COMPOSITIONS AND METHODS FOR CARDIAC TISSUE REPAIR
20180228847 ยท 2018-08-16
Assignee
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
C12N2501/165
CHEMISTRY; METALLURGY
A61K38/1833
HUMAN NECESSITIES
A61K38/30
HUMAN NECESSITIES
C12N2502/00
CHEMISTRY; METALLURGY
A61K35/34
HUMAN NECESSITIES
International classification
A61K35/34
HUMAN NECESSITIES
Abstract
The invention features compositions comprising agents having cardiac protective activity isolated from epicardial progenitor cells and derivatives thereof, and methods for the use of such compositions.
Claims
1. A pharmaceutical composition comprising one or more cellular factors having cardiac protective activity in a pharmaceutically acceptable excipient, wherein the cellular factor is isolated from a cultured epicardial progenitor cell.
2. The method of claim 1, wherein the epicardial progenitor cell selected for expression of epicardin, Nkx 2.5, Is1-1, GATA 5, WT1, Tbx18, and/or Tbx5 polypeptides or polynucleotides; has a biological activity selected from the group consisting of reducing cell death in a cell population at risk thereof, increasing cell survival, reducing inflammation, increasing epicardial cell proliferation, increasing epithelial to mesenchymal transformation, and increasing cardiac function; has a molecular weight that is at least about 5 kD; and is inactivated by heat denaturation.
3. The pharmaceutical composition of claim 2, wherein the cellular factor is isolated from a primary cultured or a cell passaged for at least one, two, three, four, five, six or more passages.
4. The pharmaceutical composition of claim 2, wherein the epicardial progenitor cell expresses a polypeptide selected from the group consisting of GATA 4, Mef2c, myocardin, CD105+, CD90+, CD73+, CD44+, CD29+, and Stro-1; and fails to express detectable levels or expresses reduced levels of a polypeptide selected from the group consisting of CD34+, CD45+, c-kit, and vascular pericyte marker.
5. A method for producing a pharmaceutical composition comprising one or more cellular factors, the method comprising: (a) selecting an isolated epicardial progenitor cell that expresses epicardin, Nkx 2.5, Is1-1, GATA 5, WT1, Tbx18, and Tbx5 polypeptides or polynucleotides; and (b) isolating one or more cellular factors from the cell, thereby generating a composition that promotes cardiac tissue repair.
6. The method of claim 5, wherein the cellular factor has a biological activity selected from the group consisting of reducing cell death in a cell population at risk thereof, increasing cell survival, reducing inflammation, increasing epicardial cell proliferation, increasing epithelial to mesenchymal transformation, and increasing cardiac function.
7. The method of claim 6, wherein the purification involves selecting fractions having a desired biological activity.
8. A method for increasing cardiac cell survival or proliferation, the method comprising contacting a cardiac cell at risk of cell death with a composition of claim 1.
9. A method for stabilizing or reducing cardiac tissue damage in a subject, the method comprising contacting a cardiac cell of the subject with one or more secreted cellular factors having epicardial protective activity, wherein at least one of the cellular factors is HGF, VEGF, SDF-1 alpha or IGF-1 thereby stabilizing or reducing cardiac tissue damage in the subject.
10. A method for increasing cardiac function in subject at risk of ischemic cardiac tissue damage, the method comprising contacting a cardiac cell of the subject with a composition of claim 1.
11. The method of claim 10, wherein an increase in cardiac function is indicated by increased cardiac output, reduced left ventricular end diameter during diastole (LVEDD), improves echocardiography scoring for wall motion, increases the difference in left ventricle anterior wall thickness between diastole and systole, or improves percent fractional shortening.
12. A method for increasing cardiac cell survival or proliferation or reducing cardiac tissue damage in a subject, the method comprising contacting a cardiac cell at risk of cell death with an effective amount of a composition of claim 1.
13. The method of claim 15, wherein the method increases cardiac cell number or reduces cardiac cell death.
14. The method of claim 12, wherein the composition is administered to a subject directly to a site of cardiac tissue damage or cardiac disease or is administered systemically.
15. The method of claim 12, wherein the subject has a disease or disorder selected from the group consisting of myocardial infarction, congestive heart failure, stroke, and ischemia.
16. The method of claim 12, wherein the method reduces apoptosis or increases cell proliferation.
17. The method of claim 12, wherein the method prevents or ameliorates ischemic damage in a cardiac tissue post-myocardial infarction.
18. A method for identifying an agent useful for cardiac tissue repair or regeneration, the method comprising contacting a cardiac cell at risk of cell death with a composition of claim 1 and isolating the agent, thereby identifying an agent useful for cardiac tissue repair or regeneration.
19. A cellular composition comprising an isolated epicardial progenitor cell or progeny cell thereof that expresses epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, and Tbx5.
20. A method of culturing an isolated epicardial progenitor cell or progeny thereof that expresses epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, and Tbx5, comprising culturing an isolated epicardial progenitor cell or progeny thereof on polystyrene.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
DETAILED DESCRIPTION OF THE INVENTION
[0105] The invention features therapeutic compositions comprising agents secreted by epicardial progenitor cells and/or epicardial progenitor-derived mesenchymal stem cells and methods of using such compositions for the repair or regeneration of damaged cardiac tissue or heart.
[0106] The present invention is based, at least in part, on the discoveries that media isolated from epicardial progenitor cells or epicardial progenitor-derived mesenchymal stem (EPI CdM) preserved cardiac function, reduced cell death, reduced inflammatory responses, and promoted healing of injured tissues and prevention of vascular rhexis in the mice when administered intra-arterially to mice after prolonged myocardial ischemia (4 hours) with reperfusion. Without intending to be bound to theory, EPI CdM treatment rapidly reduces myocardial necrosis and infarct expansion after MI by preventing the progression of vascular rhexis that occurs following reperfusion. Treatment using EPI Cdm provides advantages over cell-based therapies, which involve invasive isolation procedures, lack of available autologous materials, or the requirement for MHC-matching. Unexpectedly and surprisingly, EPI CdM from patients of advanced age did not reduce the ability of EPI CdM to provide cardioprotection or vasoprotection.
[0107] Accordingly, the invention provides therapeutic and prophylactic compositions comprising agents secreted by epicardial progenitor cells and/or epicardial progenitor-derived mesenchymal stem cells (e.g., HGF VEGF SDF-1 alpha and IGF-1) and methods of using such compositions to reduce cardiac cell death, preserve cardiac function after an ischemic event, and to generally prevent cardiac damage and promote cardiac healing or regeneration.
Epicardial Progenitor Cells
[0108] The epicardium is a specialized epithelial cell layer that covers the heart and is important in maintaining cardiac structure and function (Gittenberger-de Groot et al., Circ Res. 2000; 87:969-971; Eralp et al., Circ Res. 2005; 96:526-534). During cardiac development, a subset of epicardial cells undergo epithelial to mesenchymal transformation, invade the underlying subepicardium and myocardium, and contribute to the interstitial fibroblasts and the subepicardial and coronary vasculature (Dettman et al., Dev Biol. 1998; 193:169-181; Vrancken Peeters et al., Anat Embryol (Berl). 1999; 199:367-378; Perez-Pomares et al., Int J Dev Biol. 2002; 46:1005-1013; Reese et al., Circ Res. 2002; 91:761-768). Recent genetic lineage tracing studies have demonstrated that epicardial progenitor cells also contribute extensively to the cardiac myocyte pool (Cai et al., Nature. 2008; 454:104-108). The dramatic cardiac regeneration that occurs in adult zebrafish after ventricular injury depends upon on epicardial cell proliferation, epithelial-to-mesenchymal transition, invasion and subsequent neovascularization of myocardium (Lepilina et al., Cell. 2006; 127:607-619). Because of their ability to respond to injury and to differentiate into multiple cardiac cell types (Limana et al., Circ Res. 2007; 101:1255-1265), epicardial cells and their derivatives can be considered as a potential source of post-natal cardiac stem/progenitor cells for regenerative medicine (Wessels et al., Anat Rec A Discov Mol Cell Evol Biol. 2004 January; 276(1):43-57; Winter et al., Circulation. 2007; 116:917-927).
Isolation of Cells
[0109] While the results reported herein provide specific examples of the isolation of epicardial progenitor cells from right atrial appendages, the invention is not so limited. The unpurified source of cells for use in the methods of the invention may be any cells or tissue capable of giving rise to epicardial progenitor cells, embryonic stem cells, and induced pluripotent cells (Wernig et al. Nature 19; 448(7151):318-24, 2007). Preferably, cells of the invention are epicardial progenitor cells selected for expression of epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, and Tbx5 transcription factors. In various embodiments, the epicardial progenitor cells are selected for expression of one or more of a cell surface marker (e.g., CD105.sup.+, CD90.sup.+, CD73.sup.+, CD44.sup.+, CD29.sup.+, and Stro-1) prior to selection for expression of an internal marker (e.g., epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, Tbx5, GATA 4, Mef2c, and/or myocardin. Various techniques can be employed to separate or enrich for the desired cells. Such methods include a positive selection for cells expressing these markers. Monoclonal antibodies are particularly useful for identifying markers associated with the desired cells. If desired, negative selection methods can be used in conjunction with the methods of the invention to reduce the number of irrelevant cells present in a population of cells selected for epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, and Tbx5 expression. For example, epicardial progenitor cells may be negatively selected for hematopoietic cell surface markers such as CD34, CD45, c-kit, and the vascular pericyte marker NG2.
[0110] In one approach, epicardial progenitor cells are isolated by the selective culture of cells obtained from cardiac tissue (e.g., right atrial appendage) in medium favoring stem/progenitor cell growth (e.g., DMEM/F12 (Invitrogen) with 3% FCS (Atlanta Biologicals) and 20 ng/ml epidermal growth factor (EGF), 10 ng/ml basic fibroblast growth factor (bFGF), 10 ng/ml leukocyte migration inhibitory factor (LIF) (all growth factors from Sigma, Saint Louis, Mo.), 11insulin, transferrin, selenium (ITS plus) (BD Biosciences, San Jose, Calif.), 100 units/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine (Mediatech Inc.). In mixed cell cultures, epicardial progenitor cells are distinguishable by their morphology and pattern of growth (e.g., epicardial progenitor cells do not readily mix with other cells in culture; epicardial progenitor cells form spheroids or clusters of spheriods that proliferate upwards into the medium rather than horizontally). Epicardial progenitor cells can be collected from mixed cultures by shaking the culture to release the loosely adherent aggregates and spheroids of stem/progenitor cells.
[0111] Other procedures that may be used for selection of cells of interest include, but are not limited to, density gradient centrifugation, flow cytometry, magnetic separation with antibody-coated magnetic beads, affinity chromatography, cytotoxic agents joined to or used in conjunction with a mAb, including, but not limited to, complement and cytotoxins; and panning with antibody attached to a solid matrix or any other convenient technique. The cells can be selected against dead cells, by employing dyes associated with dead cells such as propidium iodide (PI). Preferably, the cells are collected in a medium comprising (alpha MEM), fetal calf serum (FCS), or bovine serum albumin (BSA) or any other suitable, preferably sterile, isotonic medium. Selected cells of the invention may be employed for the isolation of secreted cellular factors as described herein.
[0112] In one embodiment, selected cells of the invention comprise a purified population of epicardial progenitor cells selected for expression of epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, and Tbx5. Those skilled in the art can readily determine the percentage of cells in a population using various well-known methods, such as fluorescence activated cell sorting (FACS). Preferable ranges of purity in populations comprising selected cells are about 50 to about 55%, about 55 to about 60%, and about 65 to about 70%. More preferably the purity is at least about 70%, 75%, or 80% pure, more preferably at least about 85%, 90%, or 95% pure. In some embodiments, the population is at least about 95% to about 100% selected cells.
[0113] The selected cells may be grown in culture for hours, days, or even weeks during which time their culture medium becomes enriched in one or more secreted cellular factors that support cardiac progenitor cell proliferation, reduce cardiac cell death, preserve cardiac function after an ischemic event, prevent or reduce cardiac damage, increase cardiac function, increase cardiac healing or increase cardiac regeneration. Media enriched for such biologically active agents is termed conditioned media.
[0114] Media and reagents for tissue culture are well known in the art (see, for example, Pollard, J. W. and Walker, J. M. (1997) Basic Cell Culture Protocols, Second Edition, Humana Press, Totowa, N.J.; Freshney, R. I. (2000) Culture of Animal Cells, Fourth Edition, Wiley-Liss, Hoboken, N.J.). Examples of suitable media for incubating mesenchymal stem cells or multipotent stromal cells samples include, but are not limited to, Dulbecco's Modified Eagle Medium (DMEM), RPMI media, Hanks' Balanced Salt Solution (HBSS) phosphate buffered saline (PBS) and other media known in the art. Examples of appropriate media for culturing cells of the invention include, but are not limited to, Dulbecco's Modified Eagle Medium (DMEM), RPMI media. The media may be supplemented with fetal calf serum (FCS) or fetal bovine serum (FBS) as well as antibiotics, growth factors, amino acids, inhibitors or the like, which is well within the general knowledge of the skilled artisan.
[0115] If desired, the epicardial progenitor cells or their progeny is cultured under conditions that maintain the cells in a proliferative state. In one embodiment, the cells are immortalized to enhance their proliferation. Methods for immortalizing a cell are known in the art and include, but are not limited to, expressing in the cell one or more of dominant negative p53, telomerase, beta catenin, notch and/or a transcription factor or other polypeptide that promotes cell proliferation (e.g., stem cell proliferation). The aforementioned polypeptides may be expressed using any vector suitable for expression in an epicardial progenitor cell (e.g., a viral vector).
Formulations
[0116] In one embodiment, a composition of the invention comprises or consists essentially of one or more cellular factors isolated from selected epicardial progenitor cells or their progeny. In particular embodiments, the cellular factor is secreted by an epicardial progenitor cell selected for expression of epicardin, Nkx 2.5, GATA 4, Mef2c, and myocardin polypeptides, polynucleotides, or the cellular progeny of a selected cell. Such cells are cultured according to any method known in the art. In another embodiment, a composition of the invention comprises conditioned media obtained during the culture of such cells that contains one or more biologically active agents secreted by a cell of the invention. If desired, the secreted cellular factors are at least partially purified (e.g., at least about 10%, 25%, 30%, 50%, 75%, 80%, 90%, or 95%) to remove undesired agents present in the culture media. In one embodiment, one or more identified cellular factors (e.g., HGF, VEGF, SDF-1 alpha, and/or IGF-1) is expressed recombinantly and used to supplement a composition of the invention. The biologically active agents present in the condition media, the cells, or a combination thereof, can be conveniently provided to a subject as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may be buffered to a selected pH. Cells and agents of the invention may be provided as liquid or viscous formulations. For some applications, liquid formations are desirable because they are convenient to administer, especially by injection. Where prolonged contact with a tissue is desired, a viscous composition may be preferred. Such compositions are formulated within the appropriate viscosity range. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof.
[0117] Sterile injectable solutions are prepared by compositions comprising a secreted cellular factor isolated from cultures of epicardial progenitor cells in the required amount of the appropriate solvent with various amounts of the other ingredients, as desired. Such compositions may be in admixture with a suitable carrier, diluent, or excipient, such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can also be lyophilized. The compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as REMINGTON'S PHARMACEUTICAL SCIENCE, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation.
[0118] Various additives which enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the cells or agents present in their conditioned media.
[0119] The compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and lacrimal fluid. The desired isotonicity of the compositions of this invention may be accomplished using sodium chloride, or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes. Sodium chloride is preferred particularly for buffers containing sodium ions.
[0120] Viscosity of the compositions, if desired, can be maintained at the selected level using a pharmaceutically acceptable thickening agent, such as methylcellulose. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form, such as a time release form or liquid-filled form). Those skilled in the art will recognize that the components of the compositions should be selected to be chemically inert.
[0121] Compositions comprising secreted cellular factors present in conditioned media (e.g., from the culture of epicardial progenitor cells and/or epicardial progenitor derived mesenchymal cells) are also administered in an amount required to achieve a therapeutic or prophylactic effect. Such an amount will vary depending on the conditions of the culture. Typically, biologically active cellular factors present in the conditioned media will be purified and subsequently concentrated so that the protein content of the composition is increased by at least about 5-fold, 10-fold or 20-fold over the amount or protein originally present in the media. In other embodiments, the protein content is increased by at least about 25-fold, 30-fold, 40-fold or even by 50-fold. Preferably, the composition comprises an effective amount of a cellular factor isolated from an epicardial progenitor cell and/or an epicardial progenitor derived mesenchymal cell.
[0122] The precise determination of what would be considered an effective dose is based on factors individual to each subject, including their size, age, sex, weight, and condition of the particular subject. Dosages can be readily ascertained by those skilled in the art from this disclosure and the knowledge in the art.
[0123] Optionally, the methods of the invention provide for the administration of a composition of the invention to a suitable animal model to identify the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit tissue repair, reduce cell death, or induce another desirable biological response. Such determinations do not require undue experimentation, but are routine and can be ascertained without undue experimentation.
Methods of Delivery
[0124] Compositions comprising one or more cellular factors(e.g., HGF VEGF SDF-1 alpha and IGF-1) present in conditioned media (e.g., agents isolated from a culture of epicardial progenitor cells selected for expression of epicardin, Nkx 2.5, GATA 4, Mef2c, and/or myocardin are provided systemically or directly to a desired site (e.g., a site of tissue damage or ischemic injury). Modes of administration include intramuscular, intra-cardiac, oral, rectal, topical, intraocular, buccal, intravaginal, intracisternal, intra-arterial, intracerebroventricular, intratracheal, nasal, transdermal, within/on implants, e.g., fibers such as collagen, osmotic pumps, or parenteral routes. The term parenteral includes subcutaneous, intravenous, intramuscular, intraperitoneal, intragonadal or infusion.
[0125] The isolated cellular factors can be administered via localized injection, including catheter administration, systemic injection, localized injection, intravenous injection, or parenteral administration. When administering a therapeutic composition of the present invention, it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion). Dosages can be readily adjusted by those skilled in the art (e.g., a decrease in purity may require an increase in dosage). Compositions of the invention can be introduced by injection, catheter, or the like. Compositions of the invention include pharmaceutical compositions comprising cellular factors of the invention and a pharmaceutically acceptable carrier. Administration can be autologous or heterologous. For example, epicardial progenitor cells selected for expression of epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, and Tbx5 can be obtained from one subject, and the CdM from the culture of such cells administered to the same subject or a different, compatible subject.
[0126] If desired, biologically active agents present in conditioned media are incorporated into a polymer scaffold to promote tissue repair, cell survival, proliferation in a tissue in need thereof. Polymer scaffolds can comprise, for example, a porous, non-woven array of fibers. The polymer scaffold can be shaped to maximize surface area, to allow adequate diffusion of nutrients and growth factors to a cell of the invention. Polymer scaffolds can comprise a fibrillar structure. The fibers can be round, scalloped, flattened, star-shaped, solitary or entwined with other fibers. Branching fibers can be used, increasing surface area proportionately to volume.
[0127] Unless otherwise specified, the term polymer includes polymers and monomers that can be polymerized or adhered to form an integral unit. The polymer can be non-biodegradable or biodegradable, typically via hydrolysis or enzymatic cleavage. The term biodegradable refers to materials that are bioresorbable and/or degrade and/or break down by mechanical degradation upon interaction with a physiological environment into components that are metabolizable or excretable, over a period of time from minutes to three years, preferably less than one year, while maintaining the requisite structural integrity. As used in reference to polymers, the term degrade refers to cleavage of the polymer chain, such that the molecular weight stays approximately constant at the oligomer level and particles of polymer remain following degradation.
[0128] Materials suitable for polymer scaffold fabrication include polylactic acid (PLA), poly-L-lactic acid (PLLA), poly-D-lactic acid (PDLA), polyglycolide, polyglycolic acid (PGA), polylactide-co-glycolide (PLGA), polydioxanone, polygluconate, polylactic acid-polyethylene oxide copolymers, modified cellulose, collagen, polyhydroxybutyrate, polyhydroxpriopionic acid, polyphosphoester, poly(alpha-hydroxy acid), polycaprolactone, polycarbonates, polyamides, polyanhydrides, polyamino acids, polyorthoesters, polyacetals, polycyanoacrylates, degradable urethanes, aliphatic polyester polyacrylates, polymethacrylate, acyl substituted cellulose acetates, non-degradable polyurethanes, polystyrenes, polyvinyl chloride, polyvinyl flouride, polyvinyl imidazole, chlorosulphonated polyolifins, polyethylene oxide, polyvinyl alcohol, teflon RTM, nylon silicon, and shape memory materials, such as poly(styrene-block-butadiene), polynorbornene, hydrogels, metallic alloys, and oligo(-caprolactone)diol as switching segment/oligo(p-dioxyanone)diol as physical crosslink. Other suitable polymers can be obtained by reference to The Polymer Handbook, 3rd edition (Wiley, N.Y., 1989).
Screening Assays
[0129] The invention provides methods for identifying cellular factors present in the conditioned media of a cell of the invention (e.g., an epicardial progenitor cell selected for expression of epicardin, Nkx 2.5, Is1-1, GATA 5, WT1, Tbx18, and Tbx5). Such agents include proteins, peptides, polynucleotides, small molecules or other agents that enhance tissue repair or increase cardiac function. Agents thus identified can be used to enhance tissue repair by modulating, for example, the proliferation, survival, or differentiation of cells of the tissue of interest. In one embodiment, agents identified according to a method of the invention reduce apoptosis.
[0130] The test agents of the present invention can be obtained singly or using any of numerous approaches. Such methods will typically involve contacting a population of cells at risk of cell death with a test agent isolated from conditioned media and measuring an increase in survival or a reduction in cell death as a result of the contact. Comparison to an untreated control can be concurrently assessed. Where an increase in the number of surviving cells or a reduction in cell death is detected relative to the control, the test agent is determined to have the desired activity.
[0131] Fractionation of the conditioned media will be necessary to isolate one or more cellular factors having a desired biological activity. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the conditioned media having the desired biological activity. Methods of fractionation and purification of heterogenous extracts are known in the art. If desired, peptides, polynucleic acids, or small compounds shown to be useful agents for enhancing tissue repair are chemically modified according to methods known in the art. Such agents may be characterized for biological activity in using methods known in the art, including animal models of tissue injury and disease (e.g., myocardial infarction, hind limb ischemia, and stroke).
[0132] Once identified, agents having a desired biological activity (e.g., cardioprotective activity) may be recombinantly expressed and used to supplement a therapeutic or prophylactic composition described herein (e.g., conditioned media).
Methods for Evaluating Therapeutic Efficacy
[0133] In one approach, the efficacy of the treatment is evaluated by measuring, for example, the biological function of the treated organ (e.g., cardiac cell function). Such methods are standard in the art and are described, for example, in the Textbook of Medical Physiology, Tenth edition, (Guyton et al., W.B. Saunders Co., 2000). In particular, a method of the present invention, increases the biological function of a tissue or organ by at least 5%, 10%, 20%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, or even by as much as 300%, 400%, or 500%. Preferably, the tissue is cardiac tissue and, preferably, the organ is heart.
[0134] In another approach, the therapeutic efficacy of the methods of the invention is assayed by measuring an increase in cell number in the treated or transplanted tissue or organ as compared to a corresponding control tissue or organ (e.g., a tissue or organ that did not receive treatment). Preferably, cell number in a tissue or organ is increased by at least 5%, 10%, 20%, 40%, 60%, 80%, 100%, 150%, or 200% relative to a corresponding tissue or organ. Methods for assaying cell proliferation are known to the skilled artisan and are described, for example, in Bonifacino et al., (Current Protocols in Cell Biology Loose-leaf, John Wiley and Sons, Inc., San Francisco, Calif.). For example, assays for cell proliferation may involve the measurement of DNA synthesis during cell replication. In one embodiment, DNA synthesis is detected using labeled DNA precursors, such as [.sup.3H]-Thymidine or 5-bromo-2*-deoxyuridine [BrdU], which are added to cells (or animals) and then the incorporation of these precursors into genomic DNA during the S phase of the cell cycle (replication) is detected (Ruefli-Brasse et al., Science 302(5650):1581-4, 2003; Gu et al., Science 302 (5644):445-9, 2003).
[0135] In another approach, efficacy is measured by detecting an increase in the number of viable cells present in a tissue or organ relative to the number present in an untreated control tissue or organ, or the number present prior to treatment. Assays for measuring cell viability are known in the art, and are described, for example, by Crouch et al. (J. Immunol. Meth. 160, 81-8); Kangas et al. (Med. Biol. 62, 338-43, 1984); Lundin et al., (Meth. Enzymol. 133, 27-42, 1986); Petty et al. (Comparison of J. Biolum. Chemilum.10, 29-34, .1995); and Cree et al. (AntiCancer Drugs 6: 398-404, 1995). Cell viability can be assayed using a variety of methods, including MTT (3-(4,5-dimethylthiazolyl)-2,5-diphenyltetrazolium bromide) (Barltrop, Bioorg. & Med. Chem. Lett. 1: 611, 1991; Cory et al., Cancer Comm. 3, 207-12, 1991; Paull J. Heterocyclic Chem. 25, 911, 1988). Assays for cell viability are also available commercially. These assays include but are not limited to CELLTITER-GLO Luminescent Cell Viability Assay (Promega), which uses luciferase technology to detect ATP and quantify the health or number of cells in culture, and the CellTiter-Glo Luminescent Cell Viability Assay, which is a lactate dehyrodgenase (LDH) cytotoxicity assay (Promega).
[0136] Alternatively, or in addition, therapeutic efficacy is assessed by meauring a reduction in apoptosis. Apoptotic cells are characterized by characteristic morphological changes, including chromatin condensation, cell shrinkage and membrane blebbing, which can be clearly observed using light microscopy. The biochemical features of apoptosis include DNA fragmentation, protein cleavage at specific locations, increased mitochondrial membrane permeability, and the appearance of phosphatidylserine on the cell membrane surface. Assays for apoptosis are known in the art. Exemplary assays include TUNEL (Terminal deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling) assays, caspase activity (specifically caspase-3) assays, and assays for fas-ligand and annexin V. Commercially available products for detecting apoptosis include, for example, Apo-ONE Homogeneous Caspase-3/7 Assay, FragEL TUNEL kit (ONCOGENE RESEARCH PRODUCTS, San Diego, Calif.), the ApoBrdU DNA Fragmentation Assay (BIOVISION, Mountain View, Calif.), and the Quick Apoptotic DNA Ladder Detection Kit (BIOVISION, Mountain View, Calif.).
Methods for Evaluating Cardiac Function
[0137] Compositions of the invention may be used to enhance cardiac function in a subject having reduced cardiac function. Methods for measuring the biological function of the heart (e.g., contractile function) are standard in the art and are described, for example, in the Textbook of Medical Physiology, Tenth edition, (Guyton et al., W.B. Saunders Co., 2000). In the invention, cardiac function is increased by at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% relative to the cardiac function present in a naturally-occurring, corresponding tissue or organ. Most advantageously, cardiac function is enhanced or damage is reversed, such that the function is substantially normal (e.g., 85%, 90%, 95%, or 100% of the cardiac function of a healthy control subject). Reduced cardiac function may result from conditions such as cardiac hypertrophy, reduced systolic function, reduced diastolic function, maladaptive hypertrophy, heart failure with preserved systolic function, diastolic heart failure, hypertensive heart disease, aortic and mitral valve disease, pulmonary valve disease, hypertrophic cardiomyopathy (e.g., hypertrophic cardiomyopathy originating from a genetic or a secondary cause), post ischemic and post-infarction cardiac remodeling and cardiac failure.
[0138] Any number of standard methods are available for assaying cardiovascular function. Preferably, cardiovascular function in a subject (e.g., a human) is assessed using non-invasive means, such as measuring net cardiac ejection (ejection fraction, fractional shortening, and ventricular end-systolic volume) by an imaging method such echocardiography, nuclear or radiocontrast ventriculography, or magnetic resonance imaging, and systolic tissue velocity as measured by tissue Doppler imaging. Systolic contractility can also be measured non-invasively using blood pressure measurements combined with assessment of heart outflow (to assess power), or with volumes (to assess peak muscle stiffening). Measures of cardiovascular diastolic function include ventricular compliance, which is typically measured by the simultaneous measurement of pressure and volume, early diastolic left ventricular filling rate and relaxation rate (can be assessed from echoDoppler measurements). Other measures of cardiac function include myocardial contractility, resting stroke volume, resting heart rate, resting cardiac index (cardiac output per unit of time [L/minute], measured while seated and divided by body surface area [m.sup.2])) total aerobic capacity, cardiovascular performance during exercise, peak exercise capacity, peak oxygen (O.sub.2) consumption, or by any other method known in the art or described herein. Measures of vascular function include determination of total ventricular afterload, which depends on a number of factors, including peripheral vascular resistance, aortic impedance, arterial compliance, wave reflections, and aortic pulse wave velocity, Methods for assaying cardiovascular function include any one or more of the following: Doppler echocardiography, 2-dimensional echo-Doppler imaging, pulse-wave Doppler, continuous wave Doppler, oscillometric arm cuff, tissue Doppler imaging, cardiac catheterization, magnetic resonance imaging, positron emission tomography, chest X-ray, X ray contrast ventriculography, nuclear imaging ventriculography, computed tomography imaging, rapid spiral computerized tomographic imaging, 3-D echocardiography, invasive cardiac pressures, invasive cardiac flows, invasive cardiac cardiac pressure-volume loops (conductance catheter), non-invasive cardiac pressure-volume loops.
Kits
[0139] Compositions comprising a cell of the invention (e.g., an epicardial progenitor cell selected for expression of epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, and Tbx5) or a composition comprising biologically active agents (e.g., HGF VEGF SDF-1 alpha and IGF-1) present in conditioned media of such cells is supplied along with additional reagents in a kit. The kits can include instructions for the treatment regime, reagents, equipment (test tubes, reaction vessels, needles, syringes, etc.) and standards for calibrating or conducting the treatment. The instructions provided in a kit according to the invention may be directed to suitable operational parameters in the form of a label or a separate insert. Optionally, the kit may further comprise a standard or control information so that the test sample can be compared with the control information standard to determine if whether a consistent result is achieved.
[0140] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook, 1989); Oligonucleotide Synthesis (Gait, 1984); Animal Cell Culture (Freshney, 1987); Methods in Enzymology Handbook of Experimental Immunology (Weir, 1996); Gene Transfer Vectors for Mammalian Cells (Miller and Calos, 1987); Current Protocols in Molecular Biology (Ausubel, 1987); PCR: The Polymerase Chain Reaction, (Mullis, 1994); Current Protocols in Immunology (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
[0141] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
EXAMPLES
Example 1
Isolated Cardiac Progenitor Cells are Capable of Epithelial to Mesenchymal Transformation when Expanded in Conditioned Media
[0142] Adult human atrial stem/progenitor cells were isolated from right atrial biopsies. The right atrial appendage, commonly removed to install a cardiopulmonary pump during bypass surgery, provided ample material to isolate atrial stem/progenitor cells from 11 out of 12 donors. Adult human atrial stem/progenitor cells were successfully isolated from 12 out of 13 donors (Table 1).
TABLE-US-00001 TABLE 1 Patient Data for Epicardial Progenitor Cell Isolations. Sex Age HTN DM CAD MR AS LVEF M 47 + + + 0.45 M 59 + + NI M 57 + NI M 52 + NI M 57 + NI F 53 + + NI M 80 + + NI F 72 + + 0.45 M 53 + + + NI M 78 + NI F 72 + + NI F 60 + + NI Abbreviations: HTN, hypertension; DM, diabetes mellitus; CAD, coronary artery disease; MR, mitral regurgitation; AS, aortic stenosis; LVEF, left ventricular ejection fraction.
[0143] Right atrial appendages were obtained from consenting cardiac bypass patients according to an Institutional Review Board (IRB) protocol that was approved by the University of Vermont (UVM). The appendages were transferred from the hospital to the UVM Stem Cell Core on ice in 50 ml conical tubes containing explant medium: alpha MEM (Invitrogen, Carlsbad, Calif.), 10% fetal calf serum (FCS) (lot selected for rapid growth of hMSCs, Atlanta Biologicals, Lawrenceville, Ga.), 100 units/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine (Mediatech Inc., Hendron, Va.). In the cell culture hood, the tissue was immediately rinsed in phosphate buffered saline (1 PBS) and any extracardiac fat was manually removed with fine scissors. The remaining tissue was transferred to a 100 cm.sup.2 dish (Nunc, Thermo Fisher Scientific, Rochester, N.Y.) containing phosphate buffered saline (1 PBS) supplemented with 1 mg/mL collagenase/dispase (Roche Applied Science, Indianapolis, Ind.). The tissue was minced into approximately 1 mm.sup.3 pieces using sterile scalpel blades (#23, World Precision Instruments, Sarasota, Fla.). The dish was placed into a sterile 37 C. humidified cell culture incubator (Thermo Forma, 5% CO.sub.2) for 1.5 hours, with shaking every 10 minutes. The resulting tissue digest was collected and centrifuged at 600g for 5 minutes. The pellet was resuspended and washed in 25 mls of explant medium and centrifuged again. The final pellet was resuspended in 20 ml of explant medium and the digested fragments were split between 2 uncoated 100 cm.sup.2 dishes. After 2-3 days, the dishes were supplemented by the addition of 5 ml of explant medium and then left undisturbed to allow for the adherence of tissue fragments. Following 5-7 days, when fibroblast/endothelial outgrowth from the explants had almost reached confluence, the dishes were washed once with phosphate buffered saline (1 PBS) and the explant medium was changed to a medium that favored stem/progenitor cell growth: DMEM/F12 (Invitrogen) with 3% FCS (Atlanta Biologicals) and 20 ng/ml epidermal growth factor (EGF), 10 ng/ml basic fibroblast growth factor (bFGF), 10 ng/ml leukocyte migration inhibitory factor (LIF) (all growth factors from Sigma, Saint Louis, Mo.), 1 insulin, transferrin, selenium (ITS plus) (BD Biosciences, San Jose, Calif.), 100 units/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine (Mediatech Inc.). After 2-3 days, areas of stem/progenitor cells were observed proliferating in between the fibroblasts/endothelial cells.
[0144] The stem/progenitor cells were distinguishable by morphology. They did not mix with the other cells in the dishes, and formed spheroids and bunches of grapes as they divided upwards into the medium rather than horizontally. By shaking the dishes and washing once with calcium- and magnesium-free PBS, the loose aggregates and spheroids of stem/progenitor cells were collected, centrifuged at 600g for 5 minutes, resuspended in Claycomb expansion medium (SAFC Biosciences, Sigma) with 10% fetal calf serum (FCS), 100 units/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine, and transferred to new dishes. Following adherence to culture plastic, the majority of the atrial stem/progenitor cells underwent epithelial to mesenchymal transformation (EMT) into mesodermal progenitors and precursor cells as they expanded in the high serum medium.
[0145] The isolation method yielded relatively pure cultures of proliferating epicardial progenitor cells that expressed markers of epicardial and cardiac stem/progenitor cells such as epicardin, Nkx 2.5, Isl-1, GATA 5, WT1, Tbx18, and Tbx5 (
[0146] An alternative method was also developed (method#2) by direct culture of human epicardium dissected from the surface of right atrial appendages, which produced proliferating epicardial progenitor-like cells like those obtained using the method above (method#1).
[0147] The epicardial progenitor cells were maintained as epithelial cultures in stem/progenitor cell medium or were induced to undergo epithelial to mesenchymal transformation into mixtures of transit-amplifying precursor cells following adherence to culture plastic. After plating onto charged or coated cell ware in medium containing 10% fetal calf serum (FCS), the majority of the atrial stem/progenitor cells underwent epithelial to mesenchymal transformation into mesodermal progenitors and precursor cells as they expanded in the high serum medium. Some of the precursor cells expressed contractile proteins characteristic of myocytes, while others expressed markers of smooth muscle cells or endothelial cells (
[0148] Cell surface phenotyping demonstrated that multiple cell surface antigens typical of bone marrow MSCs such as CD105, CD90, CD73, CD54, CD49d, CD44, and CD29 were expressed by the EDPCs (
[0149] In an attempt to replace cardiac cells after myocardial infarction, epicardial precursor cells cultured for 2 passages were administered to 3 different strains of immunodeficient mice (NOD/SCID, NOD/SCID/beta 2m.sup./, NOD/SCID/IL2r.sup./) by either intramuscular injection into border zone areas or by intra-arterial (left ventricle lumen) administration 1 day after myocardial infarction. The intramuscular cell injections were associated with a persistent but low level of human cell engraftment in the left ventricle (LV) wall 1 week after injection. The intra-arterial infusion of cells after myocardial infarction (MI) led to micro vascular emboli and sudden cardiac death.
Example 2
Conditioned Media Produced from Epicardial Progenitor Cells Preserved Cardiac Function After Myocardial Infarction
[0150] In cardiac development epicardial cells provide supportive and multifaceted roles. To determine whether agents present in conditioned media secreted by expanded epicardial precursor cells could provide cardioprotection or promote cardiac regeneration after myocardial infarction, a mouse model of myocardial infarction (MI) was used. Due to the human origin of the epicardial progenitor cells, immunodeficient (NOD/SCID) mice were used for treatment with CdM.
[0151] To prepare conditioned media from human atrial progenitor cells, atrial progenitor cells cultured for 3 passages were grown in Claycomb expansion medium on 150 cm.sup.2 dishes (Nunc). When the cells reached 70-90% confluence, the plates were washed twice with PBS and serum-free alpha minimal essential media (MEM) was placed on the cells (20 mls per plate). After 48 hours of incubation, the conditioned media was collected, filtered (0.2 m PES membrane, Nalgene MF75, Rochester, N.Y.), and concentrated 30-fold with a commercially available diafiltration system (Labscale TFF diafiltration system) using filters with a 5 kD cut-off (Millipore, Bedford, Mass.). Medium components above 5 kD were concentrated (base medium components and salts remained at 1). One ml vials of conditioned media were frozen and stored at 80 C.
[0152] Groups of immunodeficient (NOD-SCID) and immunocompetent (C57 B16/J) mice underwent coronary ligation surgery during which the ligature remained in place for 4 hours. Following recovery of the animal after initial suture placement, the mouse was again anesthetized, intubated, and surgically opened at 4 hours post-ligation. Once the intact suture and area of blanching were confirmed and reperfusion was accomplished, Human EPI CdM (30, 200 l) warmed to 37 C. was delivered to the entire cardiovascular arterial tree by injecting the solution into the lumen of the left ventricle (LV). This method was designed to deliver a maximum amount of conditioned media to the injured myocardium by employing the naturally existing arterial network of the heart, which is supplied by the immediate portion of the aorta. Using a 30.5 gauge needle inserted below the great cardiac vein (LV apex) at an angle 45 to the myocardium, 200 l of 30 conditioned media warmed to 37 C. was slowly injected over a period of 1 minute. Control animals received Alpha Minimum Essential Medium (vehicle control, 200 l) in the same manner. All animals were randomized to treatment at the end of the first surgery (after ligation) and prior to revascularization. Following treatment with either conditioned media or vehicle, the needle was removed and the intercostals were rejoined using 6.0 chromic gut suture (Ethicon, Johnson and Johnson, Inc., Livingston, UK). The lungs reinflated, and the overlying dermis was rejoined with 6.0 nylon suture. Sham mice underwent all procedures except that the suture was passed under the left anterior descending coronary artery (LAD) and not tied. All mice were then recovered to an ambulatory state and transferred to the vivarium for the remaining duration of the experiment.
[0153] At 1 week after myocardial infarction, dramatic improvements in cardiac function were observed by echocardiography (ECHO) in conditioned media-treated mice compared with controls that received vehicle infusion. There was a highly significant difference in both the percentage of fractional shortening and anterior wall thickness during systole and diastole for immunodeficient mice treated with conditioned media compared with controls (percent fractional shortening (FS), p0.001; AWT (S-D), p0.001;
[0154] Assessment of surviving ventricular myocardium after myocardial infarction by creatine kinase (CK) activity assays demonstrated a profound rescue of cardiac tissue and a highly significant decrease in the percentage of myocardial infarction in the CdM treatment group (
[0155] The conditioned media from the human epicardial progenitor cells also rescued left ventricular myocardium in immunocompetent mice. Representative M Mode images and electrocardiograms (ECG) for sham-operated, conditioned media-treated, and alpha MEM-treated (control) mice are shown in
Example 3
Conditioned Media From the Human Epicardial Progenitor Cells Contains Growth Factors that Reduce Cardiac Necrosis Following Myocardial Infarction
[0156] To examine the timing and nature of cardioprotection provided by conditioned media from the human epicardial progenitor cells (EPI CdM), groups of immunocompetent mice were subjected to the 4 hour ischemia/reperfusion myocardial infarction (MI) model, treated with EPI CdM at the time of reperfusion, and euthanized after 24 hours to determine the numbers of cardiac cells undergoing apoptosis or necrosis. Similar to the results reported above, immunohistochemical assays specific for apoptotic cells (single-stranded DNA, ssDNA) minimal numbers of apoptotic cells were observed in either control hearts or those treated with EPI CdM at 24 hours after ischemia and reperfusion (
[0157] To characterize the cardioprotective factors contained in EPI CdM, ELISAs for Hepatocyte Growth Factor (HGF), Vascular Endothelial Growth Factor (VEGF), Insulin-like Growth Factor (IGF-1), and Stromal-Derived Factor 1 (SDF-1 alpha) were performed on EPI CdM (
[0158] To examine whether EPI CdM from donors of varying ages would provide cardioprotection, cell protection assays were performed under conditions of simulated ischemia (low glucose medium,1% oxygen, for 24 or 48 hrs). Compared with incubation in alpha MEM (vehicle), unconcentrated EPI CdMs generated from precursor cells of donors from 52 to 80 years of age all significantly protected primary human cardiac endothelial cells from simulated ischemic injury for 24 hours (
[0159] To determine the relative importance of HGF in the cardioprotection conferred by EPI CdM in vivo, pulldowns (PD) were performed with biotinylated antisera specific to HGF or biotinylated nonspecific IgG (control). By ELISA, incubation in strepavidin-agarose and centrifugation removed 100% of HGF from EPI CdM (
Example 4
EPI CdM Preserves Cardiac Tissue After MI in a Large Animal Model (Swine)
[0160] To determine whether human EPI CdM would also preserve cardiac tissue after MI in a large animal model, studies with 10 adult conventional farm swine were carried out (65 kgs). Under anesthesia and with fluoroscopic guidance, a balloon catheter was advanced and inflated to completely occlude the LAD for 1 hour prior to revascularization. At the time of reperfusion, pigs in the control group received additional contrast dye to confirm re-flow (n=5). Alternatively, pigs in the treatment groups received 16 mls of 20 EPI CdM and contrast (n=3) or 16 mls of 25 EPI CdM and contrast (n=2), by infusing 8 mls of EPI CdM directly into the LCAD at the location of the deflated balloon, and an additional 8 mls into the left main coronary artery from the guide catheter. The EPI CdM was infused over 3-5 minutes. No anti-arrhythmic drugs were used and there were no adverse events following any of the treatments. All pigs were euthanized at 24 hours after treatment. The hearts were removed and cut transversely from apex to base (1 cm slices), stained by 2,3,5-Triphenyltetrazolium chloride (TTC), and digitally photographed (
Example 5
EPI CdM Provides Vasoprotection and Prevents Vascular Rhexis after MI and Reperfusion
[0161] To determine whether EPI CdM treatment was vasoprotective in the context of MI and reperfusion, assays of vascular integrity were performed at 24 hrs after MI, reperfusion and treatment. As HGF depletion only partially reduced the benefit of EPI CdM treatment, multiple factors present in EPI CdM could work in concert to preserve vascular integrity after MI and reperfusion. Using the same biotinylated antibody PD strategy to remove multiple growth factors simultaneously, HGF, VEGFA, and SDF-1 alpha were depleted from 30 EPI CdM (3 GF PD). Non-specific IgG-PD control EPI CdM was formulated to match the concentrations of IgG used for specific PD.
[0162] To assess microvascular rhexis, FITC-albumin (FITC-Alb) was injected by tail vein 2 hrs before euthanization. Serial sections were cut from each heart from apex to base and used to determine the mural volume containing extravasated FITC-Alb. TUNEL assays performed on the same sections demonstrated that FITC-positive areas of the LV correlated with areas of cellular necrosis (
TABLE-US-00002 TABLE 2 Correlation of TUNEL positive cells in left ventricle with areas containing FITC-Alb at 24 hr after MI and reperfusion Outside Border Inside (%) (%) (%) Alpha MEM A 0 0 100 B 0 0 100 C 0 0 100 D 25 0 100 IgG-PD A 16.7 40 100 B 0 50 100 C 0 0 100 D 0 0 100 E 0 25 100 F 0 33.3 100 3 GF PD A 33.3 33.3 100 B 0 20 100 C 0 0 100 D 0 25 100 E 0 0 100 Serial sections spanning the infarct zone were scored for presence or absence of TUNEL positive cells outside the FITC-positive area, in border regions of FITC staining, and inside the FITC-positive area. Border regions were defined by taking photomicrographs that contained 50% of FITC-positive myocytes and 50% FITC-negative myocytes. Data indicate the percentage of sections that contained at least a single TUNEL-positive cell in a particular area for a given animal. For each animal, 4 to 5 sections were scored that spanned the region of infarction.
[0163] Compared with Alpha MEM treatment, IgG-PD treatment significantly reduced the LV mural volume of FITC-Alb, indicating that EPI CdM treatment protects against vascular rhexis that occurs after reperfusion (
[0164] For an independent measure of vascular rhexis, blood serum samples obtained from the same mice at 24 hrs after reperfusion were assayed for the long pentraxin, PTX3, a marker of inflammation and vasculopathy after MI.sup.29. PTX3 expression increases in neutrophils, macrophages and endothelial cells after MI and is released by damaged/dying endothelial cells within hours of reperfusion following myocardial ischemia.sup.29.
[0165] By ELISA, serum PTX3 levels increased markedly at 24 hrs after reperfusion in Alpha MEM control animals compared with sham-operated mice that had suture passed under the LAD but were not ligated (
[0166] In patients with acute MI, concentrations of PTX3 in blood predict mortality.sup.31. Therefore, the results with PTX3 are consistent with a novel and clinically relevant approach of putative value for treatment after MI based on human EPI CdM or its ligands. Without intending to be bound to theory, EPI CdM treatment after MI prevents vascular rhexis, and permits reperfusion to salvage damaged cardiomyocytes through microvasculature.
[0167] Most studies that treat animal models of acute MI with adult stem/progenitor cells.sup.6,32, 33 or conditioned medium.sup.9,10,24 employ a persistent coronary ligation.sup.6,9,10,24,32,33, treat by intramuscular injection.sup.6,9,10,24,32,33, and treat very early after MI (e.g. immediately.sup.6,24,32, 30 min.sup.9 or 1.sup.hr10,33 after ligation). The studies described herein, were performed under clinical circumstance, in which a period of myocardial ischemia is followed by revascularization. Despite a relatively long 4 hr interval of ischemia, intra-arterial administration of EPI CdM at the time of reperfusion was sufficient to provide substantial preservation of cardiac tissue and function. Because of the small size of the murine heart, EPI CdM was injected into the left ventriclular lumen for delivery into the coronary arterial blood after reperfusion. Without intending to be bound to theory, one may deliver EPI CdM or a defined combination of its ligands (with stabilizing carriers such as albumin) directly into coronary arteries at the time of percutaneous coronary intervention to obtain benefits in patients. Recently, CdM from porcine bone marrow MSCs was delivered through an intracoronary infusion catheter after 60 min of myocardial ischemia in pigs.sup.34.
[0168] Without intending to be bound to theory, EPI CdM treatment has the potential to reduce the no re-flow phenomenon commonly observed after reperfusion in animal models.sup.35,36 and in patients with MI.sup.37. No re-flow refers to compromised distal myocardial perfusion despite restoration of patency in macroscopic vessels. After MI and recanalization of an infarct-related artery, myocardial perfusion can become progressively impaired, despite relief of the coronary occlusion.sup.38. The extent of no re-flow is known to predict infarct expansion.sup.36 and the results herein indicate that EPI CdM treatment rapidly reduces myocardial necrosis and infarct expansion after MI by preventing the progression of vascular rhexis that occurs following reperfusion.
[0169] The results described in the Examples above were obtained using the following methods and materials.
Isolation of Adult Human Epicardial Progenitor-Like Cells and EMT into Precursor Cells
[0170] Right atrial appendages were obtained from consenting cardiac bypass patients in a protocol that was approved by the IRB of the University of Vermont. The appendages were transferred from the hospital to the UVM Stem Cell Core on ice in 50 ml conical tubes containing explant medium: Alpha MEM (Invitrogen, Carlsbad, Calif.), 10% FCS (lot selected for rapid growth of hMSCs, Atlanta Biologicals, Lawrenceville, Ga.), 100 units/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine (Mediatech Inc., Hendron, Va.).
Method #1
[0171] In a cell culture hood, appendages were immediately rinsed in 1 PBS and any extracardiac fat was manually removed with fine scissors. The remaining tissue was transferred to a 100 cm.sup.2 dish (Nunc, Thermo Fisher Scientific, Rochester, N.Y.) containing 1 PBS supplemented with 1 mg/mL collagenase/dispase (Roche Applied Science, Indianapolis, Ind.) in which it was minced into approximately 1 mm.sup.3 pieces with sterile scalpel blades (#23, World Precision Instruments, Sarasota, Fla.). The dish was placed into a sterile 37 C. humidified cell culture incubator (Thermo Forma, 5% CO.sub.2) for 1.5 hours, with shaking every 10 minutes. The resulting tissue digest was collected and centrifuged at 600g for 5 min. The pellet was resuspended and washed in 25 mls of explant medium and centrifuged again. The final pellet was resuspended in 20 mls of explant medium and the digested fragments were split between 2 uncoated 100 cm.sup.2 dishes. After 2-3 days, the dishes were supplemented by the addition of 5 mls of explant medium and then left undisturbed to allow for the adherence of tissue fragments.
[0172] After 5-7 days, when fibroblast outgrowth from the explants had nearly reached confluence, the dishes were washed once by PBS and the explant medium was changed to a medium that favored stem/progenitor cell growth: DMEM/F12 (Invitrogen) with 3% FCS (Atlanta Biologicals) and 20 ng/ml EGF, 10 ng/ml bFGF, 10 ng/ml LIF (all growth factors from Sigma, Saint Louis, Mo.), 1 ITS plus (BD Biosciences, San Jose, Calif.), 100 units/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine (Mediatech Inc.) .
[0173] After 2-3 days, areas of epicardial progenitor cells were observed proliferating in between the fibroblasts. The progenitor cells were morphologically distinguishable from surrounding cell types, did not mix with surrounding cells, and formed floating spheroids and cell aggregates that resembled bunches of grapes as they divided upwards into the medium rather than horizontally. By shaking the dishes and washing once with calcium- and magnesium-free PBS, the floating progenitor cells were collected. The resulting cells (epicardial progenitor-like cells) were cultured in petri dishes (uncharged) in stem/progenitor growth medium for up to several weeks (in some cases up to 2 months).
[0174] The epicardial nature of the cells was clear as all of the cells were epithelial and expressed Keratin proteins. Under these conditions, the epithelial cells continued to produce floating cells. To induce EMT, the epicardial cells were collected, centrifuged at 600g for 5 min, resuspended in Claycomb medium (SAFC Biosciences, Sigma) with 10% FCS, 100 units/ml penicillin, 100 g/ml streptomycin, and 2 mM L-glutamine, and transferred to new dishes. Following adherence to culture plastic, the majority of the progenitor-like cells underwent EMT within 3 days into precursor cells and expanded rapidly in the Claycomb medium with 10% FCS.
[0175] Whether long-term growth in the stem/progenitor cell medium (low serum with growth factors) and in uncoated petri dishes were important to generate the precursor cells at the next stage of culture was examined. This was not the case as primary floating epithelial progenitor cells obtained directly from initial the feeder layer cultures could also undergo EMT when plated onto typical positively-charged cell culture dishes and incubated in the Claycomb medium with 10% FCS. Furthermore, immunocytochemistry, cell surface phenotyping, and ELISA data indicated that the precursor cells derived from EMT did not differ whether the cells were rapidly induced to undergo EMT or were maintained for several weeks as epithelial progenitor cells and then induced to undergo EMT.
Method #2
[0176] A faster method was developed involving isolating EDPCs by direct culture of human epicardium dissected from the surface of right atrial appendages (
Immunocytochemistry and Immunohistochemistry
[0177] Atrial precursor cells were cultured for 2 days in Claycomb expansion medium in Labtek chamber slides (Nunc). They were washed once with PBS and fixed by a 10 minute incubation in 4% paraformaldehyde in phosphate buffered saline (PBS). Following several PBS washes, the chamber slides were blocked for 1 hour with 5% goat serum with 0.4% Triton-X 100 in PBS. Primary antibodies were diluted into blocking solution, placed on the cells, and incubated overnight at 4 C. (see below, antibody list and dilutions). Following 3 PBS washes, secondary antisera was applied in blocking buffer and incubated for 1 hour at room temperature. After 3 more washes, slides were mounted and coverslipped (Vectashield with DAPI, Vector laboratories, Burlingame, Calif.) and viewed with an epifluorescence microscope (Leica DM6000B with DFC350 FX camera). Double immunohistochemistry was performed as in Spees et al. 2008 (FASEB J. April; 22(4):1226-36).
Primary Antisera:
[0178]
TABLE-US-00003 Smooth muscle myosin heavy chain, SMMS-1, Dako, 1:100 Carpinteria, CA Von Willebrand Factor, F8/86, Dako 1:50 Human STRO-1, MAB1038, R and D Systems, Minneapolis, 5 g/ml MN GATA 4, G-4, Santa Cruz Biotechnology, Santa Cruz, CA 1:100 Nkx 2.5, H-114, Santa Cruz 1:50 Cytokeratin (mixture), C2562, Sigma 1:100 Alpha smooth muscle actin, clone 1A4, A2547, Sigma 1:800 Sarcomeric actin, A2172, Sigma 1:500 SERCa2 ATPase, clone IID8, S1439, Sigma 1:400 Cardiac calsequestrin, C2491, Sigma 10 g/ml Connexin 43, C6219, Sigma 1:400 Connexin 40, 36-4900, Zymed Laboratories (Invitrogen) 2 g/ml Epicardin (TCF21), ab32981, Abcam 1:100 Myosin light chain phospho S20, ab2480, Abcam 1:100 Vimentin, E2944, Spring Bioscience, Freemont, CA 1:200
Secondary Antisera:
[0179]
TABLE-US-00004 Goat anti-mouse IgG ALEXA 594, Molecular Probes, Invitrogen 1:800 Goat anti-mouse IgG ALEXA 488, Molecular Probes, Invitrogen 1:500 Goat anti-mouse IgM ALEXA 594, Molecular Probes, Invitrogen 1:800 Goat anti-rabbit IgG ALEXA 594, Molecular Probes, Invitrogen 1:800 Goat anti-rabbit IgG ALEXA 488, Molecular Probes, Invitrogen 1:500 Donkey anti-goat IgG ALEXA 594, Molecular Probes, Invitrogen 1:800
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
[0180] Total RNA was isolated from cell pellets using a commercial kit (RNAqueous, Ambion, Austin, Tex). To avoid the possibility of contaminating DNA, the total RNA samples were treated with DNase prior to reverse transcription (TURBO DNase, Ambion). Reverse transcription was performed with Superscript III (Invitrogen) in the presence of RNase inhibitor (RNaseOUT, Invitrogen). PCR was carried out using an Eppendorf Master Cycler EP thermal cycler. Control RT-PCR reactions included template samples in which the reverse transcriptase was omitted from the single strand synthesis reaction. Primer sequences and annealing temperatures are listed below. Target sequences were denatured at 94 C. (2 minutes) followed by 30 amplification cycles of 94 C. (30 seconds), anneal temp (30 seconds), and 72 C. (45 seconds). The last PCR step extended the products at 72 C for 1 minute. RT-PCR products were analyzed on 1% agarose gels.
TABLE-US-00005 PCRPrimers: Cardiacalphaactin Tm C. Forward5 TGCTGATCGTATGCAGAAGG3 (SEQIDNO:1) 54.8 Reverse5 GCTGGAAGGTGGACAGAGAG3 (SEQIDNO:2) 57.3 MLC4 Forward5 AAGATCACCTACGGCCAGTG3 (SEQIDNO:3) 56.8 Reverse5 CCCTCCACGAAGTCCTCATA3 (SEQIDNO:4) 55.8 SERCA2a Forward5 GGTGCTGAAAATCTCCTTGC3 (SEQIDNO:5) 54.3 Reverse5 ATCAGTCATGCACAGGGTTG3 (SEQIDNO:6) 55.3 MLC2a Forward5 GTCTTCCTCACGCTCTTTGG3 (SEQIDNO:7) 55.7 Reverse5 CCACCTCAGCTGGAGAGAAC3 (SEQIDNO:8) 57.3 MLC2v Forward5 GGTGCTGAAGGCTGATTACGTT3 (SEQIDNO:9) 56.7 Reverse5 TATTGGAACATGGCCTCTGGAT3 (SEQIDNO:10) 56.1 GAPDH Forward5 GCTGAGTACGTCGTGGAGT3 (SEQIDNO:11) 56.6 Reverse5 CACCACTGACACGTTGGCA3 (SEQIDNO:12) 58.3 Cx43 Forward5 AGGCGTGAGGAAAGTACCAA3 (SEQIDNO:13) 56.2 Reverse5 ACACCTTCCCTCCAGCAGTT3 (SEQIDNO:14) 58.7 Myocardin Forward5 GGACTGCTCTGGCAACCCAGTGC3 (SEQIDNO:15) 64.7 Reverse5 CATCTGACTCCGGGTCATTTGC3 (SEQIDNO:16) 61.9 vWF Forward5 AAGAACCGAAGTCCCAGGAGAAAGG3 (SEQIDNO:17) 61.5 Reverse5 AGATTTCAGAGGCGTTCTAAAACTCA3 (SEQIDNO:18) 58.4 Smoothmusclealphaactin Forward5 GAAGAGGACAGCACTGCCT3 (SEQIDNO:19) 57.1 Reverse5 CTGATAGGACATTGTTAGCATA3 (SEQIDNO:20) 49.6 GATA4 Forward5 GACGGGTCACTATCTGTGCAAC3 (SEQIDNO:21) 57.8 Reverse5 AGACATCGCACTGACTGAGAAC3 (SEQIDNO:22) 56.8 GATA5 Forward5 CACAAGATGAATGGCGTCAA3 (SEQIDNO:23) 53.5 Reverse5 CTTCCGTGTCTGGATGCTTT3 (SEQIDNO:24) 55.2 Tbx18 Forward5 GGGGAGACTTGGATGAGACA3 (SEQIDNO:25) 56.1 Reverse5 AGCAAGAGGAGCCAGACAAA3 (SEQIDNO:26) 56.5 Tbx5 Forward5 ACGTGCTCAGTTTTGCCTCT3 (SEQIDNO:27) 57.2 Reverse5 CAGTTTTGTGTTGGCATTGG3 (SEQIDNO:28) 53.0 Wt1 Forward5 CGGGGGTGAATCTTGTCTAA3 (SEQIDNO:29) 54.2 Reverse5 CCTGGACCATCCCCTATTTT3 (SEQIDNO:30) 54.2 Isl-1 Forward5 GTAGAGATGACGGGCCTCAG3 (SEQIDNO:31) 56.9 Reverse5 TTTCCAAGGTGGCTGGTAAC3 (SEQIDNO:32) 55.3 Mef2C Forward5 CTGGGAAACCCCAACCTATT3 (SEQIDNO:33) 54.7 Reverse5 GCTGCCTGGTGGAATAAGAA3 (SEQIDNO:34) 55.1
Characterization of Cell Surface Epitopes
[0181] Pellets of 0.510.sup.6 to 110.sup.6 cells were suspended in 0.5 ml PBS and were incubated for 30 minutes at 4 C. with monoclonal mouse anti-human antibodies that were pre-titered for flow cytometry. All antibodies except those against CD133 (Miltenyi Biotech) and CD105 and NG2 (Beckman Coulter, Miami, Fla.) were purchased from BD Biosciences Pharmingen (San Diego, Calif.). After labeling, the cells were washed twice with PBS and analyzed by closed-stream flow cytometry (LSR II, Becton Dickinson, Franklin Lakes, N.J.).
Pulldown (PD) of Growth Factors from EPI CdM
[0182] For pulldown (PD) of HGF from EPI CdM, 2 g of biotinylated human HGF antisera in 100 ul of PBS was added to 1 ml of 30 EPI CdM and incubated at 4 C. overnight. Separate incubations were performed with 2 g of biotinylated non-specific IgG to produce control 30 EPI CdM. For simultaneous PD of 3 growth factors from EPI CdM, 2 g each of biotinylated anti-HGF, anti-VEGF, anti-SDF, or biotinylated IgG (for control) in 100 ul of PBS were added (in combination) to 1 ml of 30 EPI CdM and incubated at 4 C. overnight. The following day 0.1 ml of 50% suspension Streptavidin Agarose resin (Pierce, Thermo Scientific) in PBS was added to each sample and incubated for 2 h at 4 C. with slow rotation. Supernatants were removed after a centrifugation to remove agarose, filtered through 0.22 um syringe filters (Acrodisk) and stored frozen until use. Biotinylated antisera were obtained from R and D Systems.
Myocardial Infarction
[0183] Male mice at 8 weeks of age underwent ischemia-reperfusion myocardial infarction (MI-IR) surgery (immunodeficient mice: NOD-SCID, NOD-SCID IL2R.sup./, and NOD-SCID 32.sup./, Jackson Labs, Bar Harbor, Me.; immunocompetant mice, C57 b16/J, Taconic, Hudson, N.Y.). Immunodeficient mice were maintained on a Sulfa-Trim diet and were housed in a standard barrier facility environment. Any mice with abnormalities in weight, general health, or cardiac health were not included in the study. Mice were also not included in the study if they did not survive the initial myocardial infarction surgery, did not achieve a successful myocardial infarction (as determined by blanching observed at time of treatment), or died during treatment application. Following all procedures, mice were given analgesia (buprenorphine, 0.05-0.1 mg/kg i.p.) and monitored for signs of distress until termination of the study. All procedures were done in accordance with the University of Vermont IACUC (protocol 08-016).
[0184] For the MI-IR surgery, mice were anesthetized using 2-4% IsoFlurane, shaved, weighed, intubated, and then maintained for the duration of the procedure on a sterile surgical field using a mechanical ventilation system (MiniVent, Harvard Apparatus, Holliston, Mass.). Throughout the surgery and during the recovery period, body temperatures were maintained with a heated water pad system (Gaymar T-Pump TP-500, Gaymar Industries, Orchard Park, N.Y.). Viewing the chest through a dissecting microsope (Stemi 2000-C, Carl Zeiss Microlmaging, Thornwood, N.Y.) a dermal incision was made, the underlying fascia were removed, and the thoracic musculature was retracted to expose the left ribcage. Next the intercostal muscles were retracted and the outer (parietal or visceral) pericardium was removed to expose the left coronary artery descending (LCAD). The LCAD was then ligated with 8.0 nylon suture (Henry Schein, Melville, N.Y.) and blanching within the myocardium of the left ventricle was noted. Finally, the intercostals were rejoined using a 6.0 nylon suture (Henry Schein), the lungs were reinflated, and overlying dermis rejoined with a 6.0 nylon suture. All mice were recovered to an ambulatory state prior to any subsequent treatment procedure, including reperfusion.
[0185] All surgical attempts and outcomes were extensively recorded, including the location of LCAD, suture placement (usually 2.0-3.0 mm from left atrial apex), area of blanching observed, and any complications noted. A surgery was considered successful if the mouse survived the initial myocardial infarction procedure, the suture remained in place for the appropriate time (4 hours), and tissue blanching below the suture was observed from initial ligation until reperfusion and/or treatment administration. Reperfusion was considered accomplished with a return of color to the previously blanched myocardium. The survival rate for the 4 hr MI-I/R surgery was 90%.
Treatment Regimens
[0186] Following recovery of animals after initial suture placement, mice were again anesthetized, intubated, and the chest opened as described previously at 4 hrs after coronary ligation. Once the intact suture and area of blanching were confirmed and reperfusion was accomplished, 30 EPI CdM (200 uL) warmed to 37 C. was delivered to the entire cardiovascular arterial tree by injecting the solution into the lumen of the left ventricle (LV). This method was designed to deliver a maximum amount of EPI CdM to the injured myocardium by employing the naturally existing arterial network of the heart, which is supplied by the immediate portion of the aorta. With a 30.5 gauge needle inserted below the great cardiac vein (LV apex) at an angle 45 to the myocardium, 200 uL of 30 EPI CdM warmed to 37 C. was slowly injected over a period of 1 minute. Control animals received 200 ul of Alpha MEM (vehicle) in the same manner. All animals were randomized to treatment at the end of the first surgery (after ligation). Following treatment with either EPI CdM or vehicle, the needle was removed and the intercostals were rejoined using 6.0 chromic gut suture (Ethicon, Johnson and Johnson, Inc., Livingston, UK), lungs then reinflated, and overlying dermis rejoined with 6.0 nylon suture. All mice were then recovered to an ambulatory state and transferred to the vivarium for the remaining duration of the experiment. The survival rate for treated immunodeficient mice was: Alpha MEM, 71%; EPI CdM, 75%. The survival rate for treated immunocompetent mice was: Alpha MEM, 43%; EPI CdM, 86%.
Echocardiography
[0187] Two dimensional, Doppler, and M-Mode echocardiography was performed with a Vevo 770 High-Resolution Imaging System (Visual Sonics, Toronto, ON, Canada). Data was recorded from sham-operated mice, control mice with myocardial infarction, and treated mice with myocardial infarction while under isoflurane anesthesia. All left ventricular dimensions in systole and diastole were measured from M-mode images obtained at the mid-papillary muscle level. Echocardiographic data were coded for unbiased measurements and determination of ECHO wall motion scores. ECHO scores were determined from functional assessment of 13 segments using a model based on the Amercian Society of Echocardiography 17 segment model. Systolic wall motion scores were assigned to 4 quadrants each of 3 short axis segments taken at apical, mid papillary, and basal levels, with an additional segment at the apex (13 total). Scores were assigned as: 1=normal, >25% motion; 2=hypokinetic, 10-25% motion; 3=akinetic, <10% motion. Pulmonary arterial Doppler flow velocities and volumes were quantified as in Baumann et al., 2008 Echocardiography. 25: 739-748.
[0188] Following ECHO, the mice were killed humanely by exsanguination and the hearts were removed and rinsed in PBS. For creatine kinase assays, left ventricular tissue was dissected away from the atria and the aorta, further separated into anterior left ventricle and posterior left ventricle/septum, and immediately snap frozen by submersion of cryovials in liquid N.sub.2. The LV tissues were maintained at 80 C. until the day of the creatine kinase assay. For histology, the ventricles were dissected and rinsed in PBS. They were fixed for 2 days in 4% paraformaldehyde in PBS at 4 C. After fixation, the ventricles were cut transversely across the mid portion of the infarct zone, and placed into 70% ethanol prior to paraffin imbedding. Serial sections were cut from each of the two halves to section the entire heart from apex to base.
Creatine Kinase Assay
[0189] The remaining creatine kinase (CK) activity in left ventricular tissues was assessed to determine the extent of infarction (Zaman et al. 2009 Exp Biol Med (Maywood). 234: 246-254). The loss of creatine kinase activity directly reflects the loss of viable myocardium after myocardial infarction (Kjekshus and Sobel. 1970 Circ Res 27:403-414; Roberts et al. 1975 Circulation 52: 743-754; Shell et al. 1973. J Clin Invest 52: 2579-2590). The percentage of left ventricle with infarction was calculated based on observed total left ventricular creatine kinase activity (IU/mg protein) in left ventricles of normal hearts without infarction. The percent of myocardial infarction=100[NL CK-LV CK]/, where NL CK normal left ventricle creatine kinase activity is the amount of CK in tissue from normal left ventricle (IU/mg of soluble protein), left ventricle creatine kinase is total remaining creatine kinase activity in the left ventricle after myocardial infarction (IU/mg soluble protein), and is the difference between the amount of creatine kinase in normal zones of myocardium and in zones of myocardium with infarction.
Statistical Analysis.
[0190] All values are expressed as meanSEM unless otherwise indicated. Comparisons of parameters among the three groups were made using one-way analysis of variance (ANOVA) followed by Scheff's multiple comparison test. Comparisons of parameters between two groups were made by unpaired Student's t-test. P<0.05 was considered significant.
[0191] The results described in Examples 3-5 were carried out using the following methods and materials.
Epicardial Precursor Cell Conditioned Medium (EPI CdM).
[0192] After EMT, passage 3 epicardial precursor cells were seeded and grown in Claycomb expansion medium on 150 cm.sup.2 dishes (Nunc). When the cells reached 90% confluence, the plates were washed twice with PBS and serum-free alpha MEM was placed on the cells (20 mls per plate). After 48 hours of incubation, the CdM was collected, filtered (0.2 m PES membrane, Nalgene MF75, Rochester, N.Y.), and concentrated 30-fold with a Labscale TFF diafiltration system with the use of filters with a 5 kD cut-off (Millipore, Bedford, Mass.). Medium components above 5 kD were concentrated (base medium components and salts remained at 1). One ml vials of CdM were frozen and stored at 80 C. Some of the EPI CdM was kept at 1 (unconcentrated) for ELISAs and cell protection assays with primary human cardiac endothelial cells. ELISAs for human growth factors were performed with commercially available kits (R and D systems).
Cell Protection Assays with EPI CdM
[0193] Primary human aortic and coronary artery endothelial cells were purchased and cultured in EGM-2MV (Cambrex, Lonza). For cell protection assays under simulated ischemia, endothelial cells were seeded at 10,000 cells/cm.sup.2into 24 well plates (Nunc) containing growth medium and allowed to incubate for 2 days under normoxic conditions. For experiments, the cells were washed once with PBS and the medium was switched to either growth medium, alpha MEM base medium, 1 EPI CdM, or 10 EPI CdM. After changing the medium, the cells were then incubated in a dedicated incubator set to 1% oxygen for 24 or 48 hrs. For neutralization studies, monoclonal antisera against HGF or VEGF were added to EPI CdM, incubated for 30 min at RT, and spun down (HGF, H1896; VEGF, V4758; Sigma). For controls, non-specific mouse IgG (Sigma) was added to EPI CdM at the same concentration and incubated similarly. Cell viability (metabolism) was determined by MTS assay (CellTiter 96 AQueousOne Solution Cell Proliferation Assay, Promega). Cell number was quantified by dye binding of nucleic acids (CyQuant Assay, Molecular Probes, Invitrogen).
FITC-Alb Extravasation Assay for Vascular Integrity
[0194] At 22 hr after MI, reperfusion and treatment (2 hr before euthanization), 200 ul of FITC-conjugated albumin (5 mg/ml in PBS, Sigma) was injected by tail vein. Hearts were removed, fixed in 4% paraformaldehyde in PBS, processed in O.C.T. Compound (Tissue Tek), and serially sectioned from apex to base on a cryostat to 40 micron thickness. TUNEL staining was performed on all sections using a commercially available kit (In Situ Cell Death Detection Kit, tetramethyl rhodamine version, Roche Applied Science).
[0195] For each LV section, multiple photomicrographs were obtained at 5 magnification to image the entire LV and were montaged in Adobe Photoshop. Total LV areas and FITC-positive areas were determined from composite, flattened montages with Scion Image Software. LV volumes and FITC-positive volumes were estimated using measurements from 6-7 sections that were equi-distant from each other and that spanned the entire zone of infarction. The volumes between sections were estimated by averaging the section areas for total LV and FITC-positive LV and multiplying by the distance between the sections (typically 720 microns). For TUNEL scoring of FITC-Alb sections, separate images were obtained outside, at border areas, and inside the FITC-positive area for each section.
Determination of PTX3 in Blood Serum
[0196] Immediately before removing hearts for fixation and sectioning for the FITC-Alb assay, blood was collected by syringe from the left ventricular lumen, allowed to clot, and then centrifuged to collect serum. Due to the relatively high concentrations of circulating PTX3 in blood of animals with MI, serum samples were diluted in buffer prior to ELISA. Murine PTX3 was measured by ELISA according to the manufacturer's instructions (R & D Systems).
Other Embodiments
[0197] From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.
[0198] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
[0199] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.
REFERENCES
[0200] The following documents are cited herein. [0201] 1. Beltrami, A. P. et al. Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 114, 763-776 (2003). [0202] 2. Dawn, B. et al. Cardiac stem cells delivered intravascularly traverse the vessel barrier, regenerate infarcted myocardium, and improve cardiac function. Proc. Natl. Acad. Sci. USA. 102, 3766-3771 (2005). [0203] 3. Amado, L. C. et al. Cardiac repair with intramyocardial injection of allogeneic mesenchymal stem cells after myocardial infarction. Proc. Natl. Acad. Sci. USA 102, 11474-11479 (2005). [0204] 4. Kawamoto, A. et al. CD34-positive cells exhibit increased potency and safety for therapeutic neovascularization after myocardial infarction compared with total mononuclear cells. Circulation 114, 2163-2169 (2006). [0205] 5. Iso, Y. et al. Multipotent human stromal cells improve cardiac function after myocardial infarction in immunodeficient mice without long-term engraftment. Biochem. Biophys. Res. Com. 354, 700-706 (2007). [0206] 6. Winter, E. M. et al. Preservation of left ventricular function and attenuation of remodeling after transplantation of human epicardium-derived cells into the infarcted mouse heart. Circulation 116, 917-927 (2007). [0207] 7. Smith, R. R. et al. Regenerative potential of cardiosphere-derived cells expanded from percutaneous endomyocardial biopsy specimens. Circulation 115, 896-908 (2007). [0208] 8. Gnecchi, M., Zhang, Z., Ni, A., & Dzau, V. J. Paracrine mechanisms in adult stem cell signaling and therapy. Circ. Res. 103, 1204-1219 (2008). Review. [0209] 9. Gnecchi, M. et al. Paracrine action accounts for marked protection of ischemic heart by Akt-modified mesenchymal stem cells. Nat. Med. 11, 367-368 (2005). [0210] 10. Gnecchi, M. et al. Evidence supporting paracrine hypothesis for Akt-modified mesenchymal stem cell-mediated cardiac protection and functional improvement. FASEB J. 20, 661-669 (2006). [0211] 11. Lee, R. H. et al. The CD34-like protein PODXL and alpha6-integrin (CD49f) identify early progenitor MSCs with increased clonogenicity and migration to infarcted heart in mice. Blood 113, 816-826 (2009). [0212] 12. Johnston, P. V. et al. Engraftment, differentiation, and functional benefits of autologous cardiosphere-derived cells in porcine ischemic cardiomyopathy. Circulation 120, 1075-1083 (2009). [0213] 13. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Bergwerff, M., Mentink, M. M., & Poelmann, R. E. Epicardial outgrowth inhibition leads to compensatory mesothelial outflow tract collar and abnormal cardiac septation and coronary formation. Circ. Res. 87, 969-971 (2000). [0214] 14. Eralp, I. et al. Coronary artery and orifice development is associated with proper timing of epicardial outgrowth and correlated Fas-ligand-associated apoptosis patterns. Circ. Res. 96, 526-534 (2005). [0215] 15. Dettman, R. W., Denetclaw, W. Jr., Ordahl, C. P., & Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev. Biol. 193, 169-181 (1998). [0216] 16. Vrancken Peeters, M. P., Gittenberger-de Groot, A. C., Mentink, M. M., & Poelmann, R. E. Smooth muscle cells and fibroblasts of the coronary arteries derive from epithelial mesenchymal transformation of the epicardium. Anat. Embryol. (Berl). 199, 367-378 (1999). [0217] 17. Perez-Pomares, J. M. et al. Origin of coronary endothelial cells from epicardial mesothelium in avian embryos. Int. J. Dev. Biol. 46, 1005-1013 (2002). [0218] 18. Zhou, B. et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature 454, 109-113 (2008). [0219] 19. Cai, C. L. et al. A myocardial lineage derives from Tbx18 epicardial cells. Nature 454, 104-108 (2008). [0220] 20. Eralp, I. et al. Epicardium-derived cells are important for correct development of the Purkinje fibers in the avian heart. Anat. Rec. A Discov. Mol. Cell Evol. Biol. 288, 1272-1280 (2006). [0221] 21. Eid, H. et al. Role of epicardial mesothelial cells in the modification of phenotype and function of adult rat ventricular myocytes in primary coculture. Circ. Res. 71, 40-50 (1992). [0222] 22. Chen, T. H. et al. Epicardial induction of fetal cardiomyocyte proliferation via a retinoic acid-inducible trophic factor. Dev Biol. 250, 198-207 (2002). [0223] 23. Lepilina, A. et al. A dynamic epicardial injury response supports progenitor cell activity during zebrafish heart regeneration. Cell 127, 607-619 (2006). [0224] 24. Zhou, B. et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011). [0225] 25. Kjekshus, J. K., & Sobel, B. E. Depressed myocardial creatine phosphokinase activity following experimental myocardial infarction in rabbit. Circ. Res. 27, 403-414 (1970). [0226] 26. Shell, W. E., Lavelle, J. F., Covell, J. W., & Sobel, B. E. Early estimation of myocardial damage in conscious dogs and patients with evolving acute myocardial infarction. J. Clin. Invest. 52, 2579-2590 (1973). [0227] 27. Roberts, R., Henry, P. D., & Sobel, B. E. An improved basis for enzymatic estimation of infarct size. Circulation 52, 743-754 (1975). [0228] 28 French, C. J., Spees, J. L., Zaman, A. K., Taatjes, D. J., & Sobel, B. E. The magnitude and temporal dependence of apoptosis early after myocardial ischemia with or without reperfusion. FASEB J. 23, 1177-1185 (2009). [0229] 29. Salio, M. et al. Cardioprotective function of the long pentraxin PTX3 in acute myocardial infarction. Circulation 117, 1055-1064 (2008). [0230] 30. Tarikuz Zaman, A. K. M., French, C. J., Spees, J. L., Binbrek, A. S., & Sobel, B. E. Vascular rhexis in mice subjected to non-sustained myocardial ischemia and its therapeutic implications. Exp. Biol. Med. (Maywood) 236, 598-603 (2011). [0231] 31. Latini, R. et al. Prognostic significance of the long pentraxin PTX3 in acute myocardial infarction. Circulation 110, 2349-2354 (2004). [0232] 32. Deuse, T. et al. Hepatocyte growth factor or vascular endothelial growth factor gene transfer maximizes mesenchymal stem cell-based myocardial salvage after acute myocardial infarction. Circulation 120, S247-S254 (2009). [0233] 33. Mangi, A. A. et al. Mesenchymal stem cells modified with Akt prevent remodeling and restore performance of infarcted hearts. Nat. Med. 9, 1195-1201 (2003). [0234] 34. Nguyen et al. Improved function and myocardial repair of infarcted heart by intracoronary injection of mesenchymal stem cell-derived growth factors. J Cardiovasc. Trans. Res. 3, 547-558 (2010). [0235] 35. Kloner, R. A., Ganote, C. E., & Jennings, R. B. The no-reflow phenomenon after temporary coronary occlusion in the dog. J Clin Invest. 54, 1496-1508 (1974). [0236] 36. Reffelmann, T., Hale, S. L., Dow, J. S., & Kloner, R. A. No-reflow phenomenon persists long-term after ischemia/reperfusion in the rat and predicts infarct expansion. Circulation 108, 2911-2917 (2003). [0237] 37. Ragosta, M. et al. Microvascular integrity indicates myocellular viability in patients with recent myocardial infarction. New insights using myocardial contrast echocardiography. Circulation 89, 2562-2569 (1994). [0238] 38. Ambrosio, G., Weisman, H. F., Mannisi, J. A., & Becker, L. C. Progressive impairment of regional myocardial perfusion after initial restoration of postischemic blood flow. Circulation 80, 1846-1861 (1989).