Method of Producing Lipid

20180223299 ยท 2018-08-09

Assignee

Inventors

Cpc classification

International classification

Abstract

A method of improving lipid productivity, containing the steps of: enhancing the expression of a gene encoding the following protein (A) or (B), and improving the productivity of medium-chain fatty acids or lipids containing these fatty acids as components produced in a cell of a transformant, or the total amount of all fatty acids produced in a cell of a transformant:
(A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; and
(B) a protein consisting of an amino acid sequence having 64% or more identity with the amino acid sequence of the protein (A), and having glycerol-3-phosphate dehydrogenase activity.

Claims

1.-4. (canceled)

5. A method of improving lipid productivity, comprising the steps of: introducing a gene encoding the following protein (A) or (B) into a host, and thereby preparing a transformant, and improving productivity of medium-chain fatty acids or lipids containing these fatty acids as components produced in a cell of the transformant: (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; and (B) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (A), and having glycerol-3-phosphate dehydrogenase activity.

6. A method of improving lipid productivity, comprising the steps of: introducing a gene encoding the following protein (A) or (B) into a host, and thereby producing a transformant, and improving the total amount of all fatty acids produced in a cell of the transformant: (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; and (B) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (A), and having glycerol-3-phosphate dehydrogenase activity.

7.-11. (canceled)

12. The method according to claim 5, wherein expression of a gene encoding an acyl-ACP thioesterase having substrate specificity to a medium-chain acyl-ACP is enhanced in the transformant.

13.-14. (canceled)

15. The method according to claim 5, wherein expression of a gene encoding a ?-ketoacyl-ACP synthase having medium-chain ?-ketoacyl-ACP synthase activity is enhanced in the transformant.

16.-17. (canceled)

18. The method according to claim 5, wherein the transformant is a microalga.

19. (canceled)

20. The method according to claim 18, wherein the microalga is an alga belonging to the genus Nannochloropsis.

21. The method according to claim 5, wherein the lipids contain a fatty acid having 6 or more and 14 or less carbon atoms or an ester compound thereof.

22. A transformant, wherein the expression of a gene encoding the following protein (A) or (B) is enhanced, and at least either of the productivity of medium-chain fatty acids or lipids containing these fatty acids as components and the total amount of all fatty acids produced in a cell of the transformant is improved: (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; and (B) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (A), and having glycerol-3-phosphate dehydrogenase activity.

23. (canceled)

24. The transformant according to claim 22, wherein expression of a gene encoding an acyl-ACP thioesterase having substrate specificity to a medium-chain acyl-ACP is enhanced.

25.-26. (canceled)

27. The transformant according to claim 22, wherein expression of a gene encoding a ?-ketoacyl-ACP synthase having medium-chain ?-ketoacyl-ACP synthase activity is enhanced.

28.-29. (canceled)

30. The transformant according to claim 22, wherein the transformant is a microalga.

31. (canceled)

32. The transformant according to claim 30, wherein the microalga is an alga belonging to the genus Nannochloropsis.

33.-34. (canceled)

35. The method according to claim 6, wherein expression of a gene encoding an acyl-ACP thioesterase having substrate specificity to a medium-chain acyl-ACP is enhanced in the transformant.

36. The method according to claim 6, wherein expression of a gene encoding a ?-ketoacyl-ACP synthase having medium-chain ?-ketoacyl-ACP synthase activity is enhanced in the transformant.

37. The method according to claim 6, wherein the transformant is a microalga.

38. The method according to claim 37, wherein the microalga is an alga belonging to the genus Nannochloropsis.

39. The method according to claim 6, wherein the lipids contain a fatty acid having 6 or more and 14 or less carbon atoms or an ester compound thereof.

Description

MODE FOR CARRYING OUT THE INVENTION

[0027] The present invention relates to a method of producing lipids, which improves productivity of medium-chain fatty acids or the lipids containing these fatty acids as components, and total amount of the lipids to be produced.

[0028] Further, the present invention relates to a transformant in which the productivity of medium-chain fatty acids or the lipids containing these fatty acids as components and total amount of the lipids to be produced are improved.

[0029] The present inventors newly identified, as an enzyme involved in a fatty acid synthesis, a G3PDH of algae of the genus Nannochloropsis, being one kind of algae. Then, the present inventor enhanced expression of the G3PDH in microorganisms, and as the result, found that the productivity of medium-chain fatty acids or the lipids containing these fatty acids as components to be produced and total amount of the lipids to be produced are significantly improved.

[0030] The present invention was completed based on these findings.

[0031] According to the method of producing the lipids of the present invention, the productivity of medium-chain fatty acids or the lipids containing these fatty acids as components and total amount of the lipids to be produced can be improved.

[0032] Moreover, the transformant of the present invention is excellent in the productivities of medium-chain fatty acids or the lipids containing these fatty acids as components and total amount of the lipids to be produced.

[0033] Other and further features and advantages of the invention will appear more fully from the following description.

[0034] The term lipid(s) in the present specification, covers a simple lipid such as a neutral lipid (triacylglycerol, or the like), wax, and a ceramide; a complex lipid such as a phospholipid, a glycolipid, and a sulfolipid; and a derived lipid obtained from the lipid such as a fatty acid, alcohols, and hydrocarbons.

[0035] In the present specification, the description of Cx:y for the fatty acid or the acyl group constituting the fatty acid means that the number of carbon atoms is x and the number of double bonds is y. The description of Cx means a fatty acid or an acyl group having x as the number of carbon atoms.

[0036] In the present specification, the identity of the nucleotide sequence and the amino acid sequence is calculated through the Lipman-Pearson method (Science, 1985, vol. 227, p. 1435-1441). Specifically, the identity can be determined through use of a homology analysis (search homology) program of genetic information processing software Genetyx-Win with Unit size to compare (ktup) being set to 2.

[0037] It should be note that, in this description, the stringent conditions includes, for example, the method described in Molecular CloningA LABORATORY MANUAL THIRD EDITION [Joseph Sambrook and David W. Russell, Cold Spring Harbor Laboratory Press], and examples thereof include conditions where hybridization is performed by incubating a solution containing 6?SSC (composition of 1?SSC: 0.15 M sodium chloride, 0.015 M sodium citrate, pH 7.0), 0.5% SDS, 5?Denhardt's solution and 100 mg/mL herring sperm DNA together with a probe at 65? C. for 8 to 16 hours.

[0038] Furthermore, in the present specification, the term upstream of a gene means a region subsequent to a 5 side of a targeted gene or region, and not a position from a translational initiation site. On the other hand, the term downstream of the gene means a region subsequent to a 3 side of the targeted gene or region.

[0039] The above-described protein (A) or (B) (hereinafter, also referred to as NoG3PDH) is one of the oxidation-reduction enzyme, and the protein which catalyzes the reductive reaction from dihydroxyacetone phosphate to glycerol-3-phosphate. The protein consisting of the amino acid sequence set forth in SEQ ID NO: 1 is one of the G3PDH derived from Nannochloropsis oculata NIES-2145 being algae belonged to the genus Nannochloropsis.

[0040] Both proteins (A) and (B) described above have the glycerol-3-phosphate dehydrogenase activity (hereinafter, also referred to as G3PDH activity). In the present specification, the term G3PDH activity means the activity to catalyze the reductive reaction from dihydroxyacetone phosphate to glycerol-3-phosphate.

[0041] The G3PDH activity of the protein can be confirmed by, for example, introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and analyzing any change of the content of glycerol-3-phosphate (hereinafter, also referred to as G3P) caused thereby in the host cell by an ordinary technique. Alternatively, the G3PDH activity can be confirmed by introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and subjecting a disruption liquid of the cell to a G3P synthesis reaction using dihydroxyacetone phosphate and NADH.

[0042] By the results of Blast analysis using the amino acid sequence and nucleotide sequence, the proteins (A) and (B) were determined to be the G3PDH. In addition, in Nannochloropsis oculata NIES-2145 strain into which the gene encoding the protein (A) or (B) was introduced, it was also confirmed that the content of G3P was significantly improved in comparison with the wild type strain.

[0043] As shown in Examples mentioned later, the productivity of medium-chain fatty acids having 12, 14 or the like carbon atoms and total amount of all fatty acids to be produced are improved in the transformant, wherein the expression of the gene encoding the protein (A) is enhanced.

[0044] In addition, in the present specification, the term medium-chain means that the number of carbon atoms of the acyl group is 6 or more and less than 14, preferably 8 or more and less than 14, more preferably 10 or more and less than 14, more preferably 12 or more and less than 14, and furthermore preferably 12 or 14.

[0045] In the protein (B), the identity with the amino acid sequence of the protein (A) is preferably 65% or more, preferably 70% or more, more preferably 75% or more, further preferably 80% or more, further preferably 83% or more, further preferably 85% or more, further preferably 87% or more, further preferably 90% or more, further preferably 93% or more, further preferably 95% or more, further preferably 97% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of G3PDH activity. Further, specific examples of the protein (B) include a protein in which 1 or several, for example 1 or more and 167 or less, preferably 1 or more and 162 or less, more preferably 1 or more and 139 or less, further preferably 1 or more and 116 or less, furthermore preferably 1 or more and 93 or less, furthermore preferably 1 or more and 69 or less, furthermore preferably 1 or more and 60 or less, furthermore preferably 1 or more and 46 or less, furthermore preferably 1 or more and 32 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 13 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 4 or less, amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (A).

[0046] A method of introducing the mutation into an amino acid sequence includes a method of, for example, introducing a mutation into a nucleotide sequence encoding the amino acid sequence. A method of introducing the mutation includes a method of introducing a site-specific mutation. Specific examples of the method of introducing the site-specific mutation include a method of utilizing the SOE-PCR, the ODA method, and the Kunkel method. Further, commercially available kits such as Site-Directed Mutagenesis System Mutan-Super Express Km kit (Takara Bio), Transformer TM Site-Directed Mutagenesis kit (Clontech Laboratories), and KOD-Plus-Mutagenesis Kit (TOYOBO) can also be utilized. Furthermore, a gene containing a desired mutation can also be obtained by introducing a genetic mutation at random, and then performing an evaluation of the enzyme activities and a gene analysis thereof by an appropriate method.

[0047] The proteins (A) and (B) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Nannochloropsis oculata. In addition, the proteins (A) and (B) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 1. Alternatively, as recombinant proteins, proteins (A) and (B) may also be produced by gene recombination technologies. In the case of producing a recombinant protein, the G3PDH gene described below can be used.

[0048] Note that the algae such as Nannochloropsis oculata can be obtained from culture collection such as private or public research institutes or the like. For example, Nannochloropsis oculata NIES-2145 can be obtained from National Institute for Environmental Studies (NIES).

[0049] An example of the gene encoding the protein (A) or (B) (hereinafter, also referred to as G3PDH gene) includes a gene consisting of the following DNA (a) or (b) (hereinafter, also referred to as NoG3PDH gene).

(a) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2; and
(b) a DNA consisting of a nucleotide sequence having 59% or more identity with the nucleotide sequence of the DNA (a), and encoding a protein having G3PDH activity.

[0050] The nucleotide sequence set forth in SEQ ID NO: 2 is a nucleotide sequence of a gene encoding a protein (G3PDH derived from Nannochloropsis oculata NIES-2145) consisting of the amino acid sequence set forth in SEQ ID NO: 1.

[0051] In the DNA (b), the identity with the nucleotide sequence of the DNA (a) is preferably 60% or more, preferably 65% or more, preferably 70% or more, more preferably 75% or more, further preferably 80% or more, further preferably 83% or more, further preferably 87% or more, further preferably 90% or more, further preferably 93% or more, further preferably 95% or more, further preferably 97% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of G3PDH activity. Further, the DNA (b) is also preferably a DNA in which 1 or several, for example 1 or more and 573 or less, preferably 1 or more and 559 or less, more preferably 1 or more and 489 or less, further preferably 1 or more and 419 or less, furthermore preferably 1 or more and 349 or less, furthermore preferably 1 or more and 279 or less, furthermore preferably 1 or more and 209 or less, furthermore preferably 1 or more and 181 or less, furthermore preferably 1 or more and 139 or less, furthermore preferably 1 or more and 97 or less, furthermore preferably 1 or more and 69 or less, furthermore preferably 1 or more and 41 or less, furthermore preferably 1 or more and 27 or less, and furthermore preferably 1 or more and 13 or less nucleotides are deleted, substituted, inserted or added to the nucleotide sequence set forth in SEQ ID NO: 2, and encoding a protein having G3PDH activity.

[0052] Furthermore, the DNA (b) is also preferably a DNA capable of hybridizing with a DNA consisting of a nucleotide sequence complementary with the DNA (a) under a stringent condition, and encoding the protein having G3PDH activity.

[0053] A method of enhancing the expression of the G3PDH gene can be appropriately selected from an ordinarily method. For example, a method of introducing the G3PDH gene into a host, or a method of modifying expression regulation regions of the gene (promoter, terminator, or the like) in a host having the G3PDH gene on a genome, can be selected.

[0054] Note that, in the present specification, a cell in which expression of a gene encoding a target protein herein is enhanced is also referred to as the transformant, and a cell in which the expression of the gene encoding the target protein is not enhanced is also referred to as the host or wild type strain.

[0055] In the transformant used in the present invention, the productivity of medium-chain fatty acids and lipids containing these medium-chain fatty acids as components (a production amount of medium-chain fatty acids or lipids containing these medium-chain fatty acids as components, or a ratio of medium-chain fatty acids or lipids containing these medium-chain fatty acids as components in the total fatty acids or total lipids to be produced) is significantly improved, in comparison with a host or wild type strain. Moreover, as a result, in the transformant, the fatty acid composition in the lipid is modified. Therefore, the present invention using the transformant can be preferably applied to production of lipids having specific number of carbon atoms, particularly medium-chain fatty acids or lipids containing these medium-chain fatty acids as components, preferably fatty acids having 6 to 14 carbon atoms or lipids containing these fatty acids as components, more preferably fatty acids having 8 to 14 carbon atoms or lipids containing these fatty acids as components, further preferably fatty acids having 10 to 14 carbon atoms or lipids containing these fatty acids as components, further preferably fatty acids having 12 to 14 carbon atoms or lipids containing these fatty acids as components, further preferably fatty acids having 12 or 14 carbon atoms or lipids containing these fatty acids as components, and furthermore preferably saturated fatty acids having 12 or 14 carbon atoms (lauric acid or myristic acid) or lipids containing these fatty acids as components.

[0056] Moreover, in the transformant used in the present invention, the productivity of medium-chain fatty acids or lipids containing these fatty acids as components as well as a total amount of all fatty acids to be produced are significantly improved, in comparison with a host. Therefore, the present invention using the transformant can be preferably applied to production of lipids.

[0057] The productivity of fatty acids and lipids of the host and the transformant can be measured by the method used in Examples described below.

[0058] The method of introducing the G3PDH gene into a host and enhancing the expression of the gene is described.

[0059] The G3PDH gene can be obtained by genetic engineering techniques that are ordinarily carried out. For example, the G3PDH gene can be artificially synthesized based on the amino acid sequence set forth in SEQ ID NO: 1 or the nucleotide sequence set forth in SEQ ID NO: 2. The synthesis of the G3PDH gene can be achieved by utilizing, for example, the services of Invitrogen. Further, the gene can also be obtained by cloning from Nannochloropsis oculata. The cloning can be carried out by, for example, the methods described in Molecular Cloning: A LABORATORY MANUAL THIRD EDITION [Joseph Sambrook, David W. Russell, Cold Spring Harbor Laboratory Press (2001)]. Furthermore, Nannochloropsis oculata NIES-2145 used in Examples can be obtained from National Institute for Environmental Studies (NIES).

[0060] The transformant that can be preferably used in the present invention is obtained by introducing the G3PDH gene into a host according to an ordinarily method. Specifically, the transformant can be produced by preparing a recombinant vector or a gene expression cassette which is capable of expressing the G3PDH gene in a host cell, introducing this vector or cassette into host cell, and thereby transforming the host cell.

[0061] The host for the transformant can be appropriately selected from ordinarily used hosts. For example, microorganisms (including algae and microalgae), plants or animals can be used as the host in the present invention. Among these, microorganisms or plants are preferable, microorganisms are more preferable, and microalgae are further preferable as a host, from the viewpoints of production efficiency and the usability of lipids to be obtained.

[0062] As the microorganisms, prokaryotes and eukaryotes can be used. Examples of the prokaryotes include microorganisms belonging to the genus Escherichia, microorganisms belonging to the genus Bacillus, microorganisms belonging to the genus Synechocystis, microorganisms belonging to the genus Synechococcus, and the like. Examples of the eukaryotes include eukaryotic microorganisms belonging to yeast, filamentous fungi and the like. Among these, from a viewpoint of the lipid productivity, Escherichia coli, Bacillus subtilis, Rhodosporidium toruloides, or Mortierella sp., is preferable, and Escherichia coli is more preferable.

[0063] As the algae or microalgae, from a viewpoint of establishment of a gene recombination technique, algae belonging to the genus Chlamydomonas, algae belonging to the genus Chlorella, algae belonging to the genus Phaeodactylum, or algae belonging to the genus Nannochloropsis are preferable, and algae belonging to the genus Nannochloropsis are more preferable. Specific examples of the algae belonging to the genus Nannochloropsis include Nannochloropsis oculata, Nannochloropsis gaditana, Nannochloropsis salina, Nannochloropsis oceanica, Nannochloropsis atomus, Nannochloropsis maculata, Nannochloropsis granulata, and Nannochloropsis sp. Among these, from a viewpoint of the lipid productivity, Nannochloropsis oculata or Nannochloropsis gaditana is preferable, and Nannochloropsis oculata is more preferable.

[0064] As the plants, from a viewpoint of a high lipid content of seeds, Arabidopsis thaliana, Brassica napus, Brassica raga, Cocos nucifera, Elaeis quineensis, cuphea, Glycine max, Zea mays, Oryza sativa, Helianthus annuus, Cinnamomum camphora, or Jatropha curcas is preferable, and Arabidopsis thaliana is more preferable.

[0065] A vector for use as the plasmid vector for gene expression or a vector containing the gene expression cassette (plasmid) may be any vector capable of introducing the gene encoding the target protein into a host, and expressing the gene in the host cell. For example, a vector which has expression regulation regions such as a promoter and a terminator in accordance with the type of the host to be introduced, and has a replication initiation point, a selection marker or the like, can be used. Furthermore, the vector may also be a vector such as a plasmid capable of self-proliferation and self-replication outside the chromosome, or may also be a vector which is incorporated into the chromosome.

[0066] Specific examples of the vector that can be used preferably in the present invention include, in the case of using a microorganism as the host, pBluescript (pBS) II SK(?) (manufactured by Stratagene), a pSTV-based vector (manufactured by Takara Bio), a pUC-based vector (manufactured by Takara Shuzo), a pET-based vector (manufactured by Takara Bio), a pGEX-based vector (manufactured by GE Healthcare), a pCold-based vector (manufactured by Takara Bio), pHY300PLK (manufactured by Takara Bio), pUB110 (McKenzie, T. et al., 1986, Plasmid 15(2), p. 93-103), pBR322 (manufactured by Takara Bio), pRS403 (manufactured by Stratagene), and pMW218/219 (manufactured by Nippon Gene). In particular, in the case of using Escherichia coli as the host, pBluescript II SK(?) or pMW218/219 is preferably used.

[0067] When the algae or the microalgae are used as the host, specific examples of the vector include pUC19 (manufactured by Takara Bio), P66 (Chlamydomonas Center), P-322 (Chlamydomonas Center), pPha-T1 (see Yangmin Gong, et al., Journal of Basic Microbiology, 2011, vol. 51, p. 666-672) and pJET1 (manufactured by COSMO 610). In particular, in the case of using the algae belonging to the genus Nannochloropsis as the host, pUC19, pPha-T1 or pJET1 is preferably used. Moreover, when the host is the algae belonging to the genus Nannochloropsis, the host can be transformed, with referring to the method described in Oliver Kilian, et al., Proceedings of the National Academy of Sciences of the United States of America, 2011, vol. 108(52), by using the DNA fragment consisting of the target gene of the present invention, a promoter and a terminator (gene expression cassette). Specific examples of this DNA fragment include a PCR-amplified DNA fragment and a restriction enzyme-cut DNA fragment.

[0068] In the case of using a plant cell as the host, examples of the vector include a pRI-based vector (manufactured by Takara Bio), a pBI-based vector (manufactured by Clontech), and an 1N3-based vector (manufactured by Inplanta Innovations). In particular, in the case of using Arabidopsis thaliana as the host, a pRI-based vector or a pBI-based vector is preferably used.

[0069] Moreover, a kind of promoter regulating the expression of the gene encoding a target protein, which is introduced into the expression vector, can also be appropriately selected according to a kind of the host to be used. Specific examples of the promoter that can be preferably used in the present invention include lac promoter, trp promoter, tac promoter, trc promoter, T7 promoter, SpoVG promoter, a promoter that relates to a substance that can be induced by addition of isopropyl ?-D-1-thiogalactopyranoside (IPTG), Rubisco operon (rbc), PSI reaction center protein (psaAB), D1 protein of PSII (psbA), cauliflower mosaic virus 35S RNA promoter, promoters for housekeeping genes (e.g., tubulin promoter, actin promoter and ubiquitin promoter), Brassica napus or Brassica rapa-derived Napin gene promoter, plant-derived Rubisco promoter, a promoter of a violaxanthin/(chlorophyll a)-binding protein gene derived from the genus Nannochloropsis (VCP1 promoter, VCP2 promoter) (Oliver Kilian, et al., Proceedings of the National Academy of Sciences of the United States of America, 2011, vol. 108(52)), and a promoter of an oleosin-like protein LDSP (lipid droplet surface protein) gene derived from the genus Nannochloropsis (Astrid Vieler, et al., PLOS Genetics, 2012, vol. 8(11): e1003064. DOI: 10.1371). In the case of using Nannochloropsis as the host in the present invention, the promoter of violaxanthin/(chlorophyll a)-binding protein gene, or the promoter of an oleosin-like protein LDSP gene derived from the genus Nannochloropsis can be preferably used.

[0070] Moreover, a kind of selection marker for confirming introduction of the gene encoding a target protein can also be appropriately selected according to a kind of the host to be used. Examples of the selection marker that can be preferably used in the present invention include drug resistance genes such as an ampicillin resistance gene, a chloramphenicol resistance gene, an erythromycin resistance gene, a neomycin resistance gene, a kanamycin resistance gene, a spectinomycin resistance gene, a tetracycline resistance gene, a blasticidin S resistance gene, a bialaphos resistance gene, a zeocin resistance gene, a paromomycin resistance gene, and a hygromycin resistance gene. Further, it is also possible to use a deletion of an auxotrophy-related gene or the like as the selection marker gene.

[0071] Introduction of the gene encoding a target protein to the vector can be conducted by an ordinary technique such as restriction enzyme treatment and ligation.

[0072] Furthermore, the method for transformation can be appropriately selected from ordinary techniques according to a kind of the host to be used. Examples of the method for transformation include a transformation method of using calcium ion, a general competent cell transformation method, a protoplast transformation method, an electroporation method, an LP transformation method, a method of using Agrobacterium, a particle gun method, and the like. When the algae belonging to the genus Nannochloropsis are used as the host, transformation can also be performed by using the electroporation method described in Randor Radakovits, et al., Nature Communications, DOI: 10.1038/ncomms1688, 2012, or the like.

[0073] The selection of a transformant having a target gene fragment introduced therein can be carried out by utilizing the selection marker or the like. For example, the selection can be carried out by using an indicator whether a transformant acquires the drug resistance as a result of introducing a drug resistance gene into a host cell together with a target DNA fragment upon the transformation. Further, the introduction of a target DNA fragment can also be confirmed by PCR method using a genome as a template or the like.

[0074] In a host having the G3PDH gene on a genome, a method of modifying expression regulation regions of the gene and enhancing the expression of the gene is described.

[0075] The expression regulation region indicates the promoter or the terminator, in which these sequences are generally involved in regulation of the expression amount (transcription amount, translation amount) of the gene adjacent thereto. In a host having the above-described G3PDH gene on a genome, productivity of medium-chain fatty acids or lipids containing these medium-chain fatty acids as components can be improved by modifying expression regulation regions of the gene and enhancing the expression of the G3PDH gene.

[0076] Specific examples of the method of modifying the expression regulation regions include interchange of promoters. In the host having the above-mentioned G3PDH gene on the genome, the expression of the above-described G3PDH gene can be enhanced by interchanging the promoter of the gene (hereinafter, also referred to as G3PDH promoter) with a promoter having higher transcriptional activity. For example, in Nannochloropsis oculata NIES-2145 strain being one of the hosts having the G3PDH genes on the genome, the NoG3PDH gene exists at the downstream of a DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 58, and a promoter region exists in the DNA sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 58. The expression of the above-described G3PDH gene can be enhanced by partially or wholly interchanging the DNA sequences consisting of the nucleotide sequence set forth in SEQ ID NO: 58 with the promoter having higher transcriptional activity.

[0077] The promoter used for interchanging the G3PDH promoter is not particularly limited, and can be appropriately selected from the promoters that are higher in the transcriptional activity than the G3PDH promoter and suitable for production of the medium-chain fatty acids or the lipids containing these fatty acids as the components.

[0078] When the Nannochloropsis is used as a host, a tubulin promoter, a heat shock protein promoter, the above-described promoter of a violaxanthin/(chlorophyll a)-binding protein gene (VCP1 promoter (SEQ ID NO: 30), VCP2 promoter), or a promoter of an oleosin-like protein LDSP gene derived from the genus Nannochloropsis (SEQ ID NO: 18), can be preferably used. From a viewpoint of improvement in the productivity of medium-chain fatty acids or lipids containing these medium-chain fatty acids as components, the promoter of a violaxanthin/(chlorophyll a)-binding protein gene or the promoter of LDSP gene is more preferable.

[0079] The above-described modification of a promoter can employ according to an ordinarily method such as homologous recombination. Specifically, a linear DNA fragment containing upstream and downstream regions of a target promoter and containing other promoter instead of the target promoter is constructed, and the resultant DNA fragment is incorporated into a host cell to cause double crossover homologous recombination on the side upstream and downstream of the target promoter of the host genome. As a result, the target promoter on the genome is substituted with other promoter fragment, and the promoter can be modified.

[0080] The method of modifying a target promoter according to such homologous recombination can be conducted with, for example, reference to literature such as Besher et al., Methods in molecular biology, 1995, vol. 47, p. 291-302. In particular, in the case when the host is the algae belonging to the genus Nannochloropsis, specific region in a genome can be modified, with referring to literature such as Oliver Kilian, et al., Proceedings of the National Academy of Sciences of the United States of America, 2011, vol. 108(52), by homologous recombination method.

[0081] The transformant of the present invention preferably has enhancing expression of a gene encoding a TE (hereinafter, also referred to as TE gene), in addition to the gene encoding the protein (A) or (B)

[0082] As described above, TE is an enzyme that hydrolyzes the thioester bond of the acyl-ACP synthesized by a fatty acid synthase such as the ?-ketoacyl-ACP synthase (hereinafter, also referred to as KAS) to produce a free fatty acid. The function of the TE terminates the fatty acid synthesis on the ACP, and then the thus-hydrolyzed fatty acid is supplied to the synthesis of polyunsaturated fatty acid or triacylglycerol (hereinafter, also referred to as TAG) or the like. Then, the above-described G3PDH is involved in the TAG synthesis or the like.

[0083] Therefore, lipid productivity of the transformant to be used for the lipid production, particularly productivity of the fatty acids can be further improved by increasing the content of a substrate for TAG which is synthesized by G3PDH, due to the enhancing of the expression of the TE gene, in addition to the G3PDH gene. Furthermore, as shown in Examples mentioned later, total amount of the amounts of each of the fatty acids (total amount of the fatty acids) can be also improved by enhancing the expression of the TE gene, in addition to the G3PDH gene.

[0084] The TE that can be used in the present invention merely needs to be the protein having acyl-ACP thioesterase activity (hereinafter, also referred to as TE activity). Herein, the term TE activity means an activity of hydrolyzing the thioester bond of the acyl-ACP.

[0085] To date, several TEs having different reaction specificities depending on the number of carbon atoms and the number of unsaturated bonds of the acyl group (fatty acid residue) constituting the acyl-ACP substrate are identified. Therefore, TE is considered to be an important factor in determining the fatty acid composition of an organism. In particular, when a host originally having no gene encoding a TE is used in the transformation, it is preferable to enhance the expression of the gene encoding a TE. In addition, according to enhancing the expression of the TE gene having substrate specificity to the medium-chain acyl-ACP, the productivity of medium-chain fatty acids is improved. The productivity of medium-chain fatty acids is further improved by introducing such a gene.

[0086] The TE that can be used in the present invention can be appropriately selected from ordinary TEs and proteins functionally equivalent to the TEs, according to a kind of host or the like.

[0087] Specific examples thereof include TE derived from Cuphea calophylla subsp. mesostemon (GenBank ABB71581); TE derived from Cinnamomum camphora (GenBank AAC49151.1); TE derived from Myristica fragrans (GenBank AAB71729); TE derived from Myristica fragrans (GenBank AAB71730); TE derived from Cuphea lanceolata (GenBank CAA54060); TE derived from Cuphea hookeriana (GenBank Q39513); TE derived from Ulumus americana (GenBank AAB71731); TE derived from Sorghum bicolor (GenBank EER87824); TE derived from Sorghum bicolor (GenBank EER88593); TE derived from Cocos nucifera (CnFatB1: see Jing et al. BMC Biochemistry 2011, 12:44); TE derived from Cocos nucifera (CnFatB2: see Jing et al., BMC Biochemistry, 2011, 12:44); TE derived from Cuphea viscosissima (CvFatB1: see Jing et al., BMC Biochemistry, 2011, 12:44); TE derived from Cuphea viscosissima (CvFatB2: see Jing et al., BMC Biochemistry, 2011, 12:44); TE derived from Cuphea viscosissima (CvFatB3: see Jing et al., BMC Biochemistry, 2011, 12:44); TE derived from Elaeis quineensis (GenBank AAD42220); TE derived from Desulfovibrio vulgaris (GenBank ACL08376); TE derived from Bacteroides fragilis (GenBank CAH09236); TE derived from Parabacteriodes distasonis (GenBank ABR43801); TE derived from Bacteroides thetaiotaomicron (GenBank AA077182); TE derived from Clostridium asparagiforme (GenBank EEG55387); TE derived from Bryanthella formatexigens (GenBank EET61113); TE derived from Geobacillus sp. (GenBank EDV77528); TE derived from Streptococcus dysgalactiae (GenBank BAH81730); TE derived from Lactobacillus brevis (GenBank ABJ63754); TE derived from Lactobacillus plantarum (GenBank CAD63310); TE derived from Anaerococcus tetradius (GenBank EEI82564); TE derived from Bdellovibrio bacteriovorus (GenBank CAE80300); TE derived from Clostridium thermocellum (GenBank ABN54268); TE derived from Umbellularia californica (California bay) (hereinafter, also referred to as BTE) (GenBank AAA34215.1, SEQ ID NO: 29, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 26); TE derived from Nannochloropsis oculata (hereinafter, also referred to as NoTE) (SEQ ID NO: 38, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 39); TE derived from Cocos nucifera (SEQ ID NO: 59, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 60); TE derived from Nannochloropsis gaditana (SEQ ID NO: 61, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 62); TE derived from Nannochloropsis granulata (SEQ ID NO: 63, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 64); and TE derived from Symbiodinium microadriaticum (SEQ ID NO: 65, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 66).

[0088] Moreover, as the proteins functionally equivalent to them, a protein consisting of an amino acid sequence having 50% or more, preferably 60% or more, more preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and further preferably 95% or more identity with the amino acid sequence of any one of the TEs described above, and having TE activity, can be also used. Alternatively, a protein consisting of an amino acid sequence in which 1 or several amino acids, (for example, preferably 1 or more and 149 or less amino acids, more preferably 1 or more and 119 or less amino acids, further preferably 1 or more and 104 or less amino acids, furthermore preferably 1 or more and 90 or less amino acids, furthermore preferably 1 or more and 75 or less amino acids, furthermore preferably 1 or more and 60 or less amino acids, furthermore preferably 1 or more and 45 or less amino acids, furthermore preferably 1 or more and 30 or less amino acids, and furthermore preferably 1 or 15 amino acids), are deleted, substituted, inserted or added to the amino acid sequence of any one of the TEs described above, and having TE activity, can be also used.

[0089] Among these TEs described above, from a viewpoint of the substrate specificity for medium-chain acyl-ACP, BTE (SEQ ID NO: 29, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 26), NoTE (SEQ ID NO: 38, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 39), TE derived from Cocos nucifera (SEQ ID NO: 59, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 60), TE derived from Nannochloropsis gaditana (SEQ ID NO: 61, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 62), TE derived from Nannochloropsis granulata (SEQ ID NO: 63, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 64), TE derived from Symbiodinium microadriaticum (SEQ ID NO: 65, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 66), a protein consisting of an amino acid sequence having 50% or more, preferably 60% or more, more preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and further preferably 95% or more identity with the amino acid sequence of any one of the TEs, and having TE activity for medium-chain acyl-ACP (for example, a protein which is encoded by the DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 44), or a protein consisting of an amino acid sequence in which 1 or several amino acids, (for example, preferably 1 or more and 149 or less amino acids, more preferably 1 or more and 119 or less amino acids, further preferably 1 or more and 104 or less amino acids, furthermore preferably 1 or more and 90 or less amino acids, furthermore preferably 1 or more and 75 or less amino acids, furthermore preferably 1 or more and 60 or less amino acids, furthermore preferably 1 or more and 45 or less amino acids, furthermore preferably 1 or more and 30 or less amino acids, and furthermore preferably 1 or 15 amino acids), are deleted, substituted, inserted or added to the amino acid sequence of any one of the TEs, and having TE activity for medium-chain acyl-ACP, is preferable.

[0090] The sequence information or the like of these TEs and the genes encoding thereof can be obtained from, for example, National Center for Biotechnology Information, NCBI, or the like.

[0091] The TE activity of the protein can be confirmed by, for example, introducing a DNA produced by linking the acyl-ACP thioesterase gene to the downstream of a promoter which functions in a host cell such as Escherichia coli, into a host cell which lacks a fatty acid degradation system, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced TE gene, and analyzing any change caused thereby in the fatty acid composition of the host cell or the cultured liquid by using a gas chromatographic analysis or the like.

[0092] Alternatively, the TE activity can be measured by introducing a DNA produced by linking the TE gene to the downstream of a promoter which functions in a host cell such as Escherichia coli, into a host cell, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced TE gene, and subjecting a disruption liquid of the cell to a reaction which uses acyl-ACPs, as substrates, prepared according to the method of Yuan et al. (Yuan L. et al., Proc. Natl. Acad. Sci. U.S.A., 1995, vol. 92 (23), p. 10639-10643).

[0093] The transformants in which expression of the gene TE is enhanced can be prepared by an ordinary method. For example, the transformants can be prepared by a method similar to the above-mentioned method for enhancing expression of the G3PDH gene, such as a method of introducing a TE gene into a host, and a method of modifying expression regulation regions of a gene in a host having the TE gene on a genome.

[0094] In the transformant of the present invention, the expression of a KAS gene, in addition to the above-described gene encoding the protein (A) or (B), is also preferably enhanced.

[0095] A KAS, which is an enzyme involved in fatty acid synthetic pathway, is an enzyme involved in control of chain length of the acyl group. In plants, four kinds of KASs having different function respectively, namely KAS I, KAS II, KAS III and KAS IV are known to exist. Among these, KAS III functions in a stage of starting a chain length elongation reaction to elongate the acetyl-ACP (or acetyl-CoA) having 2 carbon atoms to the ?-ketoacyl-ACP having 4 carbon atoms. In the subsequent elongation reaction, KAS I, KAS II and KAS IV are involved. KAS I is mainly involved in the elongation reaction to the palmitoyl-ACP having 16 carbon atoms, and KAS II is mainly involved in the elongation reaction to the stearoyl-ACP having 18 carbon atoms. On the other hand, it is believed that KAS IV is involved in the elongation reaction to medium-chain acyl-ACP having 6 to 14 carbon atoms.

[0096] The KAS involves in a synthesis of a precursor (acyl-ACP) of the free fatty acid to be used as the substrate upon synthesizing the TAG. Therefore, an amount of the acyl-ACP increases by enhancing the expression of the KAS gene, and the content of the free fatty acid serving as the substrate for the TAG synthesis increases. Then, an amount of G3P being a skeleton of the TAG increases by further enhancing the expression of the G3PDH gene, and therefore a TAG synthesis amount increases as a whole, and the lipid productivity in the transformant to be used for the lipid production, particularly the productivity of the fatty acids can be further improved. Furthermore, as shown in Examples mentioned later, total amount of the amounts of each of the fatty acids (total amount of the fatty acids) can also be improved by enhancing the expression of the KAS gene, in addition to the G3PDH gene.

[0097] The KAS that can be used in the present invention merely needs to be the protein having ?-ketoacyl-ACP synthase activity (hereinafter, also referred to as KAS activity). Herein, the term KAS activity means the activity to catalyze the condensation reaction of the acetyl-ACP (or acetyl-CoA) or the acyl-ACP with the malonyl-ACP.

[0098] As described above, KAS is categorized into KAS I, KAS II, KAS III and KAS IV according to their substrate specificity. Therefore, KAS is considered to be an important factor in determining the fatty acid composition of an organism. Therefore, lipid productivity can be further improved by enhancing the expression of the KAS gene.

[0099] The KAS that can be used in the present invention can be appropriately selected from ordinary KASs and proteins functionally equivalent to the KASs, according to a kind of host or the like.

[0100] Specific examples thereof include KAS derived from Nannochloropsis oculata (SEQ ID NO: 48, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 49, SEQ ID NO:75, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 76), KAS derived from Nannochloropsis gaditana (SEQ ID NO: 67, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 68) KAS derived from Umbellularia californica (SEQ ID NO: 69, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 70, SEQ ID NO: 71, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 72), KAS derived from Cinnamomum camphora (SEQ ID NO: 73, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 74), KAS derived from Cocos nucifera (SEQ ID NO: 77, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 78), KAS derived from Cuphea hookeriana (SEQ ID NO: 79, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 80), and KAS derived from Cuphea lanceolata (SEQ ID NO: 81, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 82). Moreover, as the proteins functionally equivalent to them, a protein consisting of an amino acid sequence having 50% or more, preferably 60% or more, more preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and further preferably 95% or more identity with the amino acid sequence of any one of the KASs described above, and having KAS activity, can be also used. Alternatively, a protein consisting of an amino acid sequence in which 1 or several amino acids, (for example, preferably 1 or more and 255 or less amino acids, more preferably 1 or more and 204 or less amino acids, further preferably 1 or more and 179 or less amino acids, furthermore preferably 1 or more and 153 or less amino acids, furthermore preferably 1 or more and 128 or less amino acids, furthermore preferably 1 or more and 102 or less amino acids, furthermore preferably 1 or more and 77 or less amino acids, furthermore preferably 1 or more and 51 or less amino acids, and furthermore preferably 1 or 26 amino acids), are deleted, substituted, inserted or added to the amino acid sequence of any one of the KASs described above, and having KAS activity, can be also used.

[0101] Among these KASs described above, from a viewpoint of the medium-chain ?-ketoacyl-ACP synthesis activity, KAS derived from Nannochloropsis oculata (SEQ ID NO: 48, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 49, SEQ ID NO: 75, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 76), KAS derived from Nannochloropsis gaditana (SEQ ID NO: 67, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 68), KAS derived from Umbellularia californica (SEQ ID NO: 69, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 70, SEQ ID NO: 71, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 72), KAS derived from Cinnamomum camphora (SEQ ID NO: 73, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 74), KAS derived from Cocos nucifera (SEQ ID NO: 77, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 78), KAS derived from Cuphea hookeriana (SEQ ID NO: 79, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 80), KAS derived from Cuphea lanceolata (SEQ ID NO: 81, nucleotide sequence of a gene encoding thereof; SEQ ID NO: 82), or a protein consisting of an amino acid sequence having 50% or more, preferably 60% or more, more preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and further preferably 95% or more identity with the amino acid sequence of any one of the KASs, and having medium-chain ?-ketoacyl-ACP synthase activity, or a protein consisting of an amino acid sequence in which 1 or several amino acids, (for example, preferably 1 or more and 255 or less amino acids, more preferably 1 or more and 204 or less amino acids, further preferably 1 or more and 179 or less amino acids, furthermore preferably 1 or more and 153 or less amino acids, furthermore preferably 1 or more and 128 or less amino acids, furthermore preferably 1 or more and 102 or less amino acids, furthermore preferably 1 or more and 77 or less amino acids, furthermore preferably 1 or more and 51 or less amino acids, and furthermore preferably 1 or 26 amino acids), are deleted, substituted, inserted or added to the amino acid sequence of any one of the KASs, and having medium-chain ?-ketoacyl-ACP synthase activity, is preferable.

[0102] The sequence information or the like of these KASs and the genes encoding thereof can be obtained from, for example, National Center for Biotechnology Information, NCBI, or the like.

[0103] The KAS activity of the protein can be confirmed by, for example, introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell which lacks a fatty acid degradation system, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and analyzing any change caused thereby in the fatty acid composition of the host cell or the cultured liquid by an ordinary technique. Alternatively, the KAS activity can be confirmed by allowing, in the above-described system, coexpression of TE, and being compared with fatty acid composition in the case of allowing merely single expression of TE. Alternatively, the KAS activity can be confirmed by introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and subjecting a disruption liquid of the cell to a chain length elongation reaction.

[0104] The transformants in which expression of the gene KAS is enhanced can be prepared by an ordinary method. For example, the transformants can be prepared by a method similar to the above-mentioned method for enhancing expression of the G3PDH gene, such as a method of introducing a KAS gene into a host, and a method of modifying expression regulation regions of a gene in a host having the KAS gene on a genome.

[0105] Furthermore, in the transformant of the present invention, expression of a gene encoding an acyltransferase or the like, in addition to the above-described gene encoding the protein (A) or (B), is also preferably enhanced.

[0106] As mentioned above, the acyltransferase is an enzyme catalyzing the acylation which is necessary for the TAG synthesis. Therefore, productivity of medium-chain fatty acids can be further improved by enhancing the expression of the gene encoding the acyltransferase having specificity for the medium-chain fatty acid, such as diacylglycerol acyltransferase having specificity for the medium-chain fatty acid, in addition to the G3PDH gene.

[0107] The acyltransferase, which can be used in the present invention, can be appropriately selected from the normal acyltransferase, or proteins functionally equivalent to the acyltransferase, according to a kind of host or the like.

[0108] Further, the transformants in which the expression of the gene is enhanced can be prepared by an ordinary method. For example, the transformants can be prepared by a method similar to the above-described method for enhancing the expression of the G3PDH gene, such as a method for introducing a gene encoding the acyltransferase into a host, a method for modifying expression regulation regions of a gene in the host having the gene encoding the acyltransferase on a genome, or the like.

[0109] In the transformant of the present invention, productivity of the medium-chain fatty acids or the lipids containing these fatty acids as components is improved in comparison with the host in which the expression of the gene encoding the protein (A) or (B) is not enhanced. Accordingly, if the transformant of the present invention is cultured under suitable conditions and then the medium-chain fatty acids or the lipids containing these fatty acids as components are collected from an obtained cultured product or an obtained growth product, the medium-chain fatty acids or the lipids containing these fatty acids as components can be efficiently produced.

[0110] Further, in the transformant, total amount of all fatty acids to be produced is also significantly improved in comparison with a host. Therefore, if the transformant of the present invention is cultured under suitable conditions and then the fatty acids or the lipids containing these fatty acids as components are collected from an obtained cultured product or an obtained growth product, the fatty acids or the lipids containing these fatty acids as components can be efficiently produced.

[0111] Herein, the term cultured product means liquid medium and a transformant subjected to cultivation, and the term growth product means a transformant subjected to growth.

[0112] The culture condition of the transformant of the present invention can be appropriately selected in accordance with the type of the host, and any ordinary used culture condition for the host can be employed. Further, from a viewpoint of the production efficiency of fatty acids, for example, precursor substances involved in the fatty acid biosynthesis system, such as glycerol, acetic acid or glucose, may be added to the medium.

[0113] For example, in the case of using Escherichia coli as the host, culturing of Escherichia coli may be carried out in LB medium or Overnight Express Instant TB Medium (Novagen) at 30? C. to 37? C. for half a day to 1 day.

[0114] In the case of using Arabidopsis thaliana as the host, for example, growth of Arabidopsis thaliana may be carried out at soil under the temperature conditions of 20? C. to 25? C., by continuously irradiating white light or under light illumination conditions of a light period of 16 hours and a dark period of 8 hours, for one to two months.

[0115] In the case of using algae as the host, medium based on natural seawater or artificial seawater may be used. Alternatively, commercially available culture medium may also be used. Specific examples of the culture medium include f/2 medium, ESM medium, Daigo's IMK medium, L1 medium and MNK medium. Above all, from viewpoints of an improvement in the lipid productivity and a nutritional ingredient concentration, f/2 medium, ESM medium or Daigo's IMK medium is preferred, f/2 medium or Daigo's IMK medium is more preferred, and f/2 medium is further preferred. For growth promotion of the algae and an improvement in productivity of fatty acids, a nitrogen source, a phosphorus source, metal salts, vitamins, trace metals or the like can be appropriately added to the culture medium.

[0116] An amount of the transformant to be seeded to the culture medium is appropriately selected. In view of viability, the amount is preferably 1 to 50% (vol/vol), and more preferably 1 to 10% (vol/vol), per culture medium. Culture temperature is not particularly limited within the range in which the temperature does not adversely affect growth of the algae, and is ordinarily in the range of 5 to 40? C. From viewpoints of the growth promotion of the algae, the improvement in productivity of fatty acids, and reduction of production cost, the temperature is preferably 10 to 35? C., and more preferably 15 to 30? C.

[0117] Moreover, the algae are preferably cultured under irradiation with light so that photosynthesis can be made. The light irradiation only needs to be made under conditions in which the photosynthesis can be made, and artificial light or sunlight may be applied. From viewpoints of the growth promotion of the algae and the improvement in the productivity of fatty acids, irradiance during the light irradiation is preferably in the range of 100 to 50,000 lx, more preferably in the range of 300 to 10,000 lx, and further preferably 1,000 to 6,000 lx. Moreover, an interval of the light irradiation is not particularly limited. From the viewpoints in a manner similar to the viewpoints described above, the irradiation is preferably performed under a light and dark cycle. In 24 hours, a light period is preferably from 8 to 24 hours, more preferably from 10 to 18 hours, and further preferably 12 hours.

[0118] Moreover, the algae are preferably cultured in the presence of a carbon dioxide-containing gas or in a culture medium containing carbonate such as sodium hydrogen carbonate so that the photosynthesis can be made. A concentration of carbon dioxide in the gas is not particularly limited. From viewpoints of the growth promotion and the improvement in the productivity of fatty acids, the concentration is preferably from 0.03 (which is the same degree as the concentration under atmospheric conditions) to 10%, more preferably from 0.05 to 5%, further preferably from 0.1 to 3%, and furthermore preferably from 0.3 to 1%. A concentration of the carbonate is not particularly limited. When the sodium hydrogen carbonate is used, for example, from viewpoints of the growth promotion and the improvement in the productivity of fatty acids, the concentration is preferably from 0.01 to 5% by mass, more preferably from 0.05 to 2% by mass, and further preferably from 0.1 to 1% by mass.

[0119] A culture time is not particularly limited, and the culture may be performed for a long time (for example, about 150 days) so that an alga body in which the lipids are accumulated at a high concentration can grow at a high concentration. From viewpoints of the growth promotion of the algae, the improvement in the productivity of fatty acids, and the reduction of production cost, the culture time is preferably from 3 to 90 days, more preferably from 3 to 30 days, and further preferably from 7 to 30 days. The culture may be performed in any of aerated and agitated culture, shaking culture or static culture. From a viewpoint of improving air-permeability, aerated and agitated culture, or shaking culture is preferred, and aerated and agitated culture is more preferred.

[0120] A method of collecting the lipids from the cultured product or growth product is appropriately selected from an ordinary method. For example, lipid components can be isolated and collected from the above-described cultured product or growth product by means of filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, chloroform/methanol extraction, hexane extraction, ethanol extraction, or the like. In the case of carrying out the larger scales culturing, lipids can be obtained by collecting oil components from the cultured product or growth product through pressing or extraction, and then performing general purification processes such as degumming, deacidification, decoloration, dewaxing, and deodorization. After lipid components are isolated as such, the isolated lipids are hydrolyzed, and thereby fatty acids can be obtained. Specific examples of the method of isolating fatty acids from lipid components include a method of treating the lipid components at a high temperature of about 70? C. in an alkaline solution, a method of performing a lipase treatment, and a method of degrading the lipid components using high-pressure hot water.

[0121] The lipids produced in the production method of the present invention preferably contain fatty acids or fatty acid compounds, and more preferably contain fatty acids or fatty acid ester compounds thereof, in view of usability thereof.

[0122] In view of usability for a surfactant or the like, the fatty acid or the ester compound thereof contained in the lipid is preferably a medium-chain fatty acid or an ester compound thereof, more preferably a fatty acid having 6 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 8 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 10 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 12 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 12 or 14 carbon atoms or an ester compound thereof, more preferably a saturated fatty acid having 12 or 14 carbon atoms (lauric acid or myristic acid) or an ester compound thereof.

[0123] From a viewpoint of the productivity, the fatty acid ester compound is preferably a simple lipid or a complex lipid, more preferably a simple lipid, and further preferably a triacylglycerol.

[0124] The lipid obtained by the production method of the present invention can be utilized for food, as well as a plasticizer, an emulsifier incorporated into cosmetic products or the like, a cleansing agent such as a soap or a detergent, a fiber treatment agent, a hair conditioning agent, a disinfectant or an antiseptic.

[0125] With regard to the embodiments described above, the present invention also discloses methods of producing lipids, methods of improving lipid productivity, methods of modifying composition of fatty acids to be produced, proteins, genes, recombinant vectors, organisms, transformants, and methods of producing a transformant, described below.

<1> A method of producing lipids, containing the steps of:

[0126] culturing a transformant in which the expression of a gene encoding the following protein (A) or (B) is enhanced, and

[0127] producing fatty acids or lipids containing these fatty acids as components: [0128] (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; and [0129] (B) a protein consisting of an amino acid sequence having 64% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 83% or more, furthermore preferably 85% or more, furthermore preferably 87% or more, furthermore preferably 90% or more, furthermore preferably 93% or more, furthermore preferably 95% or more, furthermore preferably 97% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the amino acid sequence of the protein (A), and having G3PDH activity.
<2> A method of improving lipid productivity, containing the steps of:

[0130] enhancing the expression of a gene encoding the protein (A) or (B) in a transformant, and

[0131] improving the productivity of medium-chain fatty acids or lipids containing these fatty acids as components, produced in a cell of the transformant.

<3> A method of improving lipid productivity, containing the steps of:

[0132] enhancing the expression of a gene encoding the protein (A) or (B) in a transformant, and

[0133] improving the total amount of all fatty acids produced in a cell of the transformant.

<4> A method of modifying the composition of lipids, containing the steps of:

[0134] enhancing the expression of a gene encoding the protein (A) or (B) in a transformant, and

[0135] improving the productivity of medium-chain fatty acids or lipids containing these fatty acids as components produced in a cell of the transformant, to modify the composition of fatty acids or lipids in all fatty acids or all lipids to be produced.

<5> The method described in any one of the above items <1> to <4>, wherein the gene encoding the protein (A) or (B) is introduced into a host, to enhance the expression of the gene.
<6> A method of producing lipids, containing the steps of:

[0136] culturing a transformant into which a gene encoding the protein (A) or (B) is introduced, and

[0137] producing fatty acids or lipids containing these fatty acids as components.

<7> A method of improving lipid productivity, containing the steps of:

[0138] introducing a gene encoding the protein (A) or (B) into a host, and thereby producing a transformant, and

[0139] improving productivity of medium-chain fatty acids or lipids containing these fatty acids as components produced in a cell of the transformant.

<8> A method of improving lipid productivity, containing the steps of:

[0140] introducing a gene encoding the protein (A) or (B) into a host, and thereby producing a transformant, and

[0141] improving the total amount of all fatty acids produced in a cell of the transformant.

<9> A method of modifying the composition of lipids, containing the steps of:

[0142] introducing a gene encoding the protein (A) or (B) into a host, and thereby producing a transformant, and

[0143] enhancing productivity of medium-chain fatty acids or lipids containing these fatty acids as components produced in a cell of the transformant, to modify the composition of fatty acids or lipids in all fatty acids or all lipids to be produced.

<10> The method described in any one of the above items <1> to <9>, wherein the protein (B) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 167 or less, preferably 1 or more and 162 or less, more preferably 1 or more and 139 or less, further preferably 1 or more and 116 or less, furthermore preferably 1 or more and 93 or less, furthermore preferably 1 or more and 69 or less, furthermore preferably 1 or more and 60 or less, furthermore preferably 1 or more and 46 or less, furthermore preferably 1 or more and 32 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 13 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 4 or less amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein (A).
<11> The method described in any one of the above items <1> to <10>, wherein the gene encoding the protein (A) or (B) is a gene consisting of the following DNA (a) or (b):
(a) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2; and
(b) a DNA consisting of a nucleotide sequence having 59% or more, preferably 60% or more, more preferably 65% or more, further preferably 70% or more, furthermore preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 83% or more, furthermore preferably 85% or more, furthermore preferably 87% or more, furthermore preferably 90% or more, furthermore preferably 93% or more, furthermore preferably 95% or more, furthermore preferably 97% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more, identity with the nucleotide sequence of the DNA (a), and encoding the protein having G3PDH activity.
<12> The method described in the above item <11>, wherein the DNA (b) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 573 or less, more preferably 1 or more and 559 or less, further preferably 1 or more and 489 or less, furthermore preferably 1 or more and 419 or less, furthermore preferably 1 or more and 349 or less, furthermore preferably 1 or more and 279 or less, furthermore preferably 1 or more and 209 or less, furthermore preferably 1 or more and 181 or less, furthermore preferably 1 or more and 139 or less, furthermore preferably 1 or more and 97 or less, furthermore preferably 1 or more and 69 or less, furthermore preferably 1 or more and 41 or less, furthermore preferably 1 or more and 27 or less, and furthermore preferably 1 or more and 13 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (a), and encoding the protein having G3PDH activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (a) under a stringent condition, and encoding the protein having G3PDH activity.
<13> The method described in any one of the above items <1> to <12>, wherein expression of a gene encoding a TE is enhanced in the transformant.
<14> The method described in the above item <13>, wherein the TE is a TE having substrate specificity to a medium-chain acyl-ACP.
<15> The method described in the above item <13> or <14>, wherein the TE is a protein consisting of the amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 38, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, or SEQ ID NO: 65; a protein consisting of an amino acid sequence having 50% or more, preferably 60% or more, more preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and further preferably 95% or more identity with the amino acid sequence of the protein, and having TE activity for medium-chain acyl-ACP; or a protein consisting of an amino acid sequence in which 1 or several amino acids, preferably 1 or more and 149 or less amino acids, more preferably 1 or more and 119 or less amino acids, further preferably 1 or more and 104 or less amino acids, furthermore preferably 1 or more and 90 or less amino acids, furthermore preferably 1 or more and 75 or less amino acids, furthermore preferably 1 or more and 60 or less amino acids, furthermore preferably 1 or more and 45 or less amino acids, furthermore preferably 1 or more and 30 or less amino acids, or furthermore preferably 1 or 15 amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein, and having TE activity for medium-chain acyl-ACP.
<16> The method described in any one of the above items <1> to <15>, wherein expression of a gene encoding a KAS is enhanced in the transformant.
<17> The method described in the above item <16>, wherein the KAS is a KAS having medium-chain ?-ketoacyl-ACP synthase activity.
<18> The method described in the above item <16> or <17>, wherein the KAS is a protein consisting of the amino acid sequence set forth in SEQ ID NO: 48, SEQ ID NO: 75, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 79, or SEQ ID NO: 81; a protein consisting of an amino acid sequence having 50% or more, preferably 60% or more, more preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and further preferably 95% or more identity with the amino acid sequence of the protein, and having medium-chain ?-ketoacyl-ACP synthase activity; or a protein consisting of an amino acid sequence in which 1 or several amino acids, preferably 1 or more and 255 or less amino acids, more preferably 1 or more and 204 or less amino acids, further preferably 1 or more and 179 or less amino acids, furthermore preferably 1 or more and 153 or less amino acids, furthermore preferably 1 or more and 128 or less amino acids, furthermore preferably 1 or more and 102 or less amino acids, furthermore preferably 1 or more and 77 or less amino acids, furthermore preferably 1 or more and 51 or less amino acids, or furthermore preferably 1 or 26 amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein, and having medium-chain ?-ketoacyl-ACP synthase activity.
<19> The method described in any one of the above items <1> to <18>, wherein the transformant is a microorganism or a plant.
<20> The method described in the above item <19>, wherein the microorganism is a microalga.
<21> The method described in the above item <20>, wherein the microalga is an alga belonging to the genus Nannochloropsis, preferably Nannochloropsis oculata.
<22> The method described in the above item <19>, wherein the microorganism is Escherichia coli.
<23> The method described in the above item <19>, wherein the plant is Arabidopsis thaliana.
<24> The method described in any one of the above items <1> to <23>, wherein the lipids contain a medium-chain fatty acid or an ester compound thereof, preferably a fatty acid having 6 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 8 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 10 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 12 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 12 or 14 carbon atoms or an ester compound thereof, more preferably a saturated fatty acid having 12 or 14 carbon atoms (lauric acid or myristic acid) or an ester compound thereof.
<25> The protein (A) or (B) specified in any one of the above items <1> to <24>.
<26> A gene encoding the protein described in the above item <25>.
<27> A gene consisting of the DNA (a) or (b) specified in any one of the above items <1> to <24>.
<28> A recombinant vector, containing the gene described in the above item <26> or <27>.
<29> A transformant, wherein the expression of the gene described in the above item <26> or <27> is enhanced, and at least either of the productivity of medium-chain fatty acids or lipids containing these fatty acids as components, and the total amount of all fatty acids produced in a cell of the transformant is improved.
<30> A transformant, which is obtained by introducing the gene described in the above item <26> or <27> or the recombinant vector described in the above item <28> into a host.
<31> A method of producing a transformant, containing introducing the gene described in the above item <26> or <27> or the recombinant vector described in the above item <28> into a host.
<32> The transformant or the method of producing the same described in any one of the above items <29> to <31>, wherein expression of a gene encoding a TE is enhanced.
<33> The transformant or the method of producing the same described in the above item <32>, wherein the TE is a TE having substrate specificity to a medium-chain acyl-ACP.
<34> The transformant or the method of producing the same described in the above item <32> or <33>, wherein the TE is a protein consisting of the amino acid sequence set forth in SEQ ID NO: 29, SEQ ID NO: 38, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, or SEQ ID NO: 65; a protein consisting of an amino acid sequence having 50% or more, preferably 60% or more, more preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and further preferably 95% or more identity with the amino acid sequence of the protein, and having TE activity for medium-chain acyl-ACP; or a protein consisting of an amino acid sequence in which 1 or several amino acids, preferably 1 or more and 149 or less amino acids, more preferably 1 or more and 119 or less amino acids, further preferably 1 or more and 104 or less amino acids, furthermore preferably 1 or more and 90 or less amino acids, furthermore preferably 1 or more and 75 or less amino acids, furthermore preferably 1 or more and 60 or less amino acids, furthermore preferably 1 or more and 45 or less amino acids, furthermore preferably 1 or more and 30 or less amino acids, or furthermore preferably 1 or 15 amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein, and having TE activity for medium-chain acyl-ACP.
<35> The transformant or the method of producing the same described in any one of the above items <29> to <34>, wherein expression of a gene encoding a KAS is enhanced.
<36> The transformant or the method of producing the same described in the above item <35>, wherein the KAS is a KAS having medium-chain ?-ketoacyl-ACP synthase activity.
<37> The transformant or the method of producing the same described in the above item <35> or <36>, wherein the KAS is a protein consisting of the amino acid sequence set forth in SEQ ID NO: 48, SEQ ID NO: 75, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 79, or SEQ ID NO: 81; a protein consisting of an amino acid sequence having 50% or more, preferably 60% or more, more preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and further preferably 95% or more identity with the amino acid sequence of the protein, and having medium-chain ?-ketoacyl-ACP synthase activity; or a protein consisting of an amino acid sequence in which 1 or several amino acids, preferably 1 or more and 255 or less amino acids, more preferably 1 or more and 204 or less amino acids, further preferably 1 or more and 179 or less amino acids, furthermore preferably 1 or more and 153 or less amino acids, furthermore preferably 1 or more and 128 or less amino acids, furthermore preferably 1 or more and 102 or less amino acids, furthermore preferably 1 or more and 77 or less amino acids, furthermore preferably 1 or more and 51 or less amino acids, or furthermore preferably 1 or 26 amino acids, are deleted, substituted, inserted or added to the amino acid sequence of the protein, and having medium-chain ?-ketoacyl-ACP synthase activity.
<38> The transformant or the method of producing the same described in any one of the above items <29> to <37>, wherein the transformant or the host is a microorganism or a plant.
<39> The transformant or the method of producing the same described in the above item <38>, wherein the microorganism is a microalga.
<40> The transformant or the method of producing the same described in the above item <39>, wherein the microalga is an alga belonging to the genus Nannochloropsis, more preferably Nannochloropsis oculata.
<41> The transformant or the method of producing the same described in the above item <38>, wherein the microorganism is Escherichia coli.
<42> The transformant or the method of producing the same described in the above item <38>, wherein the plant is Arabidopsis thaliana.
<43> Use of the protein, the gene, the recombinant vector, the transformant or a transformant obtained by the method of producing a transformant described in any one of the above items <25> to <42>, for producing lipids.
<44> The use described in the above item <43>, wherein the lipids contain a medium-chain fatty acid or an ester compound thereof, preferably a fatty acid having 6 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 8 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 10 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 12 or more and 14 or less carbon atoms or an ester compound thereof, more preferably a fatty acid having 12 or 14 carbon atoms or an ester compound thereof, more preferably a saturated fatty acid having 12 or 14 carbon atoms (lauric acid or myristic acid) or an ester compound thereof.

EXAMPLES

[0144] Hereinafter, the present invention will be described more in detail with reference to Examples, but the present invention is not limited thereto. Herein, the nucleotide sequences of the primers used in Examples are shown in Table 1.

TABLE-US-00001 TABLE1 Primer No. Nucleotidesequence(5 .fwdarw. 3) SEQIDNO: 5 tcttttttgtgaagcatgattgaacaaga SEQIDNO:5 tggatt 6 tttcccccatcccgatcagaagaactcgt SEQIDNO:6 caagaa 7 cgagctcggtacccgactgcgcatggatt SEQIDNO:7 gaccga 8 atatcaagaagctgtctttt SEQIDNO:8 9 tcgggatgggggaaaaaaacctctg SEQIDNO:9 10 actctagaggatcccctttcgtaaataaa SEQIDNO:10 tcagctc 12 gggatcctctagagtcgacctgcaggcat SEQIDNO:12 gcaagc 13 cgggtaccgagctcgaattc SEQIDNO:13 14 cagcccgcatcaacaatgacccaaccacc SEQIDNO:14 cagcac 15 ctcttccacagaagctcacaggtcattta SEQIDNO:15 ccaaag 16 cgagctcggtacccgttcttccgcttgtt SEQIDNO:16 gctgcc 17 tgttgatgcgggctgagattggtgg SEQIDNO:17 20 gcttctgtggaagagccagtg SEQIDNO:20 21 caatccatgcgcagtctgatcttgtccat SEQIDNO:21 ctcgtg 22 actgcgcatggattgaccga SEQIDNO:22 24 tcttttttgtgaagctatggccaagctga SEQIDNO:24 ccagcgc 25 tttcccccatcccgattagtcctgctcct SEQIDNO:25 cggccac 27 cgcggtgttgcgcgctggaagccgaagcc SEQIDNO:27 gaagct 28 ctcttccacagaagcttacaccctcggtt SEQIDNO:28 ctgcgg 32 cgagctcggtacccgggcggtcttttgtc SEQIDNO:32 ctttcctc 33 aatctgctcggaggggaggatc SEQIDNO:33 34 ccctccgagcagattatgaagaccgccgc SEQIDNO:34 tctcctc 35 gcgcgcaacaccgcgggtgcgggagaac SEQIDNO:35 36 gcggccgctctagagtgcgagacggccca SEQIDNO:36 cgccgggac 37 acaaaatattaacgcctagctaatatcaa SEQIDNO:37 ttttctttgg 40 ctctagagcggccgccaccg SEQIDNO:40 41 gcgttaatattttgttaaaattcg SEQIDNO:41 42 ctggacaataccatgggatgggccttttt SEQIDNO:42 cgccgccaag 43 catggtattgtccagcaaag SEQIDNO:43 46 tcttttttgtgaagcatggtcgagattcg SEQIDNO:46 aagcat 47 tttcccccatcccgatcagaagaactcgt SEQIDNO:47 ccaaca 50 aaatcatacagcaggatgcgggtctccag SEQIDNO:50 tagcgc 51 ctcttccacagaagcttacttgaacggtt SEQIDNO:51 tgaag 53 cgagctcggtacccggctgctgccccgac SEQIDNO:53 cgtatc 54 cctgctgtatgattttggcac SEQIDNO:54 56 cagcccgcatcaacaatgtctgctgctgc SEQIDNO:56 tgatag 57 ctcttccacagaagcctaatcttcatgta SEQIDNO:57 gatcta

Example 1 Production of a Transformant in which a NoG3PDH Gene is Introduced into Nannochloropsis oculata, and Production of Fatty Acids Using the Transformant

(1) Construction of Plasmid for Neomycin Resistance Gene Expression

[0145] A neomycin resistance gene (SEQ ID NO: 3), and a tubulin promoter sequence (SEQ ID NO: 4) derived from Nannochloropsis gaditana strain CCMP 526 described in a literature (Randor Radakovits, et al., Nature Communications, DOI:10.1038/ncomms1688, 2012) were artificially synthesized.

[0146] Using the thus-synthesized DNA fragments as a template, and a pair of the primer Nos. 5 and 6, and a pair of the primer Nos. 7 and 8 shown in Table 1, PCRs were carried out, to amplify the neomycin resistance gene and the tubulin promoter sequence, respectively.

[0147] Further, using a genome of Nannochloropsis oculata strain NIES-2145 as a template, and a pair of the primer Nos. 9 and 10 shown in Table 1, PCR was carried out to amplify the heat shock protein terminator sequence (SEQ ID NO: 11).

[0148] Furthermore, using a plasmid vector pUC19 (manufactured by Takara Bio) as a template, and a pair of the primer Nos. 12 and 13 shown in Table 1, PCR was carried out to amplify the plasmid vector pUC19.

[0149] These four amplified fragments were treated by restriction enzyme DpnI (manufactured by TOYOBO) respectively, and were purified using a High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Then, obtained four fragments were fused using an In-Fusion HD Cloning Kit (manufactured by Clontech) to construct a plasmid for neomycin resistance gene expression.

[0150] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the tubulin promoter sequence, the neomycin resistance gene and the heat shock protein terminator sequence were linked in this order.

(2) Construction of Plasmid for NoG3PDH Gene Expression

[0151] Nannochloropsis oculata strain NIES-2145 was obtained from National Institute for Environmental Studies (NIES) so as to be used. Nannochloropsis oculata strain NIES-2145 was fully cultured in f/2 liquid medium (75 mg of NaNO.sub.3, 6 mg of NaH.sub.2PO.sub.4.2H.sub.2O, 0.5 ?g of vitamin B12, 0.5 ?g of biotin, 100 ?g of thiamine, 10 mg of Na.sub.2SiO.sub.3.9H.sub.2O, 4.4 mg of Na.sub.2EDTA.2H.sub.2O, 3.16 mg of FeCl.sub.3.6H.sub.2O, 12 ?g of FeCl.sub.3.6H.sub.2O, 21 ?g of ZnSO.sub.4.7H.sub.2O, 180 ?g of MnCl.sub.2.4H.sub.2O, 7 ?g of CuSO.sub.4.5H.sub.2O, 7 ?g of Na.sub.2MoO.sub.4.2H.sub.2O/artificial sea water 1 L), and then, the resultant was inoculated in 50 mL of f/2 medium so as to be 10% of the resultant in the f/2 medium, and cultured for six days at 25? C. under an atmosphere of 0.3% CO.sub.2. After culturing, collected samples were crushed by using Multi-beads shocker, and then RNA purification was conducted using RNeasy Plant Mini Kit (manufactured by Qiagen). The cDNA library was prepared by thus-obtained total RNA, using SuperScript III First-Strand Synthesis System for RT-PCR (manufactured by invitrogen). PCR using a pair of the primer Nos. 14 and 15 shown in Table 1 and the above cDNA as a template, was carried out to prepare a NoG3PDH gene fragment.

[0152] Further, using a genome of Nannochloropsis oculata strain NIES-2145 as a template, and a pair of the primer Nos. 16 and 17 shown in Table 1, PCR was carried out to amplify the LDSP promoter sequence (SEQ ID NO: 18).

[0153] Furthermore, a VCP1 terminator sequence (SEQ ID NO: 19) was artificially synthesized based on the complete cds sequence (Accession number: JF957601.1) of the VCP1 (violaxanthin/(chlorophyll a)-binding protein) gene of Nannochloropsis sp. strain W2J3B registered in GenBank. Using the thus-synthesized DNA fragments as a template, and a pair of the primer Nos. 20 and 21 shown in Table 1, PCR was carried out to prepare the VCP1 terminator sequence.

[0154] Furthermore, using the above-described plasmid for neomycin resistance gene expression as a template, and a pair of the primer Nos. 22 and 13 shown in Table 1, PCR was carried out to amplify a fragment containing the cassette for neomycin resistance gene expression (the tubulin promoter sequence, the neomycin resistance gene, and the heat shock protein terminator sequence) and the pUC19 vector sequence.

[0155] These four fragments were fused by a method in a manner similar to described above, to construct plasmids for NoG3PDH gene expression.

[0156] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the LDSP promoter sequence, the NoG3PDH gene, the VCP1 terminator sequence, the tubulin promoter sequence, the neomycin resistance gene and the heat shock protein terminator sequence were linked in this order.

(3) Introduction of a Fragment for NoG3PDH Gene Expression into Nannochloropsis

[0157] Using the above-described plasmid for the NoG3PDH gene expression as a template, and a pair of the primer Nos. 16 and 10 shown in Table 1, PCR was carried out to amplify the fragment for NoG3PDH gene expression (a DNA fragment containing the LDSP promoter sequence, the NoG3PDH gene, the VCP1 terminator sequence, the tubulin promoter sequence, the neomycin resistance gene, and the heat shock protein terminator sequence).

[0158] The amplified DNA fragment was purified using High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Herein, sterilized water was used for elution upon purification without using an elution buffer included in the kit.

[0159] About 1?10.sup.9 cells of Nannochloropsis oculata strain NIES-2145 (obtained from National Institute for Environmental Studies (NIES)) were washed with 384 mM sorbitol solution to completely remove a salt, and the resultant was used as a host cell for transformation. The fragment for NoG3PDH gene expression as amplified above was mixed by about 500 ng with the host cell, and electroporation was carried out under the conditions of 50 ?F, 500? and 2,200 v/2 mm.

[0160] After one day recovery cultivation in f/2 liquid medium (75 mg of NaNO.sub.3, 6 mg of NaH.sub.2PO.sub.4.2H.sub.2O, 0.5 ?g of vitamin B12, 0.5 ?g of biotin, 100 ?g of thiamine, 10 mg of Na.sub.2SiO.sub.3.9H.sub.2O, 4.4 mg of Na.sub.2EDTA.2H.sub.2O, 3.16 mg of FeCl.sub.3.6H.sub.2O, 12 ?g of FeCl.sub.3.6H.sub.2O, 21 ?g of ZnSO.sub.4.7H.sub.2O, 180 ?g of MnCl.sub.2.4H.sub.2O, 7 ?g of CuSO.sub.4.5H.sub.2O, 7 ?g of Na.sub.2MoO.sub.4.2H.sub.2O/artificial sea water 1 L), the resultant was inoculated in f/2 agar medium containing 500 ?g/mL of neomycin, and cultured for two to three weeks under 12 h/12 h light-dark conditions at 25? C. under an atmosphere of 0.3% CO.sub.2. Obtained colonies were selected as the transgenic strain (G3PDH).

(4) Production of Fatty Acids Using the Transformant

[0161] The selected strain was inoculated to 50 mL of medium in which a nitrogen concentration in the f/2 medium was reinforced 15 times, and a phosphorus concentration therein was reinforced 5 times (hereinafter, referred to as N15P5 medium), and subjected to shaking culture for four weeks under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 10 mL of the preculture fluid was inoculated to 40 mL of the N15P5 medium, and subjected to shaking culture under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2. After three weeks cultivation, lipid components contained in the culture fluid were analyzed by the method described below.

[0162] In addition, as a negative control, an experiment was also conducted on the transformant (WT), in which only neomycin resistance gene was introduced into the host cell.

(5) Extraction of Lipids and Analysis of Fatty Acids Contained Therein

[0163] To 1 mL of the culture fluid, 50 ?L of 1 mg/mL 7-pentadecanone as an internal standard was added, and then 0.5 mL of chloroform, 1 mL of methanol and 10 ?L of 2N hydrochloric acid were further added. The mixture was vigorously stirred and then was left for 30 minutes. Further, 0.5 mL of chloroform and 0.5 mL of 1.5% KCl were added thereto. The mixture was stirred and centrifuged for 15 minutes at 3,000 rpm, and then the chloroform layer (lower layer) was collected with Pasteur pipette.

[0164] A nitrogen gas was blown onto the resultant chloroform layer to be dried into solid. Then, 0.7 mL of 0.5 N potassium hydroxide/methanol solution was added to the sample, and the mixture was kept warm at 80? C. for 30 minutes. Next, 1 mL of 14% boron trifluoride-methanol solution (manufactured by Sigma-Aldrich) was added to the sample, and the mixture was kept warm at 80? C. for 10 minutes. Thereafter, 1 mL of hexane and 1 mL of saturated saline were added thereto, and the mixture was vigorously stirred and then was left for 30 minutes at room temperature. Then, the hexane layer was collected to obtain fatty acid methyl esters.

[0165] Under the measuring conditions as follows, the obtained fatty acid methyl esters were provided for gas chromatographic analysis.

<Gas Chromatography Conditions>

[0166] Capillary column: DB-1 MS (30 m?200 ?m?0.25 ?m, manufactured by J & W Scientific)
Mobile phase: high purity helium
Flow rate in column: 1.0 mL/minute
Elevated temperature program: 100? C. (1 minute).fwdarw.10? C./minute.fwdarw.300? C. (5 minutes)
Equilibrating time: 1 minute
Injection port: split injection (split ratio: 100:1), pressure: 14.49 psi, 104 mL/minute
Amount of injection: 1 ?L
Cleaning vial: methanol/chloroform
Detector temperature: 300? C.

[0167] Moreover, the fatty acid methyl esters were identified by providing the identical sample under identical conditions described above.

[0168] Amounts of the fatty acid methyl esters of each of the fatty acids were quantitatively determined based on the peak areas of waveform data obtained by the above gas chromatographic analysis. The peak area corresponding to each of the fatty acid methyl esters was compared with that of 7-pentadecanone as the internal standard, and carried out corrections between the samples, and then the amount of each of the fatty acids per liter of the culture fluid was calculated. Further, the total amount of the fatty acids (FA) was calculated by summing the amounts of each of the fatty acids thus obtained, and ratio of each of the fatty acids in the total amount of the fatty acids was calculated.

[0169] Table 2 shows the results. Herein, in Table below, Fatty Acid Composition (% TFA) presents a ratio of a weight of each fatty acid relative to a weight of the total fatty acid (weight percent). Herein, n designates an integer of 0 to 5. For example, when C18:n is described, the description means a total of each fatty acid having compositions of C18:0, C18:1, C18:2, C18:3, C18:4 and C18:5.

TABLE-US-00002 TABLE 2 (n = 3) Fatty acid composition (% TFA) FA C12:0 C14:0 C16:1 C16:0 C18:n C20:n (mg/L) WT 0.2 ? 0.1 5.9 ? 0.5 31.8 ? 0.3 33.5 ? 0.1 19.9 ? 0.3 8.7 ? 0.3 3655.8 ? 233.9 G3PDH 0.4 ? 0.0 10.7 ? 0.3 28.7 ? 0.4 29.2 ? 0.9 21.3 ? 0.3 9.7 ? 0.5 3818.5 ? 242.9

[0170] As shown in Table 2, it was confirmed that the ratios of lauric acid (C12:0) and myristic acid (C14:0) were significantly increased and the total amount of all fatty acids was tend to be increased, by introducing the NoG3PDH gene.

Example 2 Production of a Transformant in which a BTE Gene and a NoG3PDH Gene are Introduced into Nannochloropsis oculata, and Production of Fatty Acids Using the Transformant

(1) Construction of Plasmid for Zeocin Resistance Gene Expression

[0171] Zeocin resistance gene fragment was amplified by carrying out PCR by using the DNA fragment of the zeocin resistance gene (SEQ ID NO: 23) artificially synthesized as a template, and a pair of the primer Nos. 24 and 25 shown in Table 1.

[0172] Using the plasmid for neomycin resistance gene expression constructed in Example 1 as a template, and a pair of the primer Nos. 9 and 8 shown in Table 1, PCR was carried out to amplify the DNA fragment containing the heat shock protein terminator sequence, pUC19 vector sequence, and the tubulin promoter sequence.

[0173] Obtained DNA fragments were fused by a method in a manner similar to that described in Example 1, to construct a plasmid for zeocin resistance gene expression.

[0174] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence were linked in this order.

(2) Construction of Plasmid for BTE Gene Expression

[0175] The nucleotide sequence (SEQ ID NO: 26) encoding the BTE which is described in WO 92/20236 was artificially synthesized. Using the thus-synthesized DNA fragment as a template, and a pair of the primer Nos. 27 and 28 shown in Table 1, PCR was carried out, to prepare the BTE gene fragment. Note that, in the DNA fragment, the segment corresponding to the chloroplast transit signal (85 amino acids of the N-terminal) of BTE (SEQ ID NO: 29) was deleted.

[0176] Further, a VCP1 promoter sequence (SEQ ID NO: 30), a VCP1 chloroplast transit signal sequence (SEQ ID NO: 31) and a VCP1 terminator sequence (SEQ ID NO: 19) were artificially synthesized based on the complete cds sequence (Accession number: JF957601.1) of the VCP1 (violaxanthin/(chlorophyll a)-binding protein) gene of Nannochioropsis sp. strain W2J3B registered in GenBank. Using the thus-synthesized DNA fragments as a template, and a pair of the primer Nos. 32 and 33, a pair of the primer Nos. 34 and 35, and a pair of the primer Nos. 20 and 21 shown in Table 1, PCRs were carried out, to prepare the VCP1 promoter sequence, VCP1 chloroplast transit signal sequence, and VCP1 terminator sequence, respectively.

[0177] Furthermore, using the above-described plasmid for zeocin resistance gene expression as a template, and a pair of the primer Nos. 22 and 13 shown in Table 1, PCR was carried out to amplify a DNA fragment containing the tubulin promoter sequence, the zeocin resistance gene, the heat shock protein terminator sequence, and the pUC19 vector sequence.

[0178] DNA fragments obtained by the method described above, were fused by a method in a manner similar to that described in Example 1, to construct a plasmid for BTE gene expression.

[0179] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the VCP1 promoter sequence, the VCP1 chloroplast transit signal sequence, the BTE gene fragment, the VCP1 terminator sequence, the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence were linked in this order.

(3) Introduction of a BTE Gene and a NoG3PDH Gene into Nannochloropsis oculata

[0180] Using the above-described plasmid for the BTE gene expression as a template, and a pair of the primer Nos. 32 and 10 shown in Table 1, PCR was carried out to amplify the fragment for BTE gene expression (a DNA fragment containing the VCP1 promoter sequence, the VCP1 chloroplast transit signal sequence, the BTE gene, the VCP1 terminator sequence, the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence).

[0181] The amplified DNA fragment was purified using High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Herein, sterilized water was used for elution upon purification without using an elution buffer included in the kit.

[0182] The BTE gene was introduced into Nannochloropsis oculata strain NIES-2145 according to the same method as in Example 1. Then the resultant was cultured in zeocin-containing f/2 medium. Obtained colonies were selected as the BTE gene transgenic strain (BTE).

[0183] Further, using the BTE gene transgenic strain as a host, the NoG3PDH gene was introduced according to the same method as in Example 1 Obtained colonies were selected as the BTE and NoG3PDH genes transgenic strain (BTE+NoG3PDH).

(4) Production of Fatty Acids Using the Transformant

[0184] The selected strains were inoculated to 50 mL of the N15P5 medium, and subjected to shaking culture for four weeks under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 10 mL of the preculture fluid was inoculated to 40 mL of N15P5 medium, and subjected to shaking culture under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2.

[0185] After three weeks cultivation, lipid components contained in the culture fluid were analyzed by the method described in Example 1. Table 3 shows the results.

TABLE-US-00003 TABLE 3 (n = 3) Fatty acid composition (% TFA) FA C12:0 C14:0 C16:1 C16:0 C18:n C20:n (mg/L) BTE 5.5 ? 0.0 6.1 ? 0.0 25.9 ? 0.6 26.3 ? 0.4 14.5 ? 0.7 21.7 ? 1.5 2298.6 ? 177.9 BTE + 13.4 ? 0.7 8.2 ? 0.2 21.9 ? 0.4 22.2 ? 0.3 14.3 ? 0.2 20.0 ? 0.1 2381.6 ? 198.4 NoG3PDH

[0186] As shown in Table 3, it was confirmed that the ratios of lauric acid (C12:0) and myristic acid (C14:0) were significantly increased and the total amount of all fatty acids was tend to be increased, by introducing the NoG3PDH gene into the strain into which the BTE gene has been introduced.

Example 3 Production of a Transformant in which a Modified NoTE Gene and a NoG3PDH Gene are Introduced into Nannochloropsis oculata, and Production of Fatty Acids Using the Transformant

(1) Obtaining of a NoTE Gene and Construction of Plasmid for NoTE Gene Expression

[0187] Using the cDNA of Nannochloropsis oculata strain NIES-2145 prepared in Example 1 as a template, and a pair of the primer Nos. 36 and 37 shown in Table 1, PCR was carried out to prepare the gene fragments consisting of the nucleotide sequence of the 262nd to 864th positions set forth in SEQ ID NO: 39.

[0188] Further, using the plasmid vector of pBluescriptII SK(?) (manufactured by Stratagene) as a template, and a pair of the primer Nos. 40 and 41 shown in Table 1, PCR was carried out to amplify the pBluescriptII SK(?), then the template was digested by restriction enzyme DpnI (manufactured by TOYOBO).

[0189] These two fragments were purified using a High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Then, the obtained two fragments were fused using an In-Fusion HD Cloning Kit (manufactured by Clontech) to construct a plasmid NoTE_262 for NoTE gene expression. This plasmid NoTE_262 was constructed for expression of a protein in the form of removing amino acid residues of the 1st to 87th positions on an N-terminal side of the amino acid sequence set forth in SEQ ID NO: 38, and fusing, to the upstream of the removed terminus, amino acid residues of the 1st to 29th positions on an N-terminal side of a LacZ protein derived from the plasmid vector pBluescriptII SK(?).

[0190] In the following plasmid notation, NoTE_262 means that a plasmid had the nucleotide sequence of the 262nd to 864th positions set forth in SEQ ID NO: 39 as a nucleotide sequence encoding a polypeptide consisting of the amino acid sequence of the 88th to 287th positions set forth in SEQ ID NO: 38.

[0191] PCR was carried out by using the plasmid NoTE_262 as a template, and a pair of the primer Nos. 42 and 43 shown in Table 1, to obtain gene fragments (SEQ ID NO: 44) in which a part of nucleotides of the 262nd to 864th positions of the nucleotide sequence set forth in SEQ ID NO: 39 was subjected to mutation. The plasmids for modified NoTE expression NoTE_262 (V204W), was constructed by using the gene fragment according to a technique in a manner similar to the above-described manner. Herein, the nucleotide sequence set forth in SEQ ID NO: 44 is the nucleotide sequence wherein a codon encoding the valine of the 204th position of the amino acid sequence set forth in SEQ ID NO: 38 was substituted with a codon encoding tryptophan (TGG).

[0192] Using the plasmid NoTE_262 (V204W) as a template, and a pair of the primer Nos. 41 and 42 shown in Table 1, PCR was carried out to prepare a modified NoTE gene fragment consisting of the nucleotide sequence set forth in SEQ ID NO: 44.

[0193] According to the same method as in Example 2, the VCP1 promoter sequence, the VCP1 chloroplast transit sequence, and the VCP1 terminator sequence were prepared, respectively.

[0194] Further, according to the same method as in Example 1, the plasmid vector pUC19 was amplified.

[0195] The modified NoTE gene fragment, the VCP1 promoter sequence, the VCP1 chloroplast transit signal sequence, and the VCP1 terminator sequence were fused with plasmid vector pUC19 by a method in a manner similar to that described in Example 1, to construct a plasmid NoTE_262 (V204W)_Nanno for modified NoTE gene expression. Herein, the expression plasmid consisted of the pUC19 vector sequence and a sequence for NoTE gene expression in which the VCP1 promoter sequence, the VCP1 chloroplast transit signal sequence, the modified NoTE gene fragment, and the VCP1 terminator sequence were linked in this order.

[0196] Using the plasmid NoTE_262 (V204W)_Nanno as a template, and a pair of the primer Nos. 32 and 21 shown in Table 1, PCR was carried out to prepare a gene fragment consisted of the VCP1 promoter sequence, the VCP1 chloroplast transit signal sequence, the modified NoTE gene, and the VCP1 terminator sequence.

[0197] Further, the plasmid for zeocin resistance gene expression constructed in Example 2 as a template, and a pair of the primer Nos. 22 and 13 shown in Table 1, PCR was carried out to amplify a gene fragment consisted of the tubulin promoter sequence, the zeocin resistance gene, the heat shock protein terminator sequence, and the pUC19 vector sequence.

[0198] The obtained gene fragments were fused by a method in a manner similar to that described in Example 1, to construct a plasmid for modified NoTE gene expression.

[0199] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the VCP1 promoter sequence, the VCP1 chloroplast transit signal sequence, the modified NoTE gene fragment, the VCP1 terminator sequence, the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence were linked in this order.

(3) Introduction of a Modified NoTE Gene and a NoG3PDH Gene into Nannochloropsis oculata

[0200] Using the above-described plasmid for the modified NoTE gene expression as a template, and a pair of the primer Nos. 32 and 10 shown in Table 1, PCR was carried out to amplify the fragment for modified NoTE gene expression (a DNA fragment consisted of the VCP1 promoter sequence, the VCP1 chloroplast transit signal sequence, the modified NoTE gene, the VCP1 terminator sequence, the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence).

[0201] The amplified gene fragment was purified using High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Herein, sterilized water was used for elution upon purification without using an elution buffer included in the kit.

[0202] The modified NoTE gene was introduced into Nannochloropsis oculata strain NIES-2145 according to the same method as in Example 1. Then the resultant was cultured in zeocin-containing f/2 medium. Obtained colonies were selected as the modified NoTE gene transgenic strain (NoTE).

[0203] Further, using the modified NoTE gene transgenic strain as a host, the NoG3PDH gene was introduced according to the same method as in Example 1. Obtained colonies were selected as the modified NoTE and NoG3PDH genes transgenic strain (NoTE+NoG3PDH).

(4) Production of Fatty Acids Using the Transformant

[0204] The selected strains were inoculated to 50 mL of the N15P5 medium, and subjected to shaking culture for four weeks under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 10 mL of the preculture fluid was inoculated to 40 mL of N15P5 medium, and subjected to shaking culture under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2.

[0205] After three weeks cultivation, lipid components contained in the culture fluid were analyzed by the method described in Example 1. Table 4 shows the results.

TABLE-US-00004 TABLE 4 (n = 3) Fatty acid composition (% TFA) FA C12:0 C14:0 C16:1 C16:0 C18:n C20:n (mg/L) NoTE 6.8 ? 0.1 13.1 ? 0.2 28.9 ? 0.7 22.0 ? 1.0 14.5 ? 0.2 14.8 ? 1.0 3658.1 ? 208.2 NoTE + 10.3 ? 0.5 17.8 ? 0.6 24.6 ? 0.7 15.7 ? 2.0 14.9 ? 0.9 16.7 ? 3.0 3849.0 ? 131.6 G3PDH

[0206] As shown in Table 4, it was confirmed that the ratios of lauric acid (C12:0) and myristic acid (C14:0) were significantly increased and the total amount of all fatty acids was tend to be increased, by introducing the NoG3PDH gene into the strain into which the modified NoTE gene was introduced.

Example 4 Production of a Transformant in which a BTE Gene, a NoKAS IV Gene, and NoG3PDH are Introduced into Nannochloropsis oculata, and Production of Fatty Acids Using the Transformant

(1) Construction of Plasmid for Paromomycin Resistance Gene Expression

[0207] Using the DNA fragment of the paromomycin resistance gene (SEQ ID NO: 45) artificially synthesized as a template, and a pair of the primer Nos. 46 and 47 shown in Table 1, PCR was carried out to amplify the paromomycin resistance gene.

[0208] Further, using the plasmid of neomycin resistance gene constructed in Example 1 as a template, and a pair of the primer Nos. 9 and 8 shown in Table 1, PCR was carried out to amplify a DNA fragment containing the heat shock protein terminator sequence, the pUC19 vector sequence, and the tubulin promoter sequence.

[0209] The obtained DNA fragments were fused by a method in a manner similar to that described in Example 1, to construct a plasmid for paromomycin resistance gene expression.

[0210] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the tubulin promoter sequence, the paromomycin resistance gene, and the heat shock protein terminator sequence were linked in this order.

(2) Obtaining of a NoKAS IV, Gene and Construction of Plasmid for NoKAS IV Gene Expression

[0211] Using the cDNA of Nannochloropsis oculata strain NIES-2145 prepared in Example 1 as a template, and a pair of the primer Nos. 50 and 51 shown in Table 1, PCR was carried out to prepare the NoKAS IV gene fragment set forth in SEQ ID NO: 49.

[0212] Next, ubiquitin promoter sequence (SEQ ID NO: 52) derived from Nannochloropsis gaditana strain CCMP 526 described in Randor Radakovits, et al., Nature Communications, DOI:10.1038/ncomms1688, 2012 was artificially synthesized.

[0213] Further, using the DNA fragment of the VCP1 terminator sequence artificially synthesized by a method in a manner similar to that described above as a template, and a pair of the primer Nos. 20 and 21 shown in Table 1, PCR was carried out, to prepare the VCP1 terminator sequence.

[0214] Furthermore, using the above-described plasmid for paromomycin resistance gene expression as a template, and a pair of the primer Nos. 22 and 13 shown in Table 1, PCR was carried out to amplify a DNA fragment containing the tubulin promoter sequence, the paromomycin resistance gene, the heat shock protein terminator sequence, and the pUC19 vector sequence.

[0215] The obtained four prepared fragments were fused by a method in a manner similar to that described in Example 1, to construct a plasmid for NoKAS IV gene expression.

[0216] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the ubiquitin promoter sequence, the NoKAS IV gene fragment, the tubulin promoter sequence, the paromomycin resistance gene and the heat shock protein terminator sequence were linked in this order.

(3) Introduction of a BTE Gene, a NoKAS IV Gene, and a NoG3PDH Gene into Nannochloropsis oculata

[0217] Using the above-described plasmid for the NoKAS IV gene expression as a template, and a pair of the primer Nos. 53 and 10 shown in Table 1, PCR was carried out to amplify the fragment for NoKAS IV gene expression (a DNA fragment containing the ubiquitin promoter sequence, the NoKAS IV gene, the VCP1 terminator sequence, the tubulin promoter sequence, the paromomycin resistance gene, and the heat shock protein terminator sequence).

[0218] The amplified DNA fragment was purified using High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Herein, sterilized water was used for elution upon purification without using an elution buffer included in the kit.

[0219] Using the BTE gene transgenic strain (BTE) prepared in Example 2 as a host, the NoKAS IV gene was introduced according to the same method as in Example 1. Then the resultant was cultured in paromomycin-containing f/2 medium. Obtained colonies were selected as the BTE and NoKAS IV genes transgenic strain (BTE+NoKAS IV).

[0220] Further, using the BTE and NoKAS IV genes transgenic strain (BTE+NoKAS IV) as a host, the NoG3PDH gene was introduced according to the same method as in Example 1 Then the resultant was cultured in neomycin-containing f/2 medium. Obtained colonies were selected as the BTE, NoKAS IV, and NoG3PDH genes transgenic strain (NoTE+NoG3PDH+NoG3PDH).

(4) Production of Fatty Acids Using the Transformant

[0221] The selected strains were inoculated to 50 mL of the N15P5 medium, and subjected to shaking culture for four weeks under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 10 mL of the preculture fluid was inoculated to 40 mL of N15P5 medium, and subjected to shaking culture under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2.

[0222] After three weeks cultivation, lipid components contained in the culture fluid were analyzed by the method described in Example 1. Table 5 shows the results.

TABLE-US-00005 TABLE 5 (n = 3) Fatty acid composition (% TFA) FA C12:0 C14:0 C16:1 C16:0 C18:n C20:n (mg/L) BTE + 8.5 ? 0.4 7.6 ? 1.2 27.2 ? 1.9 24.1 ? 1.8 14.2 ? 0.8 18.4 ? 2.0 2750.3 ? 177.3 KAS IV BTE + 17.5 ? 1.0 13.1 ? 0.7 22.2 ? 1.2 15.4 ? 1.2 13.7 ? 1.4 18.1 ? 0.3 4127.3 ? 240.8 KAS IV + G3PDH

[0223] As shown in Table 5, it was confirmed that the ratios of lauric acid (C12:0) and myristic acid (C14:0) and the total amount of all fatty acids were significantly increased, by introducing the NoG3PDH gene into the strain into which the BTE gene and the NoKAS IV gene have been introduced.

(5) Fractionation of TAG and Analysis of Fatty Acids Contained in TAG

[0224] To 1 mL of the culture fluid, 50 ?L of 1 mg/mL triheptadecan (manufactured by Sigma-Aldrich) was added as an internal standard, and then 0.5 mL of chloroform and 1 mL of methanol were added. The mixture was vigorously stirred and then was left for 10 minutes or more. Further, 0.5 mL of chloroform and 0.5 mL of 1.5% KCl were added thereto. The mixture was stirred and centrifuged for 5 minutes at 3,000 rpm, and then the chloroform layer (lower layer) was collected with Pasteur pipette. A nitrogen gas was blown onto the resultant chloroform layer to be dried into solid, and the resultant material was dissolved into 20 ?L of chloroform.

[0225] A total amount of the thus-obtained lipids extract, and 3 ?L of three kinds of standard solutions {trimyristin (manufactured by Wako Pure Chemical Industries, Ltd.), glycerol dioleate (manufactured by Wako Pure Chemical Industries, Ltd.), oleic acid (manufactured by Wako Pure Chemical Industries, Ltd.), and 10 mg/mL chloroform solution} each were spotted onto TLC silica gel 60F.sub.254 (manufactured by Merck), and the resultant material was developed for about 15 minutes by using TLC developing tank DT-150 (manufactured by Mitsubishi Chemical Medience Corporation) with a developing solvent (hexane:diethyl ether:formic acid=42:28:0.3 (volume ratio)). After development, the plate was dried, 0.1% primulin (manufactured by Wako Pure Chemical Industries, Ltd.) dissolved in methanol was sprayed thereon and dried, and then a TAG fraction was detected by handy type UV lamp UVL-21 (manufactured by SOGO LABORATORY GLASS WORKS CO., LTD.).

[0226] The TAG fraction was scratched and collected by using a toothpick and 1 mL of 14% boron trifluoride-methanol solution (manufactured by Sigma-Aldrich) was added thereto, and a temperature of the resultant material was kept constant at 80? C. for 10 minutes. Then, 0.5 mL of hexane and 1 mL of saturated saline were added thereto, and the resultant mixture was vigorously stirred and left to stand for 10 minutes at room temperature, and then, the hexane layer being an upper layer was collected to obtain fatty acid methyl esters.

[0227] The obtained fatty acid methyl esters were provided for gas chromatographic analysis by a method in a manner similar to that described above. Table 6 shows the results.

TABLE-US-00006 TABLE 6 (n = 3) Fatty acid composition (% TFA) TAG C12:0 C14:0 C16:1 C16:0 C18:n C20:n (mg/L) BTE + 12.9 ? 0.4 20.0 ? 0.2 20.4 ? 0.1 26.5 ? 0.4 14.1 ? 0.1 6.1 ? 0.0 1854.0 ? 81.0 KAS IV BTE + 22.8 ? 0.7 23.7 ? 1.1 16.1 ? 0.6 18.8 ? 0.4 11.6 ? 0.1 7.0 ? 0.2 2478.7 ? 248.6 KAS IV + G3PDH

[0228] As shown in Table 6, it was confirmed that the ratios of medium-chain fatty acids (lauric acid (C12:0) and myristic acid (C14:0)) in the TAG, and the total amount of the TAG were significantly increased, by introducing the NoG3PDH gene into the strain into which the BTE gene and NoKAS IV gene have been introduced.

[0229] As described above, the transformant in which productivities of the medium-chain fatty acids and the total fatty acids to be produced are improved can be prepared by enhancing the expression of the G3PDH gene as specified in the present invention. Further, productivity of the medium-chain fatty acids and the total amount of all fatty acids to be produced can be improved by culturing this transformant.

Comparative Example 1 Production of a Transformant in which a G3PDH Gene Derived from Yeast is Introduced into Nannochloropsis oculata, and Production of Fatty Acids Using the Transformant

(1) Construction of Plasmid for Yeast-Derived G3PDH Gene Expression

[0230] The G3PDH gene derived from yeast (Saccharomyces cerevisiae) described in US 2006/0168684 (hereinafter, also referred as to YG3PDH gene) (SEQ ID NO: 55) was artificially synthesized. Using the thus-synthesized DNA fragment as a template, and a pair of the primer Nos. 56 and 57 shown in Table 1, PCR was carried out to amplify the yeast G3PDH gene.

[0231] Further, using the plasmid for NoG3PDH gene expression constructed in Example 1 as a template, and a pair of the primer Nos. 20 and 17 shown in Table 1, PCR was carried out to amplify the DNA fragment containing the LDSP promoter sequence, the VCP1 terminator sequence, the tubulin promoter sequence, the neomycin resistance gene, the heat shock protein terminator sequence, and pUC19 vector sequence.

[0232] DNA fragments, obtained by the method described above, were fused by a method in a manner similar to that described in Example 1, to construct a plasmid for YG3PDH expression.

[0233] Herein, the expression plasmid consisted of the pUC19 vector sequence and an insert sequence in which the LDSP promoter sequence, YG3PDH gene, the VCP1 terminator sequence, the tubulin promoter sequence, the neomycin resistance gene and the heat shock protein terminator sequence were linked in this order.

(2) Introduction of a BTE Gene and a Yeast G3PDH Gene into Nannochioropsis oculata

[0234] Using the above-described plasmid for the YG3PDH gene expression as a template, and a pair of the primer Nos. 16 and 10 shown in Table 1, PCR was carried out to amplify the fragment for YG3PDH gene expression (a DNA fragment containing the LDSP promoter sequence, the YG3PDH gene, the VCP1 terminator sequence, the tubulin promoter sequence, the neomycin resistance gene, and the heat shock protein terminator sequence).

[0235] The amplified DNA fragment was purified using High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Herein, sterilized water was used for elution upon purification without using an elution buffer included in the kit.

[0236] Using the BTE gene transgenic strain (BTE) constructed in Example 2 as a host, the YG3PDH gene was introduced according to the same method as in Example 1. Then, the resultant was cultured in neomycin-containing f/2 medium. Obtained colonies were selected as the BTE and yeast G3PDH genes transgenic strain (BTE+YG3PDH).

(3) Production of Fatty Acids Using the Transformant

[0237] The selected strain was inoculated to 50 mL of the N15P5 medium, and subjected to shaking culture for four weeks under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 10 mL of the preculture fluid was inoculated to 40 mL of N15P5 medium, and subjected to shaking culture under the 12 h/12 h light-dark conditions at 25? C. under the atmosphere of 0.3% CO.sub.2.

[0238] After three weeks cultivation, lipid components contained in the culture fluid were analyzed by the method described in Example 1. Table 7 shows the results.

TABLE-US-00007 TABLE 7 (n = 3) Fatty acid composition (% TFA) FA C12:0 C14:0 C16:1 C16:0 C18:n C20:n (mg/L) BTE 5.3 ? 1.1 5.2 ? 0.5 29.2 ? 1.4 33.8 ? 1.4 13.8 ? 0.9 12.8 ? 2.4 1539.9 ? 319.0 BTE + 1.8 ? 0.6 4.9 ? 0.3 30.4 ? 0.3 36.9 ? 0.6 13.5 ? 0.5 12.5 ? 0.8 1545.0 ? 279.1 YG3PDH

[0239] As shown in Table 7, in the case of introducing the YG3PDH gene, the content of medium-chain fatty acids was decreased and no increase of fats and oils was confirmed, and it was distinct from the present invention.

[0240] Note that, the identity of the amino acid sequence of the YG3PDH with the amino acid sequence of NoG3PDH was calculated through use of a homology analysis (homology search) program of genetic information processing software Genetyx-Win. As a result, the identity was 27%.

[0241] Having described our invention as related to the present embodiments, it is our intention that the invention not be limited by any of the details of the description, unless otherwise specified, but rather be construed broadly within its spirit and scope as set out in the accompanying claims.

[0242] This application claims priority on Patent Application No. 2015-179166 filed in Japan on Sep. 11, 2015, which is entirely herein incorporated by reference.