ACTIVATORS OF UC.291 FOR USE FOR IMPROVING SKIN BARRIER FUNCTION AND/OR FOR PREVENTING AND/OR ATTENUATING SKIN AGEING AND/OR FOR HYDRATING SKIN

Abstract

Disclosed is a method for identification and use of compounds which activate the expression or activity of uc.291 for improving skin barrier function, and/or for preventing and/or attenuating ageing, and/or for hydrating skin. The disclosed in vitro method for screening for candidate compounds for improving skin barrier function, and/or for preventing and/or attenuating ageing of the skin, and/or for hydrating the skin, includes: a. bringing at least one test compound in contact with a sample of keratinocytes; b. measuring the expression or the activity of uc.291 in the keratinocytes; and c. selecting the compounds for which an activation of at least 20%, preferably at least 30%, preferably at least 40% of the expression or an activation of at least 20%, preferably at least 30%, preferably at least 40% of the activity of uc.291 is measured in the keratinocytes treated in a. compared with the untreated keratinocytes.

Claims

1-7. (canceled)

8. In vitro method for screening for candidate compounds for improving skin barrier function, and/or for preventing and/or attenuating ageing of the skin, and/or for hydrating the skin, comprising the following steps: a. bringing at least one test compound in contact with a sample of keratinocytes; b. measuring the expression or the activity of uc.291 in said keratinocytes; c. selecting the compounds for which an activation of at least 20% of the expression or an activation of at least 20% of the activity of uc.291 is measured in the keratinocytes treated in a. compared with untreated keratinocytes.

9. Method according to claim 8, wherein step b. is performed before and after step a.

10. Method according to claim 8, further comprising the following steps: a. preparing at least two samples of keratinocytes; a. bringing one of the samples into contact with at least one test compound; then b. measuring the expression or the activity of uc.291 in said samples; and c. selecting the compounds for which an activation of at least 20% of the expression or an activation of at least 20% of the activity of uc.291 is measured in the keratinocytes treated in a. compared with the sample of untreated keratinocytes.

11. Method according to claim 8, wherein the test compounds are chosen from botanical extracts.

12. Method according to claim 8, wherein the activation of expression or activity of uc.291 measured in step c. is of at least 50%.

Description

[0071] The following examples illustrate the invention without limiting the scope thereof. These examples are based on the figures listed below:

[0072] FIG. 1: uc.291 is expressed in keratinocytes during calcium-induced differentiation

Primary human keratinocytes were induced to differentiate by calcium addition (1.2 mM), for 3, 6 or 9 days.
A) Evaluation of uc.291 during differentiation by RT-PCR, as positive controls (B) are used involucrin and K10 (differentiation markers).

[0073] FIG. 2: Depletion of uc.291 delays differention

Depletion of uc.291 and evaluation by RT-PCR of the expression of differentiation markers K10 and involucrin mRNAs. Both markers are strongly reduced in uc.291 depleted cells in comparison to control.

[0074] FIG. 3: Depletion of uc.291 increases proliferation

(A) Evaluation by RT-PCR of the silencing at 3 days post-transfection.
(B) Cell cycle analysis of scramble transfected (Ctrl) and si-uc.291 transfected cells at 3 days post-transfection.
(C) Evaluation by Western blot of proliferation marker (p63) and differentiation marker (K10) during calcium induced differentiation (1, 2, 3 days) upon uc.291 depletion.

[0075] FIG. 4: uc.291 is expressed in the nucleus and functions as enhancer

A) Biochemical fractionation of nucleus and cytosol of keratinocytes. Uc.291 is mainly detected in the nucleus.
B) The conserved sequence of uc.291 was cloned in a vector for luciferase-assay, upstream of the promoter, and the inventors transfected this vector (uc.291) and the control vector (Ctr) in Saos-2 cells. Luciferase assay suggests that uc.291 acts as enhancer, since the luciferase activity increases two fold over control.

[0076] FIG. 5: SFTP, ZMIZ1 and ZSWIM8 genes are localized in proximity of uc.291 and their expression is induced during differentiation

(A) Scheme of Chromosome 10 where uc.291 is located and the genes located within 4 millions of bases.
(B) RT-PCRs showing that SFTPD, ZMIZ1 and ZSWIM8 genes expression parallel with uc.291 expression during differentiation induced by calcium.

[0077] FIG. 6: uc.291 expression enhances SFTPD expression. Silencing of SFTPD recapitulate si-uc.291 effect

(A) Keratinocytes were transfected with siRNA specific for uc.291 (si-uc.291) and treated with 1.2 mM calcium. Cells were analyzed at the indicated time points.
(B) At 3 days the inventors evaluated the expression level of SFTPD, ZSWIM8 and ZMIZ1 by RT-PCR. The inventors found a 40% reduction in SFTPD, ZSWIM8 and ZMIZ1 mRNAs in absence of uc.291.

[0078] FIG. 7: Silencing of SFTPD, ZMIZ1 and ZSWIM8 recapitulate si-uc.291 effect

Keratinocytes were transfected with siRNA specific for uc.291 (si-uc.291) and treated with 1.2 mM calcium for 3 days. The inventors evaluated the expression level of the differentiation marker involucrin. The inventors found a 40% reduction in involucrin expression mRNA upon si-SFTPD, si-ZSWIM8 and si-ZMIZ1, similarly to si-uc.291.

[0079] FIG. 8: uc.291 sequence

Human uc.291 sequence 5 to 3 direction (database UCNE: http://ccg.vital-it.ch/UCNEbase/) with code name ZNF503_Siddhartha.

[0080] FIG. 9: Experimental set-up for compounds

[0081] FIG. 10: Different compound can modulate uc.291 expression

uc.291 expression was evaluated by real-time PCR upon treatments with compounds. The inventors can see that all the compounds have synergic effects with calcium in enhancing uc.291 expression.

EXAMPLE 1

[0082] Material and Methods

Cell Culture and Transfection

[0083] Human epidermal keratinocytes, neonatal (HEKn) (Cascade, Invitrogen) were grown in Epilife medium with HKGS growth supplements (Invitrogen) and cultured at 37 C. in a humidified chamber with 5% CO.sub.2. Cells were induced to differentiate in vitro by adding 1.2 mM CaCl.sub.2 to the culture medium, then cells were grown in full confluence for up to 9 days. For uc.291 silencing, HEKn were transfected with si-291-1 HP Custom siRNA (Qiagen) and the transfection was performed using Lipofectamine RNAimax transfection reagent (Invitrogen) according to manufacturer's protocols. 48 hours after transfection, the medium was removed and calcium-induced differentiation was started by adding 1.2 mM CaCl.sub.2 to the culture medium. Saos-2 cells were cultured in D-MEM F12 with 10% FBS, 100 penicillin, 100 g/mL streptomycin (GIBCO, Invitrogen) and transfected with Lipofectamine 2000 according to manufacturer's protocols (Invitrogen).

Cell Culture and Compounds

[0084] We have used the following compounds:

N1: Camellia leaf extract: final concentration 0.05%
N2: Stem cells of Camellia: final concentration 1%

[0085] Camellia leaf extract is prepared as follows: the extract of Camellia leaf is obtained by extraction of fresh and ground leaves of Camellia japonica with ethanol (or any alcoholic solvent), discoloration with activated charcoal, filtration and dilution with dipropylene glycol (or other appropriate cosmetic solvent) so as to obtain a final extract on a liquid form.

[0086] Stem cells of Camellia are stem cells obtained from meristems of Camellia japonica alba plena with the technology as disclosed in WO2003/077881.

[0087] The compounds were tested in proliferating and differentiation conditions. Cells (HEKn, 300.000/60 mm dish) were plated in proliferating conditions medium and treated for 24 hours with the compounds at the indicated concentrations. Cells were collected after 1 day and analyzed for uc.291 expression by real-time PCR, as indicated below. Alternatively, differentiating medium (containing 1.2 mM calcium) was added to cells including the indicated compounds, and collected after 3 days to evaluate uc.291 expression level.

RNA Extraction and Real-Time PCR Analysis

[0088] Total RNA was isolated from differentiated (days 3, 6 and 9) and proliferating Human Keratinocytes using the mirVana miRNA Isolation Kit (Ambion) following the manufacturer's protocol. One microgram of total RNA was reverse transcribed with GoScript Reverse Transcription System (Promega) according to manufacturer's protocols. Real Time PCR was then performed by using the Platinum SYBR Green qPCR Master Mix (Promega). The expression of each gene and uc.291 was defined from the threshold cycle (Ct) and relative expression levels were calculated by using the 2.sup.Ct method after normalization with reference to expression of housekeeping genes. Uc.291 conserved sequence is shown in FIG. 8.

Cell Proliferation and Cell Cycle Analysis

[0089] Incorporation of bromodeoxyuridine (BrdU) during DNA synthesis was evaluated with the Click-iT EdU flow cytometry assay kit, following the manufacturer's protocol (Molecular Probes, Eugene, Oreg., USA). Cell cycle was analysed using a FACS Calibur flow cytometer (BD Biosciences, San Jose, Calif., USA). Fifteen thousand events were evaluated using the Cell Quest (BD) software.

Western Blotting

[0090] Total cell extracts were resolved on a SDS polyacrylamide gel, blotted on a Hybond P PVDF membrane (G&E Healthcare, UK). Membranes were blocked with PBST 5% non-fat dry milk, incubated with primary antibodies for 2 h at room temperature, washed and hybridized for 1 h at room temperature using the appropriate horseradish peroxidase-conjugated secondary antibody (rabbit and mouse, BioRad, Hercules, Calif., USA). Detection was performed with the ECL chemiluminescence kit (Perkin Elmer, Waltham, Mass., USA). The following antibodies were used: anti-p63 (Ab4, Neomarkers, Fremont, Calif., USA; dilution 1:500), anti-K10 (Covance, Princeton, Nj, USA; dilution 1:1000), anti- actin (Sigma, St Louis, Minn., USA; dilution 1:5000).

Cell Fractionation and RNA Extraction

[0091] Cells were harvested by trypsinization and collected in 15-ml conical tubes on ice, washed three times with cold PBS, transferred to microfuge tubes, and pelleted at 4000 rpm for 3 min in a refrigerated centrifuge (Eppendorf 5415R). Cell pellets were resuspended in 1 ml of RSB (10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl2), incubated for 3 min on ice, followed by centrifugation at 4 C. The volume of the swelled cell pellet was estimated and resuspended by slow pipetting with four times its volume of lysis buffer RSBG40 [10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 10% glycerol, 0.5% Nonidet P-40, 0.5 mM dithiothreitol (DTT), and 100 U/ml rRNasin (Promega, WI)]. Nuclei were pelletted by centrifugation at 7000 rpm for 3 min, and the supernatant was recovered and saved as the cytoplasmic fraction. Nuclear pellets were resuspended in RSBG40, and one-tenth volume of detergent [3.3% (wt/wt) sodium deoxycholate and 6.6% (vol/vol) Tween 40] was added with slow vortexing, followed by incubation on ice for 5 min. Nuclei were again pelletted and the supernatant was pooled with the previous cytoplasmic fraction. Nuclear pellets were washed once more in RSBG40, collected at 10,000 rpm for 5 min, and the resulting pellet used for nuclear RNA extraction. Cell lysis and nuclear integrity was monitored by light microscopy following trypan blue staining. RNA was extracted using the TRIZOL method, according to the manufacturer's instructions (Invitrogen, CA).

Constructs and Luc Assay

[0092] Uc.291 genomic sequence (231 bp) was amplified by PCR from human genomic DNA using the following primers: uc.291pGLF 5-ggccgctagcgggaacttatttgtatgcagc-3 (SEQ ID NO:2); uc.291pGLR 5-ggccctcgagcaactgcagtgcctgcatgttttc-3 (SEQ ID NO:3). The 231-bp fragment, after NheI/XhoI restriction, was ligated to NheI/XhoI-linearized pGL3-promoter vector (Promega, Madison, Wis., USA). A total of 110.sup.5 Saos-2 cells were seeded in 12-well dishes 24 h before transfection. 600 ng of pGL3 vectors, 13 pmoles of uc.291 siRNA and 10 ng of Renilla luciferase pRL-CMV vector were cotransfected using Lipofectamine 2000 (Invitrogen). Luciferase activity of cellular extracts were measured 24 h after transfection by using a Dual Luciferase Reporter Assay System (Promega); light emission was measured using an OPTOCOMP I luminometer. Efficiency of transfection was normalized using Renilla luciferase activity.

In Situ-Hybridization

[0093] The sequence of the uc.291 probe is as follows:

/5DigN/ACAACCACATGGGCTATCAAGA/3Dig (SEQ ID NO:4); the U6 probe is from Exiqon, the Cat # is 99002-15. The formalin-fixed paraffin embedded tissue sections were de-waxed in xylenes, and rehydrated through an ethanol dilution series. Tissue sections were digested with 15 g/mL proteinase K for 10 minutes at RT, were then loaded onto Ventana Discovery Ultra for in situ hybridization analysis. The tissue slides were incubated with Dig labeled mercury probe (Exiqon) for 2 hrs at 50 C. The digoxigenins can then be detected with a polyclonal anti-DIG antibody and Alkaline Phosphatase conjugated second antibody (Ventana) using NBT-BCIP as the substrate. The double-dig labelled control U6 snRNA probe is also from Exiqon.

[0094] Results

Uc.291 is Expressed in Keratinocytes During Calcium-Induced Differentiation

[0095] Primary human keratinocytes were induced to differentiate by calcium addition, for 3, 6 or 9 days. uc.291 expression was evaluated by real time RT-PCR. uc-291 expression is time dependent; the inventors used as positive controls the two differentiation markers involucrin and K10 (FIGS. 1A and 1B). In situ-hybridization (data not shown) confirmed that uc.291 is specifically expressed in the epidermis.

Depletion of Uc.291 Delays Differentiation

[0096] To confirm that uc.291 is important during keratinocyte differentiation, the inventors silenced uc.291 by siRNA in primary human keratinocytes and differentiation was induced by calcium addition. Evaluation of cell morphology in scramble transfected cells (Ctrl) and si-uc.291 transfected cells upon 1, 2, 3 days calcium addition indicate that si-uc.291 cells maintain longer the round shape, typical of proliferating cells, while Ctrl (scramble transfected cells) appear flat and elongated already after 1 day Calcium treatment (FIG. 2). To better quantify this, the inventors have evaluated the expression of differentiation markers (K10 and involucrin) during differentiation in scramble transfected cells (Ctrl) and si-uc.291 transfected cells. The data obtained indicate that differentiation is strongly delayed by the absence of uc.291.

Depletion of Uc.291 Increases Proliferation

[0097] To evaluate the effect of uc.291 during proliferation, the inventors silenced uc.291 by siRNA in primary human keratinocytes. Silencing affects both long terminal proliferation, evaluated by clonogenic assay (FIG. 3) and short term differentiation, evaluated by FACS analysis after 3 days calcium (1.2 mM) treatment. These results were also confirmed at protein level, evaluating by Western blot the proliferation marker (p63) and differentiation marker (K10) during calcium induced differentiation (1, 2, 3 days) upon uc.291 depletion (FIG. 3C).

Uc.291 is Expressed in the Nucleus and Functions as Transcriptional Enhancer

[0098] In order to explore the molecular mechanism through which uc.291 affect proliferation and differentiation in keratinocytes, the inventors performed biochemical fractionation of keratinocyte cellular extract in order to separate nucleus from cytosol. Uc.291 is mainly detected in the nucleus, as shown in FIG. 4A. Furthermore, to understand if it works as transcriptional enhancer, the inventors cloned the conserved sequence of uc.291 in a vector for luciferase-assay, upstream of the promoter, and transfected this vector (uc.291) and the control vector (Ctr) in Saos-2 cells that express endogenous uc.291. The inventors can observe that luciferase emission increases two folds over control (FIG. 4B), indicating that uc.291 acts as transcriptional enhancer.

SFTPD, ZMIZ1, ZSWIM8 Genes are Located in Proximity of Uc.291 Locus and their Expression Parallels Uc.291 Expression

[0099] In order to identify a possible mechanism responsible for uc.291 effects in controlling proliferation and differentiation of keratinocytes, the inventors investigate the role of the gene located in proximity of uc.291 whose expression parallels uc.291 expression during differentiation. Among these genes the inventors found that SFTPD, ZMIZ1a and ZSWIM8 genes are highly expressed during keratinocytes differentiation (FIGS. 5A and 5B) and their mRNA increases similarly to uc.291 after calcium addition.

Uc.291 Expression Enhances SFTPD, ZMIZ1, ZSWIM8 Expression and Silencing of SFTPD, ZMIZ1, ZSWIM8 Recapitulate Si-Uc.291 Effects in Keratinocytes

[0100] To demonstrate that uc.291 expression acts as transcriptional enhancer for SFTPD, ZMIZ1 and ZSWIM8 the inventors silenced uc.291 and added calcium for three days. The inventors found a 50% reduction of SFTPD, ZMIZ1 and ZSWIM8 expression upon si-uc.291 (FIGS. 6A and 6B). Interestingly, si-SFTPD, si-ZMIZ1 and si-ZSWIM8 phenocopy uc.291 silencing in terms of cell morphology (not shown) and Involucrin expression. Indeed, si-uc.291 and si-SFTPD cells treated for three days with calcium have a similar morphology (round shape, not shown) as compared to three days calcium, in which the cells appear undergoing to differentiation. Also involucrin expression is delayed upon si-SFTPD, si-ZMIZ1 and si-ZSWIM8 (FIG. 7).

Different Compounds can Modulate Uc.291 Expression

[0101] The inventors have evaluated the effects of compounds (N1, 0.05%; N2, 1%) in regulating uc.291 expression level (FIGS. 9 and 10). The inventors observed that the compounds tested have synergic effects with calcium in enhancing uc.291 expression.

SUMMARY

[0102] The data presented indicate that: [0103] uc.291 is induced during calcium-driven keratinocyte differentiation. It is a pro-differentiation lnc-RNA. [0104] uc.291 is expressed in the upper layers of human epidermis. [0105] uc.291 knock-down, by siRNA, decreases keratinocytes differentiation (with differentiation markers: K10 and involucrin). [0106] uc.291 knock-down increases proliferation (short and long-term proliferation). [0107] uc.291 is mainly expressed in the nucleus of the keratinocytes. [0108] uc.291 is a transcriptional regulator with cis-enhancer activity for SFTPD, ZMIZ1 and ZSWIM8 genes. While the roles of ZMIZ1 and ZSWIM8 are not known in the epidermis so far, Surfactant protein D, encoded by SFTPD gene, is expressed in the epidermis where it shows potent immuno-modulatory and anti-inflammatory properties.

Conclusion

[0109] These data suggest that uc.291 has dual functions in skin barrier function formation: it allows proper differentiation and keratinization and maintains skin homeostasis by preventing pathogen infection and having anti-inflammatory properties.

EXAMPLE 2: Cosmetic Compositions

[0110] The following compositions can be prepared in a manner conventional to those skilled in the art. The amounts indicated below are expressed as percentages by weight.

TABLE-US-00002 O/W emulsion INCI/TRADE NAME SUPPLIER (% W/W) Jojoba esters 1-10 Meadowfoam seed oil 1-10 Butyrospermum Parkii Butter (LIPEX SHEA) 1-10 Butyrospermum parkii butter (LIPEX SHEASOFT) 1-10 Shea Butter Ethyl Esters (LIPEX SHEALIGHT) 1-10 Butyrospernum parkii butter extract (LIPEX SHEA TRIS) 1-10 Pentaerythrityl stearate/caprate/caprylate/adipate 0.5-5 (SUPERMOL S-SO) Diisostearyl dimer dilinoleate (SCHERCEMOL DISD) 1-10 Octyldodecyl myristate 1-5 Phytosqualan 0.1-7 Phytosteryl/octyldodecyl lauroyl glutamate 0.01-5 (ELDEW PS-203) Xanthan gum 1-10 Cetearyl alcohol & coco-glucoside 1-5 Hydroxyethyl acrylate/sodium acryloyldimethyltaurate 1-5 copolymer & squalane & polysorbate 60 Dimethicone & dimethicone crosspolymer 1-5 Dimethicone & dimethicone/vinyl dimethicone 0.1-10 crosspolymer (KSG-016F) Polymethylmethacrylate 0.1-10 Sodium hyaluronate 0.01-3 Glycerin 1-30 Polyquaternium-51 1-10 Adenosine 0.1-0.5 Niacinamide 0.1-5 Tremella fuciformis polysaccharide 0.1-5 Palmitoyl Tripeptide-1 & Palmitoyl Tetrapeptide-7 1-5 Secale Cereale (Rye) Seed Extract 1-5 Camellia leaf extract as obtained in example 1 0.001-5 Stem cells of Camellia as obtained in example 1 0.001-5 Vitamin C and derivatives 0.001-5 Glycols (Caprylyl Glycol and/or Pentylene Glycol and/or 0.1-10 Butylene Glycol and/or propanediol) Water Qs 100

TABLE-US-00003 Transparent aqueous serum INCI/TRADE NAME SUPPLIER (% W/W) Camellia kissi seed oil 0.01-5 PEG-40 hydrogenated castor oil 0.01-5 PPG-6 decyltetradeceth-30 0.01-5 CARBOMER 0.01-5 Xanthan gum 1-10 Agar & xantham gum 0.1-10 Hydrogenated starch hydrolysate & maltooligosyl 0.1-10 glucoside (MG-60) Glycerin 1-30 Polyquaternium-51 1-10 Adenosine 0.1-0.5 Niacinamide 0.1-5 Tremella fuciformis polysaccharide 0.1-5 Palmitoyl Tripeptide-1 & Palmitoyl Tetrapeptide-7 1-5 Secale Cereale (Rye) Seed Extract 1-5 Camellia leaf extract as obtained in example 1 0.001-5 Stem cells of camellia as obtained in example 1 0.001-5 Vitamin C and derivatives 0.001-5 Glycols (Caprylyl Glycol and/or Pentylene Glycol 0.1-10 and/or Butylene Glycol and/or propanediol) Water Qs 100

TABLE-US-00004 O/W emulsion cream INCI/TRADE NAME SUPPLIER (% W/W) Jojoba esters 1-10 C13-16 ISOPARAFFIN 1-10 Acacia decurrens/jojoba/sunflower seed 1-10 wax/polyglyceryl-3 esters (ACTICIRE) Butyrospermum parkii butter (LIPEX SHEASOFT) 1-10 Shea Butter Ethyl Esters (LIPEX SHEALIGHT) 1-10 Butyrospernum parkii butter extract (LIPEX SHEA TRIS) 1-10 Pentaerythrityl stearate/caprate/caprylate/adipate 0.5-5 (SUPERMOL S-SO) Diisostearyl dimer dilinoleate (SCHERCEMOL DISD) 1-10 Octyldodecyl myristate 1-5 Cetyl alcohol & glyceryl stearate & peg-75 stearate & 0.1-7 ceteth-20 & steareth-20 CARBOMER 0.01-5 Xanthan gum 1-10 Dimethicone & dimethicone/vinyl dimethicone 0.1-10 crosspolymer (KSG-016F) Silica (SATINIER M5) 0.1-10 Sodium hyaluronate 0.01-3 Glycerin 1-30 Polyquaternium-51 1-10 Adenosine 0.1-0.5 Niacinamide 0.1-5 Tremella fuciformis polysaccharide 0.1-5 Palmitoyl Tripeptide-1 & Palmitoyl Tetrapeptide-7 1-5 Secale Cereale (Rye) Seed Extract 1-5 Camellia leaf extract as obtained in example 1 0.001-5 Stem cells of camellia as obtained in example 1 0.001-5 Vitamin C and derivatives 0.001-5 Glycols (Caprylyl Glycol and/or Pentylene Glycol and/or 0.1-10 Butylene Glycol and/or propanediol) Water Qs 100