75-500 genes.

    [0074] Identification of variants in some instances is accomplished using imputed data. In some instances, identification of variants near a known or detected variant inform the identity of a variant no measured, or which lacks sequencing data to accurately call. In some instances, the unmeasured (or unknown) genomic variant is within 100 bases, 500 bases, 1,000 bases, 10,000 bases, 100,000 bases, or 1,000,000 bases of a measured (or identified) genomic variant or variants, or more, depending on linkage disequilibrium (the non-random association of alleles for different variants within a population) between the measured and unmeasured variants. In some instances linkage disequilibrium may be inferred by making use of information about recombination rates observed in a genome or population otherwise known genetic distance. In some instances recombination rates, genetic distance maps, and variants themselves in some instances vary between different populations.

    [0075] Variants may be present in a population of individuals, a single individual, tissue, or other group at different frequencies, such as in a genome. In some instances, genomic variants are co-occurring in less than 0.001, 0.01, 0.1, 0.5, 1, 1.5, 2, 5, 10, 20, 25, 50, or 75% of individuals in a group. In some instances, genomic variants are co-occurring in more than 0.001, 0.01, 0.1, 0.5, 1, 1.5, 2, 5, 10, 20, 25, 50, or 75% of individuals in a group. In some instances, genomic variants are co-occurring in about 0.001, 0.01, 0.1, 0.5, 1, 1.5, 2, 5, 10, 20, 25, 50, or 75% of individuals in a group. In some instances, genomic variants are co-occurring in 0.1-10%, 0.001-10%, 0.01-10%, 0.01-1%, 0.001-1%, 0.1-25%, 0.1-10%, or 0.1-5% of individuals in a group. In some instances, the occurrence of a variant is called a variant allele frequency (VAF).

    [0076] Described herein are variants for detecting a disease or condition. In some instances, the disease or condition is a proliferative disease. In some instances, the disease or condition is cancer. In some instances, a variant is present in an oncogene or tumor suppressor gene. In some instances, a variant is present in one or more of genes ABL1, ABL2, AKT1, ALK, APC, AR, ARAF, ARID1A, ATM, ATR, BAP1, BRAF, BRCA1, BRCA2, CCND1, CDC6, CDH1, CDK12, CDK4, CDX2, CTNNB1, DDR2, EGFR, EML4, ERBB2, ERBB3, ERG, ESR1, EZH2, FBXW7, FGFR1, FGFR2, FGFR3, FLT3, FOXA1, FOXL2, GATA3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, IDH2, JAK2, KDMSC, KDM6A, KIFSB, KIT, KRAS, MAP2K1, MAPK1, MET, MIR4728, ERBB2, MLH1, MPL, MYCN, MYD88, NCOA4, NF1, NF2, NFE2L2, NOTCHI, NPM1, NRAS, PBRM1, PDGFRA, PIK3CA, PTEN, PTPN11, RET, RHEB, RHOA, RIT1, ROS1, SETD2, SMAD4, SMO, SPOP, TERT, TMPRSS2, TP53, TPR, TSC1, and VHL. In some instances, a variant is present in one, two, three, five, seven, ten, 15, 20, 25 or more of genes ABL1, ABL2, AKT1, ALK, APC, AR, ARAF, ARID1A, ATM, ATR, BAP1, BRAF, BRCA1, BRCA2, CCND1, CDC6, CDH1, CDK12, CDK4, CDX2, CTNNB1, DDR2, EGFR, EML4, ERBB2, ERBB3, ERG, ESR1, EZH2, FBXW7, FGFR1, FGFR2, FGFR3, FLT3, FOXA1, FOXL2, GATA3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, IDH2, JAK2, KDM5C, KDM6A, KIF5B, KIT, KRAS, MAP2K1, MAPK1, MET, MIR4728, ERBB2, MLH1, MPL, MYCN, MYD88, NCOA4, NF1, NF2, NFE2L2, NOTCHI, NPM1, NRAS, PBRM1, PDGFRA, PIK3CA, PTEN, PTPN11, RET, RHEB, RHOA, RIT1, ROS1, SETD2, SMAD4, SMO, SPOP, TERT, TMPRSS2, TP53, TPR, TSC1, and VHL. In some instances, multiple variants are present in a single gene. In some instances, a variant is present in one, two, three, five, seven, ten, 15, 20, 25 or more of genes. In some instances, a variant is present in one, two, three, five, seven, ten, 15, 20, 25 or more of genes which are associated with a disease or condition.

    [0077] In some instances, the disease or condition is breast cancer. In some instances, a variant is present in one or more of genes TP53, PIK3CA, ERBB2, MYC, FGFR1/ZNF703, GATA3, CCND1, and CHD1 (e.g., CDH1*).

    [0078] In some instances, the disease or condition is lung cancer. In some instances, a variant is present in one or more of genes KRAS (e.g., K117N), EGFR, ROS, ALK, and BRAF.

    [0079] In some instances, the disease or condition is colorectal cancer. In some instances, a variant is present in one or more of genes TP53 APC, KRAS, BRAF, PIK3CA, SMAD4, FBXW7 (e.g., R465C), and NF1.

    [0080] In some instances, the disease or condition is bladder cancer. In some instances, a variant is present in one or more of TP53, FGFR3 (e.g., S249C), ARID1A and KDM6A.

    [0081] In some instances, the disease or condition is prostate cancer. In some instances, a variant is present in one or more of genes ETS (e.g., ETS-TMPRSS2), SPOP (e.g., F133V), TP53, FOXA1 (e.g., R219), and PTEN.

    [0082] In some instances, the disease or condition is kidney cancer. In some instances, a variant is present in one or more of genes PBRM1, SETD2, BAP1, KDM5C, MTOR, VHL, MET, NF2, KDM6A, SMARCB1, FH, and CDKN2A.

    [0083] In some instances, the disease or condition is melanoma. In some instances, a variant is present in one or more of genes NRAS, BRAF, PTEN, CDKN2A, MAP2K1, MAP2K2, GNAQ, GNA11, BAP (e.g., W196X).

    [0084] In some instances, a variant is described in Table 1.

    TABLE-US-00001 TABLE 1 mutation Gene description COSMIC_id chrom pos shift ref alt ARID1A Q1401* COSM51417 chr1 26774428 C T ARID1A M1564Hfs*8 COSM211769 chr1 26774915 487 C CC MPL p.W515L COSM18918 chr1 43349338 16574423 G T NRAS Q61H COSM586 chr1 114713907 71364569 T G NRAS G12D COSM564 chr1 114716126 2219 C T RIT1 M90I COSM3 57927 chr1 155904470 41188344 C T ABL2 P986Hfs*4 COSM2095020 chr1 179108313 23203843 GG G DDR2 I638F COSM7363943 chr1 162775707 −16332606 A T GATA3 P408fs COSM166059 chr10 8073911 −154701796 C CG RET p.M918T COSM965 chr10 43121968 35048057 T C PTEN R130G COSM5033 chr10 87933148 44811180 G A PTEN p.D268Gfs*30 COSM5012 chr10 87958018 24870 A AA PTEN p.N323Kfs*2 COSM4990 chr10 87961060 3042 A AA FGFR2 K659E COSM36909 chr10 121488002 33526942 T C FGFR2 N549K COSM36912 chr10 121498520 10518 A T FGFR2 C382R COSM36906 chr10 121515260 16740 A G FGFR2 S252W COSM36903 chr10 121520163 4903 G C HRAS G12V COSM483 chr11 534288 −120985875 C A CCND1 T286I COSM931395 chr11 69651251 69116963 C T CCND1 E275*fs COSM931393 chr11 69651217 69116929 G T ATM S214Pfs*16 COSM1350740 chr11 108244089 38592838 CT C KRAS K117N COSM19940 chr12 25225713 −83018376 T G KRAS Q61H COSM554 chr12 25227341 1628 T G KRAS G13D COSM532 chr12 25245347 18006 C T KRAS p.G12D COSM521 chr12 25245350 3 C T ERBB3 v104m COSM20710 chr12 56085070 30839723 G A CDK4 R24C COSM1677139 chr12 57751648 1666578 G A PTPN11 E76K COSM13000 chr12 112450406 54698758 G A PTPN11 G503R COSM14259 chr12 112489083 38677 G A HNF1A P289fs COSM1476243 chr12 120994313 8505230 G GC CDX2 V306Cfs*2 COSM1366182 chr13 27963146 −93031167 CC C FLT3 p.D835Y COSM783 chr13 28018505 55359 C A BRCA2 N1784Tfs*7 COSM18607 chr13 32339699 4321194 CA C BRCA2 T3033Lfs*29 COSM1366491 chr13 32379885 40186 CA C FOXA1 R219S COSM3738526 chr14 37592129 5212244 G T AKT1 Q79K COSM159008 chr14 104776711 67184582 G T AKT1 L52R COSM93893 chr14 104780108 3397 A C AKT1 p.E17K COSM33765 chr14 104780214 3503 C T MAP2K1 K57N COSM1235478 chr15 66435117 −38345097 G T IDH2 R140Q COSM41590 chr15 90088702 23653585 C T IDH2 R172K COSM33733 chr15 90088606 23653489 C T CDH1 Q23* COSM19503 chr16 68738315 −21350387 C T CDH1 A634V COSM19822 chr16 68822190 83875 C T CDH1 R732Q COSM972800 chr16 68828204 6014 G A TP53 R282W COSM10704 chr17 7673776 −61154428 G A TP53 R342Efs*3 COSM18597 chr17 7670685 −61157519 GG G TP53 p.R273H COSM10660 chr17 7673802 3117 C T TP53 G245C COSM11081 chr17 7674230 428 C A TP53 p.R175H COSM10648 chr17 7675088 858 C T TP53 p.L26Pfs*11 COSM45386 chr17 7676382 1294 CAGAAC C GTTGTT TTCAGG AAGT (SEQ ID NO: 5) TP53 R209Kfs*6 COSM6482 chr17 7674903 673 TTC T TP53 P152Rfs*18 COSM43792 chr17 7675156 68 CG C TP53 V73Rfs*76 COSM128714 chr17 7676152 996 C C NF1 I679Dfs*21 COSM24504 chr17 31226465 23550083 C CC NF1 F1247Ifs*18 COSM436320 chr17 31235638 9173 CTGTT C NF1 Y2285Tfs*5 COSM39161 chr17 31338733 103095 CACTT C CDK12 W719* COSM118018 chr17 39492798 8154065 G A CDK12 E928fs27* COSM6965693 chr17 39515745 22947 A AATACA CAAAGA T (SEQ ID NO: 6) ERBB2 L755S COSM14060 chr17 39723967 208222 T C ERBB2 p.A775_G776i COSM20959 chr17 39724730 763 C CATACG nsYVMA TGATGG (“YVMA” C (SEQ ID disclosed as NO: 8) SEQ ID NO: 7) ERBB2 P780_Y781ins COSM21607 chr17 39724758 28 A AGGCTC GSP ACCA (SEQ ID NO: 9) ERBB2 V842I COSM14065 chr17 39725079 349 G A BRCA1 R1443* COSM979730 chr17 43082434 3357355 G A BRCA1 K654Sfs*47 COSM219054 chr17 43093569 11135 CT C BRCA1 E23Vfs*17 COSM35893 chr17 43124027 30458 ACT A SPOP F133V COSM219965 chr17 49619064 6495037 A C SMAD4 D52Rfs*2 COSM14091 chr18 51047198 1428134 A AA SMAD4 R361H COSM14122 chr18 51065549 18351 G A NFE2L2 G333C COSM1193323 chr19 10491905 −40573644 C A MYCN P44L COSM35624 chr2 15942195 5450290 C T ALK P1543S COSM2941442 chr2 29193460 13251265 G A ALK R1275Q COSM28056 chr2 29209798 16338 C T ALK R1192P COSM7340824 chr2 29220776 10978 C G ALK F1174L COSM28055 chr2 29220829 11031 G T ALK G1128A COSM98475 chr2 29222584 1755 C G IDH1 p.R132C COSM28747 chr2 208248389 179025805 G A GNAS p.R201C COSM27887 chr20 58909365 −149339024 C T MAPK1 E322K COSM461148 chr22 21772875 −37136490 C T NF2 L14Qfs*34 COSM22312 chr22 29604033 7831158 GCT G NF2 P275Tfs*4 COSM6951489 chr22 29665000 60967 A AA NF2 R341* COSM21990 chr22 29671847 6847 C T NF2 E445Gfs*9 COSM22271 chr22 29673477 1630 CAGAG C VHL F148Lfs*11 COSM14410 chr3 10146612 −19526865 AT A VHL R161* COSM17612 chr3 10149804 3192 C T MLH1 R498fs COSM5895322 chr3 37028864 26879060 GG G MYD88 L265P COSM85940 chr3 38141150 1112286 T C CTNNB1 p.T41A COSM5664 chr3 41224633 3083483 A G CTNNB1 G34E COSM5671 chr3 41224613 3083463 G A SETD2 S2382Lfs*29 COSM3068849 chr3 47042655 5818022 AG A SETD2 R1407Gfs*5 COSM3069036 chr3 47120416 77761 CT C SETD2 S203Ifs*33 COSM1161887 chr3 47124027 3611 TGA T RHOA Y42C COSM2849892 chr3 49375465 2251438 T C BAP1 W196* COSM51977 chr3 52406900 3031435 C T PBRM1 p.I279Yfs*4 COSM52863 chr3 52644767 237867 AT A FOXL2 p.C134W COSM33661 chr3 138946321 86301554 G C ATR I774Yfs*5 COSM214499 chr3 142555906 3609585 TT T PIK3CA G106_R108del COSM13475 chr3 179199140 36643234 AGGCAA A CCGT (SEQ ID NO: 10) PIK3CA N345K COSM754 chr3 179203765 4625 T A PIK3CA p.E545K COSM763 chr3 179218303 14538 G A PIK3CA p.S553Tfs*20 COSM27488 chr3 179218327 24 AGT A PIK3CA p.H1047R COSM775 chr3 179234297 15994 A G FGFR3 p.S249C COSM715 chr4 1801841 −177432456 C G FGFR3 Y375C COSM718 chr4 1804372 2531 A G FGFR3 K652E COSM719 chr4 1806162 1790 A G FGFR3 S249C COSM715 chr4 1801841 −177432456 C G PDGFRA S566_ COSM30546 chr4 54274884 52468722 GCCCAG G E571delinsR ATGGAC ATGA (SEQ ID NO: 11) PDGFRA N659K COSM22414 chr4 54277981 3097 C G PDGFRA p.D842V COSM736 chr4 54285926 7945 A T PDGFRA V561D COSM739 chr4 54274869 52468707 T A KIT L576P COSM1290 chr4 54727495 441569 T C KIT del557-558 COSM1210 chr4 54727434 441508 CAGTGG C A KIT K642E COSM1304 chr4 54728055 560 A G KIT p.D816V COSM1314 chr4 54733155 5100 A T FBXW7 R465C COSM22932 chr4 152328233 97595078 G A TERT C228G tert_c228g chr5 1295229 −151033004 G A TERT C250T None chr5 1295250 22 C T APC p.R213* COSM13134 chr5 112780895 111485666 C T APC A1002Gfs*6 COSM5748894 chr5 112838598 57703 G GG APC p.E1309Dfs*4 COSM13113 chr5 112839514 916 TAAAAG T APC p.R1450* COSM13127 chr5 112839942 428 C T APC R2714C COSM2991126 chr5 112843734 3792 C T APC p.S1465Wfs*3 COSM13864 chr5 112839978 36 AAG A NPM1 p.W288fs*12 COSM17559 chr5 171410539 58566805 C CTCTG ROS1 G2032R COSM1651690 chr6 117317184 −54093355 C T ESR1 D538G COSM94250 chr6 152098791 34781607 A G EGFR L718Q COSM6503269 chr7 55174012 −96924779 T A EGFR p.E746_A750d COSM6225 chr7 55174772 760 GGAATT G elELREA AAGAG (“ELREA” AAGCA disclosed as (SEQ ID SEQ ID NO: NO: 13) 12) EGFR S768I COSM6241 chr7 55181312 6540 G T EGFR p.D770_ COSM12378 chr7 55181319 7 C CGGT N771insG EGFR p.T790M COSM6240 chr7 55181378 6606 C T EGFR p.L858R COSM6224 chr7 55191822 10444 T G EGFR G724S COSM13979 chr7 55174029 17 G A EGFR L792H COSM6493934 chr7 55181384 6 T A MET exon_14_skip metexon14_skip chr7 116771990 61580168 G A MET d1246n COSM5015794 chr7 116783353 11363 G A SMO D473H COSM34198 chr7 129209348 12425995 G C BRAF p.V600E COSM476 chr7 140753336 11543988 A T EZH2 Y641F COSM37028 chr7 148811635 8058299 T A RHEB Y35N COSM485065 chr7 151490964 2679329 A T FGFR1 K656E COSM35673 chr8 38414790 −113076174 T C FGFR1 N546K COSM19176 chr8 38417331 2541 G T JAK2 p.V617F COSM12600 chr9 5073770 −33343561 G T GNAQ p.Q209P COSM28758 chr9 77794572 72720802 T G GNAQ T96S COSM404628 chr9 77922196 127624 T A ABL1 F317V COSM211607 chr9 130872901 52950705 T G TSC1 Q794 COSM753312 chr9 132902616 2029715 G A NOTCH1 P2514Rfs*4 COSM12774 chr9 136496196 3593580 CAG C NOTCH1 p.L1600Pfs*10 COSM5751249 chr9 136504893 8697 G GG KDM6A K1097Sfs*6 COSM7211707 chrX 45083464 −91421429 AAGTT A ARAF S214C COSM5044705 chrX 47566722 2483258 C G KDM5C p.D1407Tfs*5 COSM1161909 chrX 53193534 5626812 TC T AR W742C COSM5944171 chrX 67717530 14523996 G C AR T878A COSM236693 chrX 67723710 6180 A G

    [0085] In some instances, a variant is described in Table 2.

    TABLE-US-00002 TABLE 2 region_ LEGACY_ gene COSMIC_id str chrom pos ref alt MUTATION_ID HGVSP name RET COSM9358963 chr10: chr10 43112867 T TTCC COSM9358963 ENSP00000347942.3: T > TTCC 43112852- p.Phe555_ 43112963 Ser556insLeu PTEN COSM7350864 chr10: chr10 87864536 T TCGG COSM7350864 ENSP00000361021.3: T > TCGG 87864469- GAGC p.Leu23SerfsTer23 GAGC 87864548 PTEN COSM5346960 chr10: chr10 87894056 T TATG COSM5346960 ENSP00000361021.3: T > TATG 87894024- GGAT p.Phe37_ GGATTG 87894109 TG Pro38insMetGlyLeu (SEQ (SEQ ID NO: ID 14) NO: 14) PTEN COSM5882 chr10: chr10 87925549 A ATAT COSM5882 ENSP00000361021.3: A > ATAT 87925512- p.Tyr68dup 87925557 PTEN COSM1173605 chr10: chr10 87931069 C CTA COSM1173605 ENSP00000361021.3: C > CTA 87931045- p.Ala79ThrfsTer21 87931089 PTEN COSM7347202 chr10: chr10 87952180 T TCAC COSM7347202 ENSP00000361021.3: T > TCAC 87952117- CGA p.His185_ CGA 87952259 Leu186insHisArg ATM COSM1235448 chr11: chr11 108247062 T TA COSM1235448 ENSP00000278616.4: T > TA 108246963- p.Ser334TyrfsTer5 108247127 ATM COSM6928114 chr11: chr11 108256298 TGAA TAAA COSM6928114 ENSP00000278616.4: TGAA 108256214- G AA p.Glu737LysfsTer6 G > TA 108256340 AAAA ATM COSM9312366 chr11: chr11 108292758 C CATA COSM9312366 ENSP00000278616.4: C > CAT 108292618- A p.Pro1526HisfsTer6 AA 108292793 ATM COSM9358682 chr11: chr11 108293339 G GGAT COSM9358682 ENSP00000278616.4: G > GG 108293312- A p.Ile1547AspfsTer4 ATA 108293477 ATM, COSM6853938 chr11: chr11 108331534 G GA COSM6853938 ENSP00000278616.4: G > GA C11orf65 108331443- p.Gly2536GlufsTer4 108331557 ATM, COSM6936524 chr11: chr11 108331960 T TA COSM6936524 ENSP00000278616.4: T > TA C11orf65 108331878- p.Phe2571TyrfsTer4 108332037 ATM, COSM6854263 chr11: chr11 108345767 G GT COSM6854263 ENSP00000278616.4: G > GT C11orf65 108345742- p.Glu2815ValfsTer4 108345908 AKT1 COSM7345039 chr14: chr14 104772908 G GC COSM7345039 ENSP00000451828.1: G > GC 104772877- p.Ser381CysfsTer54 104773092 AKT1 COSM5751911 chr14: chr14 104792618 T TC COSM5751911 ENSP00000451828.1: T > TC 104792597- p.Glu9GlyfsTer24 104792643 ERBB2 COSM9494270 chr17: chr17 39727873 C CAGA COSM9494270 ENSP00000269571.4: C > CA 39727688- G p.Gln1200ArgfsTer78 GAG 39728044 TP53 COSM6503572 chr17: chr17 7669655 C CT COSM6503572 ENSP00000269305.4: C > CT 7669608- p.Arg379GlnfsTer3 7669690 ALK COSM7347227 chr2: chr2 29320797 T TG COSM7347227 ENSP00000373700.3: T > TG 29320750- p.Gln500HisfsTer26 29320882 PIK3CA COSM5751700 chr3: chr3 179219582 G GT COSM5751700 ENSP00000263967.3: G > GT 179219570- p.Val587CysfsTer10 179219735 CTNNB1 COSM6853630 chr3: chr3 41233407 G GGGA COSM6853630 ENSP00000495360.1: G > GG 41233340- p.Trp383_ GA 41233444 Thr384insGlu FGFR3 COSM13248 chr4: chr4 1804823 G GGTA COSM13248 ENSP00000339824.4: G > GG 1804823- ACA p.Val425_ TAAC 1804969 Ser426insThrVal A FGFR3 COSM7448276 chr4: chr4 1806568 T TTGG COSM7448276 ENSP00000339824.4: T > TTG 1806545- GAGA p.Trp687delinsLeu GGAG 1806683 TCTT GlyAspLeuAlaArg ATCTT GCAC (“LeuGlyAspLeuAla GCAC (SEQ Arg” (SEQ ID disclosed as ID NO: NO: SEQ ID NO: 16) 15) 15) FGFR3 COSM729 chr4: chr4 1807221 CT CGA COSM729 ENSP00000339824.4: CT > CG 1807115- p.Leu796ArgfsTer23 A 1807262 PDGFRA COSM7345286 chr4: chr4 54261354 C CA COSM7345286 ENSP00000257290.5: C > CA 54261094- p.His104ThrfsTer8 54261412 PDGFRA COSM9358924 chr4: chr4 54270721 A AAGC COSM9358924 ENSP00000257290.5: A > AA 54270632- T p.Ser404LysfsTer6 GCT 54270748 KIT COSM6008883 chr4: chr4 54723605 A ACGA COSM6008883 ENSP00000288135.5: A > AC 54723583- TTTT p.Arg420PhefsTer30 GATT 54723698 TT KIT COSM53306 chr4: chr4 54726012 C CTGC COSM53306 ENSP00000288135.5: C > CTG 54725856- CTT p.Ala502_ CCTT 54726050 Tyr503insPheAla APC COSM9113053 chr5: chr5 112767380 G GGAG COSM9113053 ENSP00000257430.4: G > GG 112767188- AAAG p.Glu138GlyfsTer35 AGAA 112767390 A AGA APC COSM5010340 chr5: chr5 112815593 G GATG COSM5010340 ENSP00000257430.4: G > GA 112815494- TTT p.Lys311_ TGTTT 112815593 Val312insMetPhe APC COSM25155 chr5: chr5 112819174 C CG COSM25155 ENSP00000257430.4: C > CG 112818965- p.Arg382GlnfsTer15 112819344 APC COSM6854200 chr5: chr5 112835141 T TA COSM6854200 ENSP00000257430.4: T > TA 112834950- p.Ile646AspfsTer5 112835165 ROS1 COSM6967149 chr6: chr6 117319975 G GA COSM6967149 ENSP00000357494.3: G > GA 117319867- p.Leu1945SerfsTer17 117320030 ROS1 COSM9499684 chr6: chr6 117359964 C CAA COSM9499684 ENSP00000357494.3: C > CA 117359808- p.Val1165LeufsTer4 A 117360011 MET COSM6957131 chr7: chr7 116763127 C CA COSM6957131 ENSP00000317272.6: C > CA 116763049- p.Leu833ThrfsTer18 116763268 RET COSM7341796 chr10: chr10 43077301 TTGC T COSM7341796 ENSP00000347942.3: TTG 43077258- p.Leu19del C > T 43077331 RET COSM7351211 chr10: chr10 43102447 CCTT C COSM7351211 ENSP00000347942.3: CCT 43102341- p.Phe150del T > C 43102629 RET COSM4989957 chr10: chr10 43105037 CGAG C COSM4989957 ENSP00000347942.3: CGAG 43104951- CTGG p.Glu238GlyfsTer113 CTGG 43105193 T T > C RET COSM9277092 chr10: chr10 43111413 GCAG G COSM9277092 ENSP00000347942.3: GCAG 43111206- ACCT p.Thr492_Gln499del ACCT 43111465 CTAG CTAG GCAG GCAG GCCC GCCC AGGC AGGC C C (SEQ (SEQ ID NO: ID 17) > G NO: 17) RET COSM1237681 chr10: chr10 43112100 TGTG T COSM1237681 ENSP00000347942.3: TGTG 43112098- GCCG p.Val509_Glu511del GCCG 43112224 AG AG (SEQ (SEQ ID ID NO: NO: 18) > T 18) RET COSM984 chr10: chr10 43113625 ACTG A COSM984 ENSP00000347942.3: ACTG 43113555- CTTC p.Phe612_Cys620del CTTCC 43113675 CCTG CTGA AGGA GGAG GGAG GAGA AAGT AGTG GCTT CTT (SEQ (SEQ ID ID NO: NO: 19) > A 19) RET COSM962 chr10: chr10 43120163 GAGA G COSM962 ENSP00000347942.3: GAGA 43120080- TGTT p.Asp898_Glu901del TGTTT 43120203 TATG ATGA A (SEQ (SEQ ID NO: ID 20) > G NO: 20) RET COSM6929334 chr10: chr10 43123710 AG A COSM6929334 ENSP00000347942.3: AG > A 43123670- p.Gly949GlufsTer16 43123808 RET COSM7449721 chr10: chr10 43128223 TGCT T COSM7449721 ENSP00000347942.3: TGCTT 43128111- TTCA p.Leu1101GlnfsTer3 TCAC 43128269 CCCT CCTC CAGC AGCG G (SEQ (SEQ ID NO: ID 21) > T NO: 21) PTEN COSM6942496 chr10: chr10 87965289 GAAG G COSM6942496 ENSP00000361021.3: GAAG 87965286- CTGT p.Leu345GlnfsTer2 CTGT 87965472 ACTT ACTT CACA CACA A A (SEQ (SEQ ID NO: ID 22) > G NO: 22) ATM COSM1315819 chr11: chr11 108227624 CATG C COSM1315819 ENSP00000278616.4: CATG 108227624- AGTC p.Met1? AGTC 108227696 TAGT TAGT ACTT ACTT AATG AATG (SEQ (SEQ ID ID NO: NO: 23) > C 23) ATM COSM6978979 chr11: chr11 108229315 CAAA C COSM6978979 ENSP00000278616.4: CAAA 108229177- CAGA p.Asn109SerfsTer3 CAGA 108229323 A A > C ATM COSM758337 chr11: chr11 108235814 TATC T COSM758337 ENSP00000278616.4: TATCT 108235669- TC p.Ser160AlafsTer23 C > T 108235834 ATM COSM3733253 chr11: chr11 108244952 AAG A COSM3733253 ENSP00000278616.4: AAG > A 108244787- p.Glu277SerfsTer4 108245026 ATM COSM1235427 chr11: chr11 108249045 GGGA G COSM1235427 ENSP00000278616.4: GGGAA 108248932- AGTA p.Trp393Ter GTA > G 108249102 ATM COSM6945044 chr11: chr11 108250727 CAAA CT COSM6945044 ENSP00000278616.4: CAAA 108250700- G p.Lys422del G > CT 108251072 ATM COSM6935895 chr11: chr11 108251945 AAAG A COSM6935895 ENSP00000278616.4: AAAG 108251836- GAAT p.Lys573AsnfsTer13 GAAT 108252031 C C > A ATM COSM6958308 chr11: chr11 108252838 GGA G COSM6958308 ENSP00000278616.4: GGA > G 108252816- p.Lys610AsnfsTer11 108252912 ATM COSM22531 chr11: chr11 108253991 CTGT CG COSM22531 ENSP00000278616.4: CTGT 108253813- CTTC p.Cys693_ CTTCT 108254039 TGGG Gln700delinsGlu GGGA ATTA TTATC TCAG AGAA AAC C (SEQ (SEQ ID NO: ID 24) > C NO: G 24) ATM COSM6986880 chr11: chr11 108257598 TGTA T COSM6986880 ENSP00000278616.4: TGTA 108257480- CCA p.Cys790_ CCA > T 108257606 Lys792delinsTer ATM COSM9179264 chr11: chr11 108259065 GTAA G COSM9179264 GTAA 108258985- AAGT AAGT 108259075 TTAG TTAG TAAG TAAG TA TA (SEQ (SEQ ID ID NO: NO: 25) > G 25) ATM COSM6856770 chr11: chr11 108267334 GTAC G COSM6856770 ENSP00000278616.4: GTAC 108267170- CA p.Thr878ArgfsTer4 CA > G 108267342 ATM COSM6906886 chr11: chr11 108268563 TTGA T COSM6906886 ENSP00000278616.4: TTGA 108268409- TTCT p.Asp932ArgfsTer32 TTCTA 108268609 AGCA GCAC CGC GC (SEQ (SEQ ID ID NO: NO: 26) > T 26) ATM COSM7345428 chr11: chr11 108271283 ATGT A COSM7345428 ENSP00000278616.4: ATGT 108271250- T p.Cys987LysfsTer4 T > A 108271406 ATM COSM7345432 chr11: chr11 108272761 GGA G COSM7345432 ENSP00000278616.4: GGA > G 108272721- p.Gly1065GlufsTer7 108272852 ATM COSM1235411 chr11: chr11 108279519 TC T COSM1235411 ENSP00000278616.4: TC > T 108279490- p.Arg1106GlyfsTer3 108279608 ATM COSM9493731 chr11: chr11 108281162 GA G COSM9493731 ENSP00000278616.4: GA > G 108280994- p.Lys1192ArgfsTer3 108281168 ATM COSM758341 chr11: chr11 108282852 ACTA A COSM758341 ENSP00000278616.4: ACTA 108282709- CACA p.Asn1240LysfsTer4 CACA 108282879 AATA AATA TTGA TTGA GG GG (SEQ (SEQ ID ID NO: NO: 27) > A 27) ATM COSM21638 chr11: chr11 108284389 CAGA C COSM21638 ENSP00000278616.4: CAGAG 108284226- GACA p.Arg1304ValfsTer43 ACA > C 108284473 ATM COSM6958310 chr11: chr11 108287644 GTTA G COSM6958310 ENSP00000278616.4: GTT 108287599- p.Leu1348del A > G 108287715 ATM COSM6971320 chr11: chr11 108289010 TC T COSM6971320 ENSP00000278616.4: TC > T 108288976- p.Pro1382HisfsTer4 108289103 ATM COSM6956709 chr11: chr11 108289695 CTGT C COSM6956709 ENSP00000278616.4: CTG 108289601- T p.Phe1445LeufsTer5 TT > C 108289801 ATM COSM22532 chr11: chr11 108294983 TGAA TT COSM22532 ENSP00000278616.4: TGAA 108294926- GGAC p.Glu1612_ GGAC 108295059 TAAA Gln1620delinsTer TAAA GGAT GGAT CTTC CTTC GAAG GAAG AC AC (SEQ (SEQ ID ID NO: NO: 28) > TT 28) ATM COSM4745906 chr11: chr11 108297369 AAAA A COSM4745906 ENSP00000278616.4: AAAA 108297286- G p.Glu1666PhefsTer2 G > A 108297382 ATM COSM22533 chr11: chr11 108299754 TTTC T COSM22533 ENSP00000278616.4: TTTCT 108299713- TC p.Phe1683TyrfsTer7 C > T 108299885 ATM COSM22526 chr11: chr11 108301670 GTTA G COSM22526 ENSP00000278616.4: GTTA 108301647- CCTG p.Thr1735GlufsTer11 CCTG 108301789 T T > G ATM COSM7347299 chr11: chr11 108302857 TAGA T COSM7347299 ENSP00000278616.4: TAG 108302852- p.Glu1776del A > T 108303029 ATM COSM9358193 chr11: chr11 108304685 AC A COSM9358193 ENSP00000278616.4: AC > A 108304674- p.Cys1838ValfsTer8 108304852 ATM COSM1315822 chr11: chr11 108307969 TGAG T COSM1315822 ENSP00000278616.4: TGA 108307896- p.Met1916_ G > T 108307984 Arg1917delinsIle ATM, COSM5967541 chr11: chr11 108310286 TAAG T COSM5967541 ENSP00000278616.4: TAAG C11orf65 108310159- AAAA p.Lys1964ArgfsTer19 AAAA 108310315 GTAT GTAT GGAT GGAT GATC GATC AAG AAG (SEQ (SEQ ID ID NO: NO: 29) > T 29) ATM, COSM1235422 chr11: chr11 108316060 TA T COSM1235422 ENSP00000278616.4: TA > T C11orf65 108316010- p.Tyr2049LeufsTer33 108316113 ATM, COSM6944878 chr11: chr11 108317460 GAAG GTC COSM6944878 ENSP00000278616.4: GAAG C11orf65 108317372- AACT p.Glu2096ValfsTer29 AAC 108317521 T > GTC ATM, COSM6911065 chr11: chr11 108319958 GA G COSM6911065 ENSP00000278616.4: GA > G C11orf65 108319953- p.Val2119Ter 108320058 ATM, COSM21644 chr11: chr11 108325443 GAA G COSM21644 ENSP00000278616.4: GAA > G C11orf65 108325309- p.Lys2237GlyfsTer11 108325544 ATM, COSM6933908 chr11: chr11 108326152 CA C COSM6933908 ENSP00000278616.4: CA > C C11orf65 108326057- p.Lys2303ArgfsTer7 108326225 ATM, COSM758343 chr11: chr11 108327657 CTAA C COSM758343 ENSP00000278616.4: CTAA C11orf65 108327644- AACT p.Lys2331HisfsTer6 AAC 108327758 T > C ATM, COSM6977654 chr11: chr11 108329028 AAG A COSM6977654 ENSP00000278616.4: AAG > A C11orf65 108329020- p.Glu2366AspfsTer6 108329238 ATM, COSM6986181 chr11: chr11 108330215 TACA T COSM6986181 ENSP00000278616.4: TACA C11orf65 108330213- C p.Tyr2437Ter C > T 108330421 ATM, COSM4745907 chr11: chr11 108332850 CTTA C COSM4745907 ENSP00000278616.4: CTTAT C11orf65 108332761- TA p.Ile2629SerfsTer25 A > C 108332900 ATM, COSM6853895 chr11: chr11 108333892 TA T COSM6853895 ENSP00000278616.4: TA > T C11orf65 108333885- p.Asn2646IlefsTer14 108333968 ATM, COSM6986871 chr11: chr11 108334992 AAAT A COSM6986871 ENSP00000278616.4: AAAT C11orf65 108334968- CTGG p.Asn2679SerfsTer9 CTGG 108335109 TGAC TGAC TATA TATA C C(SEQ (SEQ ID NO: ID 30) > A NO: 30) ATM, COSM1235408 chr11: chr11 108343270 ACTG AA COSM1235408 ENSP00000278616.4: ACTG C11orf65 108343221- TCCC p.Thr2773AsnfsTer4 TCCC 108343371 CATT CATT GGTG GGTG AAT AAT (SEQ (SEQ ID ID NO: NO: 31) > AA 31) ATM, COSM22484 chr11: chr11 108347306 GACA G COSM22484 ENSP00000278616.4: GAC C11orf65 108347278- p.Arg2871_ A > G 108347365 His2872delinsSer ATM, COSM6933059 chr11: chr11 108353803 TGAG T COSM6933059 ENSP00000278616.4: TGAG C11orf65 108353765- ACAG p.Glu2904AspfsTer29 ACAG 108353880 TTCC TTCCT TTTT TTTA A (SEQ (SEQ ID NO: ID 32) > T NO: 32) ATM, COSM6930780 chr11: chr11 108354854 ACT A COSM6930780 ENSP00000278616.4: ACT > A C11orf65 108354810- p.Leu2945ValfsTer10 108354874 ATM, COSM3733420 chr11: chr11 108365362 GTCT G COSM3733420 ENSP00000278616.4: GTC C11orf65 108365324- p.Leu3010del T > G 108365508 AKT1 COSM9358172 chr14: chr14 104773279 CA C COSM9358172 ENSP00000451828.1: CA > C 104773250- p.Cys310AlafsTer33 104773379 ERBB2 COSM5967125 chr17: chr17 39707050 TGCT T COSM5967125 ENSP00000269571.4: TGCT 39706989- CCGC p.Leu46AlafsTer40 CCGC 39707141 CACC CACC TCTA TCTA CCAG CCAG (SEQ (SEQ ID ID NO: NO: 33) > T 33) ERBB2 COSM7345562 chr17: chr17 39708492 TCC T COSM7345562 ENSP00000269571.4: TCC > T 39708320- p.Pro134ArgfsTer66 39708534 ERBB2 COSM7345564 chr17: chr17 39710383 GC G COSM7345564 ENSP00000269571.4: GC > G 39710339- p.Pro269GlnfsTer28 39710481 ERBB2 COSM6961097 chr17: chr17 39712401 CAAG C COSM6961097 ENSP00000269571.4: CAA 39712321- p.Lys369del G > C 39712448 ERBB2 COSM9494227 chr17: chr17 39715878 GCT G COSM9494227 ENSP00000269571.4: GCT > G 39715739- p.Phe486SerfsTer80 39715939 ERBB2 COSM6974323 chr17: chr17 39717434 GATG G COSM6974323 ENSP00000269571.4: GATG 39717319- AGGA p.Glu619GlnfsTer11 AGGA 39717484 GGGC GGGC GCAT GCAT GCCA GCCA GCCT GCCT TGCC TGCC CC CC (SEQ (SEQ ID ID NO: NO: 34) > G 34) ERBB2 COSM7345566 chr17: chr17 39719798 TG T COSM7345566 ENSP00000269571.4: TG > T 39719786- p.Asp638MetfsTer14 39719834 ERBB2 COSM6973838 chr17: chr17 39723542 TGGA T COSM6973838 ENSP00000269571.4: TGG 39723537- p.Glu698del A > T 39723660 ERBB2 COSM7345570 chr17: chr17 39725766 CG C COSM7345570 ENSP00000269571.4: CG > C 39725706- p.Glu930ArgfsTer24 39725853 MIR4728, COSM6865894 chr17: chr17 39726611 TG T COSM6865894 ENSP00000269571.4: TG > T ERBB2 39726561- p.Glu975AsnfsTer85 39726659 ERBB2 COSM6865896 chr17: chr17 39727352 TCTC T COSM6865896 ENSP00000269571.4: TCTCC 39727294- CACT p.Leu1075MetfsTer48 ACTG 39727547 GGCA GCAC CCCT CCTC CCGA CGAA AGGG GGGG GCTG CTGG G (SEQ (SEQ ID NO: ID 35) > T NO: 35) GNA11 COSM9232870 chr19: chr19 3114989 CA C COSM9232870 ENSP00000078429.3: CA > C 3114943- p.Thr175ProfsTer49 3115072 GNA11 COSM1392334 chr19: chr19 3118935 TG T COSM1392334 ENSP00000078429.3: TG > T 3118923- p.Gly208AlafsTer16 3119053 GNA11 COSM6342228 chr19: chr19 3121130 TG T COSM6342228 ENSP00000078429.3: TG > T 3120988- p.Lys345ArgfsTer108 3121179 GNAS COSM9277149 chr20: chr20 58854492 AGAT A COSM9277149 ENSP00000360141.3: AGAT 58853265- CCCG p.Thr415_Gly423del CCCG 58855333 ACTC ACTC CGGG CGGG ACAG ACAG CACC CACC AGCC AGCC (SEQ (SEQ ID ID NO: NO: 36) > A 36) GNAS COSM6984215 chr20: chr20 58905438 ACGA AG COSM6984215 ENSP00000360141.3: ACG 58905382- p.Tyr806Ter A > AG 58905480 ALK COSM7347365 chr2: chr2 29228926 CACC C COSM7347365 ENSP00000373700.3: CACC 29228883- CCCT p.Phe921_Gly924del CCCT 29229066 CCGA CCGA A A (SEQ (SEQ ID NO: ID 37) > C NO: 37) ALK COSM2941501 chr2: chr2 29233586 AC A COSM2941501 ENSP00000373700.3: AC > A 29233564- p.Gly822ValfsTer9 29233696 ALK COSM6926372 chr2: chr2 29275466 TC T COSM6926372 ENSP00000373700.3: TC > T 29275401- p.Gly616AspfsTer49 29275496 ALK COSM6922292 chr2: chr2 29318345 TG T COSM6922292 ENSP00000373700.3: TG > T 29318303- p.Ser536ValfsTer25 29318404 ALK COSM9358093 chr2: chr2 29920118 CCTT CG COSM9358093 ENSP00000373700.3: CCTT 29919992- GGCG p.Trp176_ GGCG 29920659 AATC Gly181delinsArg AATC CACC CACC A A (SEQ (SEQ ID NO: ID 38) > CG NO: 38) PIK3CA COSM5613085 chr3: chr3 179209674 GT G COSM5613085 ENSP00000263967.3: GT > G 179209594- p.Gly411AlafsTer17 179209700 PIK3CA COSM6940128 chr3: chr3 179210290 AGAA A COSM6940128 ENSP00000263967.3: AGAA 179210185- GATT p.Glu453_Thr462del GATT 179210338 TGCT TGCT GAAC GAAC CCTA CCTA TTGG TTGG TGTT TGTT ACT ACT (SEQ (SEQ ID ID NO: NO: 39) > A 39) PIK3CA COSM6911769 chr3: chr3 179221134 GAGA G COSM6911769 ENSP00000263967.3: GAG 179220985- p.Lys724del A > G 179221157 CTNNB1 COSM6845286 chr3: chr3 41225063 TCAT T COSM6845286 ENSP00000495360.1: TCAT 41224953- CCCA p.His118LeufsTer13 CCC 41225207 A > T CTNNB1 COSM6963932 chr3: chr3 41225731 CTAA CA COSM6963932 ENSP00000495360.1: CTAA 41225659- AATG p.Lys270_Val273del AATG 41225861 GCAG GCAG TG TG (SEQ (SEQ ID ID NO: NO: 40) > CA 40) CTNNB1 COSM5608170 chr3: chr3 41227274 AAAC A COSM5608170 ENSP00000495360.1: AAAC 41227207- T p.Lys335AsnfsTer9 T > A 41227352 CTNNB1 COSM6939570 chr3: chr3 41235755 GTTG G COSM6939570 ENSP00000495360.1: GTTG 41235723- TACC p.Cys573GlufsTer6 TAC 41235843 C > G CTNNB1 COSM6853546 chr3: chr3 41236462 TCTG T COSM6853546 ENSP00000495360.1: TCTG 41236348- ACAG p.Thr641_Leu644del ACAG 41236499 AGTT AGTT A A (SEQ (SEQ ID NO: ID 41) > T NO: 41) FGFR3 COSM4616014 chr4: chr4 1799410 TG T COSM4616014 ENSP00000339824.4: TG > T 1799253- p.Gln92SerfsTer6 1799523 FGFR3 COSM4992106 chr4: chr4 1803754 TGAG T COSM4992106 TGAG 1803691- GACG GACG 1803836 C C > T PDGFRA COSM6906234 chr4: chr4 54264999 GT G COSM6906234 ENSP00000257290.5: GT > G 54264918- p.Phe238LeufsTer16 54265049 PDGFRA COSM6964190 chr4: chr4 54267667 GCTG G COSM6964190 ENSP00000257290.5: GCTG 54267551- AAAA p.Lys351_Leu356del AAAA 54267741 ACAA ACAA TCTG TCTG ACT ACT (SEQ (SEQ ID ID NO: NO: 42) > G 42) PDGFRA COSM3301372 chr4: chr4 54285479 CA C COSM3301372 ENSP00000257290.5: CA > C 54285370- p.Asn813IlefsTer20 54285486 PDGFRA COSM7346029 chr4: chr4 54287473 AC A COSM7346029 ENSP00000257290.5: AC > A 54287429- p.Asp869GlufsTer7 54287541 PDGFRA COSM6972086 chr4: chr4 54289073 AGT AC COSM6972086 ENSP00000257290.5: AGT > AC 54289008- p.Ser947ThrfsTer24 54289114 PDGFRA COSM6956086 chr4: chr4 54290548 GAC G COSM6956086 ENSP00000257290.5: GAC > G 54290312- p.His1040GlnfsTer6 54290554 PDGFRA COSM7346028 chr4: chr4 54295233 CAT C COSM7346028 ENSP00000257290.5: CAT > C 54295124- p.Ile1078ArgfsTer41 54295272 KIT COSM6951399 chr4: chr4 54658073 TC T COSM6951399 ENSP00000288135.5: TC > T 54658014- p.Gln21ArgfsTer9 54658081 KIT COSM7345631 chr4: chr4 54695772 TTTG T COSM7345631 ENSP00000288135.5: TTT 54695511- p.Val111del G > T 54695781 KIT COSM7345632 chr4: chr4 54698515 AG A COSM7345632 ENSP00000288135.5: AG > A 54698283- p.Glu191ArgfsTer12 54698565 KIT COSM1305 chr4: chr4 54729451 TATA T COSM1305 ENSP00000288135.5: TATA 54729334- AGA p.Lys704_Asn705del AGA > T 54729485 KIT COSM1306 chr4: chr4 54731324 CCAG C COSM1306 ENSP00000288135.5: CCA 54731327- p.Ser715del G > C 54731419 KIT COSM28578 chr4: chr4 54731967 CA C COSM28578 ENSP00000288135.5: CA > C 54731870- p.Lys778ArgfsTer36 54731998 KIT COSM6965292 chr4: chr4 54738465 CAG C COSM6965292 ENSP00000288135.5: CAG > C 54738428- p.Lys948AlafsTer100 54738557 APC COSM6963650 chr5: chr5 112755023 AAGG A COSM6963650 AAGG 112754890- TATC TAT 112755025 C > A APC COSM6853815 chr5: chr5 112766390 AT A COSM6853815 ENSP00000257430.4: AT > A 112766325- p.Leu68TyrfsTer2 112766410 APC COSM6854236 chr5: chr5 112775710 AATA A COSM6854236 ENSP00000257430.4: AATA 112775628- G p.Asp170ValfsTer4 G > A 112775737 APC COSM6976104 chr5: chr5 112792468 AAAT A COSM6976104 ENSP00000257430.4: AAAT 112792445- CG p.Ile224LysfsTer26 CG > A 112792529 APC COSM6984704 chr5: chr5 112801284 ATC A COSM6984704 ENSP00000257430.4: ATC > A 112801278- p.Gln247GlufsTer4 112801383 APC COSM6971752 chr5: chr5 112821942 AATG A COSM6971752 ENSP00000257430.4: AATG 112821895- AAAC p.Leu456SerfsTer6 AAAC 112821991 TTTC TTTCA ATTT TTTG G (SEQ (SEQ ID NO: ID 43) > A NO: 43) APC COSM4169285 chr5: chr5 112827121 CATT C COSM4169285 ENSP00000257430.4: CATT 112827107- GCAG p.Glu477SerfsTer4 GCAG 112827247 AATT AATT (SEQ (SEQ ID ID NO: NO: 44) > C 44) APC COSM1169625 chr5: chr5 112827937 ATGC A COSM1169625 ENSP00000257430.4: ATGC 112827928- TC p.Cys520TyrfsTer15 TC > A 112828006 APC COSM4169180 chr5: chr5 112828863 CGAG C COSM4169180 ENSP00000257430.4: CGAG 112828855- T p.Ser546PhefsTer2 T > C 112828972 ROS1 COSM6921151 chr6: chr6 117310082 ATAC A COSM6921151 ENSP00000357494.3: ATAC 117310080- AT p.Asp2143ValfsTer25 AT > A 117310281 ROS1 COSM6959063 chr6: chr6 117326294 TCTG T COSM6959063 ENSP00000357494.3: TCTG 117326223- AA p.Phe1828SerfsTer6 AA > T 117326414 ROS1 COSM6968834 chr6: chr6 117341465 ATTC A COSM6968834 ENSP00000357494.3: ATTC 117341399- ACTT p.Thr1606_ ACTTT 117341632 TGTC Glu1612del GTCTT TTAG AGAG AGGA GAGT GT (SEQ (SEQ ID NO: ID 45) > A NO: 45) ROS1 COSM9225153 chr6: chr6 117342404 AT A COSM9225153 ENSP00000357494.3: AT > A 117342399- p.Asn1555MetfsTer48 117342544 ROS1 COSM6978532 chr6: chr6 117356904 CAAT C COSM6978532 CAAT 117356628- ACAA ACAA 117356915 GCGA GCGA CTAT CTAT AGAG AGAG GAAA GAAA A A (SEQ (SEQ ID NO: ID 46) > C NO: 46) ROS1 COSM6984106 chr6: chr6 117357806 TA T COSM6984106 ENSP00000357494.3: TA > T 117357803- p.Leu1284Ter 117358009 ROS1 COSM5977598 chr6: chr6 117360400 CCT C COSM5977598 ENSP00000357494.3: CCT > C 117360341- p.Arg1129GlyfsTer5 117360405 ROS1 COSM5576297 chr6: chr6 117362635 CT C COSM5576297 ENSP00000357494.3: CT > C 117362602- p.Gly1117AlafsTer2 117362865 ROS1 COSM7409277 chr6: chr6 117387804 AG A COSM7409277 ENSP00000357494.3: AG > A 117387779- p.Ser664GlnfsTer18 117388034 ROS1 COSM6940064 chr6: chr6 117393245 AT A COSM6940064 ENSP00000357494.3: AT > A 117393223- p.Ile414LeufsTer14 117393321 ROS1 COSM6916198 chr6: chr6 117396979 AT A COSM6916198 ENSP00000357494.3: AT > A 117396914- p.Lys238AsnfsTer2 117397116 MET COSM6912457 chr7: chr7 116699692 CTTC C COSM6912457 ENSP00000317272.6: CTTC 116699084- T p.Ser204IlefsTer12 T > C 116700284 MET COSM6975700 chr7: chr7 116740889 ATTT A COSM6975700 ENSP00000317272.6: ATTTC 116740851- CCAG p.Phe523_Ser527del CAGT 116741025 TCCT CCTG GCAG CAG (SEQ (SEQ ID ID NO: NO: 47) > A 47) MET COSM6976259 chr7: chr7 116755455 CTAG CG COSM6976259 ENSP00000317272.6: CTAG 116755354- AGTT p.Arg602_Ser609del AGTT 116755515 CTCC CTCCT TTGG TGGA AAAT AATG GAGA AGAG GC C(SEQ (SEQ ID NO: ID 48) > CG NO: 48) MET COSM5977594 chr7: chr7 116758487 AC A COSM5977594 ENSP00000317272.6: AC > A 116758458- p.Pro712GlnfsTer13 116758620 MET COSM6937367 chr7: chr7 116759394 TG T COSM6937367 ENSP00000317272.6: TG > T 116759336- p.Ser776AlafsTer3 116759490 MET COSM6984036 chr7: chr7 116774940 GACA G COSM6984036 ENSP00000317272.6: GACA 116774880- TGTC p.Asp1048_ TGTC 116775111 CCCC Ile1052delinsVal CCCC A A (SEQ (SEQ ID NO: ID 49) > G NO: 49) MET COSM1579075 chr7: chr7 116782056 CA C COSM1579075 ENSP00000317272.6: CA > C 116781987- p.Lys1217SerfsTer49 116782097 MET COSM7345743 chr7: chr7 116796002 CATG C COSM7345743 ENSP00000317272.6: CATG 116795886- TGAA p.Ala1372_ TGAA 116796124 CGCT Asn1376del CGCT ACTT ACTT (SEQ (SEQ ID ID NO: NO: 50) > C 50) EGFR COSM6973876 chr7: chr7 55142292 AAGG AC COSM6973876 ENSP00000275493.2: AAGG 55142285- CACG p.Gln32HisfsTer46 CACG 55142437 A A > AC EGFR COSM9494233 chr7: chr7 55154103 CCCC C COSM9494233 ENSP00000275493.2: CCCC 55154010- GAGG p.Pro281GlnfsTer15 GAGG 55154152 G G > C EGFR COSM6962235 chr7: chr7 55155837 TGTG T COSM6962235 ENSP00000275493.2: TGTG > T 55155829- p.Val301del 55155946 EGFR COSM7343128 chr7: chr7 55161538 AG A COSM7343128 ENSP00000275493.2: AG > A 55161498- p.Gly514AlafsTer54 55161631 EGFR COSM6196864 chr7: chr7 55165374 TG T COSM6196864 ENSP00000275493.2: TG > T 55165279- p.Val607SerfsTer98 55165437 EGFR COSM9110951 chr7: chr7 55170527 GCCT G COSM9110951 GCC 55170306- T > G 55170544 EGFR COSM6909028 chr7: chr7 55173048 TG T COSM6909028 ENSP00000275493.2: TG > T 55172982- p.Ile664SerfsTer41 55173124 GNAQ COSM6342235 chr9: chr9 77721491 TG T COSM6342235 ENSP00000286548.4: TG > T 77721322- p.Ala304GlufsTer7 77721513 GNAQ COSM28414 chr9: chr9 77728594 ATAA A COSM28414 ENSP00000286548.4: ATAA 77728513- CCGA p.Asn266PhefsTer4 CCGA 77728667 GGAG GGAG TT TT (SEQ (SEQ ID ID NO: NO: 51) > A 51) GNAQ COSM7347398 chr9: chr9 77815756 TAAT T COSM7347398 ENSP00000286548.4: TAAT 77815615- TGTG p.Ala108GlufsTer18 TGTG 77815770 CATG CATG AG AG (SEQ (SEQ ID ID NO: NO: 52) > T 52) GNAQ COSM9113869 chr9: chr9 78031128 GGCG G COSM9113869 ENSP00000286548.4: GGCG 78031099- TCCC p.Leu29ProfsTer24 TCCC 78031235 GCTT GCTT GTCC GTCC CTGC CTGC GGA GGA (SEQ (SEQ ID ID NO: NO: 53) > G 53) RET COSM4989947 chr10: chr10 43100532 C T COSM4989947 ENSP00000347942.3: C > T 43100458- p.Pro49= 43100722 RET COSM6947065 chr10: chr10 43106469 G A COSM6947065 ENSP00000347942.3: G > A 43106375- p.Gly321Arg 43106571 RET COSM9277606 chr10: chr10 43109132 C T COSM9277606 ENSP00000347942.3: C > T 43109030- p.Leu389Phe 43109230 RET COSM4418405 chr10: chr10 43118395 G T COSM4418405 ENSP00000347942.3: G > T 43118372- p.Leu769= 43118480 RET COSM6945831 chr10: chr10 43119624 G T COSM6945831 ENSP00000347942.3: G > T 43119530- p.Ser829Ile 43119745 RET COSM3997965 chr10: chr10 43124887 C T COSM3997965 ENSP00000347942.3: C > T 43124882- p.Arg982Cys 43124982 RET COSM6914657 chr10: chr10 43126707 G A COSM6914657 ENSP00000347942.3: G > A 43126574- p.Glu1058Lys 43126754 ATM, COSM21325 chr11: chr11 108312465 A C COSM21325 ENSP00000278616.4: A > C C11orf65 108312410- p.Glu1991Asp 108312498 ATM, COSM7343670 chr11: chr11 108321330 G A COSM7343670 ENSP00000278616.4: G > A C11orf65 108321300- p.Arg2161His 108321420 ATM, COSM200673 chr11: chr11 108335854 G A COSM200673 ENSP00000278616.4: G > A C11orf65 108335844- p.Asp2721Asn 108335961 AKT1 COSM5044338 chr14: chr14 104770406 A T COSM5044338 ENSP00000451828.1: A > T 104770340- p.Cys460Ser 104770420 AKT1 COSM6966503 chr14: chr14 104770769 T A COSM6966503 ENSP00000451828.1: T > A 104770744- p.Ile447Phe 104770847 AKT1 COSM5020215 chr14: chr14 104772446 G A COSM5020215 ENSP00000451828.1: G > A 104772364- p.Gly393= 104772452 AKT1 COSM6924152 chr14: chr14 104773963 G C COSM6924152 ENSP00000451828.1: G > C 104773911- p.Phe217Leu 104773980 AKT1 COSM9102250 chr14: chr14 104775003 C T COSM9102250 ENSP00000451828.1: C > T 104774937- p.Asp190Asn 104775003 AKT1 COSM6986817 chr14: chr14 104775763 G C COSM6986817 ENSP00000451828.1: G > C 104775651- p.Asp108Glu 104775799 ERBB2 COSM5414789 chr17: chr17 39700281 C T COSM5414789 ENSP00000269571.4: C > T 39700238- p.Leu15Phe 39700311 ERBB2 COSM9102609 chr17: chr17 39709385 G A COSM9102609 ENSP00000269571.4: G > A 39709317- p.Trp169Ter 39709452 ERBB2 COSM6913537 chr17: chr17 39709822 G A COSM6913537 ENSP00000269571.4: G > A 39709812- p.Cys195Tyr 39709881 ERBB2 COSM94225 chr17: chr17 39711955 C A COSM94225 ENSP00000269571.4: C > A 39711927- p.Ser310Tyr 39712047 ERBB2 COSM9110847 chr17: chr17 39715294 C A COSM9110847 ENSP00000269571.4: C > A 39715285- p.Ala386Asp 39715359 ERBB2 COSM7343981 chr17: chr17 39716431 G T COSM7343981 ENSP00000269571.4: G > T 39716300- p.Gln548His 39716433 TP53 COSM9312241 chr17: chr17 7673240 G A COSM9312241 G > A 7673218- 7673266 GNA11 COSM5611295 chr19: chr19 3110238 ACC ATT COSM5611295 ENSP00000078429.3: ACC > A 3110148- p.Thr76Ile TT 3110333 GNA11 COSM6939602 chr19: chr19 3113334 A G COSM6939602 ENSP00000078429.3: A > G 3113329- p.Asn109Ser 3113484 GNAS COSM6939725 chr20: chr20 58891769 G T COSM6939725 G > T 58891726- 58891865 GNAS COSM6965756 chr20: chr20 58895644 A G COSM6965756 ENSP00000360141.3: A > G 58895611- p.Lys701Glu 58895684 GNAS COSM9312081 chr20: chr20 58898948 G A COSM9312081 ENSP00000360141.3: G > A 58898940- p.Glu717Lys 58898985 GNAS COSM3758661 chr20: chr20 58903752 C T COSM3758661 ENSP00000360141.3: C > T 58903671- p.Ile774= 58903791 GNAS COSM6977578 chr20: chr20 58910048 C T COSM6977578 ENSP00000360141.3: C > T 58909950- p.Pro956Ser 58910081 GNAS COSM4485625 chr20: chr20 58910387 C T COSM4485625 ENSP00000360141.3: C > T 58910333- p.Arg985Ter 58910401 GNAS COSM6907299 chr20: chr20 58910782 C T COSM6907299 ENSP00000360141.3: C > T 58910682- p.Arg1023Cys 58910829 ALK COSM7408659 chr2: chr2 29196823 C T COSM7408659 ENSP00000373700.3: C > T 29196769- p.Glu1371Lys 29196860 ALK COSM6924954 chr2: chr2 29197575 C T COSM6924954 ENSP00000373700.3: C > T 29197541- p.Arg1347Gln 29197676 ALK COSM6939221 chr2: chr2 29207181 T C COSM6939221 ENSP00000373700.3: T > C 29207170- p.Thr1310Ala 29207272 ALK COSM28617 chr2: chr2 29214027 C T COSM28617 ENSP00000373700.3: C > T 29213983- p.Ala1234Thr 29214081 ALK COSM6949625 chr2: chr2 29223444 G A COSM6949625 ENSP00000373700.3: G > A 29223341- p.Ser1086Leu 29223528 ALK COSM6948461 chr2: chr2 29227060 C T COSM6948461 ENSP00000373700.3: C > T 29226921- p.Gly977Arg 29227074 ALK COSM6908629 chr2: chr2 29227669 C T COSM6908629 ENSP00000373700.3: C > T 29227573- p.Gly940Asp 29227672 ALK COSM148825 chr2: chr2 29232401 A G COSM148825 ENSP00000373700.3: A > G 29232303- p.Gly845= 29232448 ALK COSM50296 chr2: chr2 29239766 C T COSM50296 ENSP00000373700.3: C > T 29239679- p.Val757Met 29239830 ALK COSM6940013 chr2: chr2 29251115 C T COSM6940013 ENSP00000373700.3: C > T 29251104- p.Asp732Asn 29251267 ALK COSM5019540 chr2: chr2 29275101 G A COSM5019540 ENSP00000373700.3: G > A 29275098- p.Thr680Ile 29275227 ALK COSM6963778 chr2: chr2 29296995 C G COSM6963778 ENSP00000373700.3: C > G 29296887- p.Glu570Asp 29297057 ALK COSM6947853 chr2: chr2 29328379 G T COSM6947853 ENSP00000373700.3: G > T 29328349- p.Ala462Asp 29328481 ALK COSM1172867 chr2: chr2 29383830 C T COSM1172867 ENSP00000373700.3: C > T 29383731- p.Arg395His 29383859 ALK COSM6598514 chr2: chr2 29532024 C T COSM6598514 ENSP00000373700.3: C > T 29531914- p.Val349Ile 29532116 ALK COSM1236664 chr2: chr2 29694870 C T COSM1236664 ENSP00000373700.3: C > T 29694849- p.Arg311His 29695014 ALK COSM4416269 chr2: chr2 29717663 A T COSM4416269 ENSP00000373700.3: A > T 29717577- p.Pro234= 29717697 PIK3CA COSM3205605 chr3: chr3 179199822 G A COSM3205605 ENSP00000263967.3: G > A 179199689- p.Arg162Lys 179199899 PIK3CA COSM6931303 chr3: chr3 179201476 A T COSM6931303 ENSP00000263967.3: A > T 179201289- p.Tyr250Phe 179201540 PIK3CA COSM21450 chr3: chr3 179204576 G T COSM21450 ENSP00000263967.3: G > T 179204502- p.Cys378Phe 179204588 PIK3CA COSM1716809 chr3: chr3 179219228 C T COSM1716809 ENSP00000263967.3: C > T 179219195- p.Pro566Leu 179219277 PIK3CA COSM250052 chr3: chr3 179219950 T C COSM250052 ENSP00000263967.3: T > C 179219948- p.Val638Ala 179220052 PIK3CA COSM6475729 chr3: chr3 179224123 T C COSM6475729 ENSP00000263967.3: T > C 179224080- p.Phe744Leu 179224187 PIK3CA COSM6981846 chr3: chr3 179224740 C A COSM6981846 ENSP00000263967.3: C > A 179224699- p.Leu779Met 179224821 PIK3CA COSM1041507 chr3: chr3 179225997 C T COSM1041507 ENSP00000263967.3: C > T 179225961- p.Arg818Cys 179226040 PIK3CA COSM39499 chr3: chr3 179229374 G C COSM39499 ENSP00000263967.3: G > C 179229271- p.Leu866Phe 179229442 PIK3CA COSM769 chr3: chr3 179230039 G T COSM769 ENSP00000263967.3: G > T 179230003- p.Cys901Phe 179230121 PIK3CA COSM6475740 chr3: chr3 179230373 A G COSM6475740 ENSP00000263967.3: A > G 179230224- p.Glu978Gly 179230376 PIK3CA, COSM9111593 chr3: chr3 179240022 T C COSM9111593 T > C KCNMB3 179239995- 179240064 CTNNB1 COSM4117539 chr3: chr3 41224075 A G COSM4117539 ENSP00000495360.1: A > G 41224068- p.Thr3Ala 41224081 CTNNB1 COSM5576265 chr3: chr3 41234157 C T COSM5576265 ENSP00000495360.1: C > T 41234138- p.Arg515Ter 41234297 CTNNB1 COSM1044608 chr3: chr3 41238068 G A COSM1044608 ENSP00000495360.1: G > A 41238015- p.Arg710His 41238076 CTNNB1 COSM1485172 chr3: chr3 41239208 G A COSM1485172 ENSP00000495360.1: G > A 41239133- p.Glu738Lys 41239342 FGFR3 COSM6968758 chr4: chr4 1794007 T A COSM6968758 ENSP00000339824.4: T > A 1793934- p.Leu25Met 1794043 FGFR3 COSM9213245 chr4: chr4 1799784 C T COSM9213245 ENSP00000339824.4: C > T 1799746- p.Asp139= 1799812 FGFR3 COSM6942045 chr4: chr4 1801370 C T COSM6942045 ENSP00000339824.4: C > T 1801366- p.Ala150Val 1801536 FGFR3 COSM7342301 chr4: chr4 1802941 G A COSM7342301 ENSP00000339824.4: G > A 1802913- p.Asp320Asn 1803064 FGFR3 COSM6919387 chr4: chr4 1805402 T C COSM6919387 ENSP00000339824.4: T > C 1805354- p.Val489Ala 1805476 PDGFRA COSM4383728 chr4: chr4 54258785 C T COSM4383728 ENSP00000257290.5: C > T 54258768- p.Pro6Leu 54258817 PDGFRA COSM4416371 chr4: chr4 54263911 T C COSM4416371 ENSP00000257290.5: T > C 54263666- p.Asn204= 54263927 PDGFRA COSM6938810 chr4: chr4 54272497 G A COSM6938810 ENSP00000257290.5: G > A 54272393- p.Trp447Ter 54272520 PDGFRA COSM2155032 chr4: chr4 54273575 A G COSM2155032 ENSP00000257290.5: A > G 54273536- p.Asn468Ser 54273730 PDGFRA COSM4417622 chr4: chr4 54277410 G A COSM4417622 ENSP00000257290.5: G > A 54277387- p.Ala603= 54277492 PDGFRA COSM6958142 chr4: chr4 54278422 A C COSM6958142 ENSP00000257290.5: A > C 54278361- p.Lys688Thr 54278515 PDGFRA COSM4383732 chr4: chr4 54280374 A G COSM4383732 ENSP00000257290.5: A > G 54280315- p.Thr739Ala 54280482 KIT COSM6909371 chr4: chr4 54699686 G T COSM6909371 ENSP00000288135.5: G > T 54699629- p.Gly226Trp 54699766 KIT COSM3301432 chr4: chr4 54703760 G A COSM3301432 ENSP00000288135.5: G > A 54703723- p.Gly265Ser 54703892 KIT COSM9500507 chr4: chr4 54707133 A G COSM9500507 ENSP00000288135.5: A > G 54707097- p.Thr321Ala 54707287 KIT COSM6005552 chr4: chr4 54709427 C T COSM6005552 ENSP00000288135.5: C > T 54709423- p.Tyr373= 54709539 KIT COSM1325 chr4: chr4 54736599 G C COSM1325 ENSP00000288135.5: G > C 54736497- p.Leu862= 54736609 KIT COSM6945539 chr4: chr4 54737225 C A COSM6945539 ENSP00000288135.5: C > A 54737174- p.Thr916Lys 54737280 ROS1 COSM249317 chr6: chr6 117288728 C T COSM249317 ENSP00000357494.3: C > T 117288491- p.Glu2270Lys 117288802 ROS1 COSM150168 chr6: chr6 117301021 G C COSM150168 ENSP00000357494.3: G > C 117300973- p.Ser2229Cys 117301137 ROS1 COSM5576148 chr6: chr6 117308866 G T COSM5576148 ENSP00000357494.3: G > T 117308793- p.Ser2166Tyr 117308928 ROS1 COSM6950684 chr6: chr6 117311094 C A COSM6950684 ENSP00000357494.3: C > A 117311019- p.Leu2053Phe 117311117 ROS1 COSM6950893 chr6: chr6 117318188 C T COSM6950893 ENSP00000357494.3: C > T 117318187- p.Ser2002Asn 117318252 ROS1 COSM9513198 chr6: chr6 117321391 C A COSM9513198 ENSP00000357494.3: C > A 117321258- p.Trp1882Leu 117321394 ROS1 COSM6941244 chr6: chr6 117324337 G A COSM6941244 ENSP00000357494.3: G > A 117324331- p.Thr1879Ile 117324415 ROS1 COSM6965416 chr6: chr6 117329359 C A COSM6965416 ENSP00000357494.3: C > A 117329328- p.Cys1779Phe 117329446 ROS1 COSM9125580 chr6: chr6 117337327 T C COSM9125580 ENSP00000357494.3: T > C 117337171- p.Glu1698Gly 117337340 ROS1 COSM6969339 chr6: chr6 117344154 C T COSM6969339 ENSP00000357494.3: C > T 117344059- p.Trp1477Ter 117344262 ROS1 COSM4992412 chr6: chr6 117353036 C T COSM4992412 ENSP00000357494.3: C > T 117352989- p.Arg1425= 117353169 ROS1 COSM6951463 chr6: chr6 117365132 G C COSM6951463 ENSP00000357494.3: G > C 117365059- p.Leu1016Val 117365204 ROS1 COSM6954777 chr6: chr6 117365633 G A COSM6954777 ENSP00000357494.3: G > A 117365580- p.Ala974Val 117365741 ROS1 COSM95208 chr6: chr6 117366216 T C COSM95208 ENSP00000357494.3: T > C 117366075- p.Tyr891Cys 117366290 ROS1 COSM4992418 chr6: chr6 117379095 C T COSM4992418 ENSP00000357494.3: C > T 117379058- p.Cys854Tyr 117379159 ROS1 COSM7342701 chr6: chr6 117383402 G T COSM7342701 ENSP00000357494.3: G > T 117383316- p.Thr804Asn 117383508 ROS1 COSM9277478 chr6: chr6 117385755 G C COSM9277478 ENSP00000357494.3: G > C 117385682- p.Ser744Arg 117385861 ROS1 COSM6977455 chr6: chr6 117386990 G A COSM6977455 ENSP00000357494.3: G > A 117386888- p.Pro675Leu 117386999 ROS1 COSM6912204 chr6: chr6 117389389 G C COSM6912204 ENSP00000357494.3: G > C 117389349- p.Leu574Val 117389846 ROS1 COSM6912725 chr6: chr6 117394313 T A COSM6912725 ENSP00000357494.3: T > A 117394161- p.Tyr338Phe 117394346 ROS1 COSM6968764 chr6: chr6 117394705 C T COSM6968764 ENSP00000357494.3: C > T 117394615- p.Arg297Lys 117394738 ROS1 COSM6921289 chr6: chr6 117396196 G C COSM6921289 ENSP00000357494.3: G > C 117396187- p.Ser283Cys 117396264 ROS1 COSM5019315 chr6: chr6 117403216 C T COSM5019315 ENSP00000357494.3: C > T 117403138- p.Arg167Gln 117403277 ROS1 COSM3761460 chr6: chr6 117404415 T A COSM3761460 ENSP00000357494.3: T > A 117404279- p.Leu101= 117404428 ROS1 COSM6952051 chr6: chr6 117409597 C T COSM6952051 ENSP00000357494.3: C > T 117409581- p.Glu92Lys 117409642 ROS1 COSM4604501 chr6: chr6 117416316 C T COSM4604501 ENSP00000357494.3: C > T 117416257- p.Cys57Tyr 117416317 ROS1 COSM6355496 chr6: chr6 117418506 c T COSM6355496 ENSP00000357494.3: C > T 117418461- p.Gly42Ser 117418506 ROS1 COSM6910632 chr6: chr6 117425580 T C COSM6910632 ENSP00000357494.3: T > C 117425533- p.Gln26Arg 117425656 MET COSM5945634 chr7: chr7 116731717 G A COSM5945634 ENSP00000317272.6: G > A 116731667- p.Arg417Gln 116731859 MET COSM6927005 chr7: chr7 116739966 C T COSM6927005 ENSP00000317272.6: C > T 116739949- p.Ser470Leu 116740084 MET COSM3632213 chr7: chr7 116757727 G A COSM3632213 ENSP00000317272.6: G > A 116757637- p.Gly685= 116757774 MET COSM5047343 chr7: chr7 116769789 G C COSM5047343 ENSP00000317272.6: G > C 116769644- p.Glu928Gln 116769791 MET COSM5609378 chr7: chr7 116771624 C T COSM5609378 ENSP00000317272.6: C > T 116771497- p.Leu971= 116771654 MET COSM6438054 chr7: chr7 116777440 A T COSM6438054 ENSP00000317272.6: A > T 116777388- p.Lys1122Ile 116777469 MET COSM6983877 chr7: chr7 116778811 ACC ATT COSM6983877 ENSP00000317272.6: ACC > A 116778775- p.Thr1144Ile TT 116778957 EGFR COSM6937748 chr7: chr7 55019353 G A COSM6937748 ENSP00000275493.2: G > A 55019277- p.Glu26Lys 55019365 EGFR COSM9233361 chr7: chr7 55143416 G T COSM9233361 ENSP00000275493.2: G > T 55143304- p.Ala118Ser 55143488 EGFR COSM42978 chr7: chr7 55146655 C T COSM42978 ENSP00000275493.2: C > T 55146605- p.Asn158= 55146740 EGFR COSM7002280 chr7: chr7 55151308 C G COSM7002280 ENSP00000275493.2: C > G 55151293- p.Pro192Ala 55151362 EGFR COSM4166393 chr7: chr7 55152627 C T COSM4166393 ENSP00000275493.2: C > T 55152545- p.Ala237Val 55152664 EGFR COSM6970489 chr7: chr7 55156802 G A COSM6970489 ENSP00000275493.2: G > A 55156758- p.Asp393Asn 55156843 EGFR COSM7002279 chr7: chr7 55157735 G A COSM7002279 ENSP00000275493.2: G > A 55157662- p.Arg427His 55157753 EGFR COSM236670 chr7: chr7 55160316 C A COSM236670 ENSP00000275493.2: C > A 55160138- p.Ser492Arg 55160338 EGFR COSM5530405 chr7: chr7 55163734 G A COSM5530405 ENSP00000275493.2: G > A 55163732- p.Glu545Lys 55163823 EGFR COSM3762772 chr7: chr7 55171181 T A COSM3762772 ENSP00000275493.2: T > A 55171174- p.Thr629= 55171213 EGFR COSM6976991 chr7: chr7 55192784 G A COSM6976991 ENSP00000275493.2: G > A 55192765- p.Ala882Thr 55192841 EGFR COSM6932208 chr7: chr7 55198789 C T COSM6932208 ENSP00000275493.2: C > T 55198716- p.Ser925Phe 55198863 EGFR COSM5762244 chr7: chr7 55200351 C T COSM5762244 ENSP00000275493.2: C > T 55200315- p.Arg962Cys 55200413 EGFR COSM3762773 chr7: chr7 55201223 C T COSM3762773 ENSP00000275493.2: C > T 55201187- p.Asp994= 55201355 EGFR COSM6925302 chr7: chr7 55201765 T C COSM6925302 ENSP00000275493.2: T > C 55201734- p.Cys1049Arg 55201782 EGFR COSM7410173 chr7: chr7 55202527 G A COSM7410173 ENSP00000275493.2: G > A 55202516- p.Cys1058Tyr 55202625 EGFR COSM9496259 chr7: chr7 55205525 G A COSM9496259 ENSP00000275493.2: G > A 55205255- p.Ala1181Thr 55205617 GNAQ COSM52975 chr9: chr9 77797577 C T COSM52975 ENSP00000286548.4: C > T 77797519- p.Arg183Gln 77797648

    [0086] In some instances, a variant is described in Table 3.

    TABLE-US-00003 TABLE 3 genome_ fusion_name chrom_5 pos_5 chrom_3 pos_3 build TPR-ALK chr1  186,356,039 chr2  29,224,077 hg38 NCOA4-RET chr10 46,011,368 chr10 43,116,070 hg38 EML4-ALK1 chr2  42296684 chr2  29223819 hg38 EML4-ALK2 chr2  42274039 chr2  29225364 hg38 EML4-ALK3 chr2  42299217 chr2  29224971 hg38 KIF5B-RET1 chr10 32024672 chr10 43115128 hg38 KIF5B-RET2 chr10 32017899 chr10 43116571 hg38 KIF5B-RET3 chr10 32016770 chr10 43111682 hg38 CDC6-RET_1 chr10 59902926 chr10 43116231 hg38 CDC6-RET_2 chr10 59856493 chr10 43115739 hg38 CDC6-RET_3 chr10 59878856 chr10 43114499 hg38 TMPRSS2- chr21 41500529 chr21 38459804 hg38 ERG_1 TMPRSS2- chr21 41498978 chr21 38498963 hg38 ERG_2 TMPRSS2- chr21 41492789 chr21 38454919 hg38 ERG_3 TMPRSS2- chr21 41491740 chr21 38504508 hg38 ERG_4

    [0087] In some instances, a variant is described in Table 4.

    TABLE-US-00004 TABLE 4 cosmic_ ddpcr_ Var_ chrom start end gene protein dna ref alt id quant length  1 11471 11471 NRAS/ p.Q61R c.182A > G T C COSM58 0.0221  1 3907 3908 CSDE1 4  3 17923 17923 PIK3C p.N1068fs*4 c.3204_320 c C + 1A COSM12 0.0187  1 4360 4361 A 5insA 464  4 54274 54274 PDGFR p.S566fs*6 C.1694_169 T T + 1A COSM28 0.0224  1 880 881 A 5insA 053  5 11284 11284 APC p.T1556fs*3 c.4666_466 G G + 1A COSM18 0.0181  1 0253 0254 7insA 561 10 87957 87957 PTEN p.P248fs*5 c.741_742 T T + 1A COSM49 0.0143  1 957 958 insA 86 10 87958 87958 PTEN p.K267fs*9 c.800delA A * COSM58 0.0143  1 012 013 09 11 10824 10824 ATM p.C353fs*5 c.1058_105 COSM21 0.025  1 7120 7121 9delGT 924 17 76742 76742 TP53 p.R248Q c.743G > A C T COSM10 0.0204  1 19 20 662 17 76742 76742 TP53 p.C242fs*5 c.723delC G * COSM65 0.0202  1 39 40 30 17 76761 76761 TP53 p.S90fs*33 c.263delC G * COSM18 NaN  1 01 02 610 18 51076 51076 SMAD4 p.A466fs*28 c.1394_139 G G + 1T COSM14 0.0197  1 721 722 5insT 105  1 43349 43349 MPL P.W515L c.1544G > T G T COSM18 0.0219  1 337 338 918  2 20824 20824 IDH1 P.R132C c.394C > T G A COSM28 0.0253  1 8388 8389 747  3 41224 41224 CTNNB1 p.T41A c.121A > G A G COSM56 0.0226  1 632 633 64  3 13894 13894 FOXL2 P.C134W c.402C > G G C COSM33 0.0189  1 6320 6321 661  3 17921 17921 PIK3C p.E545K c.1633G > A G A COSM76 0.0177  1 8302 8303 A 3  3 17923 17923 PIK3C p.H1047R c.3140A > G A G COSM77 0.0204  1 4296 4297 A 5  4 18018 18018 FGFR3 P.S249C c.746C > G C G COSM71 0.0199  1 40 41 5  4 54285 54285 PDGFR p.D842V c.2525A > T A T COSM73 0.0211  1 925 926 A 6  4 54733 54733 KIT P.D816V c.2447A > T A T COSM13 0.0223  1 154 155 14  5 11283 11283 APC p.R1450* c.4348C > T C T COSM13 0.0175  1 9941 9942 127  5 17141 17141 NPMI p.W288fs*12 c.863_864 C C + COSM17 0.015  1 0538 0539 insTCTG 4TCTG 559  7 55174 55174 EGFR p.E746_A750 c.2236_225 COSM62 0.0243 15 772 787 delELREA 0del15 25 (“ELREA” disclosed as SEQ ID NO: 12)  7 55181 55181 EGFR p.D770_N771 c.2310_231 C C+3GGT COSM12 0.0214 1 318 319 insG linsGGT 378  7 55181 55181 EGFR p.T790M c.2369C > T C T COSM62 0.0214 1 377 378 40  7 55191 55191 EGFR p.L858R c.2573T > G T G COSM62 0.0261 1 821 822 24  7 14075 14075 BRAF P.V600E c,1799T > A A T COSM47 0.0213 1 3335 3336 6  9 50737 50737 JAK2 P.V617F c,1849G > T G T COSM12 0.0198 1 69 70 600  9 77794 77794 GNAQ P.Q209P c.626A > C T G COSM28 0.0193 1 571 572 758 10 43121 43121 RET p.M918T c.2753T > C T C COSM96 0.0204 1 967 968 5 12 25245 25245 KRAS p.G12D c.35G>  A C T COSM52 0.0203 1 349 350 1 13 28018 28018 FLT3 p.D835Y c.2503G > T C A COSM78 0.021 1 504 505 3 14 10478 10478 AKTI p.E17K c.49G > A C T COSM33 0.022 1 0213 0214 765 17 76738 76738 TP53 p.R273H c.818G > A c T COSM10 0.0196 1 01 02 660 17 76750 76750 TP53 p.R175H c.524G > A c T COSM10 0.0209 1 87 88 648 17 39724 39724 ERBB2 p.A775_G776 c.2324_232 A A  +  COSM68 0.0227 1 insYVMA 5ins12 12GCATA 2/20959 727 728 (“YVMA” CGTGATG disclosed as (SEQ ID SEQ ID NO: NO: 7) 54) 20 58854 58854 GNAS P.R201C c.601C > T c T COSM27 0.0206 1 052 053 887

    [0088] In some instances, a variant is described in Table 5.

    TABLE-US-00005 TABLE 5 Chromosome Gene Mutation 7q34 BRAF V600E 4q11-q12 cKIT D816V 7p12 EGFR ΔE746 - A750 7p12 EGFR L858R 7p12 EGFR T790M 7p12 EGFR G719S 12p12.1 KRAS G13D 12p12.1 KRAS G12D 1p13.2 NRAS Q61K 3q26.3 PIK3CA h2047R 3q26.3 PIK3CA E545K p23 ALK P1543S 1q25.2 ABL2 P986fs 5q21-q22 ARC R2714C 1p35.3 ARID1A p.M1564fs*1 13q12.3 BRCA2 A1689fs 13q12.3 CDX2 V306fs 22q13.2 EP300 K291fs 4q31.3 FBXW7 G667fs 8p12 FGFR1 P150L 13q12 FLT3 V197A 2q33.3 IDh2 S261L 7q31 MET V237fs 3p21.3 MLh2 L323M 17q11.2 NF1 L626fs 22q12.2 NF2 P275fs 9q34.3 NOTCh2 P668S 1q21-q22 NTRK1 5′UTR 4q12 PDGFRA G426D

    [0089] In some instances, a variant is described in Table 6.

    TABLE-US-00006 TABLE 6 Gene Variant description NRAS G12D NRAS Q61H IDH2 R172K IDH2 R140Q CTNNB1 G34E FOXL2 — PIK3CA N345K FGFR1 N546K FGFR1 K656E FGFR2 S252W FGFR2 N549K FGFR2 C382R FGFR2 K659E FGFR3 Y373C FGFR3 K650E PDGFRA V561D PDGFRA N659K PDGFRA SPDGHE566- (“SPDGHE” disclosed as SEQ ID NO: 55) KIT L576P KIT V560G KIT del547-555 KIT K642E EGFR S768I EGFR G724S EGFR L792H EGFR L718Q BRAF None JAK2 None GNAQ T96S RET None PTEN None KRAS Q61H FLT3 None AKT1 L52R AKT1 Q79K TP53 G245C TP53 R282W ERBB2 L755S ERBB2 P780_Y781insGSP ERBB2 V842I SMAD4 R361H GNA11 None GNAS1 None ATM None ALK G1128A, F1174L, R1192P, R1275Q AR T878A, W742C, structural variants ARAF S214C BRCA1 c.4964_4982del19 - p.(Ser1655Tyrfs*16)/5, c.5266dupC - p.(Gln1756Profs*74)/3, BRCA2 c.5351dupA - p.(Asn1784Lysfs*3)/4 CCND1 E275*fs, T286I CDH1 R732Q, A634V CDK12 W719*, E928fs27* CDK4 R24C CDK6 — CDKN2A — DDR2 I638F, L239R ESR1 D538G EZH2 Y641F FGFR2 S252W, N550K HRAS G12V JAK3 — MAP2K1 K57 N MAP2K2 — MET d1246n MTOR — NF1 — NTRK1 Fusions PTPN11 E76K, G503R RAF1 — RB1 — ROS1 G2032R SMO D473H STK11 — TERT C228T and C250T in promoter ABL1 F317V ARID1A Q1401* ATR — BAP1 W196* CCND2 None CCNE1 None CD274 None CHD1 Q23* CHEK2 None CRKL None ERBB3 v104m ERRFI1 None FBXW7 R465C FGFR4 None FH None FOXA1 R219S GATA3 P408fs HNF1A P289fs KDM5C S1222P KDM6A p.I598fsX6 MAPK1 E322K MAPK3 None MLH1 R498fs MYC T58A MYCN P44L MYD88 L265P NF2 None NFE2L2 G333C NOTCH1 LOF frameshift mutations, E124*, W1843* NTRK3 None PALB2 — PBRM1 p.F116fs*7 PDCD1LG2 None PDGFRB None RHEB Y35N RHOA Y42C RIT1 M90I SETD2 — SF3B1 None SMARCB1 None SPOP F133V TSC1 p.Q794 VEGFA — VHL None ZNF703 None

    [0090] In some instances, a variant described herein is from one or more of Tables 1-6.

    [0091] Variants (e.g., genomic variants) may be detected from a sample (e.g., genomic sample) with varying degrees of recall and precision. In some instances, the upper limit on detection is determined by performance of a reference standard described herein. In some instances, reference standards have pre-selected variant frequencies for comparison to patient samples. In some instances, recall represents the number of variants detected out of all that variants expected to be detectable. In some instances, precision represents the number of variants that are called correctly out of everything detected as a variant. In some instances, the variant is detected with a recall of at least 30%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or at least 99%. In some instances, the variant is detected with a recall of about 30%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or about 99%. In some instances, the variant is detected with a recall of about 10%-99%, 25-99%, 30-90%, 45-80%, 50-99%, 75-99%, or 90-99%. In some instances, the variant is detected with a precision of at least 30%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or at least 99%. In some instances, the variant is detected with a precision of about 30%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or about 99%. In some instances, the variant is detected with a precision of about 10%-99%, 25-99%, 30-90%, 45-80%, 50-99%, 75-99%, or 90-99%.

    [0092] Polynucleotide libraries may be designed to comprise sequences which are identical to or complementary (to target, hybridize) to one or more variants. In some instances, at least some of the polynucleotides are each configured to hybridize to genomic regions which comprise at least two variants. In some instances, at least some of the polynucleotides are each configured to hybridize to genomic regions which comprise at least one, two, three, four, five, six, or more than six variants. In some instances, at least some of the polynucleotides are each configured to hybridize to genomic regions which comprise one to four variants. In some instances, at least some of the polynucleotides are each configured to hybridize to genomic regions which comprise one to two or three variants. In some instances, at least 50% of the polynucleotides are each configured to hybridize to genomic regions which comprise at least two variants. In some instances, at least 50% of the polynucleotides are each configured to hybridize to genomic regions which comprise at least one, two, three, four, five, six, or more than six variants. In some instances, at least 50% of the polynucleotides are each configured to hybridize to genomic regions which comprise one to four variants. In some instances, at least 50% of the polynucleotides are each configured to hybridize to genomic regions which comprise one to two or three variants. In some instances, at least 25% of the polynucleotides are each configured to hybridize to genomic regions which comprise at least two variants. In some instances, at least 25% of the polynucleotides are each configured to hybridize to genomic regions which comprise at least one, two, three, four, five, six, or more than six variants. In some instances, at least 25% of the polynucleotides are each configured to hybridize to genomic regions which comprise one to four variants. In some instances, at least 25% of the polynucleotides are each configured to hybridize to genomic regions which comprise one to two or three variants. In some instances, at least 5% of the polynucleotides are each configured to hybridize to genomic regions which comprise at least two variants. In some instances, at least 5% of the polynucleotides are each configured to hybridize to genomic regions which comprise at least one, two, three, four, five, six, or more than six variants. In some instances, at least 5% of the polynucleotides are each configured to hybridize to genomic regions which comprise one to four variants. In some instances, at least 5% of the polynucleotides are each configured to hybridize to genomic regions which comprise one to two or three variants.

    [0093] Polynucleotide libraries may be configured to bind to many variants. In some instances, a polynucleotide library is collectively configured to bind to genomic regions comprising about 50, 100, 200, 500, 800, 1000, 2000, 5000, 8000, 10,000, 20,000, 50,000, 80,000, 100,000, 250,000, 500,000, 750,000, 1 million, 1.5 million, 2 million, 2.5 million, 3 million, 3.5 million, 4 million, 4.5 million, or about 5 million variants. In some instances, a polynucleotide library is collectively configured to bind to genomic regions comprising at least 50, 100, 200, 500, 800, 1000, 2000, 5000, 8000, 10,000, 20,000, 50,000, 80,000, 100,000, 250,000, 500,000, 750,000, 1 million, 1.5 million, 2 million, 2.5 million, 3 million, 3.5 million, 4 million, 4.5 million, or at least 5 million variants. In some instances, a polynucleotide library is collectively configured to bind to genomic regions comprising 100-1000, 50-100, 50-500, 50-5000, 50-10,000, 100,000-5 million, 250,000-3 million, 500,000-2 million, 750,000-4 million, 1 million-5 million, 1 million-3 million, 1 million-4 million, or 4 million to 6 million variants.

    [0094] Polynucleotide libraries for identifying variants may be optimized. In some instances, the library is uniform (each unique polynucleotide is equally represented). In some instances, the library is not uniform. In some instances, polynucleotides are represented in an amount within at least about 1.5 times the mean representation for the polynucleotide library. In some instances, polynucleotides are represented in an amount within at least about 2 times the mean representation for the polynucleotide library. In some instances, polynucleotides are represented in an amount within at least about 1.2 times the mean representation for the polynucleotide library. In some instances, polynucleotides are represented in an amount within at least about 1.7 times the mean representation for the polynucleotide library. In some instances, at least 80% polynucleotides are represented in an amount within at least about 1.5 times the mean representation for the polynucleotide library. In some instances, at least 80% polynucleotides are represented in an amount within at least about 2 times the mean representation for the polynucleotide library. In some instances, at least 80% polynucleotides are represented in an amount within at least about 1.7 times the mean representation for the polynucleotide library. In some instances, at least 80% polynucleotides are represented in an amount within at least about 2 times the mean representation for the polynucleotide library. In some instances, at least 90% polynucleotides are represented in an amount within at least about 1.5 times the mean representation for the polynucleotide library. In some instances, at least 90% polynucleotides are represented in an amount within at least about 2 times the mean representation for the polynucleotide library. In some instances, at least 80% polynucleotides are represented in an amount within at least about 1.7 times the mean representation for the polynucleotide library. In some instances, at least 90% polynucleotides are represented in an amount within at least about 2 times the mean representation for the polynucleotide library. In some instances, at least 95% polynucleotides are represented in an amount within at least about 1.5 times the mean representation for the polynucleotide library. In some instances, at least 95% polynucleotides are represented in an amount within at least about 2 times the mean representation for the polynucleotide library. In some instances, at least 95% polynucleotides are represented in an amount within at least about 1.7 times the mean representation for the polynucleotide library. In some instances, at least 95% polynucleotides are represented in an amount within at least about 2 times the mean representation for the polynucleotide library. Polynucleotide libraries in some instances comprise at least some polynucleotides which each comprise an overlap region with another polynucleotide in the library. In some instances at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or at least 90% of the polynucleotides each comprise an overlap region with another polynucleotide in the library. In some instances about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or about 90% of the polynucleotides each comprise an overlap region with another polynucleotide in the library. In some instances 10%-90%, 10-80%, 10-75%, 25%-50%, 25-90%, 50-90%, 15-35%, or 80-99% of the polynucleotides each comprise an overlap region with another polynucleotide in the library. In some instances, the amount of at least some of the polynucleotides in the library is 5, 10, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 600 times higher than the mean representation for the polynucleotide library. In some instances, the amount of at least 1% of the polynucleotides in the library is 5, 10, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 600 times higher than the mean representation for the polynucleotide library. In some instances, the amount of at least 2% of the polynucleotides in the library is 5, 10, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 600 times higher than the mean representation for the polynucleotide library. In some instances, the amount of at least 5% of the polynucleotides in the library is 5, 10, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 600 times higher than the mean representation for the polynucleotide library. In some instances, the amount of no more than 5% of the polynucleotides in the library is 5, 10, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 600 times higher than the mean representation for the polynucleotide library. In some instances, the amount of no more than 10% of the polynucleotides in the library is 5, 10, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 600 times higher than the mean representation for the polynucleotide library. In some instances, the amount of at least 1%-10% of the polynucleotides in the library is 5, 10, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 600 times higher than the mean representation for the polynucleotide library. In some instances, the amount of at least 1%-20% of the polynucleotides in the library is 5, 10, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, or 600 times higher than the mean representation for the polynucleotide library. In some instances, the relative amount of a polynucleotide library is adjusted based on high or low GC content.

    [0095] Polynucleotide libraries for identifying variants may collectively target a desired number of bases (bait territory). In some instances, a polynucleotide library comprise a bait territory of at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90 or at least 100 million bases. In some instances, a polynucleotide library comprise a bait territory of about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90 or about 100 million bases. In some instances, a polynucleotide library comprise a bait territory of no more than 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90 or no more than 100 million bases.

    [0096] Unique Molecular Identifiers

    [0097] Described herein are adapters comprising unique molecular identifiers (UMIs). Adapters in some instances comprise a structure 1000 of FIG. 10. In some instances, adapters comprise universal adapters. In some instances adapters comprise a Y-annealing region (anneals to form yoke), one or more Y-step non-annealing regions, a first index region 1001a, a second index region 1001b, a first UMI (index) region 1002a, a second UMI (index) region 1002b, and one or more regions exterior to the index. In some instances, adapters 1000 are ligated 1004 to sample polynucleotides 1003 to form an adapter-ligated polynucleotide 1005. After denaturation 1006 of 1005 (FIG. 10A), top 1007a and bottom 1007b strand ligation products are formed. In some instances, each strand is labeled with a different UML. After amplification 1009 with forward 1008a and backward 1008b primers, top strand 1010a and bottom strand 1010b PCR products are generated. In some instances, adapter ligated polynucleotides generated with universal adapters are further amplified with barcoded primers. In some instances adapters described herein comprise “in-line” UMIs, wherein at least one of a 5′ or 3′ UMI is not complementary to the other corresponding strand of the adapter (1001a and 1001b are not complementary). In some instances adapters described herein comprise “duplex” UMIs, wherein at least one of a 5′ or 3′ UMI is complementary to the other corresponding strand of the adapter (1001a and 1001b are complementary).

    [0098] Adapter-ligated libraries comprising unique molecular identifiers may be used to distinguish between “true” mutations from a polynucleotide sample library and artifacts generated during sequencing library preparation (e.g., PCR errors, sequencing errors, or other erroneous base call). In some instances, a workflow as shown in FIG. 11 is used to analyze a library of adapter-ligated sample polynucleotides 1101. Adapter-ligated sample polynucleotides 1101 each comprise two distinct UMIs 1101b represented by letters (A-F; six combinations of barcodes are shown for simplicity), and are attached to a sample polynucleotide 1101c. After sequencing 1106, forward and reverse read pairs 1102 from sequencing are sorted into read pair groups 1102a. Potential PCR-based errors are designated with “*”, and true polymorphisms are designated as “+”. Next, read pairs 1103 are grouped 1107 by barcode and barcode position. Single-stranded consensus sequences 1104 are then generated 1108 from each group of barcode-grouped read pairs. Errors from D-C, and F-E are identified, although the error in A-B remains. Finally, duplex consensus sequences 1105 are generated 1109 by comparing each set of single stranded consensus sequences. The error in A-B can be identified, and true mutation E-F can be confirmed. In some instances, errors include substitutions, deletions, or insertions. In some instances, an error is present in the sample polynucleotide portion of an adapter-ligated polynucleotide. In some instances, an error is present in a barcode configured to identify a sample origin (e.g., index) or to uniquely identify a sample polynucleotide. In some instances, an error is present in a UML. In some instances, an error is present in a sample index. Compositions and methods described herein in some instances are used to identify such errors.

    [0099] Described herein are sets of UMIs, wherein the set has defined properties. In some instances, a UMI set comprises a plurality of different polynucleotides having unique sequences. In some instances, a UMI set is 8, 12, 16, 20, 24, 30, 32, 36, 39, 48, or 64 unique sequences. In some instances, the sequences of a UMI set differ by a Hamming distance of no more than 1, 2, 3, 4, or 5. In some instances, the sequences of a UMI set differ by a Hamming distance of at least 1, 2, 3, 4, or 5. In some instances, the sequences of a UMI set differ by a Hamming distance of at least 2. In some instances, the sequences of a UMI set differ by a Hamming distance of at least 1.

    [0100] UMIs may be any length, depending on the desired application. In some instances, a UMI is no more than 15, 12, 10, 8, 7, 6, 5, 4, or not more than 3 bases in length. In some instances, a UMI is about 15, 12, 10, 8, 7, 6, 5, 4, or about 3 bases in length. In some instances, a UMI is about 3-12, 3-10, 3-8. 4-12, 4-10, 4-8, 6-12, or 8-12 bases in length. UMIs in a set may comprise more than one length. In some instances, 10, 20, 25, 30, 40, 50, 60, or 70 percent of UMIs in the set are a first length, and 90, 80, 75, 70, 60, 50, 40, or 30 percent are a second length. In some instances, the first length is 3-5 bases, and the second length is 3-5 bases. In some instances, UMIs comprise lengths of 5 or 6 bases.

    [0101] After addition of UMI-containing adapters to sample polynucleotides, at least some of the sample polynucleotides may be uniquely labeled. In some instances, at least 30%, 50%, 75%, 80%, 90%, 95%, or at least 98% of the sample polynucleotides are ligated to adapters comprising UMIs. In some instances, at least 1%, 2%, 5%, 10%, 15%, 20%, 30%, 50%, 75%, 80%, 90%, 95%, or at least 98% of the sample polynucleotides are labeled with a unique UMI sequence. In some instances, no more than 1%, 2%, 5%, 10%, 15%, 20%, 30%, 50%, 75%, 80%, 90%, 95%, or no more than 98% of the sample polynucleotides are labeled with a unique UMI sequence. In some instances, at least 1%, 2%, 5%10%, 15%, 20%, 30%, 50%, 75%, 80%, 90%, 95%, or at least 98% of the sample polynucleotides are uniquely identifiable after labeling with a UMI.

    [0102] UMIs described herein in some instances comprise sequences of one or more of AAGGA, ACAAC, ATACG, CACTG, CATGA, CGATA, CGTGT, GCCAT, GCTGT, GTCAC, GTCGT, TACGA, TCCTA, TCGTG, TGTCG, TTGGC, AACAC, AATGC, ACTAG, AGCAT, AGTAC, ATCTC, CAGAC, CAGTA, CGAAT, CGGTT, CTTGG, GCATA, GCTAA, GTGAG, GTGTC, and TGTGC. UMIs described herein in some instances comprise sequences of two or more of AAGGA, ACAAC, ATACG, CACTG, CATGA, CGATA, CGTGT, GCCAT, GCTGT, GTCAC, GTCGT, TACGA, TCCTA, TCGTG, TGTCG, TTGGC, AACAC, AATGC, ACTAG, AGCAT, AGTAC, ATCTC, CAGAC, CAGTA, CGAAT, CGGTT, CTTGG, GCATA, GCTAA, GTGAG, GTGTC, and TGTGC. UMIs described herein in some instances comprise sequences of five or more of AAGGA, ACAAC, ATACG, CACTG, CATGA, CGATA, CGTGT, GCCAT, GCTGT, GTCAC, GTCGT, TACGA, TCCTA, TCGTG, TGTCG, TTGGC, AACAC, AATGC, ACTAG, AGCAT, AGTAC, ATCTC, CAGAC, CAGTA, CGAAT, CGGTT, CTTGG, GCATA, GCTAA, GTGAG, GTGTC, and TGTGC. UMIs described herein in some instances comprise sequences of ten or more of AAGGA, ACAAC, ATACG, CACTG, CATGA, CGATA, CGTGT, GCCAT, GCTGT, GTCAC, GTCGT, TACGA, TCCTA, TCGTG, TGTCG, TTGGC, AACAC, AATGC, ACTAG, AGCAT, AGTAC, ATCTC, CAGAC, CAGTA, CGAAT, CGGTT, CTTGG, GCATA, GCTAA, GTGAG, GTGTC, and TGTGC.

    [0103] UMIs may be represented at pre-selected percentages among a library of UMIs. In some instances at least 90% of the UMIs are present at fraction of 1-5%. In some instances at least 90% of the UMIs are present at fraction of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5% 6%, 7%, or 8%. In some instances at least 90% of the UMIs are present at fraction of 0.5-8%, 1-7%, 1.5-7%, 2-7%, 2.5-6%, 3-8%, 3-6%, 1-5%, 0.5-5.5%, 1-4%, 1-6%, or 1-8%.

    [0104] Any amount of sample polynucleotides (e.g., input DNA or other nucleic acid) may be ligated to adapters described herein. In some instances, the amount of sample polynucleotides is about 1, 5, 8, 10, 15, 20, 25, 30, 50, 75, or about 100 ng. In some instances, the amount of sample polynucleotides is no more than 1, 5, 8, 10, 15, 20, 25, 30, 50, 75, or no more than 100 ng. In some instances, the amount of sample polynucleotides is at least 1, 5, 8, 10, 15, 20, 25, 30, 50, 75, or at least 100 ng. In some instances, the amount of sample polynucleotides 1-10 ng, 1-100 ng, 3-10 ng, 5-100 ng, 5-75 ng, 5-50 ng, 10-100 ng, 10-50 ng, 25-100 ng, or 25-75 ng.

    [0105] Provided herein are methods of generating adapters comprising UMIs. In a first method of adapter synthesis comprising synthesis of a top strand of an adapter comprising at least one UMI and a complementary bottom strand. After annealing the top and bottom adapter strands, an adapter comprising the structure of adapter 1000 is formed (FIG. 10C). In a second method of adapter synthesis, a top strand is synthesized without a UMI, and a bottom strand comprising a complementary region and a UMI (FIG. 10D). After, annealing, PCR is used to generate a complementary UMI on the top strand, and a terminal transferase adds a T to the 3′ end of top strand to generate adapter 1000. In a third method of synthesis, a top strand which does not comprise a UMI, and a bottom strand comprising a UMI, a restrictions site, and a 5′ overhang are synthesized (FIG. 10E). After annealing, the top strand is extended with PCR, and a restriction endonuclease is used to cleave a portion of the 3′ top strand and 5′ bottom strand to generate adapter 1000. In a fourth method of adapter synthesis, two complementary strands each comprising a UMI, a restriction site, and an overhang portion (3′ top strand, 5′ bottom strand) are synthesized, annealed, and cleaved with a restriction enzyme to generate adapter 1000. More than one UMIs may be present per adapter. In some instances, an adapter comprises 1, 2, 3, 4, 5, or more UMIs. In some instances, adapters comprise a first UMI and a second UML. In some instances, a first UMI and a second UMI are complementary. In some instances, adapters comprise a first UMI and a second UMI. In some instances, a first UMI and a second UMI are not complementary. In some instances adapters are combined into libraries of adapters. In some instances adapters in a library comprise UMIs. In some instances adapters in a library comprise unique combinations of a first UMI and a second UMI.

    [0106] Universal Adapters

    [0107] Provided herein are universal adapters. In some instances, universal adapters comprise one or more unique molecular identifiers. In some instances, the universal adapters disclosed herein may comprise a universal polynucleotide adapter comprising a first strand and a second strand. In some instances, a first strand comprises a first primer binding region, a first non-complementary region, and a first yoke region. In some instances, a second strand comprises a second primer binding region, a second non-complementary region, and a second yoke region. In some instances, a primer binding region allows for PCR amplification of a polynucleotide adapter. In some instances, a primer binding region allows for PCR amplification of a polynucleotide adapter and concurrent addition of one or more barcodes to the polynucleotide adapter. In some instances, the first yoke region is complementary to the second yoke region. In some instances, the first non-complementary region is not complementary to the second non-complementary region. In some instances, the universal adapter is a Y-shaped or forked adapter. In some instances, one or more yoke regions comprise nucleobase analogues that raise the T.sub.m between a first yoke region and a second yoke region. Primer binding regions as described herein may be in the form of a terminal adapter region of a polynucleotide. In some instances, a universal adapter comprises one index sequence. In some instances, a universal adapter comprises one unique molecular identifier. In some instances, universal adapters are configured for use with barcoded primers, wherein after ligation, barcoded primers are added via PCR.

    [0108] A universal (polynucleotide) adapter may be shortened relative to a typical barcoded adapter (e.g., full-length “Y adapter”). For example, a universal adapter strand is 20-45 bases in length. In some instances, a universal adapter strand is 25-40 bases in length. In some instances, a universal adapter strand is 30-35 bases in length. In some instances, a universal adapter strand is no more than 50 bases in length, no more than 45 bases in length, no more than 40 bases in length, no more than 35 bases in length, no more than 30 bases in length, or no more than 25 bases in length. In some instances, a universal adapter strand is about 25, 27, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, or about 60 bases in length. In some instances, a universal adapter strand is about 60 base pairs in length. In some instances, a universal adapter strand is about 58 base pairs in length. In some instances, a universal adapter strand is about 52 base pairs in length. In some instances, a universal adapter strand is about 33 base pairs in length.

    [0109] A universal adapter may be modified to facilitate ligation with a sample polynucleotide. For example, the 5′ terminus is phosphorylated. In some instances, a universal adapter comprises one or more non-native nucleobase linkages such as a phosphorothioate linkage. For example, a universal adapter comprises a phosphorothioate between the 3′ terminal base, and the base adjacent to the 3′ terminal base. A sample polynucleotide in some instances comprises nucleic acid from a variety of sources, such as DNA or RNA of human, bacterial, plant, animal, fungal, or viral origin. An adapter-ligated sample polynucleotide in some instances comprises a sample polynucleotide (e.g., sample nucleic acid) with adapters universal adapters ligated to both the 5′ and 3′ end of the sample polynucleotide to form an adapter-ligated polynucleotide. A duplex sample polynucleotide comprises both a first strand (forward) and a second strand (reverse).

    [0110] Universal adapters may contain any number of different nucleobases (DNA, RNA, etc.), nucleobase analogues, or non-nucleobase linkers or spacers. For example, an adapter comprises one or more nucleobase analogues or other groups that enhance hybridization (T.sub.m) between two strands of the adapter. In some instances, nucleobase analogues are present in the yoke region of an adapter. Nucleobase analogues and other groups include but are not limited to locked nucleic acids (LNAs), bicyclic nucleic acids (BNAs), C5-modified pyrimidine bases, 2′-O-methyl substituted RNA, peptide nucleic acids (PNAs), glycol nucleic acid (GNAs), threose nucleic acid (TNAs), xenonucleic acids (XNAs) morpholino backbone-modified bases, minor grove binders (MGBs), spermine, G-clamps, or a anthraquinone (Uaq) caps.

    [0111] Universal adapters may comprise any number of nucleobase analogues (such as LNAs or BNAs), depending on the desired hybridization T.sub.m. For example, an adapter comprises 1 to 20 nucleobase analogues. In some instances, an adapter comprises 1 to 8 nucleobase analogues. In some instances, an adapter comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or at least 12 nucleobase analogues. In some instances, an adapter comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or about 16 nucleobase analogues. In some instances, the number of nucleobase analogous is expressed as a percent of the total bases in the adapter. For example, an adapter comprises at least 1%, 2%, 5%, 10%, 12%, 18%, 24%, 30%, or more than 30% nucleobase analogues. In some instances, adapters (e.g., universal adapters) described herein comprise methylated nucleobases, such as methylated cytosine.

    Barcodes

    [0112] Polynucleotide primers may comprise defined sequences, such as barcodes (or indices). Adapters in some instances comprise one or more barcodes. In some instances, an adapter comprises at least one indexing barcode and at least one unique molecular identifier barcode. Barcodes can be attached to universal adapters, for example, using PCR and barcoded primers to generate barcoded adapter-ligated sample polynucleotides. Primer binding sites, such as universal primer binding sites, facilitate simultaneous amplification of all members of a barcode primer library, or a subpopulation of members. In some instances, a primer binding site comprises a region that binds to a flow cell or other solid support during next generation sequencing. In some instances, a barcoded primer comprises a P5 (5′-AATGATACGGCGACCACCGA-3′ (SEQ ID NO: 56)) or P7 (5′-CAAGCAGAAGACGGCATACGAGAT-3′ (SEQ ID NO: 57)) sequence. In some instances, primer binding sites are configured to bind to universal adapter sequences, and facilitate amplification and generation of barcoded adapters. In some instances, barcoded primers are no more than 60 bases in length. In some instances, barcoded primers are no more than 55 bases in length. In some instances, barcoded primers are 50-60 bases in length. In some instances, barcoded primers are about 60 bases in length. In some instances, barcodes described herein comprise methylated nucleobases, such as methylated cytosine.

    [0113] The number of unique barcodes available for a barcode set (collection of unique barcodes or barcode combinations configured to be used together to unique define samples) may depend on the barcode length. In some instances, a Hamming distance is defined by the number of base differences between any two barcodes. In some instances, a Levenshtein distance is defined by the number changes needed to change one barcode into another (insertions, substitutions, or deletions). In some instances, barcode sets described herein comprise a Levenshtein distance of at least 2, 3, 4, 5, 6, 7, or at least 8. In some instances, barcode sets described herein comprise a Hamming distance of at least 2, 3, 4, 5, 6, 7, or at least 8.

    [0114] Barcodes may be incorrectly associated with a different sample than they were assigned. In some instances, incorrect barcodes are occur from PCR errors (e.g., substitution) during library amplification. In some instances, entire barcodes “hop” or are transferred from one sample polynucleotide to another. Such transfers in some instances result from cross-contamination of free adapters or primers during a library generation workflow. In some instances a group of barcodes (barcode set) is chosen to minimize “barcode hopping”. In some instances, barcode hopping (for a single barcode) for a barcode set described herein is no more than 7%, 5%, 4%, 3%, 2%, 1%, 0.5%, or no more than 0.1%. In some instances, barcode hopping (for a single barcode) for a barcode set described herein is 0.1-6%, 0.1-5%, 0.2-5%, 0.5-5%, 1-7%, 1-5%, or 0.5-7%. In some instances, barcode hopping (for two barcodes) for a barcode set described herein is no more than 0.7%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.05%, or no more than 0.1%. In some instances, barcode hopping (for two barcodes) for a barcode set described herein is 0.01-0.6%, 0.01-0.5%, 0.02-0.5%, 0.05-0.5%, 0.1-0.7%, 0.1-0.5%, or 0.05-0.7%.

    [0115] Barcoded primers comprise one or more barcodes. In some instances, the barcodes are added to universal adapters through PCR reaction. Barcodes are nucleic acid sequences that allow some feature of a polynucleotide with which the barcode is associated to be identified. In some instances, a barcode comprises an index sequence. In some instances, index sequences allow for identification of a sample, or unique source of nucleic acids to be sequenced. A barcode or combination of barcodes in some instances identifies a specific patient. A barcode or combination of barcodes in some instances identifies a specific sample from a patient among other samples from the same patient. After sequencing, the barcode (or barcode region) provides an indicator for identifying a characteristic associated with the coding region or sample source. Barcodes can be designed at suitable lengths to allow sufficient degree of identification, e.g., at least about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or more bases in length. Multiple barcodes, such as about 2, 3, 4, 5, 6, 7, 8, 9, 10, or more barcodes, may be used on the same molecule, optionally separated by non-barcode sequences. In some instances, a barcode is positioned on the 5′ and the 3′ sides of a sample polynucleotide. In some instances, each barcode in a plurality of barcodes differ from every other barcode in the plurality at least three base positions, such as at least about 3, 4, 5, 6, 7, 8, 9, 10, or more positions. Use of barcodes allows for the pooling and simultaneous processing of multiple libraries for downstream applications, such as sequencing (multiplex). In some instances, at least 4, 8, 16, 32, 48, 64, 128, or more 512 barcoded libraries are used. In some instances, at least 400, 500, 800, 1000, 2000, 5000, 10,000, 12,000, 15,000, 18,000, 20,000, or at 25,000 barcodes are used. Barcoded primers or adapters may comprise unique molecular identifiers (UMI). Such UMIs in some instances uniquely tag all nucleic acids in a sample. In some instances, at least 60%, 70%, 80%, 90%, 95%, or more than 95% of the nucleic acids in a sample are tagged with a UML. In some instances, at least 85%, 90%, 95%, 97%, or at least 99% of the nucleic acids in a sample are tagged with a unique barcode, or UML. Barcoded primers in some instances comprise an index sequence and one or more UMI. UMIs allow for internal measurement of initial sample concentrations or stoichiometry prior to downstream sample processing (e.g., PCR or enrichment steps) which can introduce bias. In some instances, UMIs comprise one or more barcode sequences. In some instances, each strand (forward vs. reverse) of an adapter-ligated sample polynucleotide possesses one or more unique barcodes. Such barcodes are optionally used to uniquely tag each strand of a sample polynucleotide. In some instances, a barcoded primer comprises an index barcode and a UMI barcode. In some instances, after amplification with at least two barcoded primers, the resulting amplicons comprise two index sequences and two UMIs. In some instances, after amplification with at least two barcoded primers, the resulting amplicons comprise two index barcodes and one UMI barcode. In some instances, each strand of a universal adapter-sample polynucleotide duplex is tagged with a unique barcode, such as a UMI or index barcode.

    [0116] Barcoded primers in a library comprise a region that is complementary to a primer binding region on a universal adapter. For example, universal adapter binding region is complementary to primer region of the universal adapter, and universal adapter binding region is complementary to primer region of the universal adapter. Such arrangements facilitate extension of universal adapters during PCR, and attach barcoded primers. In some instances, the T.sub.m between the primer and the primer binding region is 40-65 degrees C. In some instances, the T.sub.m between the primer and the primer binding region is 42-63 degrees C. In some instances, the T.sub.m between the primer and the primer binding region is 50-60 degrees C. In some instances, the T.sub.m between the primer and the primer binding region is 53-62 degrees C. In some instances, the T.sub.m between the primer and the primer binding region is 54-58 degrees C. In some instances, the T.sub.m between the primer and the primer binding region is 40-57 degrees C. In some instances, the T.sub.m between the primer and the primer binding region is 40-50 degrees C. In some instances, the T.sub.m between the primer and the primer binding region is about 40, 45, 47, 50, 52, 53, 55, 57, 59, 61, or 62 degrees C.

    [0117] Hybridization Blockers

    [0118] Blockers may contain any number of different nucleobases (DNA, RNA, etc.), nucleobase analogues (non-canonical), or non-nucleobase linkers or spacers. In some instances, blockers comprise universal blockers. Such blockers may in some instances are described as a “set”, wherein the set comprises two or more blockers configured to prevent unwanted interactions with the same adapter sequence. In some instances, universal blockers prevent adapter-adapter interactions independent of one or more barcodes present on at least one of the adapters. For example, a blocker comprises one or more nucleobase analogues or other groups that enhance hybridization (T.sub.m) between the blocker and the adapter. In some instances, a blocker comprises one or more nucleobases which decrease hybridization (T.sub.m) between the blocker and the adapter (e.g., “universal” bases). In some instances, a blocker described herein comprises both one or more nucleobases which increase hybridization (T.sub.m) between the blocker and the adapter and one or more nucleobases which decrease hybridization (T.sub.m) between the blocker and the adapter.

    [0119] Described herein are hybridization blockers comprising one or more regions which enhance binding to targeted sequences (e.g., adapter), and one or more regions which decrease binding to target sequences (e.g., adapter). In some instances, each region is tuned for a given desired level of off-bait activity during target enrichment applications. In some instances, each region can be altered with either a single type of chemical modification/moiety or multiple types to increase or decrease overall affinity of a molecule for a targeted sequence. In some instances, the melting temperature of all individual members of a blocker set are held above a specified temperature (e.g., with the addition of moieties such as LNAs and/or BNAs). In some instances, a given set of blockers will improve off bait performance independent of index length, independent of index sequence, and independent of how many adapter indices are present in hybridization.

    [0120] Blockers may comprise moieties which increase and/or decrease affinity for a target sequencing, such as an adapter. In some instances, such specific regions can be thermodynamically tuned to specific melting temperatures to either avoid or increase the affinity for a particular targeted sequence. This combination of modifications is in some instances designed to help increase the affinity of the blocker molecule for specific and unique adapter sequence and decrease the affinity of the blocker molecule for repeated adapter sequence (e.g., Y-stem annealing portion of adapter). In some instances, blockers comprise moieties which decrease binding of a blocker to the Y-stem region of an adapter. In some instances, blockers comprise moieties which decrease binding of a blocker to the Y-stem region of an adapter, and moieties which increase binding of a blocker to non-Y-stem regions of an adapter.

    [0121] Blockers (e.g., universal blockers) and adapters may form a number of different populations during hybridization. In a population ‘A’ in some instances comprises blockers correctly bound to non-index regions of the adapters. In a population ‘B’, a region of the blockers is bound to the “yoke” region of the adapter, but a remaining portion of the blocker does not bind to an adjacent region of the adapter. In a population ‘C’, two blockers unproductively dimerize. In a population ‘D’, blockers are unbound to any other nucleic acids. In some instances, when the number of DNA modifications that decrease affinity in the Y-stem annealing region of the blocker are increased, the populations ‘A’ & ‘D’ dominate and either have the desired or minimal effect. In some instances, as the number of DNA modifications that decrease affinity in the Y-stem annealing region of the blocker are decreased, the populations ‘B’ & ‘C’ dominate and have undesired effects where daisy-chaining or annealing to other adapters can occur (‘B’) or sequester blockers where they are unable to function properly (‘C’).

    [0122] The index on both single or dual index adapter designs may be either partially or fully covered by universal blockers that have been extended with specifically designed DNA modifications to cover adapter index bases. In some instances, such modifications comprise moieties which decrease annealing to the index, such as universal bases. In some instances, the index of a dual index adapter is partially covered (or is overlapped) by one or more blockers. In some instances, the index of a dual index adapter is fully covered by one or more blockers. In some instances, the index of a single index adapter is partially covered by one or more blockers. In some instances, the index of a single index adapter is fully covered by one or more blockers. In some instances, a blocker overlaps an index sequence by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or more than 20 bases. In some instances, a blocker overlaps an index sequence by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, or no more than 25 bases. In some instances, a blocker overlaps an index sequence by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or about 30 bases. In some instances, a blocker overlaps an index sequence by 1-5, 1-3, 2-5, 2-8, 2-10, 3-6, 3-10, 4-10, 4-15, 1-4 or 5-7 bases. In some instances, a region of a blocker which overlaps an index sequences comprises at least one 2-deoxyinosine or 5-nitroindole nucleobase.

    [0123] One or two blockers may overlap with an index sequence present on an adapter. In some instances, one or two blockers combined overlap with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or more than 20 bases of the index sequence. In some instances, one or two blockers combined overlap with no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or no more than 20 bases of the index sequence. In some instances, one or two blockers combined overlap with about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or about 20 bases of the index sequence. In some instances, one or two blockers combined overlap by 1-5, 1-3, 2-5, 2-8, 2-10, 3-6, 3-10, 4-10, 4-15, 1-4 or 5-7 bases of the index sequence. In some instances, a region of a blocker which overlaps an index sequences comprises at least one 2-deoxyinosine or 5-nitroindole nucleobase.

    [0124] In a first arrangement, the length of the adapter index overhang may be varied. When designed from a single side, the adapter index overhang can be altered to cover from 0 to n of the adapter index bases from either side of the index. This allows for the ability to design such adapter blockers for both single and dual index adapter systems.

    [0125] In a second arrangement, the adapter index bases are covered from both sides. When adapter index bases are covered from both sides, the length of the covering region of each blocker can be chosen such that a single pair of blockers is capable of interacting with a range of adapter index lengths while still covering a significant portion of the total number of index bases. As an example, take two blockers that have been designed with 3 bp overhangs that cover the adapter index. In the context of 6 bp, 8 bp, or 10 bp adapter index lengths, these blockers will leave 0 bp, 2 bp, or 4 bp exposed during hybridization, respectively.

    [0126] In a third arrangement, modified nucleobases are selected to cover index adapter bases. Examples of these modifications that are currently commercially available include degenerate bases (i.e., mixed bases of A, T, C, G), 2′-deoxylnosine, & 5-nitroindole.

    [0127] In a forth arrangement, blockers with adapter index overhangs bind to either the sense (i.e., ‘top’) or anti-sense (i.e., ‘bottom’) strand of a next generation sequencing library.

    [0128] In a fifth arrangement, blockers are further extended to cover other polynucleotide sequences (e.g., a poly-A tail added in a previous biochemical step in order to facilitate ligation or other method to introduce a defined adapter sequence, unique molecular identifier for bioinformatic assignment following sequencing, etc.) in addition to the standard adapter index bases of defined length and composition. These types of sequences can be placed in multiple locations of an adapter and in this case the most widely utilized case (i.e., unique molecular index next to the genomic insert) is presented. Other positions for the unique molecular identifier (e.g., next to adapter index bases) could also be addressed with similar approaches.

    [0129] In a sixth arrangement, all of the previous arrangements are utilized in various combinations to meet a targeted performance metric for off-bait performance during target enrichment under specified conditions.

    [0130] Blockers may comprise moieties, such as nucleobase analogues. Nucleobase analogues and other groups include but are not limited to locked nucleic acids (LNAs), bicyclic nucleic acids (BNAs), C5-modified pyrimidine bases, 2′-O-methyl substituted RNA, peptide nucleic acids (PNAs), glycol nucleic acid (GNAs), threose nucleic acid (TNAs), inosine, 2′-deoxylnosine, 3-nitropyrrole, 5-nitroindole, xenonucleic acids (XNAs) morpholino backbone-modified bases, minor grove binders (MGBs), spermine, G-clamps, or a anthraquinone (Uaq) caps. In some instances, nucleobase analogues comprise universal bases, wherein the nucleobase has a lower T.sub.m for binding to a cognate nucleobase. In some instances, universal bases comprise 5-nitroindole or 2′-deoxylnosine. In instances, blockers comprise spacer elements that connect two polynucleotide chains. In some instances, blockers comprise one or more nucleobase analogues. In some instances, such nucleobase analogues are added to control the T.sub.m of a blocker. Blockers may comprise any number of nucleobase analogues (such as LNAs or BNAs), depending on the desired hybridization T.sub.m. For example, a blocker comprises 20 to 40 nucleobase analogues. In some instances, a blocker comprises 8 to 16 nucleobase analogues. In some instances, a blocker comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or at least 12 nucleobase analogues. In some instances, a blocker comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or about 16 nucleobase analogues. In some instances, the number of nucleobase analogous is expressed as a percent of the total bases in the blocker. For example, a blocker comprises at least 1%, 2%, 5%, 10%, 12%, 18%, 24%, 30%, or more than 30% nucleobase analogues. In some instances, the blocker comprising a nucleobase analogue raises the T.sub.m in a range of about 2° C. to about 8° C. for each nucleobase analogue. In some instances, the T.sub.m is raised by at least or about 1° C., 2° C., 3° C., 4° C., 5° C., 6° C., 7° C., 8° C., 9° C., 10° C., 12° C., 14° C., or 16° C. for each nucleobase analogue. Such blockers in some instances are configured to bind to the top or “sense” strand of an adapter. Blockers in some instances are configured to bind to the bottom or “anti-sense” strand of an adapter. In some instances a set of blockers includes sequences which are configured to bind to both top and bottom strands of an adapter. Additional blockers in some instances are configured to the complement, reverse, forward, or reverse complement of an adapter sequence. In some instances, a set of blockers targeting a top (binding to the top) or bottom strand (or both) is designed and tested, followed by optimization, such as replacing a top blocker with a bottom blocker, or a bottom blocker with a top blocker. In some instances, a blocker is configured to overlap fully or partially with bases of an index or barcode on an adapter. A set of blockers in some instances comprise at least one blocker overlapping with an adapter index sequence. A set of blockers in some instances comprise at least one blocker overlapping with an adapter index sequence, and at least one blocker which does not overlap with an adapter sequence. A set of blockers in some instances comprise at least one blocker which does not overlap with a yoke region sequence. A set of blockers in some instances comprise at least one blocker which does not overlap with a yoke region sequence and at least one blocker which overlaps with a yoke region sequence. A sets of blockers in some instances comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 blockers.

    [0131] Blockers may be any length, depending on the size of the adapter or hybridization T.sub.m. For example, blockers are 20 to 50 bases in length. In some instances, blockers are 25 to 45 bases, 30 to 40 bases, 20 to 40 bases, or 30 to 50 bases in length. In some instances, blockers are 25 to 35 bases in length. In some instances blockers are at least 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or at least 35 bases in length. In some instances, blockers are no more than 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or no more than 35 bases in length. In some instances, blockers are about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or about 35 bases in length. In some instances, blockers are about 50 bases in length. A set of blockers targeting an adapter-tagged genomic library fragment in some instances comprises blockers of more than one length. Two blockers are in some instances tethered together with a linker. Various linkers are well known in the art, and in some instances comprise alkyl groups, polyether groups, amine groups, amide groups, or other chemical group. In some instances, linkers comprise individual linker units, which are connected together (or attached to blocker polynucleotides) through a backbone such as phosphate, thiophosphate, amide, or other backbone. In an exemplary arrangement, a linker spans the index region between a first blocker that each targets the 5′ end of the adapter sequence and a second blocker that targets the 3′ end of the adapter sequence. In some instances, capping groups are added to the 5′ or 3′ end of the blocker to prevent downstream amplification. Capping groups variously comprise polyethers, polyalcohols, alkanes, or other non-hybridizable group that prevents amplification. Such groups are in some instances connected through phosphate, thiophosphate, amide, or other backbone. In some instances, one or more blockers are used. In some instances, at least 4 non-identical blockers are used. In some instances, a first blocker spans a first 3′ end of an adaptor sequence, a second blocker spans a first 5′ end of an adaptor sequence, a third blocker spans a second 3′ end of an adaptor sequence, and a fourth blockers spans a second 5′ end of an adaptor sequence. In some instances a first blocker is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or at least 35 bases in length. In some instances a second blocker is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or at least 35 bases in length. In some instances a third blocker is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or at least 35 bases in length. In some instances a fourth blocker is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or at least 35 bases in length. In some instances, a first blocker, second blocker, third blocker, or fourth blocker comprises a nucleobase analogue. In some instances, the nucleobase analogue is LNA.

    [0132] The design of blockers may be influenced by the desired hybridization T.sub.m to the adapter sequence. In some instances, non-canonical nucleic acids (for example locked nucleic acids, bridged nucleic acids, or other non-canonical nucleic acid or analog) are inserted into blockers to increase or decrease the blocker's T.sub.m. In some instances, the T.sub.m of a blocker is calculated using a tool specific to calculating T.sub.m for polynucleotides comprising a non-canonical amino acid. In some instances, a T.sub.m is calculated using the Exiqon™ online prediction tool. In some instances, blocker T.sub.m described herein are calculated in-silico. In some instances, the blocker T.sub.m is calculated in-silico, and is correlated to experimental in-vitro conditions. Without being bound by theory, an experimentally determined T.sub.m may be further influenced by experimental parameters such as salt concentration, temperature, presence of additives, or other factor. In some instances, T.sub.m described herein are in-silico determined T.sub.m that are used to design or optimize blocker performance. In some instances, T.sub.m values are predicted, estimated, or determined from melting curve analysis experiments. In some instances, blockers have a T.sub.m of 70 degrees C. to 99 degrees C. In some instances, blockers have a T.sub.m of 75 degrees C. to 90 degrees C. In some instances, blockers have a T.sub.m of at least 85 degrees C. In some instances, blockers have a T.sub.m of at least 70, 72, 75, 77, 80, 82, 85, 88, 90, or at least 92 degrees C. In some instances, blockers have a T.sub.m of about 70, 72, 75, 77, 80, 82, 85, 88, 90, 92, or about 95 degrees C. In some instances, blockers have a T.sub.m of 78 degrees C. to 90 degrees C. In some instances, blockers have a T.sub.m of 79 degrees C. to 90 degrees C. In some instances, blockers have a T.sub.m of 80 degrees C. to 90 degrees C. In some instances, blockers have a T.sub.m of 81 degrees C. to 90 degrees C. In some instances, blockers have a T.sub.m of 82 degrees C. to 90 degrees C. In some instances, blockers have a T.sub.m of 83 degrees C. to 90 degrees C. In some instances, blockers have a T.sub.m of 84 degrees C. to 90 degrees C. In some instances, a set of blockers have an average T.sub.m of 78 degrees C. to 90 degrees C. In some instances, a set of blockers have an average T.sub.m of 80 degrees C. to 90 degrees C. In some instances, a set of blockers have an average T.sub.m of at least 80 degrees C. In some instances, a set of blockers have an average T.sub.m of at least 81 degrees C. In some instances, a set of blockers have an average T.sub.m of at least 82 degrees C. In some instances, a set of blockers have an average T.sub.m of at least 83 degrees C. In some instances, a set of blockers have an average T.sub.m of at least 84 degrees C. In some instances, a set of blockers have an average T.sub.m of at least 86 degrees C. Blocker T.sub.m are in some instances modified as a result of other components described herein, such as use of a fast hybridization buffer and/or hybridization enhancer.

    [0133] The molar ratio of blockers to adapter targets may influence the off-bait (and subsequently off-target) rates during hybridization. The more efficient a blocker is at binding to the target adapter, the less blocker is required. Blockers described herein in some instances achieve sequencing outcomes of no more than 20% off-target reads with a molar ratio of less than 20:1 (blocker:target). In some instances, no more than 20% off-target reads are achieved with a molar ratio of less than 10:1 (blocker:target). In some instances, no more than 20% off-target reads are achieved with a molar ratio of less than 5:1 (blocker:target). In some instances, no more than 20% off-target reads are achieved with a molar ratio of less than 2:1 (blocker:target). In some instances, no more than 20% off-target reads are achieved with a molar ratio of less than 1.5:1 (blocker:target). In some instances, no more than 20% off-target reads are achieved with a molar ratio of less than 1.2:1 (blocker:target). In some instances, no more than 20% off-target reads are achieved with a molar ratio of less than 1.05:1 (blocker:target).

    [0134] The universal blockers may be used with panel libraries of varying size. In some embodiments, the panel libraries comprises at least or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 1.0, 2.0, 4.0, 8.0, 10.0, 12.0, 14.0, 16.0, 18.0, 20.0, 22.0, 24.0, 26.0, 28.0, 30.0, 40.0, 50.0, 60.0, or more than 60.0 megabases (Mb).

    [0135] Blockers as described herein may improve on-target performance. In some embodiments, on-target performance is improved by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%. In some embodiments, the on-target performance is improved by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95% for various index designs. In some embodiments, the on-target performance is improved by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95% is improved for various panel sizes.

    [0136] De Novo Synthesis of Small Polynucleotide Populations for Amplification Reactions

    [0137] Described herein are methods of synthesis of polynucleotides from a surface, e.g., a plate (FIG. 2). In some instances, polynucleotide libraries comprise sample polynucleotide libraries. In some instances, the polynucleotides are synthesized on a cluster of loci for polynucleotide extension, released and then subsequently subjected to an amplification reaction, e.g., PCR. An exemplary workflow of synthesis of polynucleotides from a cluster is depicted in FIG. 2. A silicon plate 201 includes multiple clusters 203. Within each cluster are multiple loci 221. Polynucleotides are synthesized 207 de novo on a plate 201 from the cluster 203. Polynucleotides are cleaved 211 and removed 213 from the plate to form a population of released polynucleotides 215. The population of released polynucleotides 215 is then amplified 217 to form a library of amplified polynucleotides 219.

    [0138] Provided herein are methods where amplification of polynucleotides synthesized on a cluster provide for enhanced control over polynucleotide representation compared to amplification of polynucleotides across an entire surface of a structure without such a clustered arrangement. In some instances, amplification of polynucleotides synthesized from a surface having a clustered arrangement of loci for polynucleotides extension provides for overcoming the negative effects on representation due to repeated synthesis of large polynucleotide populations. Exemplary negative effects on representation due to repeated synthesis of large polynucleotide populations include, without limitation, amplification bias resulting from high/low GC content, repeating sequences, trailing adenines, secondary structure, affinity for target sequence binding, or modified nucleotides in the polynucleotide sequence.

    [0139] Cluster amplification as opposed to amplification of polynucleotides across an entire plate without a clustered arrangement can result in a tighter distribution around the mean. For example, if 100,000 reads are randomly sampled, an average of 8 reads per sequence would yield a library with a distribution of about 1.5× from the mean. In some cases, single cluster amplification results in at most about 1.5×, 1.6×, 1.7×, 1.8×, 1.9×, or 2.0× from the mean. In some cases, single cluster amplification results in at least about 1.0×, 1.2×, 1.3×, 1.5×1.6×, 1.7×, 1.8×, 1.9×, or 2.0× from the mean.

    [0140] Cluster amplification methods described herein when compared to amplification across a plate can result in a polynucleotide library that requires less sequencing for equivalent sequence representation. In some instances at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% less sequencing is required. In some instances up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, up to 70%, up to 80%, up to 90%, or up to 95% less sequencing is required. Sometimes 30% less sequencing is required following cluster amplification compared to amplification across a plate. Sequencing of polynucleotides in some instances is verified by high-throughput sequencing such as by next generation sequencing. Sequencing of the sequencing library can be performed with any appropriate sequencing technology, including but not limited to single-molecule real-time (SMRT) sequencing, polony sequencing, sequencing by ligation, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or sequencing by synthesis. The number of times a single nucleotide or polynucleotide is identified or “read” is defined as the sequencing depth or read depth. In some cases, the read depth is referred to as a fold coverage, for example, 55 fold (or 55×) coverage, optionally describing a percentage of bases.

    [0141] In some instances, amplification from a clustered arrangement compared to amplification across a plate results in less dropouts, or sequences which are not detected after sequencing of amplification product. Dropouts can be of AT and/or GC. In some instances, a number of dropouts are at most about 1%, 2%, 3%, 4%, or 5% of a polynucleotide population. In some cases, the number of dropouts is zero.

    [0142] A cluster as described herein comprises a collection of discrete, non-overlapping loci for polynucleotide synthesis. A cluster can comprise about 50-1000, 75-900, 100-800, 125-700, 150-600, 200-500, or 300-400 loci. In some instances, each cluster includes 121 loci. In some instances, each cluster includes about 50-500, 50-200, 100-150 loci. In some instances, each cluster includes at least about 50, 100, 150, 200, 500, 1000 or more loci. In some instances, a single plate includes 100, 500, 10000, 20000, 30000, 50000, 100000, 500000, 700000, 1000000 or more loci. A locus can be a spot, well, microwell, channel, or post. In some instances, each cluster has at least 1×, 2×, 3×, 4×, 5×, 6×, 7×, 8×, 9×, 10×, or more redundancy of separate features supporting extension of polynucleotides having identical sequence.

    [0143] Generation of Polynucleotide Libraries with Controlled Stoichiometry of Sequence Content

    [0144] In some instances, the polynucleotide library (such as a sample polynucleotide set for variant detection) is synthesized with a specified distribution of desired polynucleotide sequences. In some instances, adjusting polynucleotide libraries for enrichment of specific desired sequences results in improved downstream application outcomes.

    [0145] One or more specific sequences can be selected based on their evaluation in a downstream application. In some instances, the evaluation is binding affinity to target sequences for amplification, enrichment, or detection, stability, melting temperature, biological activity, ability to assemble into larger fragments, or other property of polynucleotides. In some instances, the evaluation is empirical or predicted from prior experiments and/or computer algorithms. An exemplary application includes increasing sequences in a probe library which correspond to areas of a genomic target having less than average read depth.

    [0146] Selected sequences in a polynucleotide library can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95% of the sequences. In some instances, selected sequences in a polynucleotide library are at most 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or at most 100% of the sequences. In some cases, selected sequences are in a range of about 5-95%, 10-90%, 30-80%, 40-75%, or 50-70% of the sequences.

    [0147] Polynucleotide libraries can be adjusted for the frequency of each selected sequence. In some instances, polynucleotide libraries favor a higher number of selected sequences. For example, a library is designed where increased polynucleotide frequency of selected sequences is in a range of about 40% to about 90%. In some instances, polynucleotide libraries contain a low number of selected sequences. For example, a library is designed where increased polynucleotide frequency of the selected sequences is in a range of about 10% to about 60%. A library can be designed to favor a higher and lower frequency of selected sequences. In some instances, a library favors uniform sequence representation. For example, polynucleotide frequency is uniform with regard to selected sequence frequency, in a range of about 10% to about 90%. In some instances, a library comprises polynucleotides with a selected sequence frequency of about 10% to about 95% of the sequences.

    [0148] Generation of polynucleotide libraries with a specified selected sequence frequency in some cases occurs by combining at least 2 polynucleotide libraries with different selected sequence frequency content. In some instances, at least 2, 3, 4, 5, 6, 7, 10, or more than 10 polynucleotide libraries are combined to generate a population of polynucleotides with a specified selected sequence frequency. In some cases, no more than 2, 3, 4, 5, 6, 7, or 10 polynucleotide libraries are combined to generate a population of non-identical polynucleotides with a specified selected sequence frequency.

    [0149] In some instances, selected sequence frequency is adjusted by synthesizing fewer or more polynucleotides per cluster. For example, at least 25, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or more than 1000 non-identical polynucleotides are synthesized on a single cluster. In some cases, no more than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 non-identical polynucleotides are synthesized on a single cluster. In some instances, 50 to 500 non-identical polynucleotides are synthesized on a single cluster. In some instances, 100 to 200 non-identical polynucleotides are synthesized on a single cluster. In some instances, about 100, about 120, about 125, about 130, about 150, about 175, or about 200 non-identical polynucleotides are synthesized on a single cluster.

    [0150] In some cases, selected sequence frequency is adjusted by synthesizing non-identical polynucleotides of varying length. For example, the length of each of the non-identical polynucleotides synthesized may be at least or about at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 2000 nucleotides, or more. The length of the non-identical polynucleotides synthesized may be at most or about at most 2000, 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides, or less. The length of each of the non-identical polynucleotides synthesized may fall from 10-2000, 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, and 19-25.

    [0151] Use of Polynucleotide Libraries as Standards

    [0152] Provided herein are methods of using polynucleotide libraries to improve the sensitivity and accuracy of nucleic acid variant detection. In some instances, the method comprises preparing a nucleic acid sample useful for determining the detection limit of genomic variants. In some instances, the method comprises one or more of the steps of providing a polynucleotide library described herein (e.g., reference standard); obtaining at least one sample from a patient suspected of having a disease or condition; detecting the presence or absence of the one or more variants in the library; and detecting the presence or absence of the one or more variants in the at least one sample. In some instances, detecting comprises sequencing. In some instances, detecting comprises Next Generation Sequencing. In some instances, sequencing comprises sequencing by synthesis, nanopore sequencing, SMRT sequencing, or other sequencing method described herein. In some instances, detecting comprises ddPCR or specific hybridization to an array.

    [0153] Samples (test samples) may be obtained from any source. In some instances, the source is a human. In some instances, the source is a human (or patient) suspected of having a disease or condition. In some instances, the test sample comprises a liquid biopsy. In some instances, the test sample comprises circulating tumor DNA (ctDNA). In some instances, the test sample comprises circulating tumor DNA (ctDNA). In some instances, the test sample is obtained from blood. In some instances, the test sample is substantially cell-free. In some instances, more than one test sample is analyzed sequentially or in parallel. In some instances, at least 1, 2, 3, 4, 5, 10, 20, 50, 100, 200, 500, 1000, or more than 2000 test samples are analyzed. In some instances, the method further comprises detection of minimal residual disease (MRD). In some instances, the patient is suspected of having a disease or condition. In some instances, the disease or condition is a proliferative disease. In some instances, the disease or condition is cancer. In some instances, the patient was previously treated, is currently treated, or has received a clinical diagnosis for cancer. In some instances, the method further comprises ligating sequencing adapters to at least some polynucleotides in the sample, the library, or both. In some instances, the method further comprises amplifying at least some polynucleotides in the sample, the library, or both. In some instances, if one or more variants are not detected in the library, then results obtained from the at least one sample is discarded or re-analyzed.

    [0154] Kits

    [0155] Provided herein are kits comprising libraries of polynucleotides. In some instances, a kit comprises one or more of a reference standards (controls), wherein the reference standard comprises a sample polynucleotide set and a background set; instructions for use of the kit contents; and packaging to hold and describe the kit contents. In some instances, a kit comprises at least two standards selected from sample polynucleotides having a VAF of 0%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. In some instances, a kit comprises five standards each having a VAF of 0%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. In some instances, kits comprise instructions of use of reference standards with one or more sequencing instruments or other instrument which is configured to measure genomic variants. In some instances, the reference standard is packaged in a buffer. In some instances, the reference standard is packaged in a tube. In some instances, the reference standard is not packaged in a plasma-like format. In some instances, the reference standard comprises 500 ng to 5 micrograms of total DNA.

    [0156] Next Generation Sequencing Applications

    [0157] Downstream applications of polynucleotide libraries (such as sample polynucleotide sets or reference standards) may include next generation sequencing. For example, enrichment of target sequences with a controlled stoichiometry polynucleotide probe library results in more efficient sequencing. The performance of a polynucleotide library for capturing or hybridizing to targets may be defined by a number of different metrics describing efficiency, accuracy, and precision. For example, Picard metrics comprise variables such as HS library size (the number of unique molecules in the library that correspond to target regions, calculated from read pairs), mean target coverage (the percentage of bases reaching a specific coverage level), depth of coverage (number of reads including a given nucleotide) fold enrichment (sequence reads mapping uniquely to the target/reads mapping to the total sample, multiplied by the total sample length/target length), percent off-bait bases (percent of bases not corresponding to bases of the probes/baits), percent off-target (percent of bases not corresponding to bases of interest), usable bases on target, AT or GC dropout rate, fold 80 base penalty (fold over-coverage needed to raise 80 percent of non-zero targets to the mean coverage level), percent zero coverage targets, PF reads (the number of reads passing a quality filter), percent selected bases (the sum of on-bait bases and near-bait bases divided by the total aligned bases), percent duplication, or other variable consistent with the specification.

    [0158] Read depth (sequencing depth, or sampling) represents the total number of times a sequenced nucleic acid fragment (a “read”) is obtained for a sequence. Theoretical read depth is defined as the expected number of times the same nucleotide is read, assuming reads are perfectly distributed throughout an idealized genome. Read depth is expressed as function of % coverage (or coverage breadth). For example, 10 million reads of a 1 million base genome, perfectly distributed, theoretically results in 10× read depth of 100% of the sequences. In practice, a greater number of reads (higher theoretical read depth, or oversampling) may be needed to obtain the desired read depth for a percentage of the target sequences. Enrichment of target sequences with a controlled stoichiometry probe library increases the efficiency of downstream sequencing, as fewer total reads will be required to obtain an outcome with an acceptable number of reads over a desired % of target sequences. For example, in some instances 55× theoretical read depth of target sequences results in at least 30× coverage of at least 90% of the sequences. In some instances no more than 55× theoretical read depth of target sequences results in at least 30× read depth of at least 80% of the sequences. In some instances no more than 55× theoretical read depth of target sequences results in at least 30× read depth of at least 95% of the sequences. In some instances no more than 55× theoretical read depth of target sequences results in at least 10× read depth of at least 98% of the sequences. In some instances, 55× theoretical read depth of target sequences results in at least 20× read depth of at least 98% of the sequences. In some instances no more than 55× theoretical read depth of target sequences results in at least 5× read depth of at least 98% of the sequences. Increasing the concentration of probes during hybridization with targets can lead to an increase in read depth. In some instances, the concentration of probes is increased by at least 1.5×, 2.0×, 2.5×, 3×, 3.5×, 4×, 5×, or more than 5×. In some instances, increasing the probe concentration results in at least a 1000% increase, or a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 500%, 750%, 1000%, or more than a 1000% increase in read depth. In some instances, increasing the probe concentration by 3× results in a 1000% increase in read depth. In some instances, sequencing is performed to achieve a theoretical read depth of at least 30×, 50×, 100×, 150×, 200×, 250×, 300×, 500×, or at least 1000×. In some instances, sequencing is performed to achieve a theoretical read depth of about 30×, 50×, 100×, 150×, 200×, 250×, 300×, 500×, or about 1000×. In some instances, sequencing is performed to achieve a theoretical read depth of no more than 30×, 50×, 100×, 150×, 200×, 250×, 300×, 500×, or no more than 1000×. In some instances, sequencing is performed to achieve an actual read depth of at least 30×, 50×, 100×, 150×, 200×, 250×, 300×, 500×, or at least 1000×. In some instances, sequencing is performed to achieve an actual read depth of no more than 30×, 50×, 100×, 150×, 200×, 250×, 300×, 500×, or no more than 1000×. In some instances, sequencing is performed to achieve an actual read depth of about 30×, 50×, 100×, 150×, 200×, 250×, 300×, 500×, or about 1000×.

    [0159] On-target rate represents the percentage of sequencing reads that correspond with the desired target sequences. In some instances, a controlled stoichiometry polynucleotide probe library results in an on-target rate of at least 30%, or at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or at least 90%. Increasing the concentration of polynucleotide probes during contact with target nucleic acids leads to an increase in the on-target rate. In some instances, the concentration of probes is increased by at least 1.5×, 2.0×, 2.5×, 3×, 3.5×, 4×, 5×, or more than 5×. In some instances, increasing the probe concentration results in at least a 20% increase, or a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, or at least a 500% increase in on-target binding. In some instances, increasing the probe concentration by 3× results in a 20% increase in on-target rate.

    [0160] Coverage uniformity is in some cases calculated as the read depth as a function of the target sequence identity. Higher coverage uniformity results in a lower number of sequencing reads needed to obtain the desired read depth. For example, a property of the target sequence may affect the read depth, for example, high or low GC or AT content, repeating sequences, trailing adenines, secondary structure, affinity for target sequence binding (for amplification, enrichment, or detection), stability, melting temperature, biological activity, ability to assemble into larger fragments, sequences containing modified nucleotides or nucleotide analogues, or any other property of polynucleotides. Enrichment of target sequences with controlled stoichiometry polynucleotide probe libraries results in higher coverage uniformity after sequencing. In some instances, 95% of the sequences have a read depth that is within 1× of the mean library read depth, or about 0.05, 0.1, 0.2, 0.5, 0.7, 1, 1.2, 1.5, 1.7 or about within 2× the mean library read depth. In some instances, 80%, 85%, 90%, 95%, 97%, or 99% of the sequences have a read depth that is within 1× of the mean.

    [0161] Enrichment of Target Nucleic Acids with a Polynucleotide Probe Library

    [0162] A probe library described herein may be used to enrich target polynucleotides present in a population of sample polynucleotides, for a variety of downstream applications. In one some instances, a sample is obtained from one or more sources, and the population of sample polynucleotides is isolated. Samples are obtained (by way of non-limiting example) from biological sources such as saliva, blood, tissue, skin, or completely synthetic sources. The plurality of polynucleotides obtained from the sample are fragmented, end-repaired, and adenylated to form a double stranded sample nucleic acid fragment. In some instances, end repair is accomplished by treatment with one or more enzymes, such as T4 DNA polymerase, klenow enzyme, and T4 polynucleotide kinase in an appropriate buffer. A nucleotide overhang to facilitate ligation to adapters is added, in some instances with 3′ to 5′ exo minus klenow fragment and dATP.

    [0163] Adapters (such as universal adapters) may be ligated to both ends of the sample polynucleotide fragments with a ligase, such as T4 ligase, to produce a library of adapter-tagged polynucleotide strands, and the adapter-tagged polynucleotide library is amplified with primers, such as universal primers. In some instances, the adapters are Y-shaped adapters comprising one or more primer binding sites, one or more grafting regions, and one or more index (or barcode) regions. In some instances, the one or more index region is present on each strand of the adapter. In some instances, grafting regions are complementary to a flowcell surface, and facilitate next generation sequencing of sample libraries. In some instances, Y-shaped adapters comprise partially complementary sequences. In some instances, Y-shaped adapters comprise a single thymidine overhang which hybridizes to the overhanging adenine of the double stranded adapter-tagged polynucleotide strands. Y-shaped adapters may comprise modified nucleic acids, that are resistant to cleavage. For example, a phosphorothioate backbone is used to attach an overhanging thymidine to the 3′ end of the adapters. If universal primers are used, amplification of the library is performed to add barcoded primers to the adapters. A library of double stranded adapter-tagged polynucleotide strands is contacted with polynucleotide probes, to form hybrid pairs. Such pairs are separated from unhybridized fragments, and isolated from probes to produce an enriched library. The enriched library may then be sequenced.

    [0164] The library of double stranded sample nucleic acid fragments is then denatured in the presence of adapter blockers. Adapter blockers minimize off-target hybridization of probes to the adapter sequences (instead of target sequences) present on the adapter-tagged polynucleotide strands, and/or prevent intermolecular hybridization of adapters (i.e., “daisy chaining”). Denaturation is carried out in some instances at 96° C., or at about 85, 87, 90, 92, 95, 97, 98 or about 99° C. A polynucleotide targeting library (probe library) is denatured in a hybridization solution, in some instances at 96° C., at about 85, 87, 90, 92, 95, 97, 98 or 99° C. The denatured adapter-tagged polynucleotide library and the hybridization solution are incubated for a suitable amount of time and at a suitable temperature to allow the probes to hybridize with their complementary target sequences. In some instances, a suitable hybridization temperature is about 45 to 80° C., or at least 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90° C. In some instances, the hybridization temperature is 70° C. In some instances, a suitable hybridization time is 16 hours, or at least 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, or more than 22 hours, or about 12 to 20 hours. Binding buffer is then added to the hybridized adapter-tagged-polynucleotide probes, and a solid support comprising a capture moiety is used to selectively bind the hybridized adapter-tagged polynucleotide-probes. The solid support is washed with buffer to remove unbound polynucleotides before an elution buffer is added to release the enriched, tagged polynucleotide fragments from the solid support. In some instances, the solid support is washed 2 times, or 1, 2, 3, 4, 5, or 6 times. The enriched library of adapter-tagged polynucleotide fragments is amplified and the enriched library is sequenced.

    [0165] A plurality of nucleic acids (i.e. genomic sequence) may obtained from a sample, and fragmented, optionally end-repaired, and adenylated. Adapters are ligated to both ends of the polynucleotide fragments to produce a library of adapter-tagged polynucleotide strands, and the adapter-tagged polynucleotide library is amplified. The adapter-tagged polynucleotide library is then denatured at high temperature, preferably 96° C., in the presence of adapter blockers. A polynucleotide targeting library (probe library) is denatured in a hybridization solution at high temperature, preferably about 90 to 99° C., and combined with the denatured, tagged polynucleotide library in hybridization solution for about 10 to 24 hours at about 45 to 80° C. Binding buffer is then added to the hybridized tagged polynucleotide probes, and a solid support comprising a capture moiety are used to selectively bind the hybridized adapter-tagged polynucleotide-probes. The solid support is washed one or more times with buffer, preferably about 2 and 5 times to remove unbound polynucleotides before an elution buffer is added to release the enriched, adapter-tagged polynucleotide fragments from the solid support. The enriched library of adapter-tagged polynucleotide fragments is amplified and then the library is sequenced. Alternative variables such as incubation times, temperatures, reaction volumes/concentrations, number of washes, or other variables consistent with the specification are also employed in the method.

    [0166] In any of the instances, the detection or quantification analysis of the oligonucleotides can be accomplished by sequencing. The subunits or entire synthesized oligonucleotides can be detected via full sequencing of all oligonucleotides by any suitable methods known in the art, e.g., Illumina sequencing by synthesis, PacBio nanopore sequencing, or BGI/MGI nanoball sequencing, including the sequencing methods described herein.

    [0167] Sequencing can be accomplished through classic Sanger sequencing methods which are well known in the art. Sequencing can also be accomplished using high-throughput systems some of which allow detection of a sequenced nucleotide immediately after or upon its incorporation into a growing strand, i.e., detection of sequence in red time or substantially real time. In some cases, high throughput sequencing generates at least 1,000, at least 5,000, at least 10,000, at least 20,000, at least 30,000, at least 40,000, at least 50,000, at least 100,000 or at least 500,000 sequence reads per hour; with each read being at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120 or at least 150 bases per read.

    [0168] In some instances, high-throughput sequencing involves the use of technology available by Illumina's Genome Analyzer IIX, MiSeq personal sequencer, or HiSeq systems, such as those using HiSeq 2500, HiSeq 1500, HiSeq 2000, HiSeq 1000, iSeq 100, Mini Seq, MiSeq, NextSeq 550, NextSeq 2000, NextSeq 550, or NovaSeq 6000. These machines use reversible terminator-based sequencing by synthesis chemistry. These machines can generate 6000 Gb or more reads in 13-44 hours. Smaller systems may be utilized for runs within 3, 2, 1 days or less time. Short synthesis cycles may be used to minimize the time it takes to obtain sequencing results.

    [0169] In some instances, high-throughput sequencing involves the use of technology available by ABI Solid System. This genetic analysis platform that enables massively parallel sequencing of clonally-amplified DNA fragments linked to beads. The sequencing methodology is based on sequential ligation with dye-labeled oligonucleotides.

    [0170] The next generation sequencing can comprise ion semiconductor sequencing (e.g., using technology from Life Technologies (Ion Torrent)). Ion semiconductor sequencing can take advantage of the fact that when a nucleotide is incorporated into a strand of DNA, an ion can be released. To perform ion semiconductor sequencing, a high density array of micromachined wells can be formed. Each well can hold a single DNA template. Beneath the well can be an ion sensitive layer, and beneath the ion sensitive layer can be an ion sensor. When a nucleotide is added to a DNA, H+ can be released, which can be measured as a change in pH. The H+ ion can be converted to voltage and recorded by the semiconductor sensor. An array chip can be sequentially flooded with one nucleotide after another. No scanning, light, or cameras can be required. In some cases, an IONPROTON™ Sequencer is used to sequence nucleic acid. In some cases, an IONPGM™ Sequencer is used. The Ion Torrent Personal Genome Machine (PGM) can do 10 million reads in two hours.

    [0171] In some instances, high-throughput sequencing involves the use of technology available by Helicos BioSciences Corporation (Cambridge, Mass.) such as the Single Molecule Sequencing by Synthesis (SMSS) method. SMSS is unique because it allows for sequencing the entire human genome in up to 24 hours. Finally, SMSS is powerful because, like the MW technology, it does not require a pre amplification step prior to hybridization. In fact, SMSS does not require any amplification.

    [0172] In some instances, high-throughput sequencing involves the use of technology available by 454 Lifesciences, Inc. (Branford, Conn.) such as the Pico Titer Plate device which includes a fiber optic plate that transmits chemiluminescent signal generated by the sequencing reaction to be recorded by a CCD camera in the instrument. This use of fiber optics allows for the detection of a minimum of 20 million base pairs in 4.5 hours.

    [0173] Methods for using bead amplification followed by fiber optics detection are described in Marguiles, M., et al. “Genome sequencing in microfabricated high-density picolitre reactors”, Nature, doi: 10.1038/nature03959.

    [0174] In some instances, high-throughput sequencing is performed using Clonal Single Molecule Array (Solexa, Inc.) or sequencing-by-synthesis (SBS) utilizing reversible terminator chemistry. Constans, A., The Scientist 2003, 17(13):36. High-throughput sequencing of oligonucleotides can be achieved using any suitable sequencing method known in the art, such as those commercialized by Pacific Biosciences, Complete Genomics, Genia Technologies, Halcyon Molecular, Oxford Nanopore Technologies and the like. Overall such systems involve sequencing a target oligonucleotide molecule having a plurality of bases by the temporal addition of bases via a polymerization reaction that is measured on a molecule of oligonucleotide, i e., the activity of a nucleic acid polymerizing enzyme on the template oligonucleotide molecule to be sequenced is followed in real time. Sequence can then be deduced by identifying which base is being incorporated into the growing complementary strand of the target oligonucleotide by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target oligonucleotide molecule complex is provided in a position suitable to move along the target oligonucleotide molecule and extend the oligonucleotide primer at an active site. A plurality of labeled types of nucleotide analogs are provided proximate to the active site, with each distinguishably type of nucleotide analog being complementary to a different nucleotide in the target oligonucleotide sequence. The growing oligonucleotide strand is extended by using the polymerase to add a nucleotide analog to the oligonucleotide strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target oligonucleotide at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labeled nucleotide analogs, polymerizing the growing oligonucleotide strand, and identifying the added nucleotide analog are repeated so that the oligonucleotide strand is further extended and the sequence of the target oligonucleotide is determined.

    [0175] The next generation sequencing technique can comprises real-time (SMRT™) technology by Pacific Biosciences. In SMRT, each of four DNA bases can be attached to one of four different fluorescent dyes. These dyes can be phospho linked. A single DNA polymerase can be immobilized with a single molecule of template single stranded DNA at the bottom of a zero-mode waveguide (ZMW). A ZMW can be a confinement structure which enables observation of incorporation of a single nucleotide by DNA polymerase against the background of fluorescent nucleotides that can rapidly diffuse in an out of the ZMW (in microseconds). It can take several milliseconds to incorporate a nucleotide into a growing strand. During this time, the fluorescent label can be excited and produce a fluorescent signal, and the fluorescent tag can be cleaved off. The ZMW can be illuminated from below. Attenuated light from an excitation beam can penetrate the lower 20-30 nm of each ZMW. A microscope with a detection limit of 20 zepto liters (10″ liters) can be created. The tiny detection volume can provide 1000-fold improvement in the reduction of background noise. Detection of the corresponding fluorescence of the dye can indicate which base was incorporated. The process can be repeated.

    [0176] In some cases, the next generation sequencing is nanopore sequencing {See e.g., Soni G V and Meller A. (2007) Clin Chem 53: 1996-2001). A nanopore can be a small hole, of the order of about one nanometer in diameter. Immersion of a nanopore in a conducting fluid and application of a potential across it can result in a slight electrical current due to conduction of ions through the nanopore. The amount of current which flows can be sensitive to the size of the nanopore. As a DNA molecule passes through a nanopore, each nucleotide on the DNA molecule can obstruct the nanopore to a different degree. Thus, the change in the current passing through the nanopore as the DNA molecule passes through the nanopore can represent a reading of the DNA sequence. The nanopore sequencing technology can be from Oxford Nanopore Technologies; e.g., a GridION system. A single nanopore can be inserted in a polymer membrane across the top of a microwell. Each microwell can have an electrode for individual sensing. The microwells can be fabricated into an array chip, with 100,000 or more microwells (e.g., more than 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or 1,000,000) per chip. An instrument (or node) can be used to analyze the chip. Data can be analyzed in real-time. One or more instruments can be operated at a time. The nanopore can be a protein nanopore, e.g., the protein alpha-hemolysin, a heptameric protein pore. The nanopore can be a solid-state nanopore made, e.g., a nanometer sized hole formed in a synthetic membrane (e.g., SiN.sub.x, or SiO.sub.2). The nanopore can be a hybrid pore (e.g., an integration of a protein pore into a solid-state membrane). The nanopore can be a nanopore with an integrated sensors (e.g., tunneling electrode detectors, capacitive detectors, or graphene based nano-gap or edge state detectors (see e.g., Garaj et al. (2010) Nature vol. 67, doi: 10.1038/nature09379)). A nanopore can be functionalized for analyzing a specific type of molecule (e.g., DNA, RNA, or protein). Nanopore sequencing can comprise “strand sequencing” in which intact DNA polymers can be passed through a protein nanopore with sequencing in real time as the DNA translocates the pore. An enzyme can separate strands of a double stranded DNA and feed a strand through a nanopore. The DNA can have a hairpin at one end, and the system can read both strands. In some cases, nanopore sequencing is “exonuclease sequencing” in which individual nucleotides can be cleaved from a DNA strand by a processive exonuclease, and the nucleotides can be passed through a protein nanopore. The nucleotides can transiently bind to a molecule in the pore (e.g., cyclodextran). A characteristic disruption in current can be used to identify bases.

    [0177] Nanopore sequencing technology from GENIA can be used. An engineered protein pore can be embedded in a lipid bilayer membrane. “Active Control” technology can be used to enable efficient nanopore-membrane assembly and control of DNA movement through the channel. In some cases, the nanopore sequencing technology is from NABsys. Genomic DNA can be fragmented into strands of average length of about 100 kb. The 100 kb fragments can be made single stranded and subsequently hybridized with a 6-mer probe. The genomic fragments with probes can be driven through a nanopore, which can create a current-versus-time tracing. The current tracing can provide the positions of the probes on each genomic fragment. The genomic fragments can be lined up to create a probe map for the genome. The process can be done in parallel for a library of probes. A genome-length probe map for each probe can be generated. Errors can be fixed with a process termed “moving window Sequencing By Hybridization (mwSBH).” In some cases, the nanopore sequencing technology is from IBM/Roche. An electron beam can be used to make a nanopore sized opening in a microchip. An electrical field can be used to pull or thread DNA through the nanopore. A DNA transistor device in the nanopore can comprise alternating nanometer sized layers of metal and dielectric. Discrete charges in the DNA backbone can get trapped by electrical fields inside the DNA nanopore. Turning off and on gate voltages can allow the DNA sequence to be read.

    [0178] The next generation sequencing can comprise DNA nanoball sequencing (as performed, e.g., by Complete Genomics; see e.g., Drmanac et al. (2010) Science 327: 78-81). DNA can be isolated, fragmented, and size selected. For example, DNA can be fragmented (e.g., by sonication) to a mean length of about 500 bp. Adaptors (Adl) can be attached to the ends of the fragments. The adaptors can be used to hybridize to anchors for sequencing reactions. DNA with adaptors bound to each end can be PCR amplified. The adaptor sequences can be modified so that complementary single strand ends bind to each other forming circular DNA. The DNA can be methylated to protect it from cleavage by a type IIS restriction enzyme used in a subsequent step. An adaptor (e.g., the right adaptor) can have a restriction recognition site, and the restriction recognition site can remain non-methylated. The non-methylated restriction recognition site in the adaptor can be recognized by a restriction enzyme (e.g., Acul), and the DNA can be cleaved by Acul 13 bp to the right of the right adaptor to form linear double stranded DNA. A second round of right and left adaptors (Ad2) can be ligated onto either end of the linear DNA, and all DNA with both adapters bound can be PCR amplified (e.g., by PCR). Ad2 sequences can be modified to allow them to bind each other and form circular DNA. The DNA can be methylated, but a restriction enzyme recognition site can remain non-methylated on the left Ad1 adapter. A restriction enzyme (e.g., Acul) can be applied, and the DNA can be cleaved 13 bp to the left of the Ad1 to form a linear DNA fragment. A third round of right and left adaptor (Ad3) can be ligated to the right and left flank of the linear DNA, and the resulting fragment can be PCR amplified. The adaptors can be modified so that they can bind to each other and form circular DNA. A type III restriction enzyme (e.g., EcoP15) can be added; EcoP15 can cleave the DNA 26 bp to the left of Ad3 and 26 bp to the right of Ad2. This cleavage can remove a large segment of DNA and linearize the DNA once again. A fourth round of right and left adaptors (Ad4) can be ligated to the DNA, the DNA can be amplified (e.g., by PCR), and modified so that they bind each other and form the completed circular DNA template.

    [0179] Rolling circle replication (e.g., using Phi 29 DNA polymerase) can be used to amplify small fragments of DNA. The four adaptor sequences can contain palindromic sequences that can hybridize and a single strand can fold onto itself to form a DNA nanoball (DNB™) which can be approximately 200-300 nanometers in diameter on average. A DNA nanoball can be attached (e.g., by adsorption) to a microarray (sequencing flowcell). The flow cell can be a silicon wafer coated with silicon dioxide, titanium and hexamethyldisilazane (HMDS) and a photoresist material. Sequencing can be performed by unchained sequencing by ligating fluorescent probes to the DNA. The color of the fluorescence of an interrogated position can be visualized by a high resolution camera. The identity of nucleotide sequences between adaptor sequences can be determined.

    [0180] A population of polynucleotides may be enriched prior to adapter ligation. In one example, a plurality of polynucleotides is obtained from a sample, fragmented, optionally end-repaired, and denatured at high temperature, preferably 90-99° C. A polynucleotide targeting library (probe library) is denatured in a hybridization solution at high temperature, preferably about 90 to 99° C., and combined with the denatured, tagged polynucleotide library in hybridization solution for about 10 to 24 hours at about 45 to 80° C. Binding buffer is then added to the hybridized tagged polynucleotide probes, and a solid support comprising a capture moiety are used to selectively bind the hybridized adapter-tagged polynucleotide-probes. The solid support is washed one or more times with buffer, preferably about 2 and 5 times to remove unbound polynucleotides before an elution buffer is added to release the enriched, adapter-tagged polynucleotide fragments from the solid support. The enriched polynucleotide fragments are then polyadenylated, adapters are ligated to both ends of the polynucleotide fragments to produce a library of adapter-tagged polynucleotide strands, and the adapter-tagged polynucleotide library is amplified. The adapter-tagged polynucleotide library is then sequenced.

    [0181] A polynucleotide targeting library may also be used to filter undesired sequences from a plurality of polynucleotides, by hybridizing to undesired fragments. For example, a plurality of polynucleotides is obtained from a sample, and fragmented, optionally end-repaired, and adenylated. Adapters are ligated to both ends of the polynucleotide fragments to produce a library of adapter-tagged polynucleotide strands, and the adapter-tagged polynucleotide library is amplified. Alternatively, adenylation and adapter ligation steps are instead performed after enrichment of the sample polynucleotides. The adapter-tagged polynucleotide library is then denatured at high temperature, preferably 90-99° C., in the presence of adapter blockers. A polynucleotide filtering library (probe library) designed to remove undesired, non-target sequences is denatured in a hybridization solution at high temperature, preferably about 90 to 99° C., and combined with the denatured, tagged polynucleotide library in hybridization solution for about 10 to 24 hours at about 45 to 80° C. Binding buffer is then added to the hybridized tagged polynucleotide probes, and a solid support comprising a capture moiety are used to selectively bind the hybridized adapter-tagged polynucleotide-probes. The solid support is washed one or more times with buffer, preferably about 1 and 5 times to elute unbound adapter-tagged polynucleotide fragments. The enriched library of unbound adapter-tagged polynucleotide fragments is amplified and then the amplified library is sequenced.

    [0182] Highly Parallel De Novo Nucleic Acid Synthesis

    [0183] Described herein is a platform approach utilizing miniaturization, parallelization, and vertical integration of the end-to-end process from polynucleotide synthesis to gene assembly within Nano wells on silicon to create a revolutionary synthesis platform. Devices described herein provide, with the same footprint as a 96-well plate, a silicon synthesis platform is capable of increasing throughput by a factor of 100 to 1,000 compared to traditional synthesis methods, with production of up to approximately 1,000,000 polynucleotides in a single highly-parallelized run. In some instances, a single silicon plate described herein provides for synthesis of about 6,100 non-identical polynucleotides. In some instances, each of the non-identical polynucleotides is located within a cluster. A cluster may comprise 50 to 500 non-identical polynucleotides.

    [0184] Methods described herein provide for synthesis of a library of polynucleotides each encoding for a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is nucleic acid sequence encoding for a protein, and the variant library comprises sequences encoding for variation of at least a single codon such that a plurality of different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are generated by standard translation processes. The synthesized specific alterations in the nucleic acid sequence can be introduced by incorporating nucleotide changes into overlapping or blunt ended polynucleotide primers. Alternatively, a population of polynucleotides may collectively encode for a long nucleic acid (e.g., a gene) and variants thereof. In this arrangement, the population of polynucleotides can be hybridized and subject to standard molecular biology techniques to form the long nucleic acid (e.g., a gene) and variants thereof. When the long nucleic acid (e.g., a gene) and variants thereof are expressed in cells, a variant protein library is generated. Similarly, provided here are methods for synthesis of variant libraries encoding for RNA sequences (e.g., miRNA, shRNA, and mRNA) or DNA sequences (e.g., enhancer, promoter, UTR, and terminator regions). Also provided here are downstream applications for variants selected out of the libraries synthesized using methods described here. Downstream applications include identification of variant nucleic acid or protein sequences with enhanced biologically relevant functions, e.g., biochemical affinity, enzymatic activity, changes in cellular activity, and for the treatment or prevention of a disease state.

    [0185] Substrates

    [0186] Provided herein are substrates comprising a plurality of clusters, wherein each cluster comprises a plurality of loci that support the attachment and synthesis of polynucleotides. The term “locus” as used herein refers to a discrete region on a structure which provides support for polynucleotides encoding for a single predetermined sequence to extend from the surface. In some instances, a locus is on a two dimensional surface, e.g., a substantially planar surface. In some instances, a locus refers to a discrete raised or lowered site on a surface e.g., a well, micro well, channel, or post. In some instances, a surface of a locus comprises a material that is actively functionalized to attach to at least one nucleotide for polynucleotide synthesis, or preferably, a population of identical nucleotides for synthesis of a population of polynucleotides. In some instances, polynucleotide refers to a population of polynucleotides encoding for the same nucleic acid sequence. In some instances, a surface of a device is inclusive of one or a plurality of surfaces of a substrate.

    [0187] Provided herein are structures that may comprise a surface that supports the synthesis of a plurality of polynucleotides having different predetermined sequences at addressable locations on a common support. In some instances, a device provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 75,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more non-identical polynucleotides. In some instances, the device provides support for the synthesis of more than 2,000; 5,000; 10,000; 20,000; 30,000; 50,000; 75,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more polynucleotides encoding for distinct sequences. In some instances, at least a portion of the polynucleotides have an identical sequence or are configured to be synthesized with an identical sequence.

    [0188] Provided herein are methods and devices for manufacture and growth of polynucleotides about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 bases in length. In some instances, the length of the polynucleotide formed is about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, or 225 bases in length. A polynucleotide may be at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 bases in length. A polynucleotide may be from 10 to 225 bases in length, from 12 to 100 bases in length, from 20 to 150 bases in length, from 20 to 130 bases in length, or from 30 to 100 bases in length.

    [0189] In some instances, polynucleotides are synthesized on distinct loci of a substrate, wherein each locus supports the synthesis of a population of polynucleotides. In some instances, each locus supports the synthesis of a population of polynucleotides having a different sequence than a population of polynucleotides grown on another locus. In some instances, the loci of a device are located within a plurality of clusters. In some instances, a device comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some instances, a device comprises more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct loci. In some instances, a device comprises about 10,000 distinct loci. The amount of loci within a single cluster is varied in different instances. In some instances, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500, 1000 or more loci. In some instances, each cluster includes about 50-500 loci. In some instances, each cluster includes about 100-200 loci. In some instances, each cluster includes about 100-150 loci. In some instances, each cluster includes about 109, 121, 130 or 137 loci. In some instances, each cluster includes about 19, 20, 61, 64 or more loci.

    [0190] The number of distinct polynucleotides synthesized on a device may be dependent on the number of distinct loci available in the substrate. In some instances, the density of loci within a cluster of a device is at least or about 1 locus per mm.sup.2, 10 loci per mm.sup.2, 25 loci per mm.sup.2, 50 loci per mm.sup.2, 65 loci per mm.sup.2, 75 loci per mm.sup.2, 100 loci per mm.sup.2, 130 loci per mm.sup.2, 150 loci per mm.sup.2, 175 loci per mm.sup.2, 200 loci per mm.sup.2, 300 loci per mm.sup.2, 400 loci per mm.sup.2, 500 loci per mm.sup.2, 1,000 loci per mm.sup.2 or more. In some instances, a device comprises from about 10 loci per mm.sup.2 to about 500 mm.sup.2, from about 25 loci per mm.sup.2 to about 400 mm.sup.2, from about 50 loci per mm.sup.2 to about 500 mm.sup.2, from about 100 loci per mm.sup.2 to about 500 mm.sup.2, from about 150 loci per mm.sup.2 to about 500 mm.sup.2, from about 10 loci per mm.sup.2 to about 250 mm.sup.2, from about 50 loci per mm.sup.2 to about 250 mm.sup.2, from about 10 loci per mm.sup.2 to about 200 mm.sup.2, or from about 50 loci per mm.sup.2 to about 200 mm.sup.2. In some instances, the distance from the centers of two adjacent loci within a cluster is from about 10 um to about 500 um, from about 10 um to about 200 um, or from about 10 um to about 100 um. In some instances, the distance from two centers of adjacent loci is greater than about 10 um, 20 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um or 100 um. In some instances, the distance from the centers of two adjacent loci is less than about 200 um, 150 um, 100 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or 10 um. In some instances, each locus has a width of about 0.5 um, 1 um, 2 um, 3 um, 4 um, 5 um, 6 um, 7 um, 8 um, 9 um, 10 um, 20 um, 30 um, 40 um, 50 um, 60 um, 70 um, 80 um, 90 um or 100 um. In some instances, each locus is has a width of about 0.5 um to 100 um, about 0.5 um to 50 um, about 10 um to 75 um, or about 0.5 um to 50 um.

    [0191] In some instances, the density of clusters within a device is at least or about 1 cluster per 100 mm.sup.2, 1 cluster per 10 mm.sup.2, 1 cluster per 5 mm.sup.2, 1 cluster per 4 mm.sup.2, 1 cluster per 3 mm.sup.2, 1 cluster per 2 mm.sup.2, 1 cluster per 1 mm.sup.2, 2 clusters per 1 mm.sup.2, 3 clusters per 1 mm.sup.2, 4 clusters per 1 mm.sup.2, 5 clusters per 1 mm.sup.2, 10 clusters per 1 mm.sup.2, 50 clusters per 1 mm.sup.2 or more. In some instances, a device comprises from about 1 cluster per 10 mm.sup.2 to about 10 clusters per 1 mm.sup.2. In some instances, the distance from the centers of two adjacent clusters is less than about 50 um, 100 um, 200 um, 500 um, 1000 um, or 2000 um or 5000 um. In some instances, the distance from the centers of two adjacent clusters is from about 50 um and about 100 um, from about 50 um and about 200 um, from about 50 um and about 300 um, from about 50 um and about 500 um, and from about 100 um to about 2000 um. In some instances, the distance from the centers of two adjacent clusters is from about 0.05 mm to about 50 mm, from about 0.05 mm to about 10 mm, from about 0.05 mm and about 5 mm, from about 0.05 mm and about 4 mm, from about 0.05 mm and about 3 mm, from about 0.05 mm and about 2 mm, from about 0.1 mm and 10 mm, from about 0.2 mm and 10 mm, from about 0.3 mm and about 10 mm, from about 0.4 mm and about 10 mm, from about 0.5 mm and 10 mm, from about 0.5 mm and about 5 mm, or from about 0.5 mm and about 2 mm. In some instances, each cluster has a diameter or width along one dimension of about 0.5 to 2 mm, about 0.5 to 1 mm, or about 1 to 2 mm. In some instances, each cluster has a diameter or width along one dimension of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm. In some instances, each cluster has an interior diameter or width along one dimension of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm.

    [0192] A device may be about the size of a standard 96 well plate, for example from about 100 and 200 mm by from about 50 and 150 mm. In some instances, a device has a diameter less than or equal to about 1000 mm, 500 mm, 450 mm, 400 mm, 300 mm, 250 nm, 200 mm, 150 mm, 100 mm or 50 mm. In some instances, the diameter of a device is from about 25 mm and 1000 mm, from about 25 mm and about 800 mm, from about 25 mm and about 600 mm, from about 25 mm and about 500 mm, from about 25 mm and about 400 mm, from about 25 mm and about 300 mm, or from about 25 mm and about 200. Non-limiting examples of device size include about 300 mm, 200 mm, 150 mm, 130 mm, 100 mm, 76 mm, 51 mm and 25 mm. In some instances, a device has a planar surface area of at least about 100 mm.sup.2; 200 mm.sup.2; 500 mm.sup.2; 1,000 mm.sup.2; 2,000 mm.sup.2; 5,000 mm.sup.2; 10,000 mm.sup.2; 12,000 mm.sup.2; 15,000 mm.sup.2; 20,000 mm.sup.2; 30,000 mm.sup.2; 40,000 mm.sup.2; 50,000 mm.sup.2 or more. In some instances, the thickness of a device is from about 50 mm and about 2000 mm, from about 50 mm and about 1000 mm, from about 100 mm and about 1000 mm, from about 200 mm and about 1000 mm, or from about 250 mm and about 1000 mm. Non-limiting examples of device thickness include 275 mm, 375 mm, 525 mm, 625 mm, 675 mm, 725 mm, 775 mm and 925 mm. In some instances, the thickness of a device varies with diameter and depends on the composition of the substrate. For example, a device comprising materials other than silicon has a different thickness than a silicon device of the same diameter. Device thickness may be determined by the mechanical strength of the material used and the device must be thick enough to support its own weight without cracking during handling. In some instances, a structure comprises a plurality of devices described herein.

    [0193] Surface Materials

    [0194] Provided herein is a device comprising a surface, wherein the surface is modified to support polynucleotide synthesis at predetermined locations and with a resulting low error rate, a low dropout rate, a high yield, and a high oligo representation. In some instances, surfaces of a device for polynucleotide synthesis provided herein are fabricated from a variety of materials capable of modification to support a de novo polynucleotide synthesis reaction. In some cases, the devices are sufficiently conductive, e.g., are able to form uniform electric fields across all or a portion of the device. A device described herein may comprise a flexible material. Exemplary flexible materials include, without limitation, modified nylon, unmodified nylon, nitrocellulose, and polypropylene. A device described herein may comprise a rigid material. Exemplary rigid materials include, without limitation, glass, fuse silica, silicon, silicon dioxide, silicon nitride, plastics (for example, polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof, and metals (for example, gold, platinum). Device disclosed herein may be fabricated from a material comprising silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), glass, or any combination thereof. In some cases, a device disclosed herein is manufactured with a combination of materials listed herein or any other suitable material known in the art.

    [0195] A listing of tensile strengths for exemplary materials described herein is provides as follows: nylon (70 MPa), nitrocellulose (1.5 MPa), polypropylene (40 MPa), silicon (268 MPa), polystyrene (40 MPa), agarose (1-10 MPa), polyacrylamide (1-10 MPa), polydimethylsiloxane (PDMS) (3.9-10.8 MPa). Solid supports described herein can have a tensile strength from 1 to 300, 1 to 40, 1 to 10, 1 to 5, or 3 to 11 MPa. Solid supports described herein can have a tensile strength of about 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 20, 25, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 270, or more MPa. In some instances, a device described herein comprises a solid support for polynucleotide synthesis that is in the form of a flexible material capable of being stored in a continuous loop or reel, such as a tape or flexible sheet.

    [0196] Young's modulus measures the resistance of a material to elastic (recoverable) deformation under load. A listing of Young's modulus for stiffness of exemplary materials described herein is provides as follows: nylon (3 GPa), nitrocellulose (1.5 GPa), polypropylene (2 GPa), silicon (150 GPa), polystyrene (3 GPa), agarose (1-10 GPa), polyacrylamide (1-10 GPa), polydimethylsiloxane (PDMS) (1-10 GPa). Solid supports described herein can have a Young's moduli from 1 to 500, 1 to 40, 1 to 10, 1 to 5, or 3 to 11 GPa. Solid supports described herein can have a Young's moduli of about 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 20, 25, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 400, 500 GPa, or more. As the relationship between flexibility and stiffness are inverse to each other, a flexible material has a low Young's modulus and changes its shape considerably under load.

    [0197] In some cases, a device disclosed herein comprises a silicon dioxide base and a surface layer of silicon oxide. Alternatively, the device may have a base of silicon oxide. Surface of the device provided here may be textured, resulting in an increase overall surface area for polynucleotide synthesis. Device disclosed herein may comprise at least 5%, 10%, 25%, 50%, 80%, 90%, 95%, or 99% silicon. A device disclosed herein may be fabricated from a silicon on insulator (SOI) wafer.

    [0198] Surface Architecture

    [0199] Provided herein are devices comprising raised and/or lowered features. One benefit of having such features is an increase in surface area to support polynucleotide synthesis. In some instances, a device having raised and/or lowered features is referred to as a three-dimensional substrate. In some instances, a three-dimensional device comprises one or more channels. In some instances, one or more loci comprise a channel. In some instances, the channels are accessible to reagent deposition via a deposition device such as a polynucleotide synthesizer. In some instances, reagents and/or fluids collect in a larger well in fluid communication one or more channels. For example, a device comprises a plurality of channels corresponding to a plurality of loci with a cluster, and the plurality of channels are in fluid communication with one well of the cluster. In some methods, a library of polynucleotides is synthesized in a plurality of loci of a cluster.

    [0200] In some instances, the structure is configured to allow for controlled flow and mass transfer paths for polynucleotide synthesis on a surface. In some instances, the configuration of a device allows for the controlled and even distribution of mass transfer paths, chemical exposure times, and/or wash efficacy during polynucleotide synthesis. In some instances, the configuration of a device allows for increased sweep efficiency, for example by providing sufficient volume for a growing a polynucleotide such that the excluded volume by the growing polynucleotide does not take up more than 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1%, or less of the initially available volume that is available or suitable for growing the polynucleotide. In some instances, a three-dimensional structure allows for managed flow of fluid to allow for the rapid exchange of chemical exposure.

    [0201] Provided herein are methods to synthesize an amount of DNA of 1 fM, 5 fM, 10 fM, 25 fM, 50 fM, 75 fM, 100 fM, 200 fM, 300 fM, 400 fM, 500 fM, 600 fM, 700 fM, 800 fM, 900 fM, 1 pM, 5 pM, 10 pM, 25 pM, 50 pM, 75 pM, 100 pM, 200 pM, 300 pM, 400 pM, 500 pM, 600 pM, 700 pM, 800 pM, 900 pM, or more. In some instances, a polynucleotide library may span the length of about 1%, 20%, 3%, 40%, 5%, 100%, 15%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 95%, or 100% of a gene. A gene may be varied up to about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100%.

    [0202] Non-identical polynucleotides may collectively encode a sequence for at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 800%, 85%, 90%, 95%, or 100% of a gene. In some instances, a polynucleotide may encode a sequence of 50%, 60%, 70%, 80%, 85%, 90%, 95%, or more of a gene. In some instances, a polynucleotide may encode a sequence of 80%, 85%, 90%, 95%, or more of a gene.

    [0203] In some instances, segregation is achieved by physical structure. In some instances, segregation is achieved by differential functionalization of the surface generating active and passive regions for polynucleotide synthesis. Differential functionalization is also be achieved by alternating the hydrophobicity across the device surface, thereby creating water contact angle effects that cause beading or wetting of the deposited reagents. Employing larger structures can decrease splashing and cross-contamination of distinct polynucleotide synthesis locations with reagents of the neighboring spots. In some instances, a device, such as a polynucleotide synthesizer, is used to deposit reagents to distinct polynucleotide synthesis locations. Substrates having three-dimensional features are configured in a manner that allows for the synthesis of a large number of polynucleotides (e.g., more than about 10,000) with a low error rate (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000; 1:3,000; 1:5,000; or 1:10,000). In some instances, a device comprises features with a density of about or greater than about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400 or 500 features per mm.sup.2.

    [0204] A well of a device may have the same or different width, height, and/or volume as another well of the substrate. A channel of a device may have the same or different width, height, and/or volume as another channel of the substrate. In some instances, the width of a cluster is from about 0.05 mm to about 50 mm, from about 0.05 mm to about 10 mm, from about 0.05 mm and about 5 mm, from about 0.05 mm and about 4 mm, from about 0.05 mm and about 3 mm, from about 0.05 mm and about 2 mm, from about 0.05 mm and about 1 mm, from about 0.05 mm and about 0.5 mm, from about 0.05 mm and about 0.1 mm, from about 0.1 mm and 10 mm, from about 0.2 mm and 10 mm, from about 0.3 mm and about 10 mm, from about 0.4 mm and about 10 mm, from about 0.5 mm and 10 mm, from about 0.5 mm and about 5 mm, or from about 0.5 mm and about 2 mm. In some instances, the width of a well comprising a cluster is from about 0.05 mm to about 50 mm, from about 0.05 mm to about 10 mm, from about 0.05 mm and about 5 mm, from about 0.05 mm and about 4 mm, from about 0.05 mm and about 3 mm, from about 0.05 mm and about 2 mm, from about 0.05 mm and about 1 mm, from about 0.05 mm and about 0.5 mm, from about 0.05 mm and about 0.1 mm, from about 0.1 mm and 10 mm, from about 0.2 mm and 10 mm, from about 0.3 mm and about 10 mm, from about 0.4 mm and about 10 mm, from about 0.5 mm and 10 mm, from about 0.5 mm and about 5 mm, or from about 0.5 mm and about 2 mm. In some instances, the width of a cluster is less than or about 5 mm, 4 mm, 3 mm, 2 mm, 1 mm, 0.5 mm, 0.1 mm, 0.09 mm, 0.08 mm, 0.07 mm, 0.06 mm or 0.05 mm. In some instances, the width of a cluster is from about 1.0 and 1.3 mm. In some instances, the width of a cluster is about 1.150 mm. In some instances, the width of a well is less than or about 5 mm, 4 mm, 3 mm, 2 mm, 1 mm, 0.5 mm, 0.1 mm, 0.09 mm, 0.08 mm, 0.07 mm, 0.06 mm or 0.05 mm. In some instances, the width of a well is from about 1.0 and 1.3 mm. In some instances, the width of a well is about 1.150 mm. In some instances, the width of a cluster is about 0.08 mm. In some instances, the width of a well is about 0.08 mm. The width of a cluster may refer to clusters within a two-dimensional or three-dimensional substrate.

    [0205] In some instances, the height of a well is from about 20 um to about 1000 um, from about 50 um to about 1000 um, from about 100 um to about 1000 um, from about 200 um to about 1000 um, from about 300 um to about 1000 um, from about 400 um to about 1000 um, or from about 500 um to about 1000 um. In some instances, the height of a well is less than about 1000 um, less than about 900 um, less than about 800 um, less than about 700 um, or less than about 600 um.

    [0206] In some instances, a device comprises a plurality of channels corresponding to a plurality of loci within a cluster, wherein the height or depth of a channel is from about 5 um to about 500 um, from about 5 um to about 400 um, from about 5 um to about 300 um, from about 5 um to about 200 um, from about 5 um to about 100 um, from about 5 um to about 50 um, or from about 10 um to about 50 um. In some instances, the height of a channel is less than 100 um, less than 80 um, less than 60 um, less than 40 um or less than 20 um.

    [0207] In some instances, the diameter of a channel, locus (e.g., in a substantially planar substrate) or both channel and locus (e.g., in a three-dimensional device wherein a locus corresponds to a channel) is from about 1 um to about 1000 um, from about 1 um to about 500 um, from about 1 um to about 200 um, from about 1 um to about 100 um, from about 5 um to about 100 um, or from about 10 um to about 100 um, for example, about 90 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or 10 um. In some instances, the diameter of a channel, locus, or both channel and locus is less than about 100 um, 90 um, 80 um, 70 um, 60 um, 50 um, 40 um, 30 um, 20 um or 10 um. In some instances, the distance from the center of two adjacent channels, loci, or channels and loci is from about 1 um to about 500 um, from about 1 um to about 200 um, from about 1 um to about 100 um, from about 5 um to about 200 um, from about 5 um to about 100 um, from about 5 um to about 50 um, or from about 5 um to about 30 um, for example, about 20 um.

    [0208] Surface Modifications

    [0209] In various instances, surface modifications are employed for the chemical and/or physical alteration of a surface by an additive or subtractive process to change one or more chemical and/or physical properties of a device surface or a selected site or region of a device surface. For example, surface modifications include, without limitation, (1) changing the wetting properties of a surface, (2) functionalizing a surface, i.e., providing, modifying or substituting surface functional groups, (3) defunctionalizing a surface, i.e., removing surface functional groups, (4) otherwise altering the chemical composition of a surface, e.g., through etching, (5) increasing or decreasing surface roughness, (6) providing a coating on a surface, e.g., a coating that exhibits wetting properties that are different from the wetting properties of the surface, and/or (7) depositing particulates on a surface.

    [0210] In some instances, the addition of a chemical layer on top of a surface (referred to as adhesion promoter) facilitates structured patterning of loci on a surface of a substrate. Exemplary surfaces for application of adhesion promotion include, without limitation, glass, silicon, silicon dioxide and silicon nitride. In some instances, the adhesion promoter is a chemical with a high surface energy. In some instances, a second chemical layer is deposited on a surface of a substrate. In some instances, the second chemical layer has a low surface energy. In some instances, surface energy of a chemical layer coated on a surface supports localization of droplets on the surface. Depending on the patterning arrangement selected, the proximity of loci and/or area of fluid contact at the loci are alterable.

    [0211] In some instances, a device surface, or resolved loci, onto which nucleic acids or other moieties are deposited, e.g., for polynucleotide synthesis, are smooth or substantially planar (e.g., two-dimensional) or have irregularities, such as raised or lowered features (e.g., three-dimensional features). In some instances, a device surface is modified with one or more different layers of compounds. Such modification layers of interest include, without limitation, inorganic and organic layers such as metals, metal oxides, polymers, small organic molecules and the like. Non-limiting polymeric layers include peptides, proteins, nucleic acids or mimetics thereof (e.g., peptide nucleic acids and the like), polysaccharides, phospholipids, polyurethanes, polyesters, polycarbonates, polyureas, polyamides, polyethyleneamines, polyarylene sulfides, polysiloxanes, polyimides, polyacetates, and any other suitable compounds described herein or otherwise known in the art. In some instances, polymers are heteropolymeric. In some instances, polymers are homopolymeric. In some instances, polymers comprise functional moieties or are conjugated.

    [0212] In some instances, resolved loci of a device are functionalized with one or more moieties that increase and/or decrease surface energy. In some instances, a moiety is chemically inert. In some instances, a moiety is configured to support a desired chemical reaction, for example, one or more processes in a polynucleotide synthesis reaction. The surface energy, or hydrophobicity, of a surface is a factor for determining the affinity of a nucleotide to attach onto the surface. In some instances, a method for device functionalization may comprise: (a) providing a device having a surface that comprises silicon dioxide; and (b) silanizing the surface using, a suitable silanizing agent described herein or otherwise known in the art, for example, an organofunctional alkoxysilane molecule.

    [0213] In some instances, the organofunctional alkoxysilane molecule comprises dimethylchloro-octodecyl-silane, methyldichloro-octodecyl-silane, trichloro-octodecyl-silane, trimethyl-octodecyl-silane, triethyl-octodecyl-silane, or any combination thereof. In some instances, a device surface comprises functionalized with polyethylene/polypropylene (functionalized by gamma irradiation or chromic acid oxidation, and reduction to hydroxyalkyl surface), highly crosslinked polystyrene-divinylbenzene (derivatized by chloromethylation, and aminated to benzylamine functional surface), nylon (the terminal aminohexyl groups are directly reactive), or etched with reduced polytetrafluoroethylene. Other methods and functionalizing agents are described in U.S. Pat. No. 5,474,796, which is herein incorporated by reference in its entirety.

    [0214] In some instances, a device surface is functionalized by contact with a derivatizing composition that contains a mixture of silanes, under reaction conditions effective to couple the silanes to the device surface, typically via reactive hydrophilic moieties present on the device surface. Silanization generally covers a surface through self-assembly with organofunctional alkoxysilane molecules.

    [0215] A variety of siloxane functionalizing reagents can further be used as currently known in the art, e.g., for lowering or increasing surface energy. The organofunctional alkoxysilanes can be classified according to their organic functions.

    [0216] Provided herein are devices that may contain patterning of agents capable of coupling to a nucleoside. In some instances, a device may be coated with an active agent. In some instances, a device may be coated with a passive agent. Exemplary active agents for inclusion in coating materials described herein includes, without limitation, N-(3-triethoxysilylpropyl)-4-hydroxybutyramide (HAPS), 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, 3-glycidoxypropyltrimethoxysilane (GOPS), 3-iodo-propyltrimethoxysilane, butyl-aldehydr-trimethoxysilane, dimeric secondary aminoalkyl siloxanes, (3-aminopropyl)-diethoxy-methylsilane, (3-aminopropyl)-dimethyl-ethoxysilane, and (3-aminopropyl)-trimethoxysilane, (3-glycidoxypropyl)-dimethyl-ethoxysilane, glycidoxy-trimethoxysilane, (3-mercaptopropyl)-trimethoxysilane, 3-4 epoxycyclohexyl-ethyltrimethoxysilane, and (3-mercaptopropyl)-methyl-dimethoxysilane, allyl trichlorochlorosilane, 7-oct-1-enyl trichlorochlorosilane, or bis (3-trimethoxysilylpropyl) amine.

    [0217] Exemplary passive agents for inclusion in a coating material described herein includes, without limitation, perfluorooctyltrichlorosilane; tridecafluoro-1,1,2,2-tetrahydrooctyl)trichlorosilane; 1H, 1H, 2H, 2H-fluorooctyltriethoxysilane (FOS); trichloro(1H, 1H, 2H, 2H-perfluorooctyl)silane; tert-butyl-[5-fluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)indol-1-yl]-dimethyl-silane; CYTOP™; Fluorinert™; perfluoroctyltrichlorosilane (PFOTCS); perfluorooctyldimethylchlorosilane (PFODCS); perfluorodecyltriethoxysilane (PFDTES); pentafluorophenyl-dimethylpropylchloro-silane (PFPTES); perfluorooctyltriethoxysilane; perfluorooctyltrimethoxysilane; octylchlorosilane; dimethylchloro-octodecyl-silane; methyldichloro-octodecyl-silane; trichloro-octodecyl-silane; trimethyl-octodecyl-silane; triethyl-octodecyl-silane; or octadecyltrichlorosilane.

    [0218] In some instances, a functionalization agent comprises a hydrocarbon silane such as octadecyltrichlorosilane. In some instances, the functionalizing agent comprises 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane, glycidyloxypropyl/trimethoxysilane and N-(3-triethoxysilylpropyl)-4-hydroxybutyramide.

    [0219] Polynucleotide Synthesis

    [0220] Methods of the current disclosure for polynucleotide synthesis may include processes involving phosphoramidite chemistry. In some instances, polynucleotide synthesis comprises coupling a base with phosphoramidite. Polynucleotide synthesis may comprise coupling a base by deposition of phosphoramidite under coupling conditions, wherein the same base is optionally deposited with phosphoramidite more than once, i.e., double coupling. Polynucleotide synthesis may comprise capping of unreacted sites. In some instances, capping is optional. Polynucleotide synthesis may also comprise oxidation or an oxidation step or oxidation steps. Polynucleotide synthesis may comprise deblocking, detritylation, and sulfurization. In some instances, polynucleotide synthesis comprises either oxidation or sulfurization. In some instances, between one or each step during a polynucleotide synthesis reaction, the device is washed, for example, using tetrazole or acetonitrile. Time frames for any one step in a phosphoramidite synthesis method may be less than about 2 minutes, 1 minute, 50 seconds, 40 seconds, 30 seconds, 20 seconds and 10 seconds.

    [0221] Polynucleotide synthesis using a phosphoramidite method may comprise a subsequent addition of a phosphoramidite building block (e.g., nucleoside phosphoramidite) to a growing polynucleotide chain for the formation of a phosphite triester linkage. Phosphoramidite polynucleotide synthesis proceeds in the 3′ to 5′ direction. Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain per synthesis cycle. In some instances, each synthesis cycle comprises a coupling step. Phosphoramidite coupling involves the formation of a phosphite triester linkage between an activated nucleoside phosphoramidite and a nucleoside bound to the substrate, for example, via a linker. In some instances, the nucleoside phosphoramidite is provided to the device activated. In some instances, the nucleoside phosphoramidite is provided to the device with an activator. In some instances, nucleoside phosphoramidites are provided to the device in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100-fold excess or more over the substrate-bound nucleosides. In some instances, the addition of nucleoside phosphoramidite is performed in an anhydrous environment, for example, in anhydrous acetonitrile. Following addition of a nucleoside phosphoramidite, the device is optionally washed. In some instances, the coupling step is repeated one or more additional times, optionally with a wash step between nucleoside phosphoramidite additions to the substrate. In some instances, a polynucleotide synthesis method used herein comprises 1, 2, 3 or more sequential coupling steps. Prior to coupling, in many cases, the nucleoside bound to the device is de-protected by removal of a protecting group, where the protecting group functions to prevent polymerization. A common protecting group is 4,4′-dimethoxytrityl (DMT).

    [0222] Following coupling, phosphoramidite polynucleotide synthesis methods optionally comprise a capping step. In a capping step, the growing polynucleotide is treated with a capping agent. A capping step is useful to block unreacted substrate-bound 5′—OH groups after coupling from further chain elongation, preventing the formation of polynucleotides with internal base deletions. Further, phosphoramidites activated with 1H-tetrazole may react, to a small extent, with the 06 position of guanosine. Without being bound by theory, upon oxidation with I.sub.2/water, this side product, possibly via O6-N7 migration, may undergo depurination. The apurinic sites may end up being cleaved in the course of the final deprotection of the polynucleotide thus reducing the yield of the full-length product. The O6 modifications may be removed by treatment with the capping reagent prior to oxidation with I.sub.2/water. In some instances, inclusion of a capping step during polynucleotide synthesis decreases the error rate as compared to synthesis without capping. As an example, the capping step comprises treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. Following a capping step, the device is optionally washed.

    [0223] In some instances, following addition of a nucleoside phosphoramidite, and optionally after capping and one or more wash steps, the device bound growing nucleic acid is oxidized. The oxidation step comprises the phosphite triester is oxidized into a tetracoordinated phosphate triester, a protected precursor of the naturally occurring phosphate diester internucleoside linkage. In some instances, oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, collidine). Oxidation may be carried out under anhydrous conditions using, e.g. tert-Butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following oxidation. A second capping step allows for device drying, as residual water from oxidation that may persist can inhibit subsequent coupling. Following oxidation, the device and growing polynucleotide is optionally washed. In some instances, the step of oxidation is substituted with a sulfurization step to obtain polynucleotide phosphorothioates, wherein any capping steps can be performed after the sulfurization. Many reagents are capable of the efficient sulfur transfer, including but not limited to 3-(Dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N′N′-Tetraethylthiuram disulfide (TETD).

    [0224] In order for a subsequent cycle of nucleoside incorporation to occur through coupling, the protected 5′ end of the device bound growing polynucleotide is removed so that the primary hydroxyl group is reactive with a next nucleoside phosphoramidite. In some instances, the protecting group is DMT and deblocking occurs with trichloroacetic acid in dichloromethane. Conducting detritylation for an extended time or with stronger than recommended solutions of acids may lead to increased depurination of solid support-bound polynucleotide and thus reduces the yield of the desired full-length product. Methods and compositions of the disclosure described herein provide for controlled deblocking conditions limiting undesired depurination reactions. In some instances, the device bound polynucleotide is washed after deblocking. In some instances, efficient washing after deblocking contributes to synthesized polynucleotides having a low error rate.

    [0225] Methods for the synthesis of polynucleotides typically involve an iterating sequence of the following steps: application of a protected monomer to an actively functionalized surface (e.g., locus) to link with either the activated surface, a linker or with a previously deprotected monomer; deprotection of the applied monomer so that it is reactive with a subsequently applied protected monomer; and application of another protected monomer for linking. One or more intermediate steps include oxidation or sulfurization. In some instances, one or more wash steps precede or follow one or all of the steps.

    [0226] Methods for phosphoramidite-based polynucleotide synthesis comprise a series of chemical steps. In some instances, one or more steps of a synthesis method involve reagent cycling, where one or more steps of the method comprise application to the device of a reagent useful for the step. For example, reagents are cycled by a series of liquid deposition and vacuum drying steps. For substrates comprising three-dimensional features such as wells, microwells, channels and the like, reagents are optionally passed through one or more regions of the device via the wells and/or channels.

    [0227] Methods and systems described herein relate to polynucleotide synthesis devices for the synthesis of polynucleotides. The synthesis may be in parallel. For example at least or about at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000 or more polynucleotides can be synthesized in parallel. The total number polynucleotides that may be synthesized in parallel may be from 2-100000, 3-50000, 4-10000, 5-1000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350, 18-300, 19-250, 20-200, 21-150,22-100, 23-50, 24-45, 25-40, 30-35. Those of skill in the art appreciate that the total number of polynucleotides synthesized in parallel may fall within any range bound by any of these values, for example 25-100. The total number of polynucleotides synthesized in parallel may fall within any range defined by any of the values serving as endpoints of the range. Total molar mass of polynucleotides synthesized within the device or the molar mass of each of the polynucleotides may be at least or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles, or more. The length of each of the polynucleotides or average length of the polynucleotides within the device may be at least or about at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides, or more. The length of each of the polynucleotides or average length of the polynucleotides within the device may be at most or about at most 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides, or less. The length of each of the polynucleotides or average length of the polynucleotides within the device may fall from 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25. Those of skill in the art appreciate that the length of each of the polynucleotides or average length of the polynucleotides within the device may fall within any range bound by any of these values, for example 100-300. The length of each of the polynucleotides or average length of the polynucleotides within the device may fall within any range defined by any of the values serving as endpoints of the range.

    [0228] Methods for polynucleotide synthesis on a surface provided herein allow for synthesis at a fast rate. As an example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides per hour, or more are synthesized. Nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks, or analogs/modified versions thereof. In some instances, libraries of polynucleotides are synthesized in parallel on substrate. For example, a device comprising about or at least about 100; 1,000; 10,000; 30,000; 75,000; 100,000; 1,000,000; 2,000,000; 3,000,000; 4,000,000; or 5,000,000 resolved loci is able to support the synthesis of at least the same number of distinct polynucleotides, wherein polynucleotide encoding a distinct sequence is synthesized on a resolved locus. In some instances, a library of polynucleotides are synthesized on a device with low error rates described herein in less than about three months, two months, one month, three weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours or less. In some instances, larger nucleic acids assembled from a polynucleotide library synthesized with low error rate using the substrates and methods described herein are prepared in less than about three months, two months, one month, three weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours or less.

    [0229] In some instances, methods described herein provide for generation of a library of polynucleotides comprising variant polynucleotides differing at a plurality of codon sites. In some instances, a polynucleotide may have 1 site, 2 sites, 3 sites, 4 sites, 5 sites, 6 sites, 7 sites, 8 sites, 9 sites, 10 sites, 11 sites, 12 sites, 13 sites, 14 sites, 15 sites, 16 sites, 17 sites 18 sites, 19 sites, 20 sites, 30 sites, 40 sites, 50 sites, or more of variant codon sites.

    [0230] In some instances, the one or more sites of variant codon sites may be adjacent. In some instances, the one or more sites of variant codon sites may be not be adjacent and separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codons.

    In some instances, a polynucleotide may comprise multiple sites of variant codon sites, wherein all the variant codon sites are adjacent to one another, forming a stretch of variant codon sites. In some instances, a polynucleotide may comprise multiple sites of variant codon sites, wherein none the variant codon sites are adjacent to one another. In some instances, a polynucleotide may comprise multiple sites of variant codon sites, wherein some the variant codon sites are adjacent to one another, forming a stretch of variant codon sites, and some of the variant codon sites are not adjacent to one another.

    [0231] Large Polynucleotide Libraries Having Low Error Rates

    [0232] Average error rates for polynucleotides synthesized within a library using the systems and methods provided may be less than 1 in 1000, less than 1 in 1250, less than 1 in 1500, less than 1 in 2000, less than 1 in 3000 or less often. In some instances, average error rates for polynucleotides synthesized within a library using the systems and methods provided are less than 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1100, 1/1200, 1/1250, 1/1300, 1/1400, 1/1500, 1/1600, 1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or less. In some instances, average error rates for polynucleotides synthesized within a library using the systems and methods provided are less than 1/1000.

    [0233] In some instances, aggregate error rates for polynucleotides synthesized within a library using the systems and methods provided are less than 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1100, 1/1200, 1/1250, 1/1300, 1/1400, 1/1500, 1/1600, 1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or less compared to the predetermined sequences. In some instances, aggregate error rates for polynucleotides synthesized within a library using the systems and methods provided are less than 1/500, 1/600, 1/700, 1/800, 1/900, or 1/1000. In some instances, aggregate error rates for polynucleotides synthesized within a library using the systems and methods provided are less than 1/1000.

    [0234] In some instances, an error correction enzyme may be used for polynucleotides synthesized within a library using the systems and methods provided can use. In some instances, aggregate error rates for polynucleotides with error correction can be less than 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1100, 1/1200, 1/1300, 1/1400, 1/1500, 1/1600, 1/1700, 1/1800, 1/1900, 1/2000, 1/3000, or less compared to the predetermined sequences. In some instances, aggregate error rates with error correction for polynucleotides synthesized within a library using the systems and methods provided can be less than 1/500, 1/600, 1/700, 1/800, 1/900, or 1/1000. In some instances, aggregate error rates with error correction for polynucleotides synthesized within a library using the systems and methods provided can be less than 1/1000.

    [0235] Error rate may limit the value of gene synthesis for the production of libraries of gene variants. With an error rate of 1/300, about 0.7% of the clones in a 1500 base pair gene will be correct. As most of the errors from polynucleotide synthesis result in frame-shift mutations, over 99% of the clones in such a library will not produce a full-length protein. Reducing the error rate by 75% would increase the fraction of clones that are correct by a factor of 40. The methods and compositions of the disclosure allow for fast de novo synthesis of large polynucleotide and gene libraries with error rates that are lower than commonly observed gene synthesis methods both due to the improved quality of synthesis and the applicability of error correction methods that are enabled in a massively parallel and time-efficient manner. Accordingly, libraries may be synthesized with base insertion, deletion, substitution, or total error rates that are under 1/300, 1/400, 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1250, 1/1500, 1/2000, 1/2500, 1/3000, 1/4000, 1/5000, 1/6000, 1/7000, 1/8000, 1/9000, 1/10000, 1/12000, 1/15000, 1/20000, 1/25000, 1/30000, 1/40000, 1/50000, 1/60000, 1/70000, 1/80000, 1/90000, 1/100000, 1/125000, 1/150000, 1/200000, 1/300000, 1/400000, 1/500000, 1/600000, 1/700000, 1/800000, 1/900000, 1/1000000, or less, across the library, or across more than 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the library. The methods and compositions of the disclosure further relate to large synthetic polynucleotide and gene libraries with low error rates associated with at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the polynucleotides or genes in at least a subset of the library to relate to error free sequences in comparison to a predetermined/preselected sequence. In some instances, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the polynucleotides or genes in an isolated volume within the library have the same sequence. In some instances, at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of any polynucleotides or genes related with more than 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more similarity or identity have the same sequence. In some instances, the error rate related to a specified locus on a polynucleotide or gene is optimized. Thus, a given locus or a plurality of selected loci of one or more polynucleotides or genes as part of a large library may each have an error rate that is less than 1/300, 1/400, 1/500, 1/600, 1/700, 1/800, 1/900, 1/1000, 1/1250, 1/1500, 1/2000, 1/2500, 1/3000, 1/4000, 1/5000, 1/6000, 1/7000, 1/8000, 1/9000, 1/10000, 1/12000, 1/15000, 1/20000, 1/25000, 1/30000, 1/40000, 1/50000, 1/60000, 1/70000, 1/80000, 1/90000, 1/100000, 1/125000, 1/150000, 1/200000, 1/300000, 1/400000, 1/500000, 1/600000, 1/700000, 1/800000, 1/900000, 1/1000000, or less. In various instances, such error optimized loci may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 30000, 50000, 75000, 100000, 500000, 1000000, 2000000, 3000000 or more loci. The error optimized loci may be distributed to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 30000, 75000, 100000, 500000, 1000000, 2000000, 3000000 or more polynucleotides or genes.

    [0236] The error rates can be achieved with or without error correction. The error rates can be achieved across the library, or across more than 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, 99.9%, 99.95%, 99.98%, 99.99%, or more of the library.

    [0237] Computer Systems

    [0238] Any of the systems described herein, may be operably linked to a computer and may be automated through a computer either locally or remotely. In various instances, the methods and systems of the disclosure may further comprise software programs on computer systems and use thereof. Accordingly, computerized control for the synchronization of the dispense/vacuum/refill functions such as orchestrating and synchronizing the material deposition device movement, dispense action and vacuum actuation are within the bounds of the disclosure. The computer systems may be programmed to interface between the user specified base sequence and the position of a material deposition device to deliver the correct reagents to specified regions of the substrate.

    [0239] The computer system 1200 illustrated in FIG. 4 may be understood as a logical apparatus that can read instructions from media 1211 and/or a network port 1205, which can optionally be connected to server 1209 having fixed media 1212. The system, such as shown in FIG. 4 can include a CPU 1201, disk drives 1203, optional input devices such as keyboard 1215 and/or mouse 1216 and optional monitor 1207. Data communication can be achieved through the indicated communication medium to a server at a local or a remote location. The communication medium can include any means of transmitting and/or receiving data. For example, the communication medium can be a network connection, a wireless connection or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present disclosure can be transmitted over such networks or connections for reception and/or review by a party 1222 as illustrated in FIG. 4.

    [0240] FIG. 5 is a block diagram illustrating a first example architecture of a computer system 1300 that can be used in connection with example instances of the present disclosure. As depicted in FIG. 5, the example computer system can include a processor 1302 for processing instructions. Non-limiting examples of processors include: Intel Xeon™ processor, AMD Opteron™ processor, Samsung 32-bit RISC ARM 1176JZ(F)-S v1.0™ processor, ARM Cortex-A8 Samsung S5PC100™ processor, ARM Cortex-A8 Apple A4™ processor, Marvell PXA 930™ processor, or a functionally-equivalent processor. Multiple threads of execution can be used for parallel processing. In some instances, multiple processors or processors with multiple cores can also be used, whether in a single computer system, in a cluster, or distributed across systems over a network comprising a plurality of computers, cell phones, and/or personal data assistant devices.

    [0241] As illustrated in FIG. 5, a high speed cache 1304 can be connected to, or incorporated in, the processor 1302 to provide a high speed memory for instructions or data that have been recently, or are frequently, used by processor 1302. The processor 1302 is connected to a north bridge 1306 by a processor bus 1308. The north bridge 1306 is connected to random access memory (RAM) 1310 by a memory bus 1312 and manages access to the RAM 1310 by the processor 1302. The north bridge 1306 is also connected to a south bridge 1314 by a chipset bus 1316. The south bridge 1314 is, in turn, connected to a peripheral bus 1318. The peripheral bus can be, for example, PCI, PCI-X, PCI Express, or other peripheral bus. The north bridge and south bridge are often referred to as a processor chipset and manage data transfer between the processor, RAM, and peripheral components on the peripheral bus 1318. In some alternative architectures, the functionality of the north bridge can be incorporated into the processor instead of using a separate north bridge chip. In some instances, system 1300 can include an accelerator card 1322 attached to the peripheral bus 1318. The accelerator can include field programmable gate arrays (FPGAs) or other hardware for accelerating certain processing. For example, an accelerator can be used for adaptive data restructuring or to evaluate algebraic expressions used in extended set processing.

    [0242] Software and data are stored in external storage 1324 and can be loaded into RAM 1310 and/or cache 1304 for use by the processor. The system 1300 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, Windows™, MACOS™, BlackBerry OS™, iOS™, and other functionally-equivalent operating systems, as well as application software running on top of the operating system for managing data storage and optimization in accordance with example instances of the present disclosure. In this example, system 1300 also includes network interface cards (NICs) 1320 and 1321 connected to the peripheral bus for providing network interfaces to external storage, such as Network Attached Storage (NAS) and other computer systems that can be used for distributed parallel processing.

    [0243] FIG. 6 is a diagram showing a network 1400 with a plurality of computer systems 1402a, and 1402b, a plurality of cell phones and personal data assistants 1402c, and Network Attached Storage (NAS) 1404a, and 1404b. In example instances, systems 1402a, 1402b, and 1402c can manage data storage and optimize data access for data stored in Network Attached Storage (NAS) 1404a and 1404b. A mathematical model can be used for the data and be evaluated using distributed parallel processing across computer systems 1402a, and 1402b, and cell phone and personal data assistant systems 1402c. Computer systems 1402a, and 1402b, and cell phone and personal data assistant systems 1402c can also provide parallel processing for adaptive data restructuring of the data stored in Network Attached Storage (NAS) 1404a and 1404b. FIG. 6 illustrates an example only, and a wide variety of other computer architectures and systems can be used in conjunction with the various instances of the present disclosure. For example, a blade server can be used to provide parallel processing. Processor blades can be connected through a back plane to provide parallel processing. Storage can also be connected to the back plane or as Network Attached Storage (NAS) through a separate network interface. In some example instances, processors can maintain separate memory spaces and transmit data through network interfaces, back plane or other connectors for parallel processing by other processors. In other instances, some or all of the processors can use a shared virtual address memory space.

    [0244] FIG. 7 is a block diagram of a multiprocessor computer system 1500 using a shared virtual address memory space in accordance with an example instance. The system includes a plurality of processors 1502a-f that can access a shared memory subsystem 1504. The system incorporates a plurality of programmable hardware memory algorithm processors (MAPs) 1506a-f in the memory subsystem 1504. Each MAP 1506a-f can comprise a memory 1508a-f and one or more field programmable gate arrays (FPGAs) 1510a-f. The MAP provides a configurable functional unit and particular algorithms or portions of algorithms can be provided to the FPGAs 1510a-f for processing in close coordination with a respective processor. For example, the MAPs can be used to evaluate algebraic expressions regarding the data model and to perform adaptive data restructuring in example instances. In this example, each MAP is globally accessible by all of the processors for these purposes. In one configuration, each MAP can use Direct Memory Access (DMA) to access an associated memory 1508a-f, allowing it to execute tasks independently of, and asynchronously from the respective microprocessor 1502a-f. In this configuration, a MAP can feed results directly to another MAP for pipelining and parallel execution of algorithms.

    [0245] The above computer architectures and systems are examples only, and a wide variety of other computer, cell phone, and personal data assistant architectures and systems can be used in connection with example instances, including systems using any combination of general processors, co-processors, FPGAs and other programmable logic devices, system on chips (SOCs), application specific integrated circuits (ASICs), and other processing and logic elements. In some instances, all or part of the computer system can be implemented in software or hardware. Any variety of data storage media can be used in connection with example instances, including random access memory, hard drives, flash memory, tape drives, disk arrays, Network Attached Storage (NAS) and other local or distributed data storage devices and systems.

    [0246] In example instances, the computer system can be implemented using software modules executing on any of the above or other computer architectures and systems. In other instances, the functions of the system can be implemented partially or completely in firmware, programmable logic devices such as field programmable gate arrays (FPGAs) as referenced in FIG. 7, system on chips (SOCs), application specific integrated circuits (ASICs), or other processing and logic elements. For example, the Set Processor and Optimizer can be implemented with hardware acceleration through the use of a hardware accelerator card, such as accelerator card 1322 illustrated in FIG. 5.

    [0247] Numbered Embodiments

    [0248] Provided herein are numbered embodiments 1-83. Embodiment 1. A polynucleotide library comprising: a sample polynucleotide set comprising at least 100 polynucleotides derived from genomic sequences; and a background set comprising background polynucleotides, wherein the background set comprises cell-free DNA (cfDNA), wherein each of the least 100 polynucleotides of the sample polynucleotide set comprises at least one variant, wherein the at least one variant comprises one or more changes compared to a background polynucleotide; and at least 2 polynucleotides of the at least 100 polynucleotides are tiled across each of the at least one variant. Embodiment 2. The library of embodiment 1, wherein each of the least 100 polynucleotides comprises one variant. Embodiment 3. The library of embodiment 2, wherein the sample polynucleotide set comprises at least 150 variants. Embodiment 4. The library of embodiment 2, wherein the sample polynucleotide set comprises at least 400 variants. Embodiment 5. The library of any one of embodiments 1-4, wherein at least 5 polynucleotides are tiled across each of the at least one variant. Embodiment 6. The library of embodiment 5, wherein at least 20 polynucleotides are tiled across the at least one variant. Embodiment 7. The library of embodiment 6, wherein at least 30 polynucleotides are tiled across the at least one variant. Embodiment 8. The library of any one of embodiments 1-7, wherein the least at least 10 polynucleotides are tiled across the at least one variant with an offset of 1-8 bases. Embodiment 9. The library of any one of embodiments 1-8, wherein the genomic sequences are derived from cell-free DNA (cfDNA). Embodiment 10. The library of any one of embodiments 1-9, wherein the sample polynucleotide set comprises no more than 10% of the total amount of polynucleotides in the library. Embodiment 11. The library of any one of embodiments 1-10, wherein the at least one variant is present at a frequency of 0.01-5% relative to a wild-type genomic sequence. Embodiment 12. The library of embodiment 11, wherein the at least one variant is present at a frequency of 1-5% relative to a wild-type genomic sequence. Embodiment 13. The library of embodiment 11, wherein the at least one variant is present at a frequency of 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. Embodiment 14. The library of embodiment any one of embodiments 1-13, wherein at least 90% of the at least one variants is present at a frequency of no more than 10% relative to the frequency of other variants. Embodiment 15. The library of embodiment 14, wherein at least 99% of the at least one variants is present at a frequency of no more than 20% relative to the frequency of other variants. Embodiment 16. The library of any one of embodiments 1-15, wherein at least some of the least 100 polynucleotides are double stranded. Embodiment 17. The library of embodiment 16, wherein at least 90% of the least 100 polynucleotides are double stranded. Embodiment 18. The library of any one of embodiments 1-17, wherein the length of at least some of the least 100 polynucleotides is 125-200 bases. Embodiment 19. The library of embodiment 18, wherein the length of at least 90% of the least 100 polynucleotides is 125-200 bases. Embodiment 20. The library of any one of embodiments 1-19, wherein the at least one variant comprises an insertion, deletion, fusion, duplication, frameshift, repeat expansion, or substitution. Embodiment 21. The library of any one of embodiments 1-19, wherein the at least one variant comprises a copy number variant (CNV), microsatellite instability, loss of heterozygosity (LOH), DNA methylation, premature stop codon, trinucleotide repeat, translocation, somatic rearrangement, allelomorph, single nucleotide variant (SNV), indel, splice variant, regulator variant, copy number variant, or fusion. Embodiment 22. The library of any one of embodiments 1-19, wherein the at least one variant comprises a single nucleotide variant, indel, fusion, or structural variant. Embodiment 23. The library of embodiment 22, wherein the indel is 1-15 bases in length. Embodiment 24. The library of any one of embodiments 1-23, wherein the at least one variant comprises a modification to an tumor suppressor or oncogene. Embodiment 25. The library of any one of embodiments 1-24, wherein the library comprises variants located in at least 50 genes. Embodiment 26. The library of embodiment 25, wherein the library comprises variants located in at least 75 genes. Embodiment 27. The library of any one of embodiments 1-26, wherein the at least one variant is located in one or more of genes ABL1, ABL2, AKT1, ALK, APC, AR, ARAF, ARID1A, ATM, ATR, BAP1, BRAF, BRCA1, BRCA2, CCND1, CDC6, CDH1, CDK12, CDK4, CDX2, CTNNB1, DDR2, EGFR, EML4, ERBB2, ERBB3, ERG, ESR1, EZH2, FBXW7, FGFR1, FGFR2, FGFR3, FLT3, FOXA1, FOXL2, GATA3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, IDH2, JAK2, KDM5C, KDM6A, KIF5B, KIT, KRAS, MAP2K1, MAPK1, MET, MIR4728, ERBB2, MLH1, MPL, MYCN, MYD88, NCOA4, NF1, NF2, NFE2L2, NOTCHI, NPM1, NRAS, PBRM1, PDGFRA, PIK3CA, PTEN, PTPN11, RET, RHEB, RHOA, RIT1, ROS1, SETD2, SMAD4, SMO, SPOP, TERT, TMPRSS2, TP53, TPR, TSC1, and VHL. Embodiment 28. The library of embodiment 27, wherein the at least one variant is located in ten or more of genes ABL1, ABL2, AKT1, ALK, APC, AR, ARAF, ARID1A, ATM, ATR, BAP1, BRAF, BRCA1, BRCA2, CCND1, CDC6, CDH1, CDK12, CDK4, CDX2, CTNNB1, DDR2, EGFR, EML4, ERBB2, ERBB3, ERG, ESR1, EZH2, FBXW7, FGFR1, FGFR2, FGFR3, FLT3, FOXA1, FOXL2, GATA3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, IDH2, JAK2, KDM5C, KDM6A, KIF5B, KIT, KRAS, MAP2K1, MAPK1, MET, MIR4728, ERBB2, MLH1, MPL, MYCN, MYD88, NCOA4, NF1, NF2, NFE2L2, NOTCHI, NPM1, NRAS, PBRM1, PDGFRA, PIK3CA, PTEN, PTPN11, RET, RHEB, RHOA, RIT1, ROS1, SETD2, SMAD4, SMO, SPOP, TERT, TMPRSS2, TP53, TPR, TSC1, and VHL. Embodiment 29. The library of any one of embodiments 1-28, wherein the sample polynucleotide set is substantially free of biological contamination. Embodiment 30. The library of embodiment 29, wherein the biological contamination comprises cellular components or biomolecules derived from plasma. Embodiment 31. The library of any one of embodiments 1-30, wherein the library further comprises a buffer. Embodiment 32. The library of any one of embodiments 1-31, wherein the background polynucleotide set comprises wild-type regions corresponding to locations of the at least one variant. Embodiment 33. The library of embodiment 32, wherein the wild-type regions are represented within 10% of the variant frequency of the variant set. Embodiment 34. The library of any one of embodiments 1-33, wherein the background polynucleotide set comprises two or more polynucleotides. Embodiment 35. The library of any one of embodiments 1-34, wherein highest abundance of polynucleotides in the background set are 125-200 bases in length. Embodiment 36. The library of embodiment 35, wherein highest abundance of polynucleotides in the background set are 150-185 bases in length. Embodiment 37. The library of any one of embodiments 1-36, wherein at least 90% of the polynucleotides in the background set are mononucleosomal or dinucleosomal. Embodiment 38. The library of any one of embodiments 1-37, wherein the ratio of mononucleosomal to dinucleosomal is 70:30 to 90:10. Embodiment 39. The library of any one of embodiments 1-38, wherein the background polynucleotide set is derived from a healthy human. Embodiment 40. The library of embodiment 39, wherein the background polynucleotide set is isolated from a healthy human. Embodiment 41. The library of embodiment 40, wherein the human is male. Embodiment 42. The library of embodiment 41, wherein the human is no more than 30 years old. Embodiment 43. The library of any one of embodiments 1-42, wherein at least one background polynucleotide comprises a variant present at a frequency of 0.001%, 0.01%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. Embodiment 44. A kit for measuring variant detection limits comprising: a) The library of any one of embodiments 1-43; b) instructions for use of the kit; and c) packaging configured to hold and describe the kit contents. Embodiment 45. The kit of embodiment 44, wherein the kit comprises at least two libraries of any one of embodiment 1-43. Embodiment 46. The kit of embodiment 44 or 45, wherein the at least two libraries each comprise variants present at a frequency of 0%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. Embodiment 47. The kit of embodiment 46, wherein the kit comprises five libraries, each comprising variants present at a frequency of 0%, 0.1% 0.25%, 0.5%, 1%, or 2% relative to a wild-type genomic sequence. Embodiment 48. A method of preparing the library of any one of embodiments 1-43 comprising: a) providing the background polynucleotide set; b) synthesizing the sample polynucleotide set from predetermined sequences; and c) mixing the variant set and the background set in a buffer. Embodiment 49. The method of embodiment 48, wherein synthesizing comprises chemical synthesis. Embodiment 50. The method of embodiment 48 or 49, wherein synthesizing comprises synthesis on a surface. Embodiment 51. The method of any one of embodiments 48-50, wherein synthesizing comprises coupling of nucleoside phosphoramidites. Embodiment 52. The method of any one of embodiments 48-51, further comprising sequencing the library. Embodiment 53. The method of any one of embodiments 48-52, further comprising ddPCR measurement of the library. Embodiment 54. The method of any one of embodiments 48-53, further comprising fluorescence/UV DNA quantification and size distribution of the library. Embodiment 55. The method of any one of embodiments 48-54, further comprising determining the variant frequency in the background polynucleotide set, where the variants correspond to the at least one variant in the sample polynucleotide set. Embodiment 56. The method of any one of embodiments 48-55, further comprising fluorescence/UV DNA quantification of the sample polynucleotide set prior to mixing. Embodiment 57. The method of any one of embodiments 48-56, further comprising electrophoretic fragment analysis of the sample polynucleotide set prior to mixing. Embodiment 58. A method of preparing a nucleic acid test sample useful for determining the detection limit of genomic variants comprising: a) providing a library of any one of embodiments 1-43; b) obtaining at least one test sample from a patient suspected of having a disease or condition; c) detecting the presence or absence of the one or more variants in the library of any one of embodiments 1-43; and d) detecting the presence or absence of the one or more variants in the at least one test sample. Embodiment 59. The method of embodiment 58, wherein detecting comprises sequencing. Embodiment 60. The method of embodiment 59, wherein detecting comprises Next Generation Sequencing. Embodiment 61. The method of embodiment 59 or 60, wherein sequencing comprises sequencing by synthesis, nanopore sequencing, or SMRT sequencing. Embodiment 62. The method of embodiment 58, wherein detecting comprises ddPCR or specific hybridization to an array. Embodiment 63. The method of any one of embodiments 58-62, wherein the at least one test sample comprises a liquid biopsy. Embodiment 64. The method of any one of embodiments 58-63, wherein the at least one test sample comprises circulating tumor DNA (ctDNA). Embodiment 65. The method of any one of embodiments 58-64, wherein the at least one test sample is obtained from blood. Embodiment 66. The method of any one of embodiments 58-65, wherein the at least one test sample is substantially cell-free. Embodiment 67. The method of any one of embodiments 58-66, wherein the method comprises at least 5 test samples. Embodiment 68. The method of any one of embodiments 58-67, wherein the method further comprises detection of minimal residual disease (MRD). Embodiment 69. The method of any one of embodiments 58-68, wherein the patient is suspected of having a disease or condition. Embodiment 70. The method of embodiment 69, wherein the disease or condition is a proliferative disease. Embodiment 71. The method of embodiment 69, wherein the disease or condition is cancer. Embodiment 72. The method of any one of embodiments 58-71, wherein the patient was previously treated, is currently treated, or has received a clinical diagnosis for cancer. Embodiment 73. The method of any one of embodiments 58-72, wherein the method further comprises ligating sequencing adapters to at least some polynucleotides in the test sample, the library, or both. Embodiment 74. The method of any one of embodiments 58-73, wherein the method further comprises amplifying at least some polynucleotides in the test sample, the library, or both. Embodiment 75. The method of any one of embodiments 58-74, wherein if one or more variants are not detected in the library, then results obtained from the at least one test sample is discarded or re-analyzed. Embodiment 76. The method of any one of embodiments 58-75, wherein detecting comprises addition of one or more adapters to at least some sample polynucleotides in the library. Embodiment 77. The method of embodiment 76, wherein the adapters comprise at least one barcode. Embodiment 78. The method of embodiment 77, wherein the at least one barcode comprises one or more of a unique molecular identifier and a sample index. Embodiment 79. The method of embodiment 78, where the at least one adapter comprises a duplex adapter. Embodiment 80. The method of embodiment 78, wherein at least one adapter comprises at least two unique molecular identifiers. Embodiment 81. The method of embodiment 78, wherein at least one adapter comprises a first unique molecular identifier and a second unique molecular identifier. Embodiment 82. The method of embodiment 81, wherein the first unique molecular identifier or the second unique molecular identifier comprises a sequence of one or more of AAGGA, ACAAC, ATACG, CACTG, CATGA, CGATA, CGTGT, GCCAT, GCTGT, GTCAC, GTCGT, TACGA, TCCTA, TCGTG, TGTCG, TTGGC, AACAC, AATGC, ACTAG, AGCAT, AGTAC, ATCTC, CAGAC, CAGTA, CGAAT, CGGTT, CTTGG, GCATA, GCTAA, GTGAG, GTGTC, and TGTGC. Embodiment 83. The method of embodiment 81, wherein the first unique molecular identifier or the second unique molecular identifier comprises a sequences of 10 or more of

    TABLE-US-00007 AAGGA, ACAAC, ATACG, CACTG, CATGA, CGATA, CGTGT, GCCAT, GCTGT, GTCAC, GTCGT,        TACGA, TCCTA, TCGTG, TGTCG, TTGGC, AACAC, AATGC, ACTAG, AGCAT, AGTAC, ATCTC,       CAGAC, CAGTA, CGAAT, CGGTT, CTTGG, GCATA, GCTAA, GTGAG, GTGTC, and TGTGC.

    EXAMPLES

    [0249] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.

    Example 1: Functionalization of a Substrate Surface

    [0250] A substrate was functionalized to support the attachment and synthesis of a library of polynucleotides. The substrate surface was first wet cleaned using a piranha solution comprising 90% H.sub.2SO.sub.4 and 10% H.sub.2O.sub.2 for 20 minutes. The substrate was rinsed in several beakers with DI water, held under a DI water gooseneck faucet for 5 minutes, and dried with N.sub.2. The substrate was subsequently soaked in NH.sub.4OH (1:100; 3 mL:300 mL) for 5 minutes, rinsed with DI water using a handgun, soaked in three successive beakers with DI water for 1 minute each, and then rinsed again with DI water using the handgun. The substrate was then plasma cleaned by exposing the substrate surface to O.sub.2. A SAMCO PC-300 instrument was used to plasma etch O.sub.2 at 250 watts for 1 minute in downstream mode.

    [0251] The cleaned substrate surface was actively functionalized with a solution comprising N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 torr, 60 minutes, 70° C., 135° C. vaporizer. The substrate surface was resist coated using a Brewer Science 200× spin coater. SPR™ 3612 photoresist was spin coated on the substrate at 2500 rpm for 40 seconds. The substrate was pre-baked for 30 minutes at 90° C. on a Brewer hot plate. The substrate was subjected to photolithography using a Karl Suss MA6 mask aligner instrument. The substrate was exposed for 2.2 seconds and developed for 1 minute in MSF 26A. Remaining developer was rinsed with the handgun and the substrate soaked in water for 5 minutes. The substrate was baked for 30 minutes at 100° C. in the oven, followed by visual inspection for lithography defects using a Nikon L200. A descum process was used to remove residual resist using the SAMCO PC-300 instrument to O.sub.2 plasma etch at 250 watts for 1 minute.

    [0252] The substrate surface was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL light mineral oil. The substrate was placed in a chamber, pumped for 10 minutes, and then the valve was closed to the pump and left to stand for 10 minutes. The chamber was vented to air. The substrate was resist stripped by performing two soaks for 5 minutes in 500 mL NMP at 70° C. with ultrasonication at maximum power (9 on Crest system). The substrate was then soaked for 5 minutes in 500 mL isopropanol at room temperature with ultrasonication at maximum power. The substrate was dipped in 300 mL of 200 proof ethanol and blown dry with N.sub.2. The functionalized surface was activated to serve as a support for polynucleotide synthesis.

    Example 2: Synthesis of a 50-Mer Sequence on a Polynucleotide Synthesis Device

    [0253] A two dimensional polynucleotide synthesis device was assembled into a flowcell, which was connected to a flowcell (Applied Biosystems (ABI394 DNA Synthesizer”). The polynucleotide synthesis device was uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest) was used to synthesize an exemplary polynucleotide of 50 bp (“50-mer polynucleotide”) using polynucleotide synthesis methods described herein.

    [0254] The sequence of the 50-mer was as described in SEQ ID NO.: 1. 5′AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT ##TTTTTTTTT T3′ (SEQ ID NO.: 1), where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker enabling the release of polynucleotides from the surface during deprotection.

    [0255] The synthesis was done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) and an ABI synthesizer.

    [0256] The phosphoramidite/activator combination was delivered similar to the delivery of bulk reagents through the flowcell. No drying steps were performed as the environment stays “wet” with reagent the entire time.

    [0257] The flow restrictor was removed from the ABI 394 synthesizer to enable faster flow. Without flow restrictor, flow rates for amidites (0.1M in ACN), Activator, (0.25M Benzoylthiotetrazole (“BTT”; 30-3070-xx from GlenResearch) in ACN), and Ox (0.02M I.sub.2 in 20% pyridine, 10% water, and 70% THF) were roughly ˜100 uL/second, for acetonitrile (“ACN”) and capping reagents (1:1 mix of CapA and CapB, wherein CapA is acetic anhydride in THF/Pyridine and CapB is 16% 1-methylimidizole in THF), roughly ˜200 uL/second, and for Deblock (3% dichloroacetic acid in toluene), roughly ˜300 uL/second (compared to ˜50 uL/second for all reagents with flow restrictor). The time to completely push out Oxidizer was observed, the timing for chemical flow times was adjusted accordingly and an extra ACN wash was introduced between different chemicals. After polynucleotide synthesis, the chip was deprotected in gaseous ammonia overnight at 75 psi. Five drops of water were applied to the surface to recover polynucleotides. The recovered polynucleotides were then analyzed on a BioAnalyzer small RNA chip (data not shown).

    Example 3: Synthesis of a 100-Mer Sequence on a Polynucleotide Synthesis Device

    [0258] The same process as described in Example 2 for the synthesis of the 50-mer sequence was used for the synthesis of a 100-mer polynucleotide (“100-mer polynucleotide”; 5′ CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATGCT AGCCATACCATGATGATGATGATGATGAGAACCCCGCAT ##TTTTTTTTTT3′, where #denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes); SEQ ID NO.: 2) on two different silicon chips, the first one uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE and the second one functionalized with 5/95 mix of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and the polynucleotides extracted from the surface were analyzed on a BioAnalyzer instrument (data not shown).

    [0259] All ten samples from the two chips were further PCR amplified using a forward (5′ATGCGGGGTTCTCATCATC3′; SEQ ID NO.: 3) and a reverse (5′CGGGATCCTTATCGTCATCG3′; SEQ ID NO.: 4) primer in a 50 uL PCR mix (25 uL NEB Q5 master mix, 2.5 uL 10 uM Forward primer, 2.5 uL 10 uM Reverse primer, 1 uL polynucleotide extracted from the surface, and water up to 50 uL) using the following thermal cycling program: [0260] 98 C, 30 seconds [0261] 98 C, 10 seconds; 63C, 10 seconds; 72C, 10 seconds; repeat 12 cycles [0262] 72C, 2 minutes

    [0263] The PCR products were also run on a BioAnalyzer (data not shown), demonstrating sharp peaks at the 100-mer position. Next, the PCR amplified samples were cloned, and Sanger sequenced. Table 7 summarizes the results from the Sanger sequencing for samples taken from spots 1-5 from chip 1 and for samples taken from spots 6-10 from chip 2.

    TABLE-US-00008 TABLE 7 Spot Error rate Cycle efficiency 1  1/763 bp 99.87% 2  1/824 bp 99.88% 3  1/780 bp 99.87% 4  1/429 bp 99.77% 5 1/1525 bp 99.93% 6 1/1615 bp 99.94% 7  1/531 bp 99.81% 8 1/1769 bp 99.94% 9  1/854 bp 99.88% 10 1/1451 bp 99.93%

    [0264] Thus, the high quality and uniformity of the synthesized polynucleotides were repeated on two chips with different surface chemistries. Overall, 89%, corresponding to 233 out of 262 of the 100-mers that were sequenced were perfect sequences with no errors.

    [0265] Finally, Table 8 summarizes error characteristics for the sequences obtained from the polynucleotides samples from spots 1-10.

    TABLE-US-00009 TABLE 8 Sample OSA_ OSA_ OSA_ OSA_ OSA_ OSA_ OSA_ OSA_ OSA_ OSA_ ID/Spot no. 0046/1 0047/2 0048/3 0049/4 0050/5 0051/6 0052/7 0053/8 0054/9 055/10 Total 32 32 32 32 32 32 32 32 32 32 Sequences Sequencing 25 of 28 27 of 27 26 of 30 21 of 23 25 of 26 29 of 30 27 of 31 29 of 31 28 of 29 25 of 28 Quality Oligo 23 of 25 25 of 27 22 of 26 18 of 21 24 of 25 25 of 29 22 of 27 28 of 29 26 of 28 20 of 25 Quality ROI Match 2500 2698 2561 2122 2499 2666 2625 2899 2798 2348 Count ROI 2 2 1 3 1 0 2 1 2 1 Mutation ROI Multi 0 0 0 0 0 0 0 0 0 0 Base Deletion ROI Small 1 0 0 0 0 0 0 0 0 0 Insertion ROI Single 0 0 0 0 0 0 0 0 0 0 Base Deletion Large 0 0 1 0 0 1 1 0 0 0 Deletion Count Mutation: 2 2 1 2 1 0 2 1 2 1 G > A Mutation: 0 0 0 1 0 0 0 0 0 0 T > C ROI Error 3 2 2 3 1 1 3 1 2 1 Count ROI Error Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Rate in 834 in 1350 in 1282 in 708 in 2500 in 2667 in 876 in 2900 in 1400 in 2349 ROI Minus MP MP MP MP MP MP MP MP MP MP Primer Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Err: ~1 Error Rate in 763 in 824 in 780 in 429 in 1525 in 1615 in 531 in 1769 in 854 in 1451

    Example 4: Parallel Assembly of 29,040 Unique Polynucleotides

    [0266] A structure comprising 256 clusters each comprising 121 loci on a flat silicon plate 201 was manufactured as shown in FIG. 2. An expanded view of a cluster is shown in 205 with 121 loci. Loci from 240 of the 256 clusters provided an attachment and support for the synthesis of polynucleotides having distinct sequences. Polynucleotide synthesis was performed by phosphoramidite chemistry using general methods from Example 3. Loci from 16 of the 256 clusters were control clusters. The global distribution of the 29,040 unique polynucleotides synthesized (240×121) is shown in FIG. 3A. Polynucleotide libraries were synthesized at high uniformity. 90% of sequences were present at signals within 4× of the mean, allowing for 100% representation. Distribution was measured for each cluster, as shown in FIG. 3B. On a global level, all polynucleotides in the run were present and 99% of the polynucleotides had abundance that was within 2× of the mean indicating synthesis uniformity. This same observation was consistent on a per-cluster level.

    [0267] The error rate for each polynucleotide was determined using an Illumina MiSeq gene sequencer. The error rate distribution for the 29,040 unique polynucleotides averages around 1 in 500 bases, with some error rates as low as 1 in 800 bases. Distribution was measured for each cluster. The library of 29,040 unique polynucleotides was synthesized in less than 20 hours. Analysis of GC percentage versus polynucleotide representation across all of the 29,040 unique polynucleotides showed that synthesis was uniform despite GC content.

    Example 5. Design and Synthesis of a Synthetic cfDNA Variant Library

    [0268] Using the general synthesis methods described in Example 3, a synthetic variant library was designed and synthesized. The total number of target variants represented was 458, and each polynucleotide in the library was 167 base pairs in length. Variants were present on 85 different human genes, and included SNVs (228), indels (215 total; 168 deletions, 47 insertions), fusions, and SVs (15). This included 147 clinically relevant variants (including all SVs). Variants were selected from Tables 1-6. Polynucleotides targeting a single variant were tiled using the general design of FIG. 1A, with an offset of 4 bases and with 32 polynucleotides targeting each variant. The distribution of indel sizes for the library is shown in FIG. 1B. The variant library was then mixed with a background cfDNA library obtained from plasma of a healthy male donor (less than 30 years old, shown in FIG. 1C). Libraries having a variant allele frequency (VAF) of 0% (wild-type), 0.1%, 0.25%, 0.5%, 1%, 2%, and 5% were generated. Accurate representation and distribution of polynucleotides in the library was further confirmed by Next Generation Sequencing (all variant sites) and ddPCR (for a subset of variant sites).

    Example 6. Variant Libraries as a Reference Standard

    [0269] At least one sample from a patient suspected of having a disease or condition is obtained, such as a sample obtained via liquid biopsy. The patient may have been previously untreated, previously diagnosed/treated, or concurrently treated for a disease or condition. A library generated using the general methods of Example 5 (reference standard, includes mixture variant polynucleotides and background cfDNA) is analyzed on an instrument (sequencing or ddPCR) with the at least one patient sample. If the variants are not detected with the required confidence in the reference standard, the instrument may be adjusted/recalibrated, subjected to maintenance, or the patient sample may be re-analyzed or results discarded. From the sensitivity of the reference standard, the patient sample is analyzed and determined to contain or not contain one or more variants found in the reference standard. Based on this result, the patient may be diagnosed or treated appropriately by a healthcare professional.

    Example 7. Design of ctDNA Standards Using Restriction Site Adapter Cleavage

    [0270] Sequences for approximately 500 variants were acquired comprising mostly SBS (single base substitutions) from a reference genome. Approximately 10,000 fragments were designed having a length of about 160 bp, with an 8 bp sliding window. About 20 fragments were tiled across each variant. Optionally, a 5 base identifier was added to label the fragments as synthetic. This identifier in some instances was a significant edit distance from the reference gene, or else it may just be called as a variant. Given a variant fasta file, fragments are designed by: [0271] 1. Selecting 162 bases (for 2 base “synthetic signatures” to the 5′ and 3′ of the variant base, for a total of 325 bases. [0272] 2. The 5′ 164 bases will be fragment 1. [0273] 3. Looping over a sliding window+8, each will be new fragment, 20 fragments to synthesize per variant. [0274] 4. For each fragment, change 5 bases at the 5′ end to encode the complement. i.e., AGATC . . . TCTAG . . . . [0275] 5. For each fragment, change 5 bases at the 3′ end to encode the complement as above.

    [0276] If the variant is at the end of a molecule, in some instances it is soft-clipped. In one embodiment, the sliding window is at 7, but starts closer to the variant. This would result in 20 unique molecules per variant.

    [0277] The length is 324 bp (for 2 bp on each end for barcoding). The variant is placed at position 161. In another embodiment, the sliding window is +7 (every 8th base), the variant is at base 161 in the original fasta at 171 in the expanded fasta, start at −150, fragment length is 164, 2 bp on each end is complemented, and flanks are added as described below. FIG. 8A depicts an example of 20 oligos to be synthesized, without the flanks added, to show the location of each of the variants across each molecule. The top is the original variant. In the bottom 20, each line is a unique molecule from the sliding window. The highlighted region contains the variant base. Within the GACCTGG, the bolded base is the variant. It is present within each molecule at least 8 bases within the end of the alignable. Flanks are added as below. Initial builds using this design resulted in 6760 oligos for the SNVs (333 variants with 20 oligos per variant). The oligos are screened for restriction sites:

    TABLE-US-00010 TABLE 9 bspq1 bsmb1 bbs1 number of oligos 162 208 792 with site % with site 2.39538666 3.07555818 11.7107792

    [0278] Bspq1 and bsmb1 (both 7 cutters) result in fewer oligos with cut sites; bbsl is a 6 cutter, and cuts more frequently. BSPQ1 cleaves at the fewest endogenous locations, so this is used to remove adapters; the cut sequences are:

    TABLE-US-00011 GCTCTTC(N1)- 3′ CGAGAAG(N4)- 5′

    [0279] There is a 3 base 5′ overhang after cutting. These are filled in with Klenow after cleanup. The N1 base is in ( ). The initial oligo has the sequence: 5′-GAAGTGCCATTCCGC GCTCTTC(A) (SEQ ID NO: 58)-2b complement—160b w/variant—2b complement—(T)GAAGAGC ATCGTACAG CTGCTCG-3′ (SEQ ID NO: 59)

    [0280] In another embodiment, the oligo has the sequence: 5′-CCATTCCGC GCTCTTC(A) (SEQ ID NO: 60)-2b complement—160b w/variant—2b complement—(T)GAAGAGCATC GTACAGCT-3′ (SEQ ID NO: 61)

    [0281] Exemplary primers include those described in Tables 10A and 10B.

    TABLE-US-00012 TABLE 10A Uni9 GAAGTGCCATTCCGCCTGACCT (SEQ ID NO: 62) B1-BSPQ-M-AFR-1B #-CGAGCAGCTGTACGATGCTCTTCA (SEQ ID NO: 63) B2-BSPQ-M-AFR-1B #-CGCTGACGATGTCAGTGCTCTTCA (SEQ ID NO: 64)

    TABLE-US-00013 TABLE 10B Forward primer Reverse primer rev comp (Uni9 based) (Bl based) reverse  original #- #- TGAAGAGCATCGTACAGCTG GAAGTGCCATTCCGCGCTC CGAGCAGCTGTACGATGCTC CTCG (SEQ ID NO: 59) TTCA (SEQ ID NO: 58) TTCA (SEQ ID NO: 63) Q5 73° C. 71° C. Tm #-CCATTCCGCGCTCTTCA #-AGCTGTACGATGCTCTTCA TGAAGAGCATCGTACAGCT (SEQ ID NO: 60) (SEQ ID NO: 65) (SEQ ID NO: 61) Q5 65° C. 63° C. Tm

    [0282] In some instances, primers are further shortened or comprise lower GC content. In some instances primers are no more than 200 bp. Primers are biotinylated for removal after cleavage. T4 DNA polymerase is used to fill-in 5′ overhangs. SPRI beads are also used to remove ends. If the primers misprime on each other (due to similar 3′ ends) primers will still introduce BSPQ1 and a biotinylated tail. Oligos are binned by GC to avoid bias during amplification, and printed to a matrixed pool at 60 oligos per cluster.

    [0283] Primers are synthesized having the sequences:

    TABLE-US-00014 cfDNA_BSPQ1F (SEQ ID NO: 60) #-CCATTCCGCGCTCTTCA cfDNA_BSPQ1R  (SEQ ID NO: 65) #-AGCTGTACGATGCTCTTCA

    [0284] Genes are binned by GC to prevent competition. For these genes, any molecules with BSPQ1 sites are removed to prevent potential issues downstream.

    [0285] An adapter-off process for this design in some instances uses restriction. Using Bsa1 may result in variance in cleavage by methylation status, as cfDNA in some instances have adapters with Bsa1 cut sites. These are methylation sensitive because the primers used are biotinylated on the 5′ end and unmethylated. Bsa1 cut side have the sequences:

    TABLE-US-00015 GGTCTC(N1)-3′ CCAGAG(N4)-5′

    [0286] In some instances, endogenous sites are protected by adding 5-methyl-dCTP to the PCR step. After digestion, uncleaved products and cleaved adapters are removed by streptavidin binding, then filled in with Klenow. In some instances, Bsmb1 is used as a restriction enzyme, resulting in sequences:

    TABLE-US-00016 5′-CGTCTC(N1)-3′ 3′-GCAGAG(N4)-5′

    [0287] Bottom strand methylation results in protection from digestion. To evaluate how this effects adapter removal, 5m-dCTP is spiked in at various ratios in a range from 10-100%. Both forward and reverse primers are biotinylated. Primers in some instances are designed to reduce homology and dimerization, as shown in Table 11.

    TABLE-US-00017 TABLE 11 Forward primer Reverse primer 3′ rev_comp adapter Primer #- #-AGTCAGGATGTCGTCTCG CGAGACGACATCCTGACT CCATGTGCTCACGTCTCA (SEQ ID NO: 67) (SEQ ID NO: 68) (SEQ ID NO: 66) Q5 Tm 65° C. 63° C.

    [0288] A design utilizing the adapters of Table 11 is synthesized at 40 oligos per cluster binned by GC:. The 5′ overhang is filled in at the end with Klenow. Optionally, a PTO (phosphorothioate oligonucleotide) modification at the most 3′ of the primer is introduced which may protect the full length DNA from exonuclease digestion. In some cases, multiple PTO modifications are employed.

    Example 8. cfDNA Expansion with Uracil Adapter Cleavage

    [0289] A cfDNA library was prepared using uracil as a terminal nucleotide of primers to enable facile cleavage of adapters sequences after amplification. In some instances, use of uracil results in fewer cleavage events in cfDNA libraries relative to a restriction enzyme digestion. Two cfDNA replicates were generated of 30 ng of cfDNA, amplified using UNI9 FWD/REV v2.1 (single uracil primers), a cfDNA expansion workflow performed comprising a) overhang digestion using Klenow and b) Overhang digestion using (non-HotStart) KAPA Hifi, and whole genome sequencing performed. A cfDNA sample was used to evaluate cleavage protocols.

    [0290] cfDNA was obtained from commercial samples, or alternatively isolated from cell lines by nucleosome preparation. Briefly, Expi293 cells were harvested and diluted to 1×10.sup.6 cells per mL in 1×PBS, spun down, and the cells lysed. Isolated nuclei were treated with a nuclease and incubated, then treated with Proteinase K treatment. The product was then purified using spin columns.

    [0291] Library preparation. 30 ng of input cfDNA was dissolved in 30 microliters EB buffer, and combined with 5 microliters water, 5 microliters 10× fragmentation buffer, and 10 microliters 5× fragmentation enzyme. The reaction was incubated for 30 minutes, the held at 4 degrees C., and mixed with 5 microliters of adapter solution. Ligation master mix was prepared from water (15 microliters), DNA ligation buffer (20 microliters), and DNA ligation mix (10 microliters), followed by incubation at 20 degrees C. for 15 minutes. Cleanup was then performed using 0.8× SPRI, and products eluted with 20 microliters EB buffer. The adapter library (20 microliters), forward and reverse primers (2.5 microliters each at 20 uM), and KAPA Hifi U+ master mix (25 microliters) were used to amplify the library. The thermocycler program was initialization (98C, 45 s, 1 cycle); denaturation (98C, 15 s), annealing (70C, 30 s), and extension (72C, 30 s)-3 cycles; final extension (72C, 1 min); and hold at 4C. After amplification, the products were cleaned up with 1× SPRI, and eluted with 30 microliters EB buffer. Amplicon size was approximately 150-500 bases, with most fragments about 234 bases in length. After fragmentation. of the cfDNA sample, ligation of adapters, and amplification with uracil-containing primers, the cfDNA library comprised the sequences (SEQ ID NOS 69 and 70, respectively, in order of appearance).

    TABLE-US-00018 5′ (B) GAAGTGCCATTCCGCCTGACCTGCTCTTCCGUNNNNNNNNNNACGGAAGAGCTCCGATCCACCTCCGAGTCAC        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     3′ CTTCACGGTAAGGCGGACTGGACGAGAAGGCANNNNNNNNNNUGCCTTCTCGAGGCTAGGTGGAGGCTCAGTG (B)

    [0292] The library was next digested with USER to cleave the adapters. 1 microgram of cfDNA was incubated with USER (1000 U/mL, 2.5 microliters), 10× cutsmart buffer (5 microliters), and water to 50 microliters at 37C for 1 hour. 3′ overhangs were removed by Klenow (1 microliter), 10× NEB buffer 2 (5 microliters), dNTPs (10 mM, 1 microliter), and water (5 microliter) incubated at 25C for 1 hour. Alternatively, 5× KAPA Hifi was used (5× KAPA Hifi Buffer, 10 microliters; KAPA Hifi Enzyme, 1 microliter; and dNTPs, 10 mM, 1 microliter) incubated at 72C for 1 hour. Products were purified by streptavidin binding to beads, and SPRI cleanup. Alternatively, primers were removed by Prep Streptavidin beads with Cutsmart (50 ul beads, wash 2 times with 1× Cutsmart buffer; Elute 20 ul 1× Cutsmart buffer); Bind sample to beads (Add beads to 500 ng of library ˜30 ul; Incubate in thermocycler 20° C. 30 min); USER digestion (Add 2.5 ul USER enzyme, Advance thermocycler 37° C. 1 hr); Strand disassociation (Advance thermocycler 70° C. 30m); Collect flow-through (Put tubes on magnetic rack, collect flow through); End blunting (Add 6 ul of 10× NEB Buffer 2; Add 1 ul of Klenow; Add 3 ul of nuclease free water; Incubate 25° C. 30 min); SPRI cleanup (2× SPRI cleanup; Elute 30 ul EB buffer). Alternatively, the following protocol changes were made: Bind to beads 20° C. 1 hr (500 ng); Add 5 ul USER, digest 37° C. 2 hr; Incubate 80° C. for 30 minutes (immediate magnetization to minimize potential re-annealing); Use KAPA Hifi for end digestion (14 ul 5× KAPA Buffer, lul KAPA Hifi (70 ul reaction total), Incubate 72° C. 1 hr); 2× SPRI cleanup (Elute 35 ul EB buffer).

    [0293] After cleavage/exoIII digestion, the library had sequences (SEQ ID NOS 71 and 72, respectively, in order of appearance):

    TABLE-US-00019 5′ (B) GAAGTGCCATTCCGCCTGACCTGCTCTTCCG NNNNNNNNNNACGGAAGAGCTCCGATCCACCTCCGAGTCAC        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     3′ CTTCACGGTAAGGCGGACTGGACGAGAAGGCANNNNNNNNNN GCCTTCTCGAGGCTAGGTGGAGGCTCAGTG (B)

    [0294] After cleanup was performed with streptavidin beads and strand dissociation to generate sequences (SEQ ID NOS 73 and 74, respectively, in order of appearance):

    TABLE-US-00020 5′                                 NNNNNNNNNNACGGAAGAGCTCCGATCCACCTCCGAGTCAC                                    |||||||||| 3′ CTTCACGGTAAGGCGGACTGGACGAGAAGGCANNNNNNNNNN

    [0295] Lastly, cfDNA repair and extension using polymerase are used to generate the cfDNA library:

    TABLE-US-00021 5′ NNNNNNNNNN    |||||||||| 3′ NNNNNNNNNN

    [0296] Sequencing results of the library are shown in FIGS. 8B-8C.

    Example 9. cfDNA Expansion Using Phosphorothioates

    [0297] Following the general methods of Example 8, cfDNA expansion libraries were generated using either no phosphorothioate at the 3′ uracil, 1 phosphorothioate bond at the 3′ uracil, or 3 phosphorothioate bonds at the 3′ uracil. Primer sequences were:

    TABLE-US-00022 cfDNA_Exp_v2.1_FWD (SEQ ID NO: 75) /5Biosg/GA AGT GCC ATT CCG CCT GAC CTG CTC TTC CG/3deoxyU/ cfDNA_Exp_v2.1_REV (SEQ ID NO: 76) /5Biosg/GT GAC TCG GAG GTG GAT CGG AGC TCT TCC G/3deoxyU/ cfDNA_Exp_v2.1_1PTO_FWD (SEQ ID NO: 77) /5Biosg/GA AGT GCC ATT CCG CCT GAC CTG CTC TTC CG*/3deoxyU/ cfDNA_Exp_v2.1_1PTO_REV (SEQ ID NO: 78) /5Biosg/GT GAC TCG GAG GTG GAT CGG AGC TCT TCC G*/3deoxyU/ cfDNA_Exp_v2.1_3PTO_FWD (SEQ ID NO:79) /5Biosg/GA AGT GCC ATT CCG CCT GAC CTG CTC TTC* C*G*/3deoxyU/ cfDNA_Exp_v2.1_3PTO_REV (SEQ ID NO: 80) /5Biosg/GT GAC TCG GAG GTG GAT CGG AGC TCT TC*C* G*/3deoxyU/

    [0298] Libraries were evaluated using a bioanalyzer as shown in FIGS. 9A-9C.

    [0299] Use of phosphorothioate bonds led to increased yields. Without being bound by theory, use of the phosphorothioate preserved the terminal uracil via preventing exonucleolytic removal of the U by the polymerase. After fragmentation. of the cfDNA sample, ligation of adapters, and amplification with uracil-containing primers, the cfDNA library comprised the sequences (SEQ ID NOS 69 and 70, respectively, in order of appearance):

    TABLE-US-00023 5′ (B) GAAGTGCCATTCCGCCTGACCTGCTCTTCCGUNNNNNNNNNNACGGAAGAGCTCCGATCCACCTCCGAGTCAC        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     3′ CTTCACGGTAAGGCGGACTGGACGAGAAGGCANNNNNNNNNNUGCCTTCTCGAGGCTAGGTGGAGGCTCAGTG (B)

    [0300] Phosphorothioate bonds are shown between G and U bases (bolded, underlined).

    Example 10. cfDNA Analysis Using UMIs for Cancer Detection

    [0301] Early detection can significantly improve the clinical outcome for a number of cancers, but many of the best current screening methods require invasive procedures. A promising alternative approach is to perform a liquid biopsy of cell-free DNA (cfDNA) from patient plasma. Because tumors generally shed relatively large amounts of DNA into the circulation, cancer can potentially be detected by identifying oncogenic variants in cfDNA. This process generally requires extremely deep sequencing, and is in some cases limited by the accuracy of next-generation sequencing (NGS).

    [0302] One approach to overcoming this limitation is to use unique molecular identifiers (UMIs), which are short sequences that uniquely tag each input DNA molecule prior to preparing NGS libraries. The approach can further be improved by tagging each original strand of the DNA molecule, in a technique termed duplex sequencing, which allows for correction of early PCR errors and/or single-strand DNA damage events.

    [0303] Following the general procedures of Example 6, a contrived sample was designed and synthesized to simulate a fraction of tumor DNA in a healthy background and ligated to polynucleotide “duplex” UMI-containing adapters. UMI sequences were optimized to maximize sequence distances for error correction. The library was then subjected to sequencing analysis.

    [0304] The rate at which input DNA is converted into sequencing libraries was determined. Using contrived samples to simulate a fraction of tumor DNA in a healthy background, both high sensitivity and specificity towards oncogenic variants was demonstrated. The baseline error rate using unmodified human cell-free DNA was evaluated, and mutation frequency in synthetic biology applications were determined.

    Example 11. Variant Analysis of cfDNA Analysis Using UMIs

    [0305] Following the general procedures of Example 10, 30 ng of ctDNA (Seracare) AF1l %, 3 μl of 10 μM adapter solution, followed by amplification (Equinox MM, 9 cycles PCR). Standard capture was performed using a 37 kb variant-targeting panel, with a hybridization time of 16 hrs (1 plex). 50 ng of input material was used and subjected to 16 cycles PCR prior to sequencing. Sequencing metrics are shown in FIGS. 12-17D. Duplex efficiency is shown below in Table 12.

    TABLE-US-00024 TABLE 12 Run blend 20000× 30000x 40000x 50000x 1 Y 6.3% 5.0% 4.0% 3.4% 1 Y 6.7% 5.3% 4.3% 3.6% 1 Z1 8.6% 6.6% 5.3% 4.4% 1 Z1 9.7% 8.2% 6.9% 5.9% 1 Z1 9.9% 8.3% 6.9% 5.9% 1 Z3 9.7% 8.3% 7.0% 6.0% 1 Z3 9.7% 8.0% 6.7% 5.7% 1 Z3 9.8% 8.1% 6.7% 5.7% 2 Y 5.8% 4.9% 4.1% 3.5% 2 Y 6.4% 5.4% 4.6% 3.9% 2 Z1 8.6% 7.7% 6.7% 5.9% 2 Z1 9.0% 8.1% 7.2% 6.3% 2 Z1 9.0% 7.9% 6.9% 6.0% 2 Z3 8.0% 7.1% 6.1% 5.3% 2 Z3 9.8% 8.7% 7.6% 6.7% 2 Z3 8.0% 7.2% 6.3% 5.5%

    Example 12. Variant Analysis of Pan Cancer Controls

    [0306] Following the general procedures of Examples 6 and 10, a 458 member pan-cancer cfDNA standard was designed, ligated to UMI-containing adapters, and sequenced. Results with and without downsampling and/or filtering are shown in FIGS. 18-19F.