Highly diverse combinatorial antibody libraries

Abstract

Disclosed is an immune library obtained from a Camelid species containing at antibody chains belonging to at least 7 human germline antibody chains. The presence of a large number of human germline antibody chain families in the library contributes to the usefulness of the library in producing antibodies to human target antigens. The antibodies produced from the library have low inherent immunogenicity.

Claims

1. A camelid Fab library, said Fab library comprising camelid antibody heavy and light chain variable regions belonging to at least seven different human antibody chain families, wherein at least one of the human antibody chain families is selected from the group consisting of VH6 and V3.

2. The camelid Fab library of claim 1, comprising antibody chains within one human antibody chain family that are expressed by at least two different genes.

3. The camelid Fab library of claim 1, wherein the camelid antibody heavy and light chain variable regions are llama antibody heavy and light chain variable regions.

4. A camelid Fab library, said Fab library comprising camelid antibody heavy and light chain variable regions belonging to at least seven different human antibody chain families, wherein at least one of the human antibody chain families is selected from the group consisting of VH6 and V3, and wherein the library is displayed on a ribosome, on a phage particle, or on a cell surface.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 is a graphic representation of usage frequencies of human chain families present in the library of Schofield et al., supra. Source: openi.nlm.nih.gov/detailedresult.php?img=2258204_gb-2007-8-11-r254-3&query=the&fields=all&favor=none&it=none&sub=none&uniq=0&sp=none&req=4&simC ollection=2583049_pone.0003793.g005&npos=35&prt=3.

(2) FIG. 2 is a graphic representation of the usage of human heavy chain families in a Camelid antibody library of the present invention (left hand bar of each pair), compared to the usage of the heavy chain families in human antibodies (right hand bar of each pair).

(3) FIG. 3 is a graphic representation of the usage of human kappa chain families in a Camelid antibody library of the present invention (left hand bar of each pair), compared to the usage of the kappa chain families in human antibodies (right hand bar of each pair).

(4) FIG. 4 is a graphic representation of the usage of human VH1 chain families in a Camelid antibody library of the present invention (left hand bar of each pair), compared to the usage of the lambda chain families in human antibodies (right hand bar of each pair).

(5) FIG. 5 is a graphic representation of the usage of human VH3 chain families in a Camelid antibody library of the present invention (left hand bar of each pair), compared to the usage of the lambda chain families in human antibodies (right hand bar of each pair).

(6) FIG. 6 is a graphic representation of the usage of human V1 chain families in a Camelid antibody library of the present invention (left hand bar of each pair), compared to the usage of the lambda chain families in human antibodies (right hand bar of each pair).

(7) FIG. 7 is a graphic representation of the usage of human V1 chain families in a Camelid antibody library of the present invention (left hand bar of each pair), compared to the usage of the lambda chain families in human antibodies (right hand bar of each pair).

(8) FIGS. 8A and 8B are a representation of V germline6. The four sequences shown in FIG. 8A correspond, from top to bottom, to SEQ ID NOs: 500-503, respectively. The sixteen sequences shown in FIG. 8B correspond, from top to bottom, to SEQ ID NOs: 504-518 and 388, respectively.

(9) FIG. 9A-9C is an alignment of camelid VH germlines genes per VH family (VH1, VH3, VH4, VH5 and VH7) referred to human VH family and germline gene counterparts. % Identity illustrates the percentage of identical amino acids (dots) of each of the Camel (Camel ferus) and Llama (Lama pacos or lama vicugna) frameworks (FR1+FR2+FR3) of the VH germline shared with a reference FR amino acid sequences (ref), here human VH germline counterpart.

(10) FIG. 10A-10L is an alignment of camelid V germlines genes per V family (V1, V2, V3, V4, V5, V6, V7, V8, V9 and V10) referred to human V family and germline gene counterparts. % identity illustrates the percentage of identical amino acids (dots) of each of the Camel (Camel ferus) and Llama (Lama pacos or lama vicugna) frameworks (FR1+FR2+FR3) of the V germline shared with a reference FR amino acid sequences (ref), here human V germline counterpart.

(11) FIG. 11A-11C is an alignment of the camelid Vfamilies with the corresponding human germline % Identity illustrates the percentage of identical amino acids (dots) of each of the Camel (Camel ferus) and Llama (Lama pacos or vicugna) frameworks (FR1+FR2+FR3) V germline shared with a reference FR amino acid sequences (ref), here a human Vgermline counterpart.

(12) FIG. 12A-12B shows camelid (Lama pacos and Camelus ferus) VH genes and the corresponding primers.

(13) FIG. 13A-13F shows camelid (Lama pacos, Camelus ferus and Lama glama) V genes and the corresponding primers.

(14) FIG. 14 shows camelid (Lama pacos, Camelus ferus and Lama glama) Vgenes and the corresponding primers.

(15) FIG. 15 shows an example of alignment of VH1-primer1 with the first 23 bp of VH1 FR1. This example of alignment illustrates how primers, specific for a V family amplification are designed. A V family specific primer is generated by aligning all Framework 1, FR1, of V germline genes belonging to the same family (here an example for VH1 family) All the FR1 family V specific are extracted from all found V germline sequences collected and annotated from Lama pacos WGS and HTG, Camel ferus WGS, and any available sequence database or unpublished or published literature. WGS stands for Whole Genome Shotgun sequencing projects and HTG or HTGS stand for High-Throughput Genomic Sequences. Dots represent identical nucleotide compared to a reference sequence, here in this example represented by VH1-primer1. Here the VH1-primer1 is a degenerated primer allowing at the position 13 to anneal with G or C; S represents G/C for primer synthesis.

DETAILED DESCRIPTION OF THE INVENTION

(16) The following is a detailed description of the invention.

Definitions

(17) Antibodies (Abs) and immunoglobulins (Igs) are glycoproteins which exhibit binding specificity to a (target) antigen.

(18) The camelid species are known to possess two different types of antibodies; the classical or conventional antibodies and also the heavy-chain antibodies.

(19) As used herein, the term Camelid antibody refers to conventional Camelid antibodies of any isotype, including IgA, IgG, IgD, IgE or IgM. Native or naturally occurring conventional camelid antibodies are usually heterotetrameric glycoproteins, composed of two identical light (L) chains and two identical heavy (H) chains.

(20) The term antibody chain is used interchangeably with the term antibody domain, and refers to the heavy chain or the light chain of an antibody.

(21) The term antibody library refers to a collection of antibodies and/or antibody fragments displayed for screening and/or combination into full antibodies. The antibodies and/or antibody fragments may be displayed on ribosomes; on phage; or on a cell surface, in particular yeast cell surface.

(22) A human antibody chain is considered to belong to a specific antibody chain family if it has at least 80% sequence homology with other members of that family Based on this definition 23 human antibody chain families have been identified: 7 heavy chain (V.sub.H) families; 6 Vlight chain families; and 10 V light chain families Thus, a human antibody chain is considered to belong to the human family V6 if it has at least 80% sequence homology with other members of the V6 family. It has been found that, in general, antibody chains have less than 70% sequence homology with members of other families.

(23) A Camelid antibody chain is considered to belong to a specific human antibody chain family if it has at least 80% sequence homology with a human germline sequence of that family Preferably the sequence homology is at least 85%, more preferably 90%, still more preferably at least 95%.

(24) Camelid antibodies can be obtained from peripheral blood or specific tissues, for example spleen, of a species in the family Camilidae. Antibodies can be obtained from a normal, healthy animal, or from a diseased animal. Preferably, however, the Camelid antibodies are obtained from the animal after active immunization of the animal with a target antigen, in order to elicit an immune response against the target antigen in which the animal raises Camelid conventional antibodies that are immunoreactive with the target antigen. Protocols for immunization of Camelids are described in US 2011/0300140, the disclosures of which are incorporated herein by reference.

(25) The process will typically involve immunization of animals of a Camilidae species (including, but not limited to, llamas and alpacas). Preferably the animals belong to an outbred population, which contributes to the strength and the diversity of the immune response. Following active immunization, peripheral blood lymphocytes or biopsies such as lymph nodes or spleen biopsies can be isolated from the immunized animal. The harvested lymphocytes can be screened for production of conventional Camelid antibodies against the target antigen. For construction of a nave antibody library no such screening is carried out.

(26) Nucleic acid encoding Camelid VH and VL domains (whether obtained by active immunization or by other means) can be used to prepare a Camelid library, for example a Fab library, as described in US 2011/0300140.

(27) It is also possible to construct a library of expression vectors encoding VH and/or VL domains of Camelid conventional antibodies to obtain amplified gene segments, each gene segment containing a sequence of nucleotides encoding a VH and/or VL domains of Camelid conventional antibodies. Constructing the expression vector library involves the following steps:

(28) a) amplifying regions of nucleic acid molecules encoding VH and/or VL domains of Camelid conventional antibodies to obtain amplified gene segments, each gene segment containing a sequence of nucleotides encoding a VH domain or a sequence of nucleotides encoding a VL domain of a Camelid conventional antibody; and
b) cloning the gene segments obtained in a) into expression vectors, such that each expression vector contains at least a gene segment encoding a VH domain and/or gene segment encoding a VL domain, whereby a library of expression vectors is obtained.

(29) Step a) may be carried out by any suitable amplification technique, for example PCR. In case PCR is used, the selection of appropriate primers is important. Use of suboptimal primers results in loss of valuable diversity because antibody chains belonging to important human families may escape isolation and detection. For example, in the past chains belonging to the human VH6, V3 or V6 families have escaped isolation and/or detection because of the use of primers that were not appropriate for sequences belonging to these families.

(30) In a first embodiment the antibody library of the invention comprises antibody chains belonging to at least 7, preferably at least 10, more preferably at least 12, even more preferably at least 15 human antibody chain families. This embodiment makes use of the discovery that functional size of an antibody library is more important than absolute size. Consider two antibody libraries, A and B, of equal absolute size, say 10.sup.10 antibodies. Library A comprises antibody chains of only 5 different families, whereas library B comprises antibody chains of 10 different families. It can easily be seen that library B offers more possible permutations in an affinity maturation protocol, such as chain shuffling. Accordingly, library B offers a greater probability of generating a high-affinity antibody than does library A, even though both libraries are equal in absolute size.

(31) Library diversity is also important better epitope coverage, with greater diversity increasing the likelihood of being able to target the epitope on the antigen that is functionally and/or therapeutically relevant. Library diversity is also important for increasing the probability of identifying antibody molecules having desirable secondary properties, such as binding specificity; cross-reactivity to orthologues of the target antigen; stability; ease of manufacture; etc.

(32) Another important aspect of the library of this embodiment is that it represents a significant number of human chain families Murine antibody libraries can be highly diverse, owing to the large number of Vfamilies in the murine germline. As such, murine antibody libraries meet the criterion of functional size, based on which one would expect such libraries to produce a significant number of high-affinity antibodies when screened against a specific target. Many of these hits are unusable, however, because of their dissimilarity to human antibodies. Other hits may require such extensive humanization engineering that they lose a significant part of their affinity. Libraries of the present invention, however, produce antibodies that require little humanization engineering.

(33) It has been found that most or all antibody chain families are expressed by a plurality of unique genes. For example, there are at least five distinct genes for the V1 chain family. This finding opens the door to even greater library diversity. An important aspect of the present invention is the development of primers that permit the extraction from an antibody pool of more than one gene for a given antibody chain family.

(34) In a second embodiment the antibody library of the present invention comprises antibody chains of at least one of the following human chain families: VH6, V3; and V6. This embodiment is based on the insight that each of these families is sufficiently important to the diversity of human germline antibodies to warrant the effort of building Camelid antibody libraries that are large enough to contain harvestable amounts of chains of these families, and of developing the appropriate primers necessary to amplify and isolate them.

(35) In a third embodiment the antibody library of the invention comprises at least members of the three human families VH3, V1 and V6; preferably members of the four human families VH1, VH3, V1, and V6; yet more preferably members of the five human families VH1, VH3, V1, V2, and V6; even more preferably members of the six human families VH1, VH3, V1, V1, V2, and V6; most preferably members of the seven human families VH1, VH3, V1, V2, V1, V2, and V6. This embodiment reflects the recognition that, in nature, these combinations of antibody chains, even though representing respectively 1.5%, 3.1%, 4.7%, 6.3%, and 7.8% of the possible permutations, they represent from about 50% to more than 80% of human antibodies. It follows that libraries comprising these combinations of chains of a high probability of producing useful therapeutic antibodies, even if the absolute size of such libraries is relatively small.

(36) It will be understood that the criteria set forth for the above three embodiments are not mutually exclusive, and that a specific library may meet the criteria of two of the embodiments, and possibly of all three. For example, a library comprising chains of all 23 human families will certainly meet the criteria of all three embodiments.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS/EXAMPLES

(37) The following is a description of certain embodiments of the invention, given by way of example only.

Example 1

(38) Description of Amplification Protocol Including the Primer Sequences.

(39) Immunization, PBL isolation, RNA extraction and cDNA preparation were done as disclosed in U.S. Patent Application Publication 2011/0300140 to Dreier et al.

(40) The Fab fragments were amplified by PCR with the cDNA as template and using primers annealing specifically to the frame work 1 (FR1) of the variable domains (BACK primers) and to the end of the constant domains (FOR primers) as described by de Haard et al. (JBC 1999). The sequences of the primers were designed on the basis of the germline sequences from camelids (Lama pacos, Camelus ferus and Lama glama) obtained from the Whole Genome Shotgun (WGS) database (www.ncbi.nlm.nih.gov/nuccore/ABRR00000000), High-throughput genome (HTG) database and sequenced amplicons. FIGS. 9A-11C show the alignment of the camelid VH, V and V families with the corresponding human germline. These sequences were used as templates for design of the FR1 primers described in Tables 1-3. An overview of the camelid germline sequences and the corresponding FR1 primers is shown in FIGS. 12A-14.

(41) The amplification of the llama variable domain can be done either in one step PCR or in two steps PCR. For the one step PCR, the BACK and FOR primers used for the amplification contain restriction sites that allow the cloning of the PCR fragment into the pCB3 phagemide vector. For the two-step PCR, a primary PCR was done with the non-tagged primers (without restriction site). The amplicons were isolated and purified before a secondary PCR was done with the primers containing the restriction sites. The restriction sites are ApaLI for the BACK primers and AscI for the FOR primers. The restriction sites are SfiI and NotI for the BACK and FOR primers of VH-CH1, respectively. Alternatively, the DNA segments can be reamplified with primers tagged with restriction sites (FOR primers with AscI site and FR4 based BACK primers with BsteII site) and cloned as VL fragments thus creating chimeric Fab's containing llama derived V regions combined with human C regions. The antisense primers are shown in Table 4.

(42) The PCRs were performed in a volume of 50 l reactions using Phusion polymerase (ThermoFischer) and 500 pM of each primer for 28 cycles (1 min at 96 C., 1 min at 60 C., and 1 min at 72 C.

(43) The construction of the Fab library was done as described in U.S. Patent Application Publication 2011/0300140 to Dreier et al.

(44) TABLE-US-00001 TABLE1 FR1primersforamplificationofcamelidVHgenes. >VH1-primer1 CAGGTCCAGCTGSTGCAGTCAGG (SEQIDNO:1) >VH1-primer2 GAGGTCCAGCTGGTGCAGCCAGG (SEQIDNO:2) >VH3-primer1 GAGGTGCAGSTGGTGGAGTCTGGG (SEQIDNO:3) >VH3-primer2 CAGGTGCAGCTGGTGGAGTCTGGG (SEQIDNO:4) >VH4-primer1 CAGGTGCAGCTGCAGGAGTCGGG (SEQIDNO:5) >VH5-primer1 CAGGTGMAGCTGGAGCAGCCTGTGG (SEQIDNO:6) >VH7-primer1 CAGGTGCAGCTGGTGCAGTCTGCG (SEQIDNO:7) >VH7-primer2 CAAGTGCAGCTGGTGCAGCCAGGG (SEQIDNO:8)

(45) TABLE-US-00002 TABLE2 FR1primersforamplificationofcamelidV genes. >V1-Primer1 CAGTCTGTGCTGACTCAGCYGCCCTC (SEQIDNO:9) >V1-Primer2 CAGTCTGTGCTGACTCAGCYGTCCTC (SEQIDNO:10) >V1-primer3 CAGTCTGTGCTGACCCAGCKGGCCTC (SEQIDNO:11) >V1-primer4 CAGTCTGGGCTGACACAGGAAGCCTC (SEQIDNO:12) >V1-primer5 CAGTCTGTGCCGATTCAGCCGTCCTC (SEQIDNO:13) >V1-primer6 AAGTCTGTGCCGACTCAGCTGCCCTT (SEQIDNO:14) >V1-primer7 CAGACTGTGGTGACCCAGGAGCCGTC (SEQIDNO:15) >V2-primer1 AACTCTGCCCTGACTCAGCCTCCATC (SEQIDNO:16) >V2-primer2 CAGTCTGCCSTGACTCAGCCTYCCTC (SEQIDNO:17) >V2-primer3 CAGTCTGCCYTGACTCAGCCTCCCTT (SEQIDNO:18) >V2-primer4 CAGTCTGCCCTGATTCAGCCTCTCTC (SEQIDNO:19) >V3-primer1 TCTTCTGCACTGACTCAGCCCTCCGC (SEQIDNO:20) >V3-primer2 TCTTCTGCASTGACTCAGCCCTCCA (SEQIDNO:21) >V3-primer3 TCCTACGAACTGACTCAGWCACCCTC (SEQIDNO:22) >V3-primer4 GCCTCTTCAGTGACTCAGCCCTCCGC (SEQIDNO:23) >V3-primer5 TCCTATGAGCTGACCCAGCAGGCTTC (SEQIDNO:24) >V4-primer1 CAGCCTGTGCTGTCGCAGCCACCCTC (SEQIDNO:25) >V4-primer2 CAGCCTGTGCTGATGCAGCTGCCCTC (SEQIDNO:26) >V4-primer3 CAGACTGTGCTGACGCAGCCGCCCTC (SEQIDNO:27) >V4-primer4 CAGCCTGAGCTGACACAGCCGCCCTC (SEQIDNO:28) >V4-primer5 GCGCCTGTGCTGACCCAGCCCCCGTC (SEQIDNO:29) >V4-primer6 GAGCCTGTGCTGACCCAGCCCYCGTC (SEQIDNO:30) >V5-primer1 CAGCATGTGGTGACTCAGCCGCCCTC (SEQIDNO:31) >V5-primer2 CAGCTTGTGSTGACTCAGCCGCCCTC (SEQIDNO:32) >V5-primer3 CAGCTTCTGCTGACTCAGCCGCCCTC (SEQIDNO:33) >V5-primer4 CAGCTTGTGCWGACTCAGCTGCCCTC (SEQIDNO:34) >V5-primer5 CAGCCTGTGCTGACTCAGCTGTCCTC (SEQIDNO:35) >V5-primer6 CAGCCTGTGCTGACTCAGCYGCCCTC (SEQIDNO:36) >V5-primer7 CAGCCTGTGGGGACTCAGCTGCCCTC (SEQIDNO:37) >V5-primer8 CAGCTTGTGGAGACTCAGCTGTCTTT (SEQIDNO:38) >V5-primer9 CAGACTGTGGGGACTCAGCCAGCCTC (SEQIDNO:39) >V6-primer1 GAGGTTGTGCTGACTCAGCCCAGCTC (SEQIDNO:40) >V7-primer1_(V.Math. 1-primer7) CAGACTGTGGTGACCCAGGAGCCGTC (SEQIDNO:41) >V8-primer1_(V.Math. 1-primer7) CAGACTGTGGTGACCCAGGAGCCGTC (SEQIDNO:42) >V8-primer2 CAGACTGTGRTGACCCAGGAGCCATC (SEQIDNO:43) >V8-primer3 CAGACTGTGGTGACCCAGRAGCCGTC (SEQIDNO:44) >V8-primer4 CAGACTGTGGTGACCCAGGTTTCATC (SEQIDNO:45) >V8-primer5 CAGACTGTGGTGACCCAACAGTCGTT (SEQIDNO:46) >V9-primer1 CAGCCTGTGCTGATGCAGCCGCCCTC (SEQIDNO:47) >V9-primer2 CAGCCTGTGCTGACACAGTCGCCCTC (SEQIDNO:48) >V9-primer3 CAGCCTATGCTGACACAGTCGTCCCC (SEQIDNO:49) >V9-primer4 CAGCCTGTGCTGACACAGACGCCCTC (SEQIDNO:50) >V9-primer5 CAGCCTGTGCCGACACAGTCACCATC (SEQIDNO:51) >V10-primer1 CAGGCAWGGCTGACTCAGCCCCRGTC (SEQIDNO:52)

(46) TABLE-US-00003 TABLE3 FR1primersforamplificationofcamelidV genes. >V1-Primer1 GCTACCCAGRTGACCCAGTCTYCCTCC (SEQIDNO:53) >V1-Primer2 GAAATTGTGCTGACCCAGTCTCCGGCC (SEQIDNO:54) >V2-Primerl GATTTWGTGCTGACCCAGAYCCCAGGC (SEQIDNO:55) >V2-Primer2 GACGTTGTGCTGACCCAGACCCCAGGC (SEQIDNO:56) >V2-Primer3 AACATTGTACTGACCCGTTTTCTAGCC (SEQIDNO:57) >V3-Primer1 AGCGCTGAGCTGACCCAGACTCCAGCC (SEQIDNO:58) >V3-Primer2 CAGATCGCCCTGACTCAGTTTCCAGAA (SEQIDNO:59) >V3-Primer3 GGAGAGAATGTGGAGCAGAGTCCTCCC (SEQIDNO:60) >V4-Primer1 GACATCGTGATGACCCAGTCTCCCAGC (SEQIDNO:61) >V5-Primer1 GAAACAGTCCCCACCCAATCTCCAGCA (SEQIDNO:62) >V6-Primerl GCGACCRTGCTGACCCAGTCCCCAGCC (SEQIDNO:63)

(47) TABLE-US-00004 TABLE4 Antisenseprimers(5-3)usedforamplificationofthe VH,V andV genes., Clambda1-FOR CTAACACTGGGAGGGGGACACCGTCTTCTC SEQIDNO:64 Clambda2-FOR CTAACACTGGGAGGGNCTCACNGTCTTCTC SEQIDNO:65 (non-tagged) caClambda1- GCCTCCACCGGGCGCGCCTTATTAACACTG SEQIDNO:66 FOR-AscI (tagged) GGAGGGGGACACCGTCTTCTC caCHkappa1-FOR TCAGCAGTGTCTCCGGTCGAAGCTCCT SEQIDNO:67 (non-tagged) CH-FOR3(as) TCCTCCATGTGGTTCCACACGCTTGTCCAC SEQIDNO:68 (non-tagged) CTTGG CH1-FOR-NotI GCCTCCACCTGCGGCCGCGCATCCTCCATG SEQIDNO:69 (tagged) TGGTTCCACACGCTT

(48) In the primer sequences provided in Tables and herein the following notation has been used: SG or C MA or C YT or C KG or T WA or T RG or A NA, C, T, G, unknown or other

(49) Thus, the invention has been described by reference to certain embodiments discussed above. It will be recognized that these embodiments are susceptible to various modifications and alternative forms well known to those of skill in the art. For example, the antibody library may be modified by modifying and/or fine tuning the PCR primers.

(50) Many modifications in addition to those described above may be made to the structures and techniques described herein without departing from the spirit and scope of the invention. Accordingly, although specific embodiments have been described, these are examples only and are not limiting upon the scope of the invention.