ANTI-CD38 HUMAN ANTIBODIES AND USES THEREFOR
20180215832 ยท 2018-08-02
Assignee
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61P7/00
HUMAN NECESSITIES
C07K2319/30
CHEMISTRY; METALLURGY
C07K2317/33
CHEMISTRY; METALLURGY
C07K2317/732
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
C12Y302/02024
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
C07K16/2896
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
International classification
C07K16/28
CHEMISTRY; METALLURGY
Abstract
The present invention provides recombinant antigen-binding regions and antibodies and functional fragments containing such antigen-binding regions that are specific for CD38, which plays an integral role in various disorders or conditions. These antibodies, accordingly, can be used to treat, for example, hematological malignancies such as multiple myeloma. Antibodies of the invention also can be used in the diagnostics field, as well as for investigating the role of CD38 in the progression of disorders associated with malignancies. The invention also provides nucleic acid sequences encoding the foregoing antibodies, vectors containing the same, pharmaceutical compositions and kits with instructions for use. The invention also provides isolated novel epitopes of CD38 and methods of use therefore.
Claims
1-84. (canceled)
85. An isolated human monoclonal antibody comprising six complementarity determining regions that binds a peptide consisting of the amino acid sequence DVVHVMLNGSRSKIFDKNSTFGS (SEQ ID NO: 47).
86. A composition comprising the isolated human monoclonal antibody of claim 85 and a pharmaceutically acceptable carrier.
87. An isolated human monoclonal antibody comprising six complementarity determining regions that binds a peptide consisting of the amino acid sequence, DVVHVMLNGSRSKIFDKNSTFGS (SEQ ID NO: 47), or that binds a 13-amino acid sequence subset thereof.
88. The antibody of claim 87, wherein the peptide consists of the amino acid sequence selected from the group consisting of DVVHVMLNGSRSKIFDKNSTFGS (SEQ ID NO: 47), DVVHVMLNGSRSK (SEQ ID NO: 48), VVHVMLNGSRSKI (SEQ ID NO: 49), VHVMLNGSRSKIF (SEQ ID NO: 50), HVMLNGSRSKIFD (SEQ ID NO: 51), VMLNGSRSKIFDK (SEQ ID NO: 52), MLNGSRSKIFDKN (SEQ ID NO: 53), LNGSRSKIFDKNS (SEQ ID NO: 54), NGSRSKIFDKNST (SEQ ID NO: 55), GSRSKIFDKNSTF (SEQ ID NO: 56), SRSKIFDKNSTFG (SEQ ID NO: 57), and RSKIFDKNSTFGS (SEQ ID NO: 58).
89. The antibody of claim 88, wherein the peptide consists of the amino acid sequence selected from the group consisting of DVVHVMLNGSRSK (SEQ ID NO: 48), VHVMLNGSRSKIF (SEQ ID NO: 50), VMLNGSRSKIFDK (SEQ ID NO: 52), LNGSRSKIFDKNS (SEQ ID NO: 54), and RSKIFDKNSTFGS (SEQ ID NO: 58).
90. The antibody of claim 89, wherein the peptide consists of the amino acid sequence, VHVMLNGSRSKIF (SEQ ID NO: 50).
91. A composition comprising the isolated human monoclonal antibody of claim 87 and a pharmaceutically acceptable carrier.
92. A composition comprising the isolated human monoclonal antibody of claim 90 and a pharmaceutically acceptable carrier.
93. A method of treating the overexpression of CD38 in a patient in need thereof of a therapeutically effective amount of the antibody of claim 85.
94. The method of claim 93, wherein the patient has multiple myeloma, chronic lymphocytic leukemia, chronic myelogenous leukemia, acute myelogenous leukemia, or acute lymphocytic leukemia.
95. The method of claim 94, wherein the patient has rheumatoid arthritis or systemic lupus erythematosus.
96. A method of treating the overexpression of CD38 in a patient in need thereof with a therapeutically effective amount of the antibody of claim 87.
97. The method of claim 96, wherein the patient has multiple myeloma, chronic lyphocytic leukemia, chronic myelogenous leukemia, acute myelogenous leukemia, or acute lymphocytic leukemia.
98. The method of claim 97, wherein the patient has rheumatoid arthritis or systemic lupus erythematosus.
99. A method of treating the overexpression of CD38 in a patient in need thereof with a therapeutically effective amount of the antibody of claim 90.
100. The method of claim 99, wherein the patient has multiple myeloma, chronic lyphocytic leukemia, chronic myelogenous leukemia, acute myelogenous leukemia, or acute lymphocytic leukemia.
101. A method of treating cancer in a subject in need thereof, wherein the cancer comprises cells that overexpress CD38, comprising administering to the subject a therapeutically effective amount of the antibody of claim 85.
102. The method of claim 101, wherein the patient has multiple myeloma, chronic lyphocytic leukemia, chronic myelogenous leukemia, acute myelogenous leukemia, or acute lymphocytic leukemia.
103. A method of treating the cancer in a subject in need thereof, wherein the cancer comprises cells that overexpress CD38 in a patient in need thereof with a therapeutically effective amount of the antibody of claim 90.
104. The method of claim 103, wherein the patient has multiple myeloma, chronic lyphocytic leukemia, chronic myelogenous leukemia, acute myelogenous leukemia, or acute lymphocytic leukemia.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0056]
[0058]
DETAILED DESCRIPTION OF THE INVENTION
[0059] The present invention is based on the discovery of novel antibodies that are specific to or have a high affinity for CD38 and can deliver a therapeutic benefit to a subject. The antibodies of the invention, which may be human or humanized, can be used in many contexts, which are more fully described herein.
[0060] A human antibody or functional human antibody fragment is hereby defined as one that is not chimeric (e.g., not humanized) and not from (either in whole or in part) a non-human species. A human antibody or functional antibody fragment can be derived from a human or can be a synthetic human antibody. A synthetic human antibody is defined herein as an antibody having a sequence derived, in whole or in part, in silico from synthetic sequences that are based on the analysis of known human antibody sequences. In silico design of a human antibody sequence or fragment thereof can be achieved, for example, by analyzing a database of human antibody or antibody fragment sequences and devising a polypeptide sequence utilizing the data obtained therefrom. Another example of a human antibody or functional antibody fragment, is one that is encoded by a nucleic acid isolated from a library of antibody sequences of human origin (i.e., such library being based on antibodies taken from a human natural source).
[0061] A humanized antibody or functional humanized antibody fragment is defined herein as one that is (i) derived from a non-human source (e.g., a transgenic mouse which bears a heterologous immune system), which antibody is based on a human germline sequence; or (ii) chimeric, wherein the variable domain is derived from a non-human origin and the constant domain is derived from a human origin or (iii) CDR-grafted, wherein the CDRs of the variable domain are from a non-human origin, while one or more frameworks of the variable domain are of human origin and the constant domain (if any) is of human origin.
[0062] As used herein, an antibody binds specifically to, is specific to/for or specifically recognizes an antigen (here, CD38) if such antibody is able to discriminate between such antigen and one or more reference antigen(s), since binding specificity is not an absolute, but a relative property. In its most general form (and when no defined reference is mentioned), specific binding is referring to the ability of the antibody to discriminate between the antigen of interest and an unrelated antigen, as determined, for example, in accordance with one of the following methods. Such methods comprise, but are not limited to Western blots, ELISA-, RIA-, ECL-, IRMA-tests and peptide scans. For example, a standard ELISA assay can be carried out. The scoring may be carried out by standard color development (e.g. secondary antibody with horseradish peroxide and tetramethyl benzidine with hydrogenperoxide). The reaction in certain wells is scored by the optical density, for example, at 450 nm. Typical background (=negative reaction) may be 0.1 OD; typical positive reaction may be 1 OD. This means the difference positive/negative can be more than 10-fold. Typically, determination of binding specificity is performed by using not a single reference antigen, but a set of about three to five unrelated antigens, such as milk powder, BSA, transferrin or the like.
[0063] However, specific binding also may refer to the ability of an antibody to discriminate between the target antigen and one or more closely related antigen(s), which are used as reference points, e.g. between CD38 and CD157. Additionally, specific binding may relate to the ability of an antibody to discriminate between different parts of its target antigen, e.g. different domains or regions of CD38, such as epitopes in the N-terminal or in the C-terminal region of CD38, or between one or more key amino acid residues or stretches of amino acid residues of CD38.
[0064] Also, as used herein, an immunoglobulin (Ig) hereby is defined as a protein belonging to the class IgG, IgM, IgE, IgA, or IgD (or any subclass thereof), and includes all conventionally known antibodies and functional fragments thereof. A functional fragment of an antibody/immunoglobulin hereby is defined as a fragment of an antibody/immunoglobulin (e.g., a variable region of an IgG) that retains the antigen-binding region. An antigen-binding region of an antibody typically is found in one or more hypervariable region(s) of an antibody, i.e., the CDR-1, -2, and/or -3 regions; however, the variable framework regions can also play an important role in antigen binding, such as by providing a scaffold for the CDRs. Preferably, the antigen-binding region comprises at least amino acid residues 4 to 103 of the variable light (VL) chain and 5 to 109 of the variable heavy (VH) chain, more preferably amino acid residues 3 to 107 of VL and 4 to 111 of VH, and particularly preferred are the complete VL and VH chains (amino acid positions 1 to 109 of VL and 1 to 113 of VH; numbering according to WO 97/08320). A preferred class of immunoglobulins for use in the present invention is IgG. Functional fragments of the invention include the domain of a F(ab).sub.2 fragment, a Fab fragment and scFv. The F(ab).sub.2 or Fab may be engineered to minimize or completely remove the intermolecular disulphide interactions that occur between the Cm and CL domains.
[0065] An antibody of the invention may be derived from a recombinant antibody library that is based on amino acid sequences that have been designed in silico and encoded by nucleic acids that are synthetically created. In silico design of an antibody sequence is achieved, for example, by analyzing a database of human sequences and devising a polypeptide sequence utilizing the data obtained therefrom. Methods for designing and obtaining in silico-created sequences are described, for example, in Knappik et al., J. Mol. Biol. (2000) 296:57; Krebs et al., J. Immunol. Methods. (2001) 254:67; and U.S. Patent No. 6,300,064 issued to Knappik et al., which hereby are incorporated by reference in their entirety.
Antibodies of the Invention
[0066] Throughout this document, reference is made to the following representative antibodies of the invention: antibody nos. or LACS or MOR 3077, 3079, 3080 and 3100. LAC 3077 represents an antibody having a variable heavy region corresponding to SEQ ID NO: 1 (DNA)/SEQ ID NO: 5 (protein) and a variable light region corresponding to SEQ ID NO: 9 (DNA)/SEQ ID NO: 13 (protein). LAC 3079 represents an antibody having a variable heavy region corresponding to SEQ ID NO: 2 (DNA)/SEQ ID NO: 6 (protein) and a variable light region corresponding to SEQ ID NO: 10 (DNA)/SEQ ID NO: 14 (protein). LAC 3080 represents an antibody having a variable heavy region corresponding to SEQ ID NO: 3 (DNA)/SEQ ID NO: 7 (protein) and a variable light region corresponding to SEQ ID NO: 11 (DNA)/SEQ ID NO: 15 (protein). LAC 3100 represents an antibody having a variable heavy region corresponding to SEQ ID NO: 4 (DNA)/SEQ ID NO: 8 (protein) and a variable light region corresponding to SEQ ID NO: 12 (DNA)/SEQ ID NO: 16 (protein).
[0067] In one aspect, the invention provides antibodies having an antigen-binding region that can bind specifically to or has a high affinity for one or more regions of CD38, whose amino acid sequence is depicted by SEQ ID NO: 22. An antibody is said to have a high affinity for an antigen if the affinity measurement is at least 100 nM (monovalent affinity of Fab fragment). An inventive antibody or antigen-binding region preferably can bind to CD38 with an affinity of about less than 100 nM, more preferably less than about 60 nM, and still more preferably less than about 30 nM. Further preferred are antibodies that bind to CD38 with an affinity of less than about 10 nM, and more preferably less than 3 about nM. For instance, the affinity of an antibody of the invention against CD38 may be about 10.0 nM or 2.4 nM (monovalent affinity of Fab fragment).
[0068] Table 1 provides a summary of affinities of representative antibodies of the invention, as determined by surface plasmon resonance (BIACORE) and FACS Scatchard analysis:
TABLE-US-00001 TABLE 1 Antibody Affinities FACS Scatchard BIACORE (Fab) (IgG1).sup.b Antibody (Fab or IgG1) K.sub.D [nM].sup.a K.sub.D [nM].sup.a MOR03077 56.0 0.89 MOR03079 2.4 0.60 MOR03080 27.5 0.47 MOR03100 10.0 6.31 Chimeric OKT10 not determined 8.28 .sup.amean from at least 2 different affinity determinations .sup.bRPMI8226 MM cell-line used for FACS-Scatchards
[0069] With reference to Table 1, the affinity of LACs 3077, 3079, 3080 and 3100 was measured by surface plasmon resonance (BIACORE) on immobilized recombinant CD38 and by a flow cytometry procedure utilizing the CD38-expressing human RPMI8226 cell line. The BIACORE studies were performed on directly immobilized antigen (CD38-Fc fusion protein). The Fab format of LACs 3077, 3079, 3080 and 3100 exhibit an monovalent affinity range between about 2.4 and 56 nM on immobilized CD38-Fc fusion protein with LAC 3079 showing the highest affinity, followed by Fabs 3100, 3080 and 3077.
[0070] The IgG1 format was used for the cell-based affinity determination (FACS Scatchard). The right column of Table 1 denotes the binding strength of the LACS in this format. LAC 3080 showed the strongest binding, which is slightly stronger than LACS 3079 and 3077.
[0071] Another preferred feature of preferred antibodies of the invention is their specificity for an area within the N-terminal region of CD38. For example, LACs 3077, 3079, 3080, and 3100 of the invention can bind specifically to the N-terminal region of CD38.
[0072] The type of epitope to which an antibody of the invention binds may be linear (i.e. one consecutive stretch of amino acids) or conformational (i.e. multiple stretches of amino acids). In order to determine whether the epitope of a particular antibody is linear or conformational, the skilled worker can analyze the binding of antibodies to overlapping peptides (e.g., 13-mer peptides with an overlap of 11 amino acids) covering different domains of CD38. Using this analysis, the inventors have discovered that LACS 3077, 3080, and 3100 recognize discontinuous epitopes in the N-terminal region of CD38, whereas the epitope of LAC 3079 can be described as linear (see
[0073] An antibody of the invention preferably is species cross-reactive with humans and at least one other species, which may be a rodent species or a non-human primate. The non-human primate can be rhesus, baboon and/or cynomolgus. The rodent species can be mouse, rat and/or hamster. An antibody that is cross reactive with at least one rodent species, for example, can provide greater flexibility and benefits over known anti-CD38 antibodies, for purposes of conducting in vivo studies in multiple species with the same antibody. Preferably, an antibody of the invention not only is able to bind to CD38, but also is able to mediate killing of a cell expressing CD38. More specifically, an antibody of the invention can mediate its therapeutic effect by depleting CD38-positive (e.g., malignant) cells via antibody-effector functions. These functions include antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC).
[0074] Table 2 provides a summary of the determination of EC50 values of representative antibodies of the invention in both ADCC and CDC:
TABLE-US-00002 TABLE 2 EC50 Values of Antibodies ADCC CDC EC50 [nM] EC50 [nM] Antibody (IgG1) LP-1 RPMI8226 CHO-transfectants MOR03077 0.60.sup.a 0.08.sup.a 0.8.sup.c; 0.94.sup.d MOR03079 0.09.sup.a 0.04.sup.a 0.41.sup.c MOR03080 0.17.sup.b 0.05.sup.a 3.2.sup.c; 2.93.sup.d MOR03100 1.00.sup.b 0.28.sup.a 10.9.sup.c; 13.61.sup.e Chimeric OKT10 5.23.sup.a 4.10.sup.a 9.30.sup.c .sup.amean from at least 2 EC50 determinations .sup.bsingle determination .sup.cmean from 2 EC50 determinations .sup.dmean from 3 EC50 determinations .sup.emean from 4 EC50 determinations
[0075] CD38-expression, however, is not only found on immune cells within the myeloid (e.g. monocytes, granulocytes) and lymphoid lineage (e.g. activated B and T-cells; plasma cells), but also on the respective precursor cells. Since it is important that those cells are not affected by antibody-mediated killing of malignant cells, the antibodies of the present invention are preferably not cytotoxic to precursor cells.
[0076] In addition to its catalytic activities as a cyclic ADP-ribose cyclase and hydrolase, CD38 displays the ability to transduce signals of biological relevance (Hoshino et al., 1997; Ausiello et al., 2000). Those functions can be induced in vivo by, e.g. receptor-ligand interactions or by cross-linking with agonistic anti-CD38 antibodies, leading, e.g. to calcium mobilization, lymphocyte proliferation and release of cytokines. Preferably, the antibodies of the present invention are non-agonistic antibodies.
Peptide Variants
[0077] Antibodies of the invention are not limited to the specific peptide sequences provided herein. Rather, the invention also embodies variants of these polypeptides. With reference to the instant disclosure and conventionally available technologies and references, the skilled worker will be able to prepare, test and utilize functional variants of the antibodies disclosed herein, while appreciating that variants having the ability to mediate killing of a CD38+ target cell fall within the scope of the present invention. As used in this context, ability to mediate killing of a CD38+ target cell means a functional characteristic ascribed to an anti-CD38 antibody of the invention. Ability to mediate killing of a CD38+ target cell, thus, includes the ability to mediate killing of a CD38+ target cell, e.g. by ADCC and/or CDC, or by toxin constructs conjugated to an antibody of the invention.
[0078] A variant can include, for example, an antibody that has at least one altered complementarity determining region (CDR) (hyper-variable) and/or framework (FR) (variable) domain/position, vis--vis a peptide sequence disclosed herein. To better illustrate this concept, a brief description of antibody structure follows.
[0079] An antibody is composed of two peptide chains, each containing one (light chain) or three (heavy chain) constant domains and a variable region (VL, VH), the latter of which is in each case made up of four FR regions and three interspaced CDRs. The antigen-binding site is formed by one or more CDRs, yet the FR regions provide the structural framework for the CDRs and, hence, play an important role in antigen binding. By altering one or more amino acid residues in a CDR or FR region, the skilled worker routinely can generate mutated or diversified antibody sequences, which can be screened against the antigen, for new or improved properties, for example.
[0080] Tables 3a (VH) and 3b (VL) delineate the CDR and FR regions for certain antibodies of the invention and compare amino acids at a given position to each other and to corresponding consensus or master gene sequences (as described in U.S. Pat. No. 6,300,064):
[0081] The skilled worker can use the data in Tables 3a and 3b to design peptide variants that are within the scope of the present invention. It is preferred that variants are constructed by changing amino acids within one or more CDR regions; a variant might also have one or more altered framework regions. With reference to a comparison of the novel antibodies to each other, candidate residues that can be changed include e.g. residues 4 or 37 of the variable light and e.g. residues 13 or 43 of the variable heavy chains of LACs 3080 and 3077, since these are positions of variance vis--vis each other. Alterations also may be made in the framework regions. For example, a peptide FR domain might be altered where there is a deviation in a residue compared to a germline sequence.
[0082] With reference to a comparison of the novel antibodies to the corresponding consensus or master gene sequence, candidate residues that can be changed include e.g. residues 27, 50 or 90 of the variable light chain of LAC 3080 compared to VLX3 and e.g. residues 33, 52 and 97 of the variable heavy chain of LAC 3080 compared to VH3. Alternatively, the skilled worker could make the same analysis by comparing the amino acid sequences disclosed herein to known sequences of the same class of such antibodies, using, for example, the procedure described by Knappik et al., 2000 and U.S. Pat. No. 6,300,064 issued to Knappik et al.
[0083] Furthermore, variants may be obtained by using one LAC as starting point for optimization by diversifying one or more amino acid residues in the LAC, preferably amino acid residues in one or more CDRs, and by screening the resulting collection of antibody variants for variants with improved properties. Particularly preferred is diversification of one or more amino acid residues in CDR-3 of VL, CDR-3 of VH, CDR-1 of VL and/or CDR-2 of VH. Diversification can be done by synthesizing a collection of DNA molecules using trinucleotide mutagenesis (TRIM) technology (Virneks, B., Ge, L., Plckthun, A., Schneider, K. C., Wellnhofer, G., and Moroney S. E. (1994) Trinucleotide phosphoramidites: ideal reagents for the synthesis of mixed oligonucleotides for random mutagenesis. Nucl. Acids Res. 22, 5600.).
Conservative Amino Acid Variants
[0084] Polypeptide variants may be made that conserve the overall molecular structure of an antibody peptide sequence described herein. Given the properties of the individual amino acids, some rational substitutions will be recognized by the skilled worker. Amino acid substitutions, i.e., conservative substitutions, may be made, for instance, on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved.
[0085] For example, (a) nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; (b) polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; (c) positively charged (basic) amino acids include arginine, lysine, and histidine; and (d) negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Substitutions typically may be made within groups (a)-(d). In addition, glycine and proline may be substituted for one another based on their ability to disrupt a-helices. Similarly, certain amino acids, such as alanine, cysteine, leucine, methionine, glutamic acid, glutamine, histidine and lysine are more commonly found in a-helices, while valine, isoleucine, phenylalanine, tyrosine, tryptophan and threonine are more commonly found in -pleated sheets. Glycine, serine, aspartic acid, asparagine, and proline are commonly found in turns. Some preferred substitutions may be made among the following groups: (i) S and T; (ii) P and G; and (iii) A, V, L and I. Given the known genetic code, and recombinant and synthetic DNA techniques, the skilled scientist readily can construct DNAs encoding the conservative amino acid variants. In one particular example, amino acid position 3 in SEQ ID NOS: 5, 6, 7, and/or 8 can be changed from a Q to an E.
[0086] As used herein, sequence identity between two polypeptide sequences indicates the percentage of amino acids that are identical between the sequences. Sequence similarity indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. Preferred polypeptide sequences of the invention have a sequence identity in the CDR regions of at least 60%, more preferably, at least 70% or 80%, still more preferably at least 90% and most preferably at least 95%. Preferred antibodies also have a sequence similarity in the CDR regions of at least 80%, more preferably 90% and most preferably 95%.
DNA Molecules of the Invention
[0087] The present invention also relates to the DNA molecules that encode an antibody of the invention. These sequences include, but are not limited to, those DNA molecules set forth in
[0088] DNA molecules of the invention are not limited to the sequences disclosed herein, but also include variants thereof. DNA variants within the invention may be described by reference to their physical properties in hybridization. The skilled worker will recognize that DNA can be used to identify its complement and, since DNA is double stranded, its equivalent or homolog, using nucleic acid hybridization techniques. It also will be recognized that hybridization can occur with less than 100% complementarity. However, given appropriate choice of conditions, hybridization techniques can be used to differentiate among DNA sequences based on their structural relatedness to a particular probe. For guidance regarding such conditions see, Sambrook et al., 1989 (Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, USA) and Ausubel et al., 1995 (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Sedman, J. G., Smith, J. A., & Struhl, K. eds. (1995). Current Protocols in Molecular Biology. New York: John Wiley and Sons).
[0089] Structural similarity between two polynucleotide sequences can be expressed as a function of stringency of the conditions under which the two sequences will hybridize with one another. As used herein, the term stringency refers to the extent that the conditions disfavor hybridization. Stringent conditions strongly disfavor hybridization, and only the most structurally related molecules will hybridize to one another under such conditions. Conversely, non-stringent conditions favor hybridization of molecules displaying a lesser degree of structural relatedness. Hybridization stringency, therefore, directly correlates with the structural relationships of two nucleic acid sequences. The following relationships are useful in correlating hybridization and relatedness (where T.sub.m is the melting temperature of a nucleic acid duplex):
a. T.sub.m=69.3+0.41(G+C)%
b. The T.sub.m of a duplex DNA decreases by 1 C. with every increase of 1% in the number of mismatched base pairs.
c. (T.sub.m).sub.2(T.sub.m).sub.1=18.5 log.sub.102/1
where 1 and 2 are the ionic strengths of two solutions.
[0090] Hybridization stringency is a function of many factors, including overall DNA concentration, ionic strength, temperature, probe size and the presence of agents which disrupt hydrogen bonding. Factors promoting hybridization include high DNA concentrations, high ionic strengths, low temperatures, longer probe size and the absence of agents that disrupt hydrogen bonding. Hybridization typically is performed in two phases: the binding phase and the washing phase.
[0091] First, in the binding phase, the probe is bound to the target under conditions favoring hybridization. Stringency is usually controlled at this stage by altering the temperature. For high stringency, the temperature is usually between 65 C. and 70 C., unless short (<20 nt) oligonucleotide probes are used. A representative hybridization solution comprises 6 SSC, 0.5% SDS, 5 Denhardt's solution and 100 g of nonspecific carrier DNA. See Ausubel et al., section 2.9, supplement 27 (1994). Of course, many different, yet functionally equivalent, buffer conditions are known. Where the degree of relatedness is lower, a lower temperature may be chosen. Low stringency binding temperatures are between about 25 C. and 40 C. Medium stringency is between at least about 40 C. to less than about 65 C. High stringency is at least about 65 C.
[0092] Second, the excess probe is removed by washing. It is at this phase that more stringent conditions usually are applied. Hence, it is this washing stage that is most important in determining relatedness via hybridization. Washing solutions typically contain lower salt concentrations. One exemplary medium stringency solution contains 2 SSC and 0.1% SDS. A high stringency wash solution contains the equivalent (in ionic strength) of less than about 0.2 SSC, with a preferred stringent solution containing about 0.1 SSC. The temperatures associated with various stringencies are the same as discussed above for binding. The washing solution also typically is replaced a number of times during washing. For example, typical high stringency washing conditions comprise washing twice for 30 minutes at 55 C. and three times for 15 minutes at 60 C.
[0093] Accordingly, the present invention includes nucleic acid molecules that hybridize to the molecules of set forth in Figures la and 2a under high stringency binding and washing conditions, where such nucleic molecules encode an antibody or functional fragment thereof having properties as described herein. Preferred molecules (from an mRNA perspective) are those that have at least 75% or 80% (preferably at least 85%, more preferably at least 90% and most preferably at least 95%) homology or sequence identity with one of the DNA molecules described herein. In one particular example of a variant of the invention, nucleic acid position 7 in SEQ ID NOS: 1, 2, 3 and/or 4 can be substituted from a C to a G, thereby changing the codon from CAA to GAA.
Functionally Equivalent Variants
[0094] Yet another class of DNA variants within the scope of the invention may be described with reference to the product they encode (see the peptides listed in
[0095] It is recognized that variants of DNA molecules provided herein can be constructed in several different ways. For example, they may be constructed as completely synthetic DNAs. Methods of efficiently synthesizing oligonucleotides in the range of 20 to about 150 nucleotides are widely available. See Ausubel et al., section 2.11, Supplement 21 (1993). Overlapping oligonucleotides may be synthesized and assembled in a fashion first reported by Khorana et al., J. Mol. Biol. 72:209-217 (1971); see also Ausubel et al., supra, Section 8.2. Synthetic DNAs preferably are designed with convenient restriction sites engineered at the 5 and 3 ends of the gene to facilitate cloning into an appropriate vector.
[0096] As indicated, a method of generating variants is to start with one of the DNAs disclosed herein and then to conduct site-directed mutagenesis. See Ausubel et al., supra, chapter 8, Supplement 37 (1997). In a typical method, a target DNA is cloned into a single-stranded DNA bacteriophage vehicle. Single-stranded DNA is isolated and hybridized with an oligonucleotide containing the desired nucleotide alteration(s). The complementary strand is synthesized and the double stranded phage is introduced into a host. Some of the resulting progeny will contain the desired mutant, which can be confirmed using DNA sequencing. In addition, various methods are available that increase the probability that the progeny phage will be the desired mutant. These methods are well known to those in the field and kits are commercially available for generating such mutants.
Recombinant DNA Constructs and Expression
[0097] The present invention further provides recombinant DNA constructs comprising one or more of the nucleotide sequences of the present invention. The recombinant constructs of the present invention are used in connection with a vector, such as a plasmid or viral vector, into which a DNA molecule encoding an antibody of the invention is inserted.
[0098] The encoded gene may be produced by techniques described in Sambrook et al., 1989, and Ausubel et al., 1989. Alternatively, the DNA sequences may be chemically synthesized using, for example, synthesizers. See, for example, the techniques described in OLIGONUCLEOTIDE SYNTHESIS (1984, Gait, ed., IRL Press, Oxford), which is incorporated by reference herein in its entirety. Recombinant constructs of the invention are comprised with expression vectors that are capable of expressing the RNA and/or protein products of the encoded DNA(s). The vector may further comprise regulatory sequences, including a promoter operably linked to the open reading frame (ORF). The vector may further comprise a selectable marker sequence. Specific initiation and bacterial secretory signals also may be required for efficient translation of inserted target gene coding sequences.
[0099] The present invention further provides host cells containing at least one of the DNAs of the present invention. The host cell can be virtually any cell for which expression vectors are available. It may be, for example, a higher eukaryotic host cell, such as a mammalian cell, a lower eukaryotic host cell, such as a yeast cell, but preferably is a prokaryotic cell, such as a bacterial cell. Introduction of the recombinant construct into the host cell can be effected by calcium phosphate transfection, DEAE, dextran mediated transfection, electroporation or phage infection.
Bacterial Expression
[0100] Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and, if desirable, to provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus.
[0101] Bacterial vectors may be, for example, bacteriophage-, plasmid- or phagemid-based. These vectors can contain a selectable marker and bacterial origin of replication derived from commercially available plasmids typically containing elements of the well known cloning vector pBR322 (ATCC 37017). Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is de-repressed/induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period. Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
[0102] In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the protein being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of antibodies or to screen peptide libraries, for example, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
Therapeutic Methods
[0103] Therapeutic methods involve administering to a subject in need of treatment a therapeutically effective amount of an antibody contemplated by the invention. A therapeutically effective amount hereby is defined as the amount of an antibody that is of sufficient quantity to deplete CD38-positive cells in a treated area of a subjecteither as a single dose or according to a multiple dose regimen, alone or in combination with other agents, which leads to the alleviation of an adverse condition, yet which amount is toxicologically tolerable. The subject may be a human or non-human animal (e.g., rabbit, rat, mouse, monkey or other lower-order primate).
[0104] An antibody of the invention might be co-administered with known medicaments, and in some instances the antibody might itself be modified. For example, an antibody could be conjugated to an immunotoxin or radioisotope to potentially further increase efficacy.
[0105] The inventive antibodies can be used as a therapeutic or a diagnostic tool in a variety of situations where CD38 is undesirably expressed or found. Disorders and conditions particularly suitable for treatment with an antibody of the inventions are multiple myeloma (MM) and other haematological diseases, such as chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), acute myelogenous leukemia (AML), and acute lymphocytic leukemia (ALL). An antibody of the invention also might be used to treat inflammatory disease such as rheumatoid arthritis (RA) or systemic lupus erythematosus (SLE).
[0106] To treat any of the foregoing disorders, pharmaceutical compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. An antibody of the invention can be administered by any suitable means, which can vary, depending on the type of disorder being treated. Possible administration routes include parenteral (e.g., intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous), intrapulmonary and intranasal, and, if desired for local immunosuppressive treatment, intralesional administration. In addition, an antibody of the invention might be administered by pulse infusion, with, e.g., declining doses of the antibody. Preferably, the dosing is given by injections, most preferably intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic. The amount to be administered will depend on a variety of factors such as the clinical symptoms, weight of the individual, whether other drugs are administered. The skilled artisan will recognize that the route of administration will vary depending on the disorder or condition to be treated.
[0107] Determining a therapeutically effective amount of the novel polypeptide, according to this invention, largely will depend on particular patient characteristics, route of administration, and the nature of the disorder being treated. General guidance can be found, for example, in the publications of the International Conference on Harmonisation and in REMINGTON'S PHARMACEUTICAL SCIENCES, chapters 27 and 28, pp. 484-528 (18th ed., Alfonso R. Gennaro, Ed., Easton, Pa.: Mack Pub. Co., 1990). More specifically, determining a therapeutically effective amount will depend on such factors as toxicity and efficacy of the medicament. Toxicity may be determined using methods well known in the art and found in the foregoing references. Efficacy may be determined utilizing the same guidance in conjunction with the methods described below in the Examples.
Diagnostic Methods
[0108] CD38 is highly expressed on hematological cells in certain malignancies; thus, an anti-CD38 antibody of the invention may be employed in order to image or visualize a site of possible accumulation of malignant cells in a patient. In this regard, an antibody can be detectably labeled, through the use of radioisotopes, affinity labels (such as biotin, avidin, etc.) fluorescent labels, paramagnetic atoms, etc. Procedures for accomplishing such labeling are well known to the art. Clinical application of antibodies in diagnostic imaging are reviewed by Grossman, H. B., Urol. Clin. North Amer. 13:465-474 (1986)), Unger, E. C. et al., Invest. Radiol. 20:693-700 (1985)), and Khaw, B. A. et al., Science 209:295-297 (1980)).
[0109] The detection of foci of such detectably labeled antibodies might be indicative of a site of tumor development, for example. In one embodiment, this examination is done by removing samples of tissue or blood and incubating such samples in the presence of the detectably labeled antibodies. In a preferred embodiment, this technique is done in a non-invasive manner through the use of magnetic imaging, fluorography, etc. Such a diagnostic test may be employed in monitoring the success of treatment of diseases, where presence or absence of CD38-positive cells is a relevant indicator. The invention also contemplates the use of an anti-CD38 antibody, as described herein for diagnostics in an ex vivo setting.
Therapeutic And Diagnostic Compositions
[0110] The antibodies of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, wherein an antibody of the invention (including any functional fragment thereof) is combined in a mixture with a pharmaceutically acceptable carrier vehicle. Suitable vehicles and their formulation are described, for example, in REMINGTON'S PHARMACEUTICAL SCIENCES (18th ed., Alfonso R. Gennaro, Ed., Easton, Pa.: Mack Pub. Co., 1990). In order to form a pharmaceutically acceptable composition suitable for effective administration, such compositions will contain an effective amount of one or more of the antibodies of the present invention, together with a suitable amount of carrier vehicle.
[0111] Preparations may be suitably formulated to give controlled-release of the active compound. Controlled-release preparations may be achieved through the use of polymers to complex or absorb anti-CD38 antibody. The controlled delivery may be exercised by selecting appropriate macromolecules (for example polyesters, polyamino acids, polyvinyl, pyrrolidone, ethylenevinyl-acetate, methylcellulose, carboxymethylcellulose, or protamine, sulfate) and the concentration of macromolecules as well as the methods of incorporation in order to control release. Another possible method to control the duration of action by controlled release preparations is to incorporate anti-CD38 antibody into particles of a polymeric material such as polyesters, polyamino acids, hydrogels, poly(lactic acid) or ethylene vinylacetate copolymers. Alternatively, instead of incorporating these agents into polymeric particles, it is possible to entrap these materials in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatine-microcapsules and poly(methylmethacylate) microcapsules, respectively, or in colloidal drug delivery systems, for example, liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences (1980).
[0112] The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampules, or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0113] The compositions may, if desired, be presented in a pack or dispenser device, which may contain one or more unit dosage forms containing the active ingredient. The pack may for example comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.
[0114] The invention further is understood by reference to the following working examples, which are intended to illustrate and, hence, not limit the invention.
EXAMPLES
Cell-Lines
[0115] The following cell-lines were obtained from the European Collection of Cell Cultures (ECACC), the German Collection of Microorganisms (DSMZ) or the American Type Culture collection (ATCC): hybridoma cell line producing the CD38 mouse IgG1 monoclonal antibody OKT10 (ECACC, #87021903), Jurkat cells (DSMZ, ACC282), LP-1 (DSMZ, ACC41), RPMI8226 (ATCC, CCL-155), HEK293 (ATCC, CRL-1573), CHO-Kl (ATCC, CRL-61) and Raji (ATCC, CCL-86)
Cells and Culture-Conditions
[0116] All cells were cultured under standardized conditions at 37 C. and 5% CO.sub.2 in a humidified incubator. The cell-lines LP-1, RPMI8226, Jurkat and Raji were cultured in RPMI1640 (Pan biotech GmbH, #PO4-16500) supplemented with 10% FCS (PAN biotech GmbH, #P30-3302), 50 U/ml penicillin, 50 g/m1 streptomycin (Gibco, #15140-122) and 2 mM glutamine (Gibco, #25030-024) and, in case of Jurkat- and Raji-cells, additionally 10 mM Hepes (Pan biotech GmbH, #P05-01100) and 1 mM sodium pyruvate (Pan biotech GmbH, # PO4-43100) had to be added.
[0117] CHO-Kl and HEK293 were grown in DMEM (Gibco, #10938-025) supplemented with 2 mM glutamine and 10% FCS. Stable CD38 CHO-Kl transfectants were maintained in the presence of G418 (PAA GmbH, P11-012) whereas for HEK293 the addition of 1 mM sodium-pyruvate was essential. After transient transfection of HEK293 the 10% FCS was replaced by Ultra low IgG FCS (Invitrogen, #16250-078). The cell-line OKT10 was cultured in IDMEM (Gibco, #31980-022), supplemented with 2 mM glutamine and 20% FCS.
Preparation of Single Cell Suspensions from Peripheral Blood
[0118] All blood samples were taken after informed consent. Peripheral blood mononuclear cells (PBMC) were isolated by HISTOPAQUE-1077 (medium comprising polysucrose and sodium diatrizoate adjusted to density of 1.077 g/mL)(Sigma) according to the manufacturer's instructions from healthy donors. Red blood cells were depleted from these cell suspensions by incubation in ACK Lysis Buffer (0.15 M NH4Cl, 10 mM KHCO.sub.3, 0.1 M EDTA) for 5 min at RT or a commercial derivative (Bioscience, #00-4333). Cells were washed twice with PBS and then further processed for flow cytometry or ADCC (see below).
Flow Cytometry (FACS)
[0119] All stainings were performed in round bottom 96-well culture plates (Nalge Nunc) with 210.sup.5 cells per well. Cells were incubated with Fab or IgG antibodies at the indicated concentrations in 50 l FACS buffer (PBS, 3% FCS, 0.02% NaN.sub.3) for 40 min at 4 C. Cells were washed twice and then incubated with R-Phycoerythrin (PE) conjugated goat-anti-human or goat-anti-mouse IgG (H+L) F(ab).sub.2 (Jackson Immuno Research), diluted 1:200 in FACS buffer, for 30 min at 4 C. Cells were again washed, resuspended in 0.3 ml FACS buffer and then analyzed by flow cytometry in a FACSCalibur (Becton Dickinson, San Diego, Calif.).
[0120] For FACS based Scatchard analyses RPMI8226 cells were stained with at 12 different dilutions (1:2k) starting at 12.5 g/ml (IgG) final concentration. At least two independent measurements were used for each concentration and KD values extrapolated from median fluorescence intensities according to Chamow et al. (1994).
Surface Plasmon Resonance
[0121] The kinetic constants k.sub.on and k.sub.off were determined with serial dilutions of the respective Fab binding to covalently immobilized CD38-Fc fusion protein using the BIACORE 3000 instrument (BIACORE, Uppsala, Sweden). For covalent antigen immobilization standard EDC-NHS amine coupling chemistry was used. For direct coupling of CD38 Fc-fusion protein CMS senor chips (BIACORE) were coated with 600-700 RU in 10 mM acetate buffer, pH 4.5. For the reference flow cell a respective amount of HSA (human serum albumin) was used. Kinetic measurements were done in PBS (136 mM NaCl, 2.7 mM KCl, 10 mM Na.sub.2HPO.sub.4, 1.76 mM KH.sub.2PO.sub.4 pH 7.4) at a flow rate of 20 l/min using Fab concentration range from 1.5-500 nM. Injection time for each concentration was 1 min, followed by 2 min dissociation phase. For regeneration 5 l 10 mM HCl was used. All sensograms were fitted locally using BIA evaluation software 3.1 (BIACORE).
Example 1
[0122] Antibody Generation from HUCALLibraries
[0123] For the generation of therapeutic antibodies against CD38, selections with the MorphoSys HUCAL GOLD phage display library were carried out. HUCAL GOLD is a Fab library based on the HUCAL concept (Knappik et al., 2000; Krebs et al., 2001), in which all six CDRs are diversified, and which employs the CYSDISPLAY technology for linking Fab fragments to the phage surface (Lohning, 2001).
A. Phagemid Rescue, Phage Amplification and Purification
[0124] HUCAL GOLD phagemid library was amplified in 2TY medium containing 34 g/ml chloramphenicol and 1% glucose (2TY-CG). After helper phage infection (VCSM13) at an OD600 of 0.5 (30 min at 37 C. without shaking; 30 min at 37 C. shaking at 250 rpm), cells were spun down (4120 g; 5 min; 4 C.), resuspended in 2TY/34 g/ml chloramphenicol/50 g/ml kanamycin and grown overnight at 22 C. Phages were PEG-precipitated from the supernatant, resuspended in PBS/20% glycerol and stored at 80 C. Phage amplification between two panning rounds was conducted as follows: mid-log phase TG1 cells were infected with eluted phages and plated onto LB-agar supplemented with 1% of glucose and 34 g/ml of chloramphenicol (LB-CG). After overnight incubation at 30 C., colonies were scraped off, adjusted to an OD600 of 0.5 and helper phage added as described above.
B. Pannings with HUCAL GOLD
[0125] For the selections HUCAL GOLD antibody-phages were divided into three pools corresponding to different VH master genes (pool 1: VH1/5, pool 2: VH3 , pool 3: VH2/4/6 ). These pools were individually subjected to 3 rounds of whole cell panning on CD38-expressing CHO-Kl cells followed by pH-elution and a post-adsorption step on CD38-negative CHO-Kl-cells for depletion of irrelevant antibody-phages. Finally, the remaining antibody phages were used to infect E. coli TG1 cells. After centrifugation the bacterial pellet was resuspended in 2TY medium, plated on agar plates and incubated overnight at 30 C. The selected clones were then scraped from the plates, phages were rescued and amplified. The second and the third round of selections were performed as the initial one.
[0126] The Fab encoding inserts of the selected HUCAL GOLD phages were subcloned into the expression vector pMORPH9 Fab FS (Rauchenberger et al., 2003) to facilitate rapid expression of soluble Fab. The DNA of the selected clones was digested with Xbal and EcoRI thereby cutting out the Fab encoding insert (ompA-VLCL and phoA-Fd), and cloned into the Xbal/EcoRI cut vector pMORPHx9_Fab_FS. Fab expressed in this vector carry two C-terminal tags (FLAG (recognizing the FLAG octapeptide epitope, SIGMA) and STREP-TAG II) (comprising eight amino acid residues binding specifically to the STREPTACTIN ligand) for detection and purification.
Example 2
Biological Assays
[0127] Antibody dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity was measured according to a published protocol based on flow-cytometry analysis (Naundorf et al., 2002) as follows:
ADCC:
[0128] For ADCC measurements, target cells (T) were adjusted to 2.0 E+05 cells/ml and labeled with 100 ng/ml Calcein AM (Molecular Probes, C-3099) in RPMI1640 medium (Pan biotech GmbH) for 2 minutes at room temperature. Residual calcein was removed by 3 washing steps in RPMI1640 medium. In parallel PBMC were prepared as source for (natural killer) effector cells (E), adjusted to 1.0 E+07 and mixed with the labeled target cells to yield a final E:T-ratio of 50:1 or less, depending on the assay conditions. Cells were washed once and the cell-mix resuspended in 200 l RPMI1640 medium containing the respective antibody at different dilutions. The plate was incubated for 4 hrs under standardized conditions at 37 C. and 5% CO2 in a humidified incubator. Prior to FACS analysis cells were labeled with propidium-iodide (PI) and analyzed by flow-cytometry (Becton-Dickinson). Between 50.000 and 150.000 events were counted for each assay. The following equation gave rise to the killing activity [in %]:
with ED.sup.A=events dead cells (calcein +PI stained cells), and
EL.sup.A=events living cells (calcein stained cells)
CDC:
[0129] For CDC measurements, 5.0 E+04 CD38 CHO-Kl transfectants were added to a microtiter well plate (Nunc) together with a 1:4 dilution of human serum (Sigma, #S-1764) and the respective antibody. All reagents and cells were diluted in RPMI1640 medium (Pan biotech GmbH) supplemented with 10% FCS. The reaction-mix was incubated for 2 hrs under standardized conditions at 37 C. and 5% CO.sub.2 in a humidified incubator. As negative controls served either heat-inactivated complement or CD38-transfectants without antibody. Cells were labeled with PI and subjected to FACS-analysis.
[0130] In total 5000 events were counted and the number of dead cells at different antibody concentrations used for the determination of EC50 values. The following equation gave rise to the killing activity [in %]:
with ED.sup.C=events dead cells (PI stained cells), and
EL.sup.C=events living cells (unstained)
[0131] Cytotoxicity values from a total of 12 different antibody-dilutions (1:2.sup.n) in triplicates were used in ADCC and duplicates in CDC for each antibody in order obtain EC-50 values with a standard analysis software (PRISM, Graph Pad Software).
Example 3
Generation of Stable CD38-Transfectants and CD38 Fe-Fusion Proteins
[0132] In order to generate CD38 protein for panning and screening two different expression systems had to be established. The first strategy included the generation of CD38-Fc-fusion protein, which was purified from supernatants after transient transfection of HEK293 cells. The second strategy involved the generation of a stable CHO-Klcell line for high CD38 surface expression to be used for selection of antibody-phages via whole cell panning.
[0133] As an initial step Jurkat cells (DSMZ ACC282) were used for the generation of cDNA (Invitrogen) followed by amplification of the entire CD38-coding sequence using primers complementary to the first 7 and the last 9 codons of CD38, respectively (primer MTE001 & MTE002rev; Table 4). Sequence analysis of the CD38-insert confirmed the published amino acid sequence by Jackson et al. (1990) except for position 49 which revealed a glutamine instead of a tyrosine as described by Nata et al. (1997). For introduction of restriction endonuclease sites and cloning into different derivatives of expression vector pcDNA3.1 (Stratagene), the purified PCR-product served as a template for the re-amplification of the entire gene (primers MTE006 & MTE007rev, Table 4) or a part (primers MTE004 & MTE009rev, Table 4) of it. In the latter case a fragment encoding for the extracellular domain (aa 45 to 300) was amplified and cloned in frame between a human Vkappa leader sequence and a human Fc-gamma 1 sequence. This vector served as expression vector for the generation of soluble CD38-Fc fusion-protein. Another pcDNA3.1-derivative without leader-sequence was used for insertion of the CD38 full-length gene. In this case a stop codon in front of the Fc-coding region and the missing leader-sequence gave rise to CD38-surface expression. HEK293 cells were transiently transfected with the Fc-fusion protein vector for generation of soluble CD38 Fc-fusion protein and, in case of the full-length derivative, CHO-Kl-cells were transfected for the generation of a stable CD38-expressing cell line.
TABLE-US-00003 TABLE4 Primer# Sequence(5 ->3) MTE001 ATGGCCAACTGCGAGTTCAGC (SEQIDNO:25) MTE002rev TCAGATCTCAGATGTGCAAGATGAATC (SEQIDNO:26) MTE004 TTGGTACCAGGTGGCGCCAGCAGTG (SEQIDNO:27) MTE006 TTGGTACCATGGCCAACTGCGAG (SEQIDNO:28) MTE007rev CCGATATCA*GATCTCAGATGTGCAAGATG (SEQIDNO:29) MTE009rev CCGATATCGATCTCAGATGTGCAAGATG (SEQIDNO:30) * leading to a stop codon (TGA) in the sense orientation.
Example 4
Cloning, Expression and Purification of HuCAL IgG1:
[0134] In order to express full length IgG, variable domain fragments of heavy (VH) and light chains (VL) were subcloned from Fab expression vectors into appropriate AMORPH_hIg vectors (see
[0135] IgGs were purified from cell culture supernatants by affinity chromatography via Protein A Sepharose column. Further down stream processing included a buffer exchange by gel filtration and sterile filtration of purified IgG. Quality control revealed a purity of >90% by reducing SDS-PAGE and >90% monomeric IgG as determined by analytical size exclusion chromatography. The endotoxin content of the material was determined by a kinetic LAL based assay (Cambrex European Endotoxin Testing Service, Belgium).
Example 5
[0136] Generation and Production of Chimeric OKT10 (chOKT10; SEQ ID NOS: 23 and 24)
[0137] For the construction of chOKT10 the mouse VH and VL regions were amplified by PCR using cDNA prepared from the murine OKT10 hybridoma cell line (ECACC #87021903). A set of primers was used as published (Dattamajumdar et al., 1996; Zhou et al., 1994). PCR products were used for Topo-cloning (Invitrogen; pCRII-vector) and single colonies subjected to sequence analysis (M13 reverse primer) which revealed two different kappa light chain sequences and one heavy chain sequence. According to sequence alignments (EMBL-nucleotide sequence database) and literature (Krebber et al, 1997) one of the kappa-sequence belongs to the intrinsic repertoire of the tumor cell fusion partner X63Ag8.653 and hence does not belong to OKT10 antibody. Therefore, only the new kappa sequence and the single VH-fragment was used for further cloning. Both fragments were reamplified for the addition of restriction endonuclease sites followed by cloning into the respective pMORPH IgG1-expression vectors. The sequences for the heavy chain (SEQ ID NO: 23) and light chain (SEQ ID NO: 24) are given in
Example 6
Epitope Mapping
1. Materials and Methods:
Antibodies:
[0138] The following anti-CD38 IgGs were sent for epitope mappings:
TABLE-US-00004 Conc. [mg/ml]/ MOR# Lot # Format Vol.[l] MOR03077 2CHE106_030602 human IgG1 0.44/1500 MOR03079 2APO31 human IgG1 0.38/500 MOR03080 030116_4CUE16 human IgG1 2.28/200 MOR03100 030612_6SBA6 human IgG1 0.39/500 chim. OKT10* 030603_2CHE111 human IgG1 0.83/500 *chimeric OKT10 consisting of human Fc and mouse variable regions.
CD38-Sequence:
[0139] The amino acid (aa) sequence (position 44-300) is based on human CD38 taken from the published sequence under SWISS-PROT primary accession number P28907. At position 49 the aa Q (instead of T) has been used for the peptide-design.
PepSpot-Analysis:
[0140] The antigen peptides were synthesized on a cellulose membrane in a stepwise manner resulting in a defined arrangement (peptide array) and are covalently bound to the cellulose membrane. Binding assays were performed directly on the peptide array.
[0141] In general an antigen peptide array is incubated with blocking buffer for several hours to reduce non-specific binding of the antibodies. The incubation with the primary (antigen peptide-binding) antibody in blocking buffer occurs followed by the incubation with the peroxidase (POD)-labelled secondary antibody, which binds selectively the primary antibody. A short T (Tween)-TBS-buffer washing directly after the incubation of the antigen peptide array with the secondary antibody followed by the first chemiluminescence experiment is made to get a first overview which antigen peptides do bind the primary antibody. Several buffer washing steps follow (T-TBS- and TBS-buffer) to reduce false positive binding (unspecific antibody binding to the cellulose membrane itself). After these washing steps the final chemiluminescence analysis is performed. The data were analysed with an imaging system showing the signal intensity (Boehringer Light units, BLU) as single measurements for each peptide. In order to evaluate non-specific binding of the secondary antibodies (anti-human IgG), these antibodies were incubated with the peptide array in the absence of primary antibodies as the first step. If the primary antibody does not show any binding to the peptides it can be directly labelled with POD, which increases the sensitivity of the system (as performed for MOR3077). In this case a conventional coupling chemistry via free amino-groups is performed.
[0142] The antigen was scanned with 13-mer peptides (11 amino acids overlap). This resulted in arrays of 123 peptides. Binding assays were performed directly on the array. The peptide-bound antibodies MOR03077, MOR03079, MOR03080, MOR03100 and chimeric OKT10 were detected using a peroxidase-labelled secondary antibody (peroxidase conjugate-goat anti-human IgG, gamma chain specific, affinity isolated antibody; Sigma-Aldrich, A6029). The mappings were performed with a chemiluminescence substrate in combination with an imaging system. Additionally, a direct POD-labelling of MOR03077 was performed in order to increase the sensitivity of the system.
2. Summary and Conclusions:
[0143] All five antibodies showed different profiles in the PepSpot analysis. A schematic summary is given in
[0144] The epitopes for MOR03080 and MOR03100 can be clearly considered as discontinuous since several peptides covering different sites of the protein sites were recognized. Those peptides comprise aa 82-94 and aa 158-170 for MOR03080 and aa 82-94, 142-154, 158-170, 188-200 and 280-296 for MOR03100. However, some overlaps between both epitopes can be postulated since two different sites residing within aa positions 82-94 (CQSVWDAFKGAFI (SEQ ID NO:40); peptide #20) and 158-170 (TWCGEFNTSKINY (SEQ ID NO:41); peptide #58) are recognized by both antibodies.
[0145] The epitope for MOR03077 can be considered as clearly different from the latter two and can be described as multisegmented discontinuous epitope. The epitope includes aa 44-66, 110-122, 148-164, 186-200 and 202-224.
Example 7
IL-6-Release/Proliferation Assay
1. Materials and Methods:
[0146] Proliferation- and a IL-6 release assays have been performed according to Ausiello et al. (2000) with the following modifications: PBMCs from different healthy donors (after obtaining informed consent) were purified by density gradient centrifugation using the HISTOPAQUE (medium comprising polysucrose and sodium diatrizoate adjusted to density of 1.077 g/mL) cell separation system according to the instructions of the supplier (Sigma) and cultured under standard conditions (5% CO2, 37 C.) in RPMI1640 medium, supplemented with 10% FCS and glutamine (complete RPMI1640). For both assays the following antibodies were used: HuCAL anti-CD38 IgGls Mabs MOR03077, MOR03079, and MOR03080, an agonistic murine IgG2a monoclonal antibody (IB4; Malavasi et al., 1984), an irrelevant HuCAL IgG1 antibody, a matched isotype control (murine IgG2a: anti-trinitrophenol, hapten-specific antibody; cat.#: 555571, clone G155-178; Becton Dickinson) or a medium control. For the IL-6 release assay, 1.0 E+06 PBMCs in 0.5 ml complete RPMI1640 medium were incubated for 24 hrs in a 15 ml culture tube (Falcon) in the presence of 20 g/ml antibodies. Cell culture supernatants were harvested and analysed for IL-6 release using the Quantikine kit according to the manufacturer's protocol (R&D systems). For the proliferation assay 2.0E+05 PBMCs were incubated for 3 days in a 96-well flat bottom plate (Nunc) in the presence of 20 pg/m1 antibodies. Each assay was carried out in duplicates. After 4 days BrdU was added to each well and cells incubated for an additional 24 hrs at 37 C. prior to cell fixation and DNA denaturation according to the protocol of the supplier (Roche). Incorporation of BrdU was measured via an anti-BrdU peroxidase-coupled antibody in a chemiluminescence-based setting.
2. Summary and Conclusions:
Proliferation Assay:
[0147] In addition to its catalytic activities as a cyclic ADP-ribose cyclase and hydrolase, CD38 displays the ability to transduce signals of biological relevance (Hoshino et al., 1997; Ausiello et al., 2000). Those functions can be induced in vivo by e.g. receptor-ligand interactions or by cross-linking with anti-CD38 antibodies. Those signalling events lead e.g. to calcium mobilization, lymphocyte proliferation and release of cytokines. However, this signalling is not only dependent on the antigenic epitope but might also vary from donor to donor (Ausiello et al., 2000). In the view of immunotherapy non-agonistic antibodies are preferable over agonistic antibodies. Therefore, HuCAL anti-CD38 antibodies (Mabs MOR03077; MOR03079, MOR03080) were further characterized in a proliferation assay and IL-6- (important MM growth-factor) release assay in comparison to the reference antibody chOKT10 and the agonistic anti-CD38 monoclonal antibody IB4.
[0148] As demonstrated in
Example 8
Clonogenic Assay
1. Materials and Methods:
[0149] PBMCs harbouring autologous CD34+/CD38+precursor cells were isolated from healthy individuals (after obtaining informed consent) by density gradient centrifugation using the Histopaque cell separation system according to the instructions of the supplier (Sigma) and incubated with different HUCAL IgGlanti-CD38 antibodies (Mabs MOR03077, MOR03079, and MOR03080) and the positive control (PC) chOKT10 at 10 g/ml. Medium and an irrelevant HUCAL IgG1 served as background control. Each ADCC-assay consisted of 4.0E+05 PBMCs which were incubated for 4 hrs at 37 C. in RPMI1640 medium supplemented with 10% FCS. For the clonogenic assay 2.50 ml complete methylcellulose (CellSystems) was inoculated with 2.5 E+05 cells from the ADCC-assay and incubated for colony-development for at least 14 days in a controlled environment (37 C.; 5% CO2). Colonies were analyzed by two independent operators and grouped into BFU-E +CFU-GEMM (erythroid burst forming units and granulocyte/erythroid/macrophage/megakaryocyte stem cells) and CFU-GM (granulocyte/macrophage stem cells).
2. Summary and Conclusions:
[0150] Since CD38-expression is not only found on immune cells within the myeloid (e.g. monocytes, granulocytes) and lymphoid lineage (e.g. activated B and T-cells; plasma cells) but also on the respective precursor cells (CD34+/CD38+), it is important that those cells are not affected by antibody-mediated killing. Therefore, a clonogenic assay was applied in order to analyse those effects on CD34+/CD38+progenitors.
[0151] PBMCs from healthy donors were incubated with HUCAL anti-CD38 antibodies (Mab#1, Mab#2 and Mab#3) or several controls (irrelevant HUCAL antibody, medium and reference antibody chOKT10 as positive control) according to a standard ADCC-protocol followed by further incubation in conditioned methylcellulose for colony-development. As shown in
Example 9
[0152] ADCC Assays with Different Cell-Lines and Primary Multiple Myeloma Cells
1. Materials and Methods:
[0153] Isolation and ADCC of MM-patient samples: Bone marrow aspirates were obtained from multiple myeloma patients (after obtaining informed consent). Malignant cells were purified via a standard protocol using anti-CD138 magnetic beads (Milteny Biotec) after density gradient centrifugation (Sigma). An ADCC-assay was performed as described before.
2. Summary and Conclusions:
[0154] Several cell-lines derived from different malignancies were used in ADCC in order to show the cytotoxic effect of the HUCAL anti-CD38 antibodies on a broader spectrum of cell-lines including different origins and CD38 expression-levels. As shown in
Example 10
Cross-Reactivity Analysis by FACS and Immunohistochemistry (IHC)
1. Materials and Methods:
[0155] IHC with tonsils: For IHC HUCAL anti-CD38 Mabs and an irrelevant negative control antibody were converted into the bivalent dHLX-format (Plckthun & Pack, 1997). 5 m cryo sections from lymph nodes derived from Cynomolgus monkey, Rhesus monkey and humans (retrieved from the archives of the Institute of Pathology of the University of Graz/Austria) were cut with a Leica CM3050 cryostat. Sections were air-dried for 30 minutes to 1 hour and fixed in ice-cold methanol for 10 minutes and washed with PBS. For the detection of the dHLX-format a mouse anti-His antibody (Dianova) in combination with the Envision Kit (DAKO) was used. For the detection of the anti-CD38 mouse antibodies (e.g. reference mouse monoclonal OKT10) the Envison kit was used only.
[0156] FACS-analysis of lymphocytes: EDTA-treated blood samples were obtained from healthy humans (after obtaining informed consent), from Rhesus and Cynomolgus monkeys and subjected to density gradient centrifugation using the HISTOPAQUE (medium comprising polysucrose and sodium diatrizoate adjusted to density of 1.077 g/mL)cell separation system according to the instructions of the supplier (Sigma). For FACS-analysis cells from the interphase were incubated with primary antibodies (HUCAL anti-CD38 and negative control Mabs as murine IgG2a or Fab-format, the positive control murine antibody OKT10 and a matched isotype control) followed by incubation with anti-M2 Flag (Sigma; only for Fab-format) and a phycoerythrin (PE)-labeled anti-mouse conjugate (Jackson Research). FACS analysis was performed on the gated lymphocyte population.
2. Summary and Conclusions:
[0157] HUCAL anti-CD38 were analyzed for inter-species CD38 cross-reactivity. Whereas all anti-CD38 Mabs were able to detect human CD38 on lymphocytes in FACS and IHC, only MOR03080 together with the positive control OKT10 showed an additional reactivity with Cynomolgus and Rhesus monkey CD38 (see Table 5: Cross-reactivity analysis).
TABLE-US-00005 TABLE 5 Lymphocytes (PACS) and lymph-nodes (IHC) from: Cynomolgus Rhesus Antibody Human Monkey Monkey Mab#1 ++ Mab#2 ++ Mab#3 ++ ++ ++ PC ++ ++ ++ NC ++: strong positive staining; : no staining; NC: negative control; PC: positive control (=reference cMAb)
Example 11
[0158] Treatment of Human Myeloma Xenografts in Mice (using the RPMI8226 Cell Line) with MOR03080
1. Establishment of subcutaneous mouse model:
[0159] A subcutaneous mouse model for the human myeloma-derived tumor cell line RPMI8226 in female C.B-17-SCID mice was established as follows by Aurigon Life Science GmbH (Tutzing, Germany): on day 1, 0, and 1, anti-asialo GM1 polyclonal antibodies (ASGM) (WAKO-Chemicals), which deplete the xenoreactive NK-cells in the SCID mice were applied intravenously in order to deactivate any residual specific immune reactivity in C.B-17-SCID mice. On day 0, either 510.sup.6 or 110.sup.7 RPMI8226 tumor cells in 50 l PBS were inoculated subcutaneously into the right flank of mice either treated with ASGM (as described above) or untreated (each group consisting of five mice). Tumor development was similar in all 4 inoculated groups with no significant difference being found for treatment with or without anti-asialo GM1 antibodies or by inoculation of different cell numbers. Tumors appear to be slowly growing with the tendency of stagnation or oscillation in size for some days. Two tumors oscillated in size during the whole period of investigation, and one tumor even regarded and disappeared totally from a peak volume of 321 mm.sup.3. A treatment study with this tumor model should include a high number of tumor-inoculated animals per group.
2. Treatment with MOR03080:
2.1 Study Objective
[0160] This study was performed by Aurigon Life Science GmbH (Tutzing, Germany) to compare the anti-tumor efficacy of intraperitoneally applied antibodies (HUCAL anti-CD38) as compared to the vehicle treatment (PBS). The human antibody hMOR03080 (isotype IgG1) was tested in different amounts and treatment schedules. In addition the chimeric antibody chMOR03080 (isotype IgG2a: a chimeric antibody comprising the variable regions of MOR03080 and murine constant regions constructed in a similar way as described in Example 5 for chimeric OKT10 (murine VH/VL and human constant regions)) was tested. The RPMI8226 cancer cell line had been chosen as a model and was inoculated subcutaneously in female SCID mice as described above. The endpoints in the study were body weight (b.w.), tumor volume and clinical signs.
2.2 Antibodies and Vehicle
[0161] The antibodies were provided ready to use to Aurigon at concentrations of 2.13 mg/ml (MOR03080 hIgG1) and 1.73 mg/ml (MOR03080 chIgG2a, and stored at 80 C. until application. The antibodies were thawed and diluted with PBS to the respective end concentration. The vehicle (PBS) was provided ready to use to Aurigon and stored at 4 C. until application.
2.3 Animal Specification
[0162] Species: mouse [0163] Strain: Fox chase C.B-17-scid (C.B-Igh-1b/IcrTac) [0164] Number and sex: 75 females [0165] Supplier: Taconic M&B, Bomholtvej 10, DK-8680 Ry [0166] Health status: SPF [0167] Weight ordered: appr. 18 g [0168] Acclimatization: 9 days
2.4 Tumor Cell Line
[0169] The tumor cells (RPMI8226 cell line) were grown and transported to Aurigon Life Science GmbH, where the cells were splitted and grown for another cycle. Aurigon prepared the cells for injection on the day of inoculation. The culture medium used for cell propagation was RPMI 1640 supplemented with 5% FCS, 2 mM L-Glutamin and PenStrep. The cells showed no unexpected growth rate or behaviour.
[0170] For inoculation, tumor cells were suspended in PBS and adjusted to a final concentration of 110.sup.7 cells/50 l in PBS. The tumor cell suspension was mixed thoroughly before being injected.
2.5 Experimental Procedure
[0171] On day 0, 110.sup.7 RPMI8226 tumor cells were inoculated subcutaneously into the right dorsal flank of 75 SCID mice. A first group was built with 15 randomly chosen animals (group 5) directly after inoculation. This group was treated with 1 mg/kg b.w. hIgGl-MOR03080 every second day between day 14 and 36. From all other 60 animals 4 groups were built with ten animals in each group on day 31 (tumor volume of about 92 mm.sup.3). Groups 1-4 were built with comparable means tumor sizes and standard deviations. An additional group of 5 animals (group 6) was chosen showing relatively small tumor volumes (tumor volume of about 50 mm.sup.3) for comparison with pre-treated group 5 (all but three mice showing tumor volumes of less than 10 mm.sup.3, one with about 22 mm.sup.3, one with about 44 mm.sup.3 and one with about 119 mm.sup.3). Groups 1 to 4 were treated every second day from day 32 to day 68 with either PBS (Vehicle; group 1), 1 mg/kg b.w. hIgG1-MOR03080 (group 2) or 5 mg/kg b.w.hIgGl-MOR03080 (group 3), or with 5 mg/kg b.w. chIgG2a-MOR03080 (group 4). Group 6 did not receive any treatment (see Table 6). Tumor volumes, body weight and clinical signs were measured two times a week until end of study.
TABLE-US-00006 TABLE 6 Type of Treatment Appl. No. of appli- dose volume Group animals cation Substance Schedule [mg/kg] [l/kg] 1 10 i.p. vehicle every second 10 (PBS) day between day 32 and day 68 2 10 i.p. MOR03080 every second 1 10 human day between IgG1 day 32 and day 68 3 10 i.p. MOR03080 every second 5 10 huma day between IgG1 day 32 and day 68 4 10 i.p. MOR03080 every second 5 10 chimeric day between IgG2a day 32 and day 68 5 15 i.p. MOR03080 every second 1 10 human day between IgG1 day 14 and day 36 6 5
2.6 Results
[0172] Clinical Observations and Mortality
[0173] No specific tumor or substance related clinical findings or mortality were observed. In group 3 (hIgG1 5 mg/kg) four animals died during blood sampling (one on day 3, one on day 34; two on day 52). In group 4 (muIgG2a 1 mg/kg) a single animal died during blood sampling (day 34). All other animals, that died during the study have been euthanized because of the tumor size.
Body Weight Development
[0174] No drug related interference with weight development was observed in comparison to group 1 (vehicle). Body weight was markedly influenced by blood sampling in groups 3 (hIgG1 5 mg/kg) and 4 (muIgG2a 5 mg/kg). Despite such interruptions the mean weight gain of all groups was continuous.
Tumor development (see
[0175] In group 1 (vehicle) tumor growth was found in the expected rate with a slow progression. As this cell line has a pronounced standard deviation values for the largest and smallest tumor have been excluded from further statistical analysis. The tumor growth of animals in group 1 was comparable to the tumor growth in group 6 (untreated), although this group started with a lower mean tumor volume on day 31. Treatment might therefore have a slight influence on the tumor growth rate. In group 1, two mice had to be euthanized before day 83 because of the tumor size, and a further one before day 87, so that the mean value of tumor volume is no longer representative after day 80. In group 6, one mouse had to be euthanized before day 80 because of the tumor size, two mice before day 83, and a further one before day 87, so that the mean value of tumor volume is no longer representative after day 76.
[0176] In group 2, treated with 1 mg/kg b.w. of hIgG1, one animal has been excluded from further analysis, because the tumor grew into the muscular tissue and this usually enhances the speed of tumor growth. Compared with the control group 1 (vehicle) the mean tumor size started to differ significantly starting with day 45 until the end of the study. No enhanced tumor growth was observed after end of treatment (day 68).
[0177] Animals of group 3 (5 mg/kg b.w. hIgG1) revealed a marked decrease in tumor growth in comparison to group 1 (vehicle), getting statistically significant with day 38 until day 83. The mean tumor volume started to strongly regrow about two weeks after the end of treatment. One out of ten tumors disappeared at day 45 and did not regrow up to 19 days after end of treatment.
[0178] The best performance of all treatment groups starting with 92 mm.sup.3 tumor volume was found in group 4 (5 mg/kg b.w. muIgG2a), where the mean tumor volume showed clear regression and tumors even disappeared in 4 animals until the end of the observation period. The difference to the mean tumor volume of group 1 (vehicle) was highly significant beginning from day 38 until the end of study.
[0179] The early treatment with 1 mg/kg b.w. hIgG1 between days 14 and 36 (group 5) revealed an early as well as long lasting effect on tumor development. One animal has been excluded from further analysis as the tumor grew into muscular tissue. On day 31, only five animals had a measurable tumor at the site of inoculation, in comparison to the rest of the inoculated animals, where only 2 out of 60 did not respond to tumor inoculation. The tumor progression was delayed of about 31 days (comparison of day 52 of control group 1 with day 83 of group 5). About 50% of the animals did not show tumors at the site of inoculation at the end of the study.
2.7 Conclusion
[0180] No specific tumor or substance related clinical findings or mortality were observed in comparison with group 1 (control).
[0181] No drug related interference with weight development was observed.
[0182] Tumor growth of RPMI8226 tumor cells after treatment was reduced in the order of efficiency: hIgG1 1 mg/kg, 14-36 days every second day (group 5)>muIgG2a 5 mg/kg 32-68 days every second day (group 4)>hIgG1 5 mg/kg 32-68 days every second day (group 3)>hIgG1 1mg/kg 32-68 days every second day (group 2). In groups 2 to 4, mean tumor volumes were again increased after end of treatment to varying extents.
REFERENCES
[0183] Ausiello C. M., Urbani F., Lande R., la Sala A., Di Carlo B., Baj G., Surico N., Hilgers J., Deaglio S., Funaro A., Malavasi F. (2000) Functional topography of discrete domains of human CD38. Tissue Antigens. 2000 Dec;56(6):539-47. [0184] Chamow, S. M., Zhang, D. Z., Tan, X. Y, Mathre, S. M., Marsters, S. A., Peers, D. H., Byrn, R. A., Ashknazi, A., Junghans, R. P (1994). humanized, bispecific immunoadhesin-antibody that retargets CD3+effectors to kill HIV-1-infected cells. J Immunol. 1994 Nov 1;153(9):4268-80 [0185] Dattamajumdar, A. K., Jacobsen, D. P., Hood, L. E., Osman, G. E. (1996). Rapid cloning of rearranged mouse immunoglobulin variable genes. Immunogentetics 43, 141-151
[0186] Funaro, A., Spagnoli, G. C., Ausiello, C. M., Alessio, M., Roggero, S., Delia, D., Zaccolo, M., and Malavasi, F. (1990) Involvement of the multilineage CD38 molecule in a unique pathway of cell activation and proliferation. J. Immunol. 145, 2390-2396. [0187] Hoshino S., Kukimoto I., Kontani K., Inoue S., Kanda Y., Malavasi F., Katada T. (1997) Mapping of the catalytic and epitopic sites of human CD38/NAD+ glycohydrolase to a functional domain in the carboxyl terminus. J Immunol. 158(2):741-7. [0188] Jackson D. G., Bell J. I. (1990) Isolation of a cDNA encoding the human CD38 (T10) molecule, a cell surface glycoprotein with an unusual discontinuous pattern of expression during lymphocyte differentiation. J Immunol. 144(7):2811-5. [0189] Knappik, A., Ge, L., Honegger, A., Pack, P., Fischer, M., Wellnhofer, G., Hoess, A., Wolle, J., Pluckthun, A., and Virnekas, B. (2000). Fully synthetic human combinatorial antibody libraries (HuCAL) based on modular consensus frameworks and CDRs randomized with trinucleotides. J Mol Biol 296, 57-86. [0190] Konopleva M., Estrov Z., Zhao S., Andreeff M., Mehta K. (1998) Ligation of cell surface CD38 protein with agonistic monoclonal antibody induces a cell growth signal in myeloid leukemia cells. J Immunol. 161(9):4702-8. [0191] Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bossard, H. R., Plckthun, A. (1997). Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J. Imm. Meth. 201, 35-55. [0192] Krebs, B., Rauchenberger, R., Reiffert, S., Rothe, C., Tesar, M., Thomassen, E., Cao, M., Dreier, T., Fischer, D., Hoss, A., Inge, L., Knappik, A., Marget, M., Pack, P., Meng, X. Q., Schier, R., Sohlemann, P., Winter, J., Wolle, J., and Kretzschmar, T. (2001). High-throughput generation and engineering of recombinant human antibodies. J Immunol Methods 254, 67-84. [0193] Lohning, C. (2001). Novel methods for displaying (poly)peptides/proteins on bacteriophage particles via disulfide bonds. WO 01/05950. [0194] Malavasi, F., Caligaris-Cappio, F., Milanese, C., Dellabona, P., Richiardi, P., Carbonara, A. O. (1984). Characterization of a murine monoclonal antibody specific for human early lymphohemopoietic cells. Hum. Immunol. 9: 9-20 [0195] Namba, M., Otsuki, T., Mori, M., Togawa, A., Wada, H., Sugihara, T., Yawata, Y., Kimoto, T. (1989). Establishment of five human myeloma cell lines. In Vitro Cell Dev. Biol. 25:723. [0196] Nata K., Takamura T., Karasawa T., Kumagai T., Hashioka W., Tohgo A., Yonekura H., Takasawa S., Nakamura S., Okamoto H. (1997). Human gene encoding CD38 (ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase): organization, nucleotide sequence and alternative splicing. Gene 186(2):285-92. [0197] Naundorf, S., Preithner, S., Mayer, P., Lippold, S., Wolf, A., Hanakam, F., Fichtner, I., Kufer, P., Raum, T., Riethmller, G., Baeuerle, P. A., Dreier, T. (2002). Int. J. Cancer 100, 101-110. [0198] Plckthun A, and Pack P. (1997) New protein engineering approaches to multivalent and bispecific antibody fragments. Immunotechnology 3(2):83-105. [0199] Rauchenberger R., Borges E., Thomassen-Wolf E., Rom E., Adar R., Yaniv Y., Malka M., Chumakov I., Kotzer S., Resnitzky D., Knappik A., Reiffert S., Prassler J., Jury K., Waldherr D., Bauer S., Kretzschmar T., Yayon A., Rothe C. (2003). Human combinatorial Fab library yielding specific and functional antibodies against the human fibroblast growth factor receptor 3. J Biol Chem. 278(40):38194-205.
[0200] Zhou, H., Fisher, R. J., Papas, T. S. (1994). Optimization of primer sequences for mouse scFv repertoire display library construction. Nucleic Acids Res. 22: 888-889.