NEW POLYPEPTIDE HAVING FERREDOXIN-NADP+ REDUCTASE ACTIVITY, POLYNUCLEOTIDE ENCODING THE SAME AND USES THEREOF

Abstract

The present invention relates to a novel polypeptide having the enzymatic activity of reduction of NADP+ using electrons from reduced ferredoxin (Ferredoxin-NADP+ reductase activity), a polynucleotide having a nucleotide sequence encoding such polypeptide and uses thereof. The invention relates to the modulation of the Ferredoxin NADP+ reductase activity in a microorganism by varying the expression level of the polynucleotide coding for such polypeptide. The invention also relates to the production of commodity chemicals, especially ethanol, n-butanol, 1,3-propanediol, 1,2-propanediol, isopropanol and acetone by fermenting microorganisms wherein their Ferredoxin NADP+ reductase activity is modulated.

Claims

1. A modified microorganism having Ferredoxin NADP+ reductase enzymatic activity, wherein the activity of the polypeptide having at least 70% identity with the sequence of SEQ ID No 1 is enhanced in comparison with the non-modified microorganism.

2. The microorganism according to claim 1 with enhanced Ferredoxin NADP+ reductase enzymatic activity, wherein a polynucleotide coding for the polypeptide having at least 70% identity with the sequence of SEQ ID No 1 is overexpressed.

3. The microorganism according to claim 2 wherein it contains at least one modification to produce ethanol.

4. The microorganism of claim 3, wherein the at least one modification to produce ethanol comprises: Enhancement of the expression of at least one of the following genes: pfor, fdx, udhA and/or Attenuation of the expression of at least one of the following genes: aceE, aceF, lpd, pflA, pf/B,frdABCD, ldhA, mgsA, ackA, pta poxB and iscR.

5. The microorganism according to claim 2 wherein it contains at least one modification to produce n-butanol.

6. The microorganism according to claim 5, wherein the at least one modification to produce n-butanol comprises: Enhancement of the expression of at least one of the following genes: pfor, fdx, atoB, hbd, crt, bcd, etfA, etfB, adhE2, udhA, and/or Attenuation of the expression of at least one of the following genes: aceE, aceF, lpd, pflA, pflB, frdABCD, adhE, ldhA, mgsA, ackA, pta, poxB and iscR.

7. The microorganism according to claim 2 wherein it comprises at least one modification to produce 1, 3 propanediol.

8. The microorganism of claim 7, wherein the at least one modification to produce 1, 3 propanediol comprises: Enhancement of the expression of at least one of the following genes : pfor, fdx, pntAB, dhaB1, dhaB2, yqhD and/or Attenuation of the expression of at least one of the following genes: aceE, aceF, lpd, aldA, aldB, ldhA, pflA, pflB, adhE, iscR, glpA, poxB and glpD.

9. The microorganism according to claim 2 wherein it comprises at least one modification to produce 1, 2 propanediol.

10. The microorganism according to claim 9, wherein the at least one modification to produce 1, 2 propanediol comprises: Attenuation of the expression of at least one of the following genes : ptsG, ptsH ptsl, crr, edd, eda, gloA, aceE, aceF, lpd, aldA, aldB, ldhA, pflA, pflB, adhE, tpiA, gapA, pykA, pykF, ackA, pta, poxB, arcA and ndh, p1 And/or Enhancement of the expression of at least one of the following genes : pfor, fd, pntAB gapN, galP, glk, ppsA, mgsA, yqhD, yafB, ydhF, ycdW, yqhE, yeaE, yghZ, yajO, tas, ydjG, ydbC, gldA, fucO.

11. A method for modulating the Ferredoxin NADP+ reductase enzymatic activity in a microorganism, wherein the activity of the polypeptide having at least 70% identity with the sequence of SEQ ID No 1 is enhanced in the said microorganism.

12. The method of claim 11, wherein the Ferredoxin NADP+ reductase enzymatic activity is enhanced by overexpressing a polynucleotide coding for the polypeptide having at least 70% identity with the sequence of SEQ ID No 1.

13. A method for preparing ethanol wherein the microorganism according to claim 3 or 4 is grown in an appropriate culture medium comprising a source of carbon and the ethanol is recovered.

14. A method for preparing n-butanol wherein the microorganism according to claim 5 or 6 is grown in an appropriate culture medium comprising a source of carbon and the n-butanol is recovered.

15. A method for preparing 1, 3 propanediol wherein the microorganism according to claim 7 or 8 is grown in an appropriate culture medium comprising a source of carbon and the 1, 3-propanediol is recovered.

16. A method for preparing 1, 2 propanediol wherein the microorganism according to claim 9 or 10 is grown in an appropriate culture medium comprising a source of carbon and the 1, 2-propanediol is recovered.

17. Use of a microorganism according to claim 3 or 4 to produce ethanol.

18. Use of a microorganism according to claim 5 or 6 to produce n-butanol.

19. Use of microorganism according to claim 7 or 8 to produce 1,3 propanediol.

20. Use of microorganism according to claim 9 or10 to produce 1,2 propanediol.

21. A polypeptide having at least 70% identity with the sequence of SEQ ID No 1 having Ferredoxin NADP+ reductase enzymatic activity.

22. Use of a polypeptide having at least 70% identity with the sequence of SEQ ID No 1 for the reduction of NADP+ using electrons from reduced ferredoxin in a microorganism or in the culture medium of a microorganism.

Description

DESCRIPTION OF DRAWING

[0214] FIG. 1: New metabolic pathway for ethanol production

[0215] FIG. 2: New metabolic pathway for butanol production

[0216] FIG. 3: New metabolic pathway for 1.3 propanediol production

[0217] FIG. 4: New metabolic pathway for 1.2 propanediol production

[0218] FIG. 5: Another New metabolic pathway for 1.2 propanediol production

EXAMPLES

Example 1

Purification of Ferredoxin NADP.SUP.+ activity in C. acetobutylicum and Identification of the Encoding Gene

[0219] 1.1Ferredoxin NADP.sup.+ Reductase Activity and NADPH Ferredoxin Reductase Activity Assays:

[0220] All enzyme assays were performed in the anaerobic workstation under a nitrogen atmosphere. All reagent solutions were prepared in the assay buffer (previously boiled and degassed with nitrogen) and kept under a nitrogen atmosphere. Specific activities were determined in a range where linearity with protein concentration was established. Each enzyme assay was done at least in duplicate. One unit of enzyme activity is defined as the amount of enzyme that catalyzes the conversion of 1 mol of substrate per min. The concentrations of components in the reaction mixtures (1 ml total volume) are given below.

[0221] In vitro ferredoxin NADP+ reductase activity was assayed by measuring the reduction of NADP+ using electrons from reduced methyl viologen or reduced ferredoxin (CA_C0303) with H2 as the reductant of the methyl viologen or ferredoxin (CA_C 0303) (Demuez et al. 2007) in the presence of the FeFe Hydrogenase from Clostridium acetobutylicum (CA_C0028) (Vasconcelos et al. 1994, Girbal et al. 2005). The reaction was performed anaerobically at 37 C., in 100 mM Tris-HCl buffer (pH 7) with 2 mM DTT, 25 M FAD, 150 M methyl viologen, 1,6 mM NADP+, 6 U (or more) of purified hydrogenase HydA from C. acetobutylicum and crude extract (or purified protein) and followed by monitoring the increase in A 340 nm as an indication of the apparition of NADPH using a spectrophotometer (Hewlett Packard 8453). After a gentle stream with hydrogen in the quartz cuvette cells, assays were initiated by the addition of methyl-viologen and then, after the reduction of methyl viologen followed at a wavelength of 560 nm, by the addition of NADP+. In all reactions, non-enzymatic rates were subtracted from the observed initial reaction rates.

[0222] In vitro NADPH ferredoxin reductase activity was assayed by monitoring the increase of A560 nm as an indication of the reduction of methyl viologen using a spectrophotometer (Hewlett Packard 8453). The reaction was carried out anaerobically at 37 C. in quartz cuvette cells in 100 mM Tris-HC1 buffer (pH 7,6) with 2 mM DTT, 10 M FAD, 250 M NADPH, ethanol 3% vol/vol, 45 U Adh (S. cerevisiae), 10 mM methyl viologen, 250 M NADPH, and crude extract or purified protein. Assays were initiated by the addition of methyl viologen. In all reactions, non-enzymatic rates were subtracted from the observed initial reaction rates.

[0223] The extinction coefficient of methyl viologen at 560 nm and NADPH at 340 were 7.71 mM-1 cm-1 and 6.29 mM-1 cm-1 respectively. The total protein concentration of the cell-free extract or purified fraction was determined using the Bradford method (Biorad reagent) (Bradford 1976) with bovine serum albumin as the standard.

[0224] 1.2Purification of Ferredoxin NADP reductase in C. acetobutylicum Under Solventogenic Conditions:

[0225] C. acetobutylicum ATCC 824 strain was kept in spore form at 20 C. in the synthetic medium (MS), as previously described (Meynial-SalIes et al. 2005). The flask cultures of C. acetobutylicum strains were grown anaerobically in synthetic medium (MS) and were inoculated with spore stock at 10% (v/v) and heat-shocked at 80 C. for 15 min. Cells were grown up at 37 C. to an OD620 nm of approximately 2.0 and the pH was maintained by buffering the culture medium with calcium carbonate, prior to inoculation of the bioreactor at 10% (v/v).

[0226] The pH-controlled batch fermentations were performed in synthetic medium. A 2 L Biostat B bioreactor (Sartorius, Aubagne, France) was used with a working volume of 1.3 L. After sterilization, the medium was sparged with O2-free nitrogen for 30 min During the course of the experiment, the medium was maintained under a slight nitrogen overpressure to avoid O2 entry into the reactor. All tubing was made of butyl rubber, and the reactor gas outlet was protected with a pyrogallol arrangement.

[0227] Cultures were stirred at 300 rpm, the temperature was set at 35 C., and the pH was maintained at 4.8 with automatic addition of NH4OH (3N). The cell concentration was measured turbidimetrically by monitoring the optical density (OD) at 620 nm (Biochrom libra S11) and products formation were measured in duplicate using High Performance Liquid Chromatography (HPLC) analysis (Agilent 1200 series, Massy, France) (Dussaux et al. 2013).

[0228] When the OD620 nm reached an approximatively value of 16, after the switch from acidogenic to solventogenic phase, cells were harvested under Hydrogen pressure and transferred into anaerobic chamber. Cells were washed and concentrated 20 times in 100 mM Tris-HCl 2 mM DTT 10% glycerol (pH 7.6) buffer and frozen at 80 C.

[0229] The entire purification procedure was performed under anaerobic conditions. All purification buffers were preliminary degassed and 10 M FAD and 2 mM DTT were added to prevent non-reversible activity losses.

[0230] Later, the frozen cells from solventogenic batch cultures of C. acetobutylicum ATCC 824 were thawed and broken by sonication using an ultrasonic disintegrator (vibracell 72434, Bioblock) at 4 C. in four cycles of 30 sec with 2-min intervals. Debris were removed by centrifugation at 8600 g for 10 min, 4 C. (Sigma centrifuge 2-16K). Nucleic acids were precipitated by addition of streptomycin sulfate (200 mg/ml) in the supernatant and removed by centrifugation as before. The recovered extract was then diluted 5 times in 100mM Tris-HCL buffer (pH 8) before loaded on a 5mL HiTrap Capto-DEAE matrix (GE Healthcare, ref 28-9165-40) connected to an AKTA purifier (GE Healthcare, Sweden). Active fractions were screened with the NADPH Ferredoxin Reductase assay using methyl viologen as previously described. The column was equilibrate in 100 mM Tris-HCL buffer (pH 8) and elution was performed with a 3 steps gradient of 100mM Tris-HCL+1M NaCl buffer (pH 8): 1CV 0-4%, 20CV 4-16% (target elution) and 5CV 16-100% ; 2 mL fractions were collected. The most active fraction from Capto-DEAE column was concentrated on Vivaspin 15/10000MW (Sartorius Stedim, ref VS1502) to reduce the sample volume at 150 L by centrifugation at 3000 g, 15 min. For the last purification step, the 150 1 sample volume was applied on a Superose 12, 10/300 GL column (GE Healthcare, ref 17-5173-01) preliminary equilibrated in 100 mM Tris-HCl+150 mM NaC1 buffer (pH7,6) and fractions of 400 L were collected. Finally, the total protein concentration of the cell-free extract or purified fraction was determined using the Bradford method (Biorad reagent) (Bradford 1976) with bovine serum albumin as the standard.

[0231] Yields and purification factor of each step were calculated. The purity factor of the separate active fractions was also evaluated using a SDS electrophoresis in 40 mL polyacrylamide gels.

[0232] Both in vitro ferredoxin NADP+ reductase and NADPH ferredoxin reductase activities were evaluated on the recovered pure fraction. According to table 1, the purified enzyme is strictly NADPH/NADP+ dependent:

TABLE-US-00003 TABLE 1 Ferredoxin NADP+ reductase and NADPH ferredoxin reductase specific activities on the final purified fraction using methyl viologen as a substrate: Specific activity U/mg protein Ferredoxin Ferredoxin NADH NADPH NAD.sup.+ NADP.sup.+ ferredoxin ferredoxin Activities reductase reductase reductase reductase Purified ND* 0.43 +/ 0.064 ND* 56.5 +/ 2.03 fraction .sup.9.5 +/ 1.41.sup.# *ND: non-detectable; .sup.#using reduced ferredoxin (CA_C0303) instead of methyl viologen as the substrate.

[0233] 1.3Identification of the Gene Coding for Ferredoxin NADP Reductase Activity:

[0234] The region of the gel corresponding to the protein at 45 kDa was cut off using a sterile pipette tip. This gel plug was then used for identification of proteins by mass spectroscopy.

[0235] The sample was subjected to trypsin digestion and analyzed by nano LC/MS/MS on a CapLC-Q-TOF2 (Waters) and by MALDI on MALDI MX (Waters). The candidate proteins were identified with the softwares ProteinLynx Global Server (Waters) and Mascot (Matrix Science) using the protein data bank of C. acetobutylicum. For both analyses, there was only one protein identified with a significant score (77% sequence coverage). This 45 kDa protein was shown to be encoded by CA_C0764 a gene annotated to encode for a small subunit of glutamate synthase.

Example 2

Modulation of Ferredoxin NADP Reductase Activity in C. acetobutylicum:

[0236] 2.1Disruption of CA_C0764 Gene in C. acetobutylicum, Validation of Loss of Ferredoxin NADP.sup.+ Reductase Activity and Enhanced Selectivity for Acetone:

[0237] To investigate the involvement of CA_C0764 in the in vivo butanol metabolic pathway in C. acetobutylicum, the group II intron-based Clostron technology (Heap J et al . 2007) was used to inactivate the CA_C0764 gene into the C. acetobutylicum cac15 (Soucaille et al. 2006). This technology uses the insertion of a group II intron into a genomic target site coupled to a retrotransposition-activated marker (erythromycin resistance) allowing a stable gene inactivation.

[0238] 2.1.1: Construction of the C. acetobutylicum cacl5cac0764-408s::CT Mutant:

[0239] The intron target site was identified at the 408/409s bp (from the start of the orf) on the sense strand and intron retargeting PCR primers were designed using a computer algorithm (Perutka et al. 2004):

TABLE-US-00004 1-408/409s-IBSconsistingof53bases (SEQIDNO3) AAAAAAGCTTATAATTATCCTTAGGCTACAATGTTGTGCGCCCAGATA GGGTG 2.408/409s-EBS1dconsistingof60bases (SEQIDNO4) CAGATTGTACAAATGTGGTGATAACAGATAAGTCAATGTTACTAACTT ACCTTTCTTTGT 3.408/409s-EBS2consistingof49bases (SEQIDNO5) TGAACGCAAGTTTCTAATTTCGATTTAGCCTCGATAGAGGAAAGTGTCT

[0240] The three 408/409-IBS, 408/409-IEBS1d, 408/409-EBS2 and the EBS universal primers were used in a single-tube reaction with the pMTL007 plasmid (Heap J. et al. 2007) to mutate the intron at several positions spanning a 350 bp region. The PCR reaction, which re-targets the intron by primer-mediated mutation, was performed according to the Targetron Gene Knockout System kit Protocol (http://www.sigmaaldrich.com/life-science/functional-genomics-and-rnai/targetron.html). The 350 bp PCR fragment was purified and then cloned into the pMTL007 plasmid at the HindIII and BsrGI sites, to replace the original intron fragment. The ligation product was then introduced into Top10 chemically competent E. coli cells (Invitrogen). Some single colonies were then grown in LB liquid culture supplemented with ampicillin (100 g/ml), overnight at 37 C., to finally carry out a DNA plasmid extraction (GenElute HP plasmid miniprep kit, Sigma) and check for the presence of the pMTL007:Ca-cac0764-4085 plasmid.

[0241] The retargeted plasmid pMTL007:Ca-cac0764-4085 was finally controlled by restriction and by DNA sequencing using the 408/409-IBS and 408/409-IEBS1d primers.

[0242] C. acetobutylicum cac15 was then electroporated as previously described (Mermelstein et al.,1992) using unmethylated retargeted pMTL007:Ca-cac0764-4085 plasmid, because the CA_C1502 gene encoding the type II restriction endonuclease Cac824I was deleted (Soucaille et al. 2006). After 5 hours of recovery, cells were plated on RCA (Clostridium Nutrient Medium with 15 g/l agar, Fluka (Saint-Quentin Fallavier, France, no 27546) medium supplemented with thiamphenicol (10 g/ml). Single colonies were chosen from the plate and streaked separately on a RCA plate with erythromycin (40 g/ml) to select integrants.

[0243] The insertion mutants were screened via colony-PCR using the two following primers flanking the target site:

TABLE-US-00005 cac0764del_for(SEQIDNO6): (homologoustothesequence886263to886287) cgagccaataaaatttcacgagata cac0764del_rv(SEQIDNO7): (homologoustothesequence886512to886541) ccaacctctataagtctttcttcaagctta
PCR products were purified and confirmed by DNA sequencing. One of the colonies was selected to cure the pMTL007:Ca-cac0764-4085 plasmid and generate the C. acetobutylicum cac15cac0764408s::CT.

[0244] This clone was inoculated into Clostridum Growth Medium (CGM) medium supplemented with erythromycin (40 g/mL) for successive subcultures, as previously described (Dussaux et al. 2013). 100 L of fully grown culture was inoculated into 1 mL fresh CGM medium supplemented with erythromycin (40 g/mL), grown anaerobically at 37 C. for at least 12 h until full growth achieved. This transfer process was repeated at least 3 times. The last culture was then plated onto solid RCA plate supplemented with erythromycin (40 g/mL). Colonies were re-streaked successively onto RCA plates supplemented with thiamphenicol (10 g/mL) and then onto RCA plates supplemented with erythromycin (40 g/mL). One erythromycin-resistant and thiamphenicol-sensitive clone was selected and inoculated into 3 mL of synthetic medium supplemented with erythromycin (40 g/mL), grown anaerobically at 37 C. for at least 24 h and transferred in 30 mL synthetic medium supplemented with erythromycin (40 g/mL). The culture was grown anaerobically at 37 C. for 7 days until sporulation and then the spore suspension was stored at 20 C.

[0245] 2.1.2: Phenotypic Analysis of the C. acetobutylicum cacl5cac0764408s::CT Mutant:

[0246] C. acetobutylicum cac15cac0764408s::CT strain was kept in spore form at 20 C. in the synthetic medium (MS), as previously described (Meynial-SalIes et al. 2005). The flask cultures of C. acetobutylicum strains were grown anaerobically in synthetic medium (MS) and were inoculated with spore stock at 10% (v/v) and heat-shocked at 80 C. for 15 min. Cells were grown up at 37 C. during several days, and the pH was maintained by buffering the culture medium with calcium carbonate. As a control, the C. acetobutylicum cac15 was grown in the same conditions.

[0247] The comparative phenotypic analysis was performed by measuring both glucose consumption as well as the concentration of fermentation products as is shown in table 2:

TABLE-US-00006 Products yield (% g/g glucose consumed) Ethanol Acetone Butanol Acetic acid Lactate Acetoin Butyric acid C. acetobutylicum 1.90 9.70 23 0 6 3.15 1.37 cac15 C. acetobutylicum 1.80 13.88 16.10 0 5.59 5.18 1.58 cac15cac0764408s::CT

[0248] The C. acetobutylicum cac15cac0764408s::CT strain produces more acetone and less butanol than the control strain.

[0249] 2.1.3: Ferredoxin NADP+ Reductase Activity determination in C. acetobutylicum cacl5cac0764408s::CT Mutant:

[0250] C. acetobutylicum cac15cac0764408s::CT strain was grown anaerobically in synthetic medium (MS) at 37 C., inoculated with spore stock at 10% (v/v) and heat-shocked at 80 C. for 15 min. Cells were grown up to an approximatively OD.sub.620nm of 2, and the pH was maintained by buffering the culture medium with calcium carbonate. As a control, the C. acetobutylicum cac15 was grown in the same conditions. Cells were transferred into anaerobic chamber, harvested, washed and 20 times concentrated in 100 mM Tris-HCl 2 mM DTT 10% glycerol (pH 7.6) buffer, frozen at 80 C. or immediately used. Cells were further broken by sonication using an ultrasonic disintegrator (vibracell 72434, Bioblock) at 4 C. in four cycles of 30 sec with 2-min intervals. Debris were removed by centrifugation at 8600 g for 10 min, 4 C. (Sigma centrifuge 2-16K) and the acellular crude extract was loaded onto a SephadexG25 column to eliminate salts and metabolites, before the ferredoxin NADP.sup.+ reductase activity determination using ferredoxin as a substrate and following the procedure already described in 1.1 (table A).

TABLE-US-00007 TABLE A Ferredoxin NADP.sup.+ reductase specific activities determined on crude extracts using ferredoxin as a substrate: Ferredoxin NADP+ reductase Strains specific activity U/mg protein C. acetobutylicum 0.64 cac15 C. acetobutylicum 0 cac15cac0764408s::CT

[0251] No ferredoxin NADP.sup.+ reductase activity is detected in the acellular crude extract prepared from the C. acetobutylicum cac15cac0764408s::CT mutant cells in which the CA_C0764 encoding gene is inactivated.

2 2Overexpression of CA_C0764 Gene in C. acetobutylicum, Validation of Ferredoxin NADP.sup.+ Reductase Activity Increases and Enhanced Selectivity for Butanol:

[0252] 2.2.1 : Construction of the pCLF 0764 for CA_C 0764 Overexpression:

[0253] The CA_C0764 gene was amplified from the genomic DNA of C. acetobutylicum TCC824 using primers Ocac07641 and Ocac0764r. The primers were designed to introduce a RBS region along with the CA_C0764 gene, as well as placing BamHI and SfoI restriction sites upstream and downstream respectively:

TABLE-US-00008 Ocac0764f(SEQIDNO8): AGGATCCATCAAAATTTAGGAGGTTAGTTA Ocac0764r(SEQIDNO9): GGCGCCTTAATTATTCTTGCAATACTCATCAATAGTTTC

[0254] The amplified PCR fragment was then subcloned into a Zero Blunt TOPO vector

[0255] (Invitrogen, Saint Aubin, France) to yield the Zero Blunt TOPOcac0764 plasmid and sequenced using universal primers T7P and T3P to assure that no mutations were introduced. The fragment containing the CA_C0764 gene was purified on an agarose gel after digestion of the Zero Blunt TOPOcac0764 vector with BamHI and SfoI. The 7 kb p50594 vector (Dussaux et al. 2013) was also digested with BamHI and SfoI and ligated to the BamHI-SfoI digested sadh gene, yielding the 6.25 kb p50594-cac0764 vector. The p50594-cac0764 vector was digested with SalI, and the operon-containing fragments from each vector were purified on an agarose gel. The 4.9 kb pCLF1 vector (Soucaille et al. 2006) was digested with SalI, treated with Antarctic phosphatase and ligated with the previously purified fragment to yield the pCLFcac0764.

[0256] C. acetobutylicum cac15 was then electroporated as previously described (Mermelstein et al.,1992) using unmethylated pCLFcac0764plasmid. After 5 hours of recovery, cells were plated on RCA (Clostridium Nutrient Medium with 15 g/l agar, Fluka (Saint-Quentin Fallavier, France, no 27546) medium supplemented with thiamphenicol (10 g/ml). Single colonies were chosen from the plate and streaked separately on a RCA plate with thiamphenicol (10 g/ml). The transformants were screened using PCR amplification of the synthetic operon expressing CA_C0764 . The cells were then transferred and grown on a MS agar plate with thiamphenicol (10 g/ml) before inoculation into liquid MS medium. One selected clone was grown anaerobically at 37 C. for 7 days until sporulation and then the spore suspension was stored at 20 C.

[0257] 2. 2.2: Phenotypic Analysis of the C. acetobutylicum cac15 pCLF 0764 Mutant:

[0258] C. acetobutylicum cac15pCLF 0764 mutant was kept in spore form at 20 C. in the synthetic medium (MS), as previously described (Meynial-SalIes et al. 2005). The flask cultures of C. acetobutylicum strains were grown anaerobically in synthetic medium (MS) (at the exception that cystein was omitted) and were inoculated with spore stock at 10% (v/v) and heat-shocked at 80 C. for 15 min. Cells were grown up at 37 C. during several days, and the pH was maintained by buffering the culture medium with calcium carbonate. As a control, the C. acetobutylicum cac15 was grown in the same conditions.

[0259] The comparative phenotypic analysis was performed by measuring both glucose consumption as well as the concentration of fermentation products as is shown in table 3:

TABLE-US-00009 Products yield (% g/g glucose consumed) Ethanol Acetone Butanol Acetic acid Lactate Acetoin Butyric acid C. acetobutylicum 1.96 9 20.9 3.47 1.15 3.75 5.34 cac15 C. acetobutylicum 8.69 4.69 25.72 3.14 0.63 1.39 3.53 cac15 pCLFcac0764

[0260] The C. acetobutylicum cac15 pCLFcac0764 strain produces less acetone and more butanol and ethanol than the control strain.

[0261] 2.2.3. Ferredoxin NADP.sup.+ Reductase Activity Determination in C. acetobutylicum cac15 pCLF 0764 Mutant: C. acetobutylicum cac15 pCLF 0764 mutant was grown anaerobically in synthetic medium (MS), at 37 C., inoculated with spore stock at 10% (v/v) and heat-shocked at 80 C. for 15 min. Cells were grown up to an approximatively OD.sub.620nm of 2, and the pH was maintained by buffering the culture medium with calcium carbonate. As a control, the C. acetobutylicum cac15 was grown in the same conditions. Cells were transferred into anaerobic chamber, harvested, washed and 20 times concentrated in 100 mM Tris-HCl 2 mM DTT 10% glycerol (pH 7.6) buffer, frozen at 80 C. or immediately used. Cells were further broken by sonication using an ultrasonic disintegrator (vibracell 72434, Bioblock) at 4 C. in four cycles of 30 sec with 2-min intervals. Debris were removed by centrifugation at 8600 g for 10 min, 4 C. (Sigma centrifuge 2-16K) and the acellular crude extract was loaded onto a SephadexG25 column to eliminate salts and metabolites, before the ferredoxin NADP.sup.+ reductase activity determination using ferredoxin as a substrate and following the procedure already described in 1.1 (table B).

TABLE-US-00010 TABLE B Ferredoxin NADP.sup.+ reductase specific activities determined on crude extracts using ferredoxin as a substrate: Ferredoxin NADP+ reductase Strains specific activity U/mg protein C. acetobutylicum 0.64 cac15 C. acetobutylicum 2 cac15 pCLFCA_C0764

[0262] A 3-fold increase of the ferredoxin NADP.sup.+ reductase activity is measured in the acellular crude extract prepared from the C. acetobutylicum cac15 pCLFCA_C0764 mutant cells in which the CA_C0764 encoding gene is overexpressed from a plasmid.

Example 3

Heterologous Production of Ethanol by a New Metabolic Pathway in an E. coli Strain with an Enhanced Ferredoxin NADP.SUP.+ Reductase Activity:

[0263] 3.1: Construction of an E. coli MG1655ldhA::FRT, pflAB::FRT, ack-pta::FRT, iscR::FRT, frdABCD::FRT ace::FRT, mgsA Modified Strain

[0264] 3.1.1 Construction of an E. coli MG1655 ldhA::FRT-cm-FRT Modified Strain

[0265] The ldhA gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions, deleting most of the gene concerned. The used technique was described by Datsenko and Wanner in 2000.

[0266] Two oligonucleotides were designed and used to replace the ldhA gene:

TABLE-US-00011 1-DldhAr,consistingof101bases(SEQIDNO10): ttaaaccagttcgttcgggcaggtttcgcctttttccagattgcttaag ttttgcagcgtagtctgagaaatactggtcagCATATGAATATCCTCC TTAG

[0267] With a region (lower-case letters) homologous to the sequence (1439878-1439958) of the ldhA gene (sequence 1439878 to 1440867), a reference sequence on the website http://ecocyc.org/(Keseler et al. 2005) and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid (Datsenko and Wanner 2000).

TABLE-US-00012 2. DldhAf, consisting of 100 bases (SEQ ID NO 11): gaaactcgccgtttatagcacaaaacagtacgacaagaagtacctgcaac aggtgaacgagtcctttggctttgagctggTGTAGGCTGGAGCTGCTTCG

[0268] With a region (lower-case letters) homologous to the sequence (1440786-1440865) of the ldhA gene (sequence 1439878 to 1440867), a reference sequence on the website http://ecocyc.org/ and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0269] Both oligonucleotides DldhAr and DldhAf were used to amplify the chloramphenicol resistance cassette from the pKD3plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the ldhA gene by the chloramphenicol cassette was checked by PCR analysis using both hslJC and ldhAC2 oligonucleotides.

TABLE-US-00013 3-hslJC (SEQ ID NO 12): gccatcagcaggcttagcgc (homologous to the sequence 1439724 to 1439743) 4-ldhAC2 (SEQ ID NO 13): gggtattgtggcatgtttaaccg (homologous to the sequence 1441007 to 1441029).

[0270] The chloramphenicol resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 12 and 13).

[0271] 3.1.2 Construction of a E. coli MG1655 pflAB::FRT-cm-FRT Modified Strain:

[0272] The pflAB genes were replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0273] Two oligonucleotides were designed and used to replace the pflAB genes:

TABLE-US-00014 1. DpflBr, consisting of 100 bases (SEQ ID NO 14): ccggacatcctgcgttgccgtaaatctggtgttctgaccggtctgccaga tgcatatggccgtggccgtatcatcggtgaCATATGAATATCCTCCTTAG

[0274] With a region (lower-case letters) homologous to the sequence (952236 -952315) of the pflB gene (sequence 950495-952777), a reference sequence on the website http://ecocyc.org/ and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid (Datsenko and wanner 2000).

TABLE-US-00015 2. Dpflaf, consisting of 100 bases (SEQ ID NO 15): gatgcactataagatgtgttaaaaacgctgtagcagaatgaagcgcggaa taaaaaagcggcaactcaataaagttgccgTGTAGGCTGGAGCTGCTTCG

[0275] With a region (lower-case letters) homologous to the sequence (949470-949549) located upstream the pflA gene (sequence 949563-950303), a reference sequence on the website http://ecocyc.org/and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0276] Both oligonucleotides DpflBr and DpflAf were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the pflAB genes by the chloramphenicol cassette was checked by PCR analysis using both pflAB1 and pflAB2 oligonucleotides.

TABLE-US-00016 3. pflAB1 (SEQ ID NO 16): agacattaaaaatatacgtgcagctacccg (homologous to the sequence 948462 to 948491) 4. pflAB2 (SEQ ID NO 17): gtgaaagctgacaacccttttgatctttta (homologous to the sequence 953660 to 953689).

[0277] 3.1.3 Construction of an E. coli MG1655 ldhA::FRT pflAB:: cm Modified Strain.

[0278] Both pflA and pflB genes were then replaced with a chloramphenicol resistance cassette into the MG1655 ldhA::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0279] The Cm.sup.R transductants were selected on plate and the replacement of the pflAB genes by the chloramphenicol cassette into the MG1655ldhA::FRT was checked by PCR analysis using both pflAB1 and pflAB2 oligonucleotides. Finally, both hslJC and ldhAC2 primers were also used in PCR analysis to confirm the deletion of ldhA the gene in the strain pflAB::cm. The resulting strain was named MG1655 ldhA::FRT pflAB::cm.

[0280] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 16 and 17). The new strain was named MG1655 ldhA::FRT pflAB::FRT.

[0281] 3.1.4 Construction of an MG1655 ackA-pta::cm E. coli Modified Strain:

[0282] The ackA-pta genes were replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0283] Two oligonucleotides were designed and used to replace the ackA-pta genes:

TABLE-US-00017 1. DackAf, consisting of 100 bases (SEQ ID NO 18): gtcgagtaagttagtactggttctgaactgcggtagttcttcactgaaat ttgccatcatcgatgcagtaaatggtgaagTGTAGGCTGGAGCTGCTTCG

[0284] With a region (lower-case letters) homologous to the sequence (2411494-2411573) of the ackA gene (sequence 2411492 to 2412694), a reference sequence on the website http://ecocyc.org/ and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid (Datsenko and Wanner 2000).

TABLE-US-00018 2. Dptar, consisting of 97 bases (SEQ ID NO 19): tgctgtgcagactgaatcgcagtcagcgcgatggtgtagacgatatcgtc aaccagtgcgccacgggacaggtcgttCATATGAATATCCTCCTTAG

[0285] With a region (lower-case letters) homologous to the sequence (2414906-2414830) of the pta gene (sequence 2412769 to 2414913), a reference sequence on the website http://ecocyc.org/ and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0286] Both DackAf and Dptar oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the ackA pta genes by the chloramphenicol cassette was checked by PCR analysis using both B2295f and YfcCR oligonucleotides.

TABLE-US-00019 3. B2295f (SEQ ID NO 20): gcatgggtaaacttaaggcg (homologous to the sequence 2410902 to 2410921) 4. YfcCr (SEQ ID NO 21): taatcaccaacgtatcgggc (homologous to the sequence 2415147 to 2415166).

[0287] 3.1.5: Construction of an E. coli MG1655 ldhA::FRT pflAB::FRT ackA-pta::FRT Modified Strain

[0288] Both ackA and pta genes were then replaced with a chloramphenicol resistance cassette flanked by Flp recognition target (FRT) into the MG1655 ldhA::FRT pflAB::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0289] The Cm.sup.R transductants were selected on plate and the replacement of the ackA pta genes by the chloramphenicol cassette into the MG1655 ldhA::FRT pflAB::FRT was checked by PCR analysis using both B2295f and YfcCr oligonucleotides. Finally, both i) hslJC and ldhAC2 and pFlAB1 and pflAB2 couple of primers were also used in PCR analysis to confirm the deletion of ldhA and pflAB genes in the strain ackA-pta::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTackA-pta::cm.

[0290] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 20 and 21). The new strain was named MG1655 ldhA::FRT pflAB::FRT ackA-pta::FRT.

[0291] 3.1.7. Construction of an E. coli MG1655 iscR::km Modified Strain

[0292] The iscR gene was replaced with a kanamycin antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 50-nt homology extensions, deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0293] Two oligonucleotides were designed and used to replace the iscR gene:

TABLE-US-00020 1. DiscRf, consisting of 70 bases (SEQ ID NO 22): tacaataaaaaaccccgggcaggggcgagtttgaggtgaagtaagacatg ATTCCGGGGATCCGTCGACC

[0294] With a region (lower-case letters) homologous to the sequence (2660151-2660200) corresponding to the upstream chromosomal sequence of the iscR gene (sequence 2659665 to 2660153), a reference sequence on the website http://ecocyc.org/, including the iscR gene initiation codon, and a region (upper-case letters) for the amplification of the kanamycin resistance cassette carried by the pKD13 plasmid.

TABLE-US-00021 2. DiscRr, consisting of 70 bases (SEQ ID NO 23): cactccggcctgattctgaattctttttattaagcgcgtaacttaacgtc TGTAGGCTGGAGCTGCTTCG

[0295] With a region (lower-case letters) homologous to the sequence (2659636-2659685) corresponding to the downstream chromosomal sequence of the iscR gene (sequence 2659665 to 2660153), a reference sequence on the website http://ecocyc.org/, including the codons for the six C-terminal residues and the stop codon of the iscR gene, and a region (upper-case letters) for the amplification of the kanamycin resistance cassette of the pKD13 plasmid Datsenko and Wanner in 2000. Both DiscRf and DiscRr oligonucleotides were used to amplify the kanamycin resistance cassette from the pKD13 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the iscR gene by the chloramphenicol cassette was checked by PCR analysis using both iscr1s and iscr1rv oligonucleotides.

TABLE-US-00022 3. iscr1s (SEQ ID NO 24): cgccgcatccgacaacagg (homologous to the sequence 2660325 to 2660343) 4. iscr1rv (SEQ ID NO 25): tgctggtgatgatgtgcttgcct (homologous to the sequence 2659253 to 2659275).

[0296] 3.1.8. Construction of an E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRT iscR::FRT Modified Strain:

[0297] The iscR gene was then replaced with a kanamycin resistance cassette into the MG1655 ldhA::FRTpflAB::FRTackA-pta::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0298] The Km.sup.R transductants were selected on plate and the replacement of the iscR gene by the kanamycin cassette into the MG1655ldhA::FRTpflAB::FRTackA-pta::FRT was checked by PCR analysis using both iscrs and iscr1rv oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 and iii) B2295f and YfcCR couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB and ackA-pta genes respectively in the strain iscR::km. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::km. The kanamycin-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Km.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 24 and 25). The new strain was named MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRT.

[0299] 3.1.9 Construction of a E. coli MG1655 frdABCD::cm Modified Strain:

[0300] The frdA, frdB, frdC and frdD genes were replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 50-nt homology extensions, deleting most of the concerned genes. The used technique was described by Datsenko and Wanner in 2000.

[0301] Two oligonucleotides were designed and used to replace the frdA, frdB, frdC and frdD genes:

TABLE-US-00023 1. DfrdAf, consisting of 70 bases (SEQ ID No 26): accctgaagtacgtggctgtgggataaaaacaatctggaggaatgtcgtg TGTAGGCTGGAGCTGCTTCG

[0302] With a region (lower-case letters) homologous to the sequence (4380339-4380388) corresponding to the upstream chromosomal sequence of the frdA gene (sequence 4378533 to 4380341), a reference sequence on the website http://ecocyc.org/, including the frdA gene initiation codon, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the plasmid pKD3 (Datsenko and Wanner in 2000).

TABLE-US-00024 2. DfrdDr, consisting of 70 bases (SEQ ID No 27): aggcgggccggatttacattggcgatgcgttagattgtaacgacaccaat CATATGAATATCCTCCTTAG

[0303] With a region (lower-case letters) homologous to the sequence (4377001-4377050) corresponding to the downstream chromosomal sequence of the frdD gene (sequence 4377030 to 4377389), a reference sequence on the website http://ecocyc.org/, including the codons for the six C-terminal residues and the stop codon of the frdD gene, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the plasmid pKD3.

[0304] Both DfrdAf and DfrdDr oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the frdABCD genes by the chloramphenicol cassette was checked by PCR analysis using both frdABCD1s and frdABCD1rv oligonucleotides.

TABLE-US-00025 3. frdABCD1s (SEQ ID NO 28): ctggctcatacaaggcgtctcc (homologous to the sequence 4380779 to 4380800) 4. frdABCD1rv (SEQ ID NO 29): tcccattccactgtttagcggta (homologous to the sequence 4376610 to 4376632).

[0305] 3.1.10 Construction of an E. coli MG1655 ldhA::FRTpflAB::FRT ackA-pta::FRT iscR::FRT frdABCD::FRT Modified Strain:

[0306] The frdABCD genes were then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972). The Cm.sup.R transductants were selected on plate and the replacement of the frdABCD genes by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTackA-pta::FRT iscR::FRT was checked by PCR analysis using both frdABCD1s and frdABCD1rv oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 iii) B2295f and YfcCR and iv) iscr1s and iscr1rv couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB ackA-pta and iscR genes respectively, in the strain iscR::km. The resulting strain was named MG1655ldhA::FRT pflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::cm.

[0307] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 28 and 29). The new strain was named MG1655ldhA::FRTpflAB::FRT ackA-pta::FRTiscR::FRTfrdABCD::FRT.

[0308] 3.1.11 Construction of an E. coli MG1655 aceE::km Modified Strain:

[0309] The aceE gene was replaced with a kanamycin antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 50-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0310] Two oligonucleotides were designed and used to replace the aceE gene:

TABLE-US-00026 1. DaceEf, consisting of 70 bases (SEQ ID NO 30): acaggttccagaaaactcaacgttattagatagataaggaataacccatg ATTCCGGGGATCCGTCGACC

[0311] With a region (lower-case letters) homologous to the sequence (122970-123019) corresponding to the upstream chromosomal sequence of the aceE gene (sequence 123017 to 125680), a reference sequence on the website http://ecocyc.org/, including the aceE gene initiation codon, and a region (upper-case letters) for the amplification of the kanamycin resistance cassette carried by the pKD13 plasmid (Datsenko and Wanner 2000).

TABLE-US-00027 2. DaceEr, consisting of 70 bases (SEQ ID NO 31): gatttcgatagccattattatttacctcttacgccagacgcgggttaacT GTAGGCTGGAGCTGCTTCG

[0312] With a region (lower-case letters) homologous to the sequence (125660-125709) corresponding to the downstream chromosomal sequence of the aceE gene (sequence 123017 to 125680), a reference sequence on the website http://ecocyc.org/, including the codons for the six C-terminal residues and the stop codon of the aceE gene and a region (upper-case letters) for the amplification of the kanamycin resistance cassette of the pKD13 plasmid (Datsenko and Wanner 2000). Both DaceEf and DaceEr oligonucleotides were used to amplify the kanamycin resistance cassette from the pKD13 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the aceE gene by the kanamycin cassette was checked by PCR analysis using both aceEs and aceErv oligonucleotides.

TABLE-US-00028 3. aceEs (SEQ ID NO 32): gagagccgccgtgagcgttc (homologous to the sequence 122806 to 122825) 4. aceErv (SEQ ID NO 33): ctgcaccgtcggcggaatcg (homologous to the sequence 125916 to 125935).

[0313] 3.1.12. Construction of an E. coli MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR ::FRTfrdABCD::FRTaceE::FRT Modified Strain:

[0314] The aceE gene was then replaced with a kanamycin resistance cassette into the MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0315] The km.sup.R transductants were selected on plate and the replacement of the aceE gene by the kanamycin cassette into the MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR ::FRTfrdABCD::FRT was checked by PCR analysis using both aceEs and aceErv oligonucleotides. Finally, both i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 iii) B2295f and YfcCR, iv) iscr1s and iscr1rv and v) frdABCD1s and frdABCD1rv primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, ackA-pta, iscR and frdABCD genes respectively in the strain aceE::kan. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTackA-pta::FRTiscR::FRTaceE::km.

[0316] The kanamycin-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Km.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 32 and 33). The new strain was named MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRT.

[0317] 3.1.13. Construction of an E. coli MG1655 mgsA::cm Modified Strain:

[0318] The mgsA gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 50-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0319] Two oligonucleotides were designed and used to replace the mgsA gene:

TABLE-US-00029 1. DmgsAf, consisting of 70 bases (SEQ ID NO 34): taagtgcttacagtaatctgtaggaaagttaactacggatgtacattatg TGTAGGCTGGAGCTGCTTCG

[0320] With a region (lower-case letters) homologous to the sequence (1026236-1026285) corresponding to the upstream chromosomal sequence of the mgsA gene (sequence 1025780 to 1026238), a reference sequence on the website http://ecocyc.org/, including the mgsA gene initiation codon, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid.

TABLE-US-00030 2. DmgsAr, consisting of 70 bases (SEQ ID NO 35): aacaggtggcgtttgccacctgtgcaatattacttcagacggtccgcgag CATATGAATATCCTCCTTAG

[0321] With a region (lower-case letters) homologous to the sequence (1025751-1025800) corresponding to the downstream chromosomal sequence of the mgsA gene (sequence 1025780 to 1026238), a reference sequence on the website http://ecocyc.org/, including the codons for the six C-terminal residues and the stop codon of the mgsA gene and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0322] Both DmgsAf and DmgsAr oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the mgsA gene by the chloramphenicol cassette was checked by PCR analysis using both mgsAs and mgsArv oligonucleotides.

TABLE-US-00031 3. mgsAs (SEQ ID NO 36): cccagctcatcaaccaggtc (homologous to the sequence 1026715 to 1026734) 4. mgsArv (SEQ ID NO 37): ggagtcgattatggaagaggcg (homologous to the sequence 1025559 to 1025580).

[0323] 3.1.14. Construction of an E. coli MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRT Modified Strain.

[0324] The mgsA gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTackA-pta::FRTiscR::FRT frdABCD::FRTaceE::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0325] The Cm.sup.R transductants were selected on plate and the replacement of the mgsA gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR ::FRTfrdABCD::FRTaceE::FRT was checked by PCR analysis using both mgsAs and mgsArv oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 iii) B2295f and YfcCR, iv) iscr1s and iscr1rv v) frdABCD1s and frdABCD1rv and vi) aceEs and aceErv primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, ackA-pta, iscR, frdABCD and aceE genes respectively in the strain mgsA::cm. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::cm. The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 36 and 37). The new strain was named MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT.

[0326] 3.2. Construction of the pSC101-pGI1.6-cac2229-cac0764-cac0303 Expression Vector

[0327] Three CA_C2229, CA_C0764, CA_C0303 synthetic genes encoding the pyruvate ferredoxin oxidoreductase, the ferredoxin NADP reductase and the ferredoxin respectively, from Clostridium acetobutylicum were firstly designed using the method termed codon harmonization (Angov et al. 2008). Synonymous codons from E. coli that match as closely as possible the codon usage frequency used in the native genes from C. acetobutylicum were selected. Based on the generated sequences, the synthetic genes were further synthetized by Life Technologies (ThermoFisher Scientific, Saint aubin, France) introducing the native RBS region along with each gene, as well as placing two unique restriction sites upstream and downstream each gene. Each synthetic gene with its RBS region flanked by two unique restriction sites were then subcloned into the pCR4TOPO vector (Invitrogen, Saint Aubin, France), before to be cloned as an operon into a low-copy pSC101-derived plasmid (Bernardi and Bernardi 1984) under the control of the GI 1.6 promoter (Meynial-SalIes et al. 2005, Soucaille et al. 2012) and upstream the adc terminator (from C. acetobutylicum) to yield the 9.54 kb pSC101-pGI-cac2229-cac0764-cac0303 plasmid.

[0328] 3.3. Introduction of the pSC101-PGI-cac2229-cac0764-cac0303 Expression Vector into the MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT E. coli Strain.

[0329] ThepSC101-PGI-cac2229-cac0764-cac0303 expression vector was used to transform the MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT by electroporation (Sambrook and Russel 2001).

[0330] The transformants were selected on LB agar plates supplemented with spectinomycin (70 g/ml) at 37 C. Some transformants were then grown in LB liquid culture supplemented with spectinomycin (100 g/ml) overnight at 37 C. to carry out a DNA plasmid extraction (GenElute HP plasmid miniprep kit, Sigma) and check for the presence of the pSC101-PGI-cac2229-cac0764-cac0303 plasmid. The pSC101-pGI-cac2229-cac0764-cac0303 plasmid was finally controlled by restriction profile.

[0331] The final E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT (pSC101-PGI-cac2229-cac0764-cac0303) was grown in LB liquid medium supplemented with spectinomycin (100 g/ml) and kept in 20% glycerol solution at 80 C.

[0332] 3.4. : Physiological Characterization of the MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT (pSC101-pGI1.6-cac2229-cac0764-cac0303) E. coli Strain:

[0333] The MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT (pSC101-pGI1.6-cac2229-cac0764-cac0303) E. coli strain was grown anaerobically on a 20 g/L glucose mineral medium containing minerals salts as previously described (Meynial-salles et al. 2005) supplemented with 4 g/l of yeast extract, 5 mM sodium nitrate and spectinomycin (100 g/ml) and inoculated with 100 l of a LB overnight culture. Cells were grown up at 37 C. during several days, and the pH was maintained by buffering the culture medium with MOPS. As controls, both the MG1655 ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRT E.coli (without plasmid) and the MG1655 ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRT (pSC101-pGI1.6-cac2229-cac0303) (without the cac0764 gene) were grown in the same conditions.

[0334] The comparative phenotypic analysis was performed by measuring glucose consumption as well as the concentration of fermentation products for the culture of each strain as is shown in table 3:

TABLE-US-00032 Glucose consumption Products yield (% g/g glucose consumed) Strains (g/L) Pyruvate Succinate Lactate Formate Acetate Ethanol C0.sub.2 MG1655ldhA::FRTpflAB:: 2.27 87.7 1.54 0.66 1.45 4.84 17 19.86 FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRT MG1655ldhA::FRTpflAB:: 3.14 37.90 3.18 3.82 2.23 1.27 23.89 23.71 FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRT (pSC101-pGI1.6- cac2229-cac0303) MG1655ldhA::FRTpflAB:: 20.23 2.37 0.84 6.13 0.00 1.43 42.46 41.31 FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRT (pSC101-pGI1.6- cac2229-cac0764-cac0303

[0335] As shown in table 3, the expression of the complete synthetic CA_C2229-CA_C0764-CA_C0303 operon into the MG1655 ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRT E.coli led to the production of ethanol as the main fermentation product from glucose at a yield of 42.5 g/g glucose consumed corresponding to 83% of the theoretical yield. Moreover, the expression of the complete synthetic CA_C2229-CA_C0764-CA_C0303 operon favoured the growth which was strongly hampered in both control strains as the strains were unable to balance the redox.

[0336] 3.5. Ferredoxin NADP+ reductase activity determination in the MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT (pSC101-pGI1.6-cac2229-cac0764-cac0303) E. coli Strain:

[0337] The MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT (pSC101-pGI1.6-cac2229-cac0764-cac0303) E. coli strain was grown anaerobically on a 20 g/L glucose mineral medium containing minerals salts as previously described (Meynial-salles et al. 2005) supplemented with 4 g/l of yeast extract, 5 mM sodium nitrate and spectinomycin (100 g/ml) and inoculated with 100 l of a LB overnight culture. Cells were grown up at 37 C. up to an approximatively OD.sub.550 nm of 2, and the pH was maintained by buffering the culture medium with MOPS. As controls, both the MG1655 ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRT (pSC101-pGI1.6-cac2229-cac0303) (without the cac0764 gene) were grown in the same conditions. Cells were transferred into anaerobic chamber, harvested, washed and 20 times concentrated in 100 mM Tris-HCl 2 mM DTT 10% glycerol (pH 7.6) buffer, frozen at 80 C. or immediately used. Cells were further broken by sonication using an ultrasonic disintegrator (vibracell 72434, Bioblock) at 4 C. in four cycles of 30 sec with 2-min intervals. Debris were removed by centrifugation at 8600 g for 10 min, 4 C. (Sigma centrifuge 2-16K) and the acellular crude extract was loaded onto a SephadexG25 column to eliminate salts and metabolites, before the ferredoxin NADP.sup.+ reductase activity determination using ferredoxin as a substrate and following the procedure already described in 1.1 (table C).

TABLE-US-00033 TABLE C Ferredoxin NADP.sup.+ reductase specific activities determined on crude extracts using ferredoxin as a substrate: Ferredoxin NADP+ reductase Strains specific activity U/mg protein MG1655ldhA::FRTpflAB:: 0 FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRT(pSC101-pGI1.6- cac2229-cac0303) MG1655ldhA::FRTpflAB:: 0.08 FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRT (pSC101-pGI1.6- cac2229-cac0764-cac0303

[0338] As shown in table C, a ferredoxin NADP.sup.+ reductase activity is only detected into the E. coli modified strain expressing the CA_C0764 encoding gene.

Example 4

Heterologous Production of n-butanol by a new Metabolic Pathway in an E. coli Strain with an Enhanced Ferredoxin NADP .SUP.+ Eductase Activity.

[0339] 4.1: Construction of an E. coli MG1655ldhA::FRT, pflAB::FRT, ack-pta::FRT, iscR::FRT, frdABCD::FRT ace::FRT, mgsA::FRT adhE::FRT melB::TT02-Ptrc01/RBSOP2-crt-hbd-TT07-FRT ptrc30/RBS01*2-atoB-FRT Modified Strain

[0340] 4.1.1: Construction of an E. coli MG1655 adhE::FRT-cm-FRT Modified Strain:

[0341] The adhE gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0342] Two oligonucleotides were designed and used to replace the adhE gene:

TABLE-US-00034 DadhE r de 100 bases (SEQ ID No 38): atggctgttactaatgtcgctgaacttaacgcactcgtagagcgtgtaa aaaaagcccagcgtgaatatgccagtttcactCATATGAATATCCT CCTTAG

[0343] With a region (lower-case letters) homologous to the sequence (1297264 -1297344) including the adhE gene initiation codon of the adhE gene (sequence 1294669 to 1297344), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid.

TABLE-US-00035 DadhEf de 100 bases (SEQ ID NO 39): ttaagcggattttttcgcttttttctcagctttagccggagcagcttct ttcttcgctgcagtttcaccttctacataatTGTAGGCTGGAGCTG CTTCG

[0344] With a region (lower-case letters) homologous to the sequence (1294693-1294748) corresponding to the downstream chromosomal sequence of the adhE gene (sequence1294669 to 1297344), a reference sequence on the website http://ecocyc.org/ and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0345] Both DadhEf and DadhEr oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the adhE gene by the chloramphenicol cassette was checked by PCR analysis using both ychGf and adhECr oligonucleotides.

TABLE-US-00036 ychGf (SEQ ID NO 40): ggctcattgcaccaccatccag (homologous to the sequence 1294357 to 1294378) adhECr (SEQ ID NO 41): gaaaagacgcgctgacaatacgcc (homologous to the sequence 1297749 to 1297772).

[0346] 4.1.2. Construction of an E. coli MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRT Modified Strain.

[0347] The adhE gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTackA-pta::FRTiscR::FRT frdABCD::FRTaceE::FRT mgsA::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0348] The Cm.sup.R transductants were selected on plate and the replacement of the adhE gene by the chloramphenicol cassette into the MG1655ldhA::FRT pflAB::FRT ackA-pta::FRTiscR ::FRT frdABCD::FRTaceE::FRT mgsA::FRT was checked by PCR analysis using both ychGf and adhECr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 iii) B2295f and YfcCR, iv) iscr1s and iscr1rv v) frdABCD1s and frdABCD1rv vi) aceEs and aceErv and vii) mgsAs and mgsArv couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, ackA-pta, iscR, frdABCD, aceE, mgsA genes respectively in the strain adhE::cm. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::cm.

[0349] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 40 and 41). The new strain was named MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT.

[0350] 4.1.3. Construction of an E. coli MG1655melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-Km modified strain

[0351] Both CA_C2712 and CA_C2708 synthetic genes encoding the crotonase and the -hydroxy-butyrylCoA dehydrogenase respectively, from Clostridium acetobutylicum were firstly designed using the method termed codon harmonization (Angov et al. 2008). Synonymous codons from E. coli that match as closely as possible the codon usage frequency used in the native genes from C. acetobutylicum were selected. Based on the generated sequences, the synthetic genes were further synthetized in operon by Life Technologies (ThermoFisher Scientific, Saint aubin, France) introducing the RBS01 region along with each gene, as well as placing two unique restriction sites upstream and downstream each gene. The synthetic crt-hbd operon was then cloned under the control of ptrc01 promoter into the pUC18-TTadc-CI*0-PlambdaR*(35)-melB::Km (Norrander et al.1983) carrying two homologous region of the melB locus and the kanamycin resistant cassette. The plasmid was digested with SmaI-BamHI and ligated with the Smal-crt-hbd-BamHI synthetic operon to yield the pUC18-TTadc-CI*0-PlambdaR*(35)-melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-Km plasmid.

[0352] Both ome1847 and ome1850 primers were then used in a single tube PCR reaction with the pUC18-TTadc-CI*0-PlambdaR*(35)-melB::TT02-Ptrc01/RBS01*2-crt-hbd-TT07-Km plasmid to amplify the TT02-ptrc01/RBS01*2-crt-hbd-TT07::Km region.

TABLE-US-00037 Ome1847 (SEQ ID No 42) TTCGTCACGGAATCGTCAGAAC Ome1850 (SEQ ID No 43) CCTGATTTATACCGGCATTTCGG

[0353] The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the melB gene by the TT02-ptrc01/RBS01*2-crt-hbd-TT07-Km cassette was checked by PCR analysis using both ome1845 and 1846rv oligonucleotides. The final strain was named MG1655 melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-Km.

TABLE-US-00038 ome1845s (SEQ ID No 44) gccgattttgtcgtggtggc (homologous to the sequence from 4340168 to 4340187) ome1846rv (SEQ ID No 45) gccggttatccatcaggttcac (homologous to the sequence from 4344065 to 4344044)

[0354] 4.1.4 Construction of an E. coli MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-FRT Modified Strain

[0355] The melB locus into the MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT E. coli strain was then replaced by the ptrc01/RBS01*2-crt-hbd-TT07::Km synthetic operon and the replacement was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972). The Km.sup.R transductants were selected on plate and the replacement of the melB gene by the ptrc01/RBS01*2-crt-hbd-TT07-Km synthetic operon into the MG1655ldhA::FRT pflAB::FRT ackA-pta::FRTiscR ::FRT frdABCD::FRTaceE::FRT mgsA::FRTadhE::FRT was checked by PCR analysis using both ome1845 and 1846rv oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 iii) B2295f and YfcCR, iv) iscr1s and iscr1rv v) frdABCD1s and frdABCD1 rv vi) aceEs and aceErv vii) mgsAs and mgsArv and viii) ychGf and adhECr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, ackA-pta, iscR, frdABCD, aceE, mgsA and adhE genes respectively in the strain melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-Km. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-Km.

[0356] The kanamycin-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Km.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 44 and 45). The new strain was named MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-FRT.

[0357] 4.1.5. Construction of an E. coli MG1655 ptrc30/RBS01*2-atoB-cm Modified Strain:

[0358] Both Ome1246 and Odi0247 oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid and introduced ptrc30 and RBS01 regions upstream the atoB gene and replace the natural promoter region.

TABLE-US-00039 Ome1246_3D r (SEQ ID 46) TGTAGGCTGGAGCTGCTTCG

[0359] Homologous to a region for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00040 Odi 0247_Ptrc30/RBS01*2-atoB R r (SEQ ID 47) CAATTTTTCATttataacctccttaTTCCACACAGTATACGAGCCGGAT GATTAATCGTCAACAGCTCCATGGTCCATATGAATATCCTCCTTA

[0360] With a region (bold letters) homologous to the sequence 2324141-2324131 of the atoB gene (sequence 2 324 131 to 2 325 315) a reference sequence on the website http://ecocyc.org/, a region (lower case letters) homologous to the RBS01*2 consensus sequence containing the Psil restriction site, a region (italic letters) containing the artficial ptrc30 promoter and a region (underlined letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid. The PCR product was then purified and used for a second PCR using both Odi0242 and 0246 oligonucleotides to increase the size of homologous regions and, finally, favour in vivo homologous recombination.

TABLE-US-00041 Odi 0242 (SEQ ID No 48) GCATCACTGCCCTGCTCTTCTCCGGTGTCATTTTCGTCATTGGTTTAAC GCTGTTCTGACGGCACCCCTACAAACAGAAGGAATATAAACTGGCTCAC CTTCGGGTGGGCCTTTCTGCTGTAGGCTGGAGCTGCTTC

[0361] With a region (bold letters) homologous to the sequence 2324042-2324130 upstream of the atoB gene (sequence 2 324 131 to 2 325 315) a reference sequence on the website http://ecocvc.org/, a region (italic letters) corresponding to the transcriptional terminator T7T of the T7 phage (Harrington et al. 2001) and a region (underlined letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid.

TABLE-US-00042 Odi 0246 (SEQ ID No 49) TTACTGTCGCCCCCAGGTCGATGGCGCTGGTGGAAGCGAGTGAACCGTT AAAACTACCGATAGCAGTACGTACCGCACTGACGATGACACAATTTTTC ATTTATAACCTCCTTA

[0362] With a region (bold letters) homologous to the sequence 2324230-2324131 of the atoB gene (sequence 2 324 131 to 2 325 315) a reference sequence on the website http://ecocyc.org/ and a region (underlined letters) homologous to the RBS01*2 consensus sequence containing the Psil restriction site.

[0363] The second amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the natural promoter region of the atoB gene by the ptrc01/RBS01*2-cm cassette was checked by PCR analysis using both atoBs and atoBrvoligonucleotides. The final strain was named MG1655 MG1655 ptrc30/RBS01*2-atoB-cm.

TABLE-US-00043 atoBs (SEQ ID No 50) gcgcggcagcacgcagtac (homologous to the sequence 2323667 to 2323685) atoBrv (SEQ ID No 51) cgcacatcaggccatcgcgc (homologous to the sequence 2324584 to 2324565)

[0364] 4.1.6. Construction of an E. coli MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-Ptrc01/RBS01*2-crt-hbd-TT07::FRT ptrc30/RBS01*2-atoB-:FRT modified strain The natural promoter region of the atoB gene was then replaced by the artificial ptrc01/RBS01*2 region into the MG1655ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-Ptrc01/RBS01*2-crt-hbd-TT07-FRT and the replacement was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0365] The Cm.sup.R transductants were selected on plate and the replacement of the natural promoter region by the ptrc01/RBS01*2 artificial region into the MG1655ldhA::FRT pflAB::FRT ackA-pta::FRTiscR ::FRT frdABCD::FRTaceE::FRT mgsA::FRTadhE::FRTmelB::TT02-Ptrc01/RBS01*2-crt-hbd-TT07-FRT was checked by PCR analysis using both atoBs and atoBrv oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 iii) B2295f and YfcCR, iv) iscr1s and iscr1rv v) frdABCD1s and frdABCD1 rv vi) aceEs and aceErv vii) mgsAs and mgsArv viii) ychGf and adhECr and ix) ome1845 and 1846rv couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, ackA-pta, iscR, frdABCD, aceE, mgsA and adhE genes respectively and the crt-hbd expression in the ptrc30/RBS01*2-atoB-cm strain. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-FRT ptrc30/RBS01*2-atoB-cm.

[0366] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 50 and 51). The new strain was named MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07-FRT ptrc30/RBS01*2-atoB-FRT.

[0367] 4.2. Construction of pSC101_pGI-cac2229-cac0764-cac0303_pth1-cap0035-cac2711-cac2710-cac2709 Expression Vector:

[0368] Four CA_P0035, CA_C2711, CA_C2710, CA_C2701 synthetic genes encoding the bifunctionnal butyraldehyde and butanol dehydrogenase NADH dependent AdhE2, the butyrylCoA dehydrogenase, the electron transfer flavoproteins B and A respectively, from Clostridium acetobutylicum were firstly designed using the method termed codon harmonization (Angov et al. 2008). Synonymous codons from E. coli that match as closely as possible the codon usage frequency used in the native genes from C. acetobutylicum were selected. Based on the generated sequences, the synthetic genes were further synthetized by Life Technologies (ThermoFisher Scientific, Saint aubin, France) introducing the RBS region along with each gene, as well as placing two unique restriction sites upstream and downstream each gene. The CA_C2711, CA_C2710 and CA_C2701 were synthesized as an operon and the adhE2 was synthesized independently.The synthetic adhE2 gene was firstly inserted into the pSOS95 plasmid (Genbank accession number AY187686.1) between the BamHI site located downstream the thl promoter and the SfoI site, located upstream the adc terminator. The bcd-etfB-etfA synthetic artificial operon was then introduced into the pSOS95-adhE2 between the XhoI site located downstream the adhE2 gene and the SfoI site, located upstream the adc terminator to yield the pSOS95 adhE2-bcd-etfB-etfA plasmid. The pSOS95 adhE2-bcd-etfB-etfA plasmid was then digested with SalI and the operon containing fragment was purified on agarose gel before to be ligated to the pSC101_pGI-cac2229-cac0764-cac0303 plasmid pre-digested with SalI, yielding the 15.4 kb pSC101-pGI-cac2229-cac0764-cac0303-pthl-cap0035-cac2711-cac2710-cac2709 plasmid.

[0369] 4.3. Construction of pSC101_pGI-cac2229-cac0764-cac0303-udhA_pthl-cap0035-cac2711-cac2710-cac2709 Expression Vector:

[0370] The udhA gene was amplified from the genomic DNA of E. coli MG1655 using primers udhA-NheIf and udhA-xma1r. The primers were designed to introduce a RBS region along with the udhA gene, as well as placing NheI and XmaI restriction sites upstream and downstream respectively:

TABLE-US-00044 udhA-NheIf:(SEQIDNo52): AATTGCTAGCATTATATACAAGGAGGAAACAGCTATGCCACATTCCTACG ATTACGATG udhA-xma1r:(SEQIDNo53) AATTCCCGGGATAATTTTAAAACAGGCGGTTTAAACCGTTTAAC

[0371] The amplified PCR fragment was then subcloned into a Zero Blunt TOPO vector (Invitrogen, Saint Aubin, France) to yield the Zero Blunt TOPO-udhA plasmid and sequenced using universal primers T7P and T3P to assure that no mutations were introduced. The fragment containing the udhA gene was purified on an agarose gel after digestion of the Zero Blunt TOPO-udhA vector with NheI and XmaI. The 15.4 kb pSC101_pGI-cac2229-cac0764-cac0303_pThl-cap0035-cac2711-cac2710-cac2709 expression vector was also digested with NheI and XmaI and ligated to the NheI-XmaI digested udhA fragment, yielding the 16.8 kb pSC101_pGI-cac2229-cac0764-cac0303-udhA_pthl-cap0035-cac2711-cac2710-cac2709 vector.

[0372] 4.4. Introduction of the pSC101_pGI-cac2229-cac0764-cac0303-udhA_pthl-cap0035-cac2711-cac2710-cac2709 expression vector into the E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-Ptrc01/RBS01*2-crt-hbd-TT07::FRT ptrc30/RBS01*2-atoB::FRT Modified Strain.

[0373] The pSC101_pGI-cac2229-cac0764-cac0303-udhA_pthl-cap0035-cac2711-cac2710-cac2709 expression vector was used to transform the E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT adhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07::FRT ptrc30/RBS01*2-atoB::FRT modified strain by electroporation (Sambrook and Russel 2001).

[0374] The transformants were selected on LB agar plates supplemented with spectinomycin (70 g/ml) at 37 C. Some transformants were then grown in LB liquid culture supplemented with spectinomycin (100 g/ml) overnight at 37 C. to carry out a DNA plasmid extraction (GenElute HP plasmid miniprep kit, Sigma) and check for the presence of the pSC101_pGI-cac2229-cac0764-cac0303-udhA_pthl-cap0035-cac2711-cac2710-cac2709 plasmid. The pSC101_pGI-cac2229-cac0764-cac0303-udhA_pthl-cap0035-cac2711-cac2710-cac2709 plasmid was finally controlled by restriction profile.

[0375] The final E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07::FRT ptrc30/RB SO1*2-atoB::FRT (pSC101_pGI-cac2229-cac0764-cac0303-udhA_pthl-cap0035-cac2711-cac2710-cac2709) was grown in LB liquid medium supplemented with spectinomycin (100 g/ml) and kept in 20% glycerol solution at 80 C.

[0376] 4.5. : Physiological Characterization of the E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07::FRT ptrc30/RBS01*2-atoB::FRT pSC101_PGI-cac2229-cac0764-cac0303-udhA_PThl-cap0035-cac2711-cac2710-cac2709 modified strain.

[0377] The E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-Ptrc01/RBS01*2-crt-hbd-TT07::Km ptrc30/RBS01*2-atoB::cm pSC101_pGI-cac2229-cac0764-cac0303-udhApthl-cap0035-cac2711-cac2710-cac2709 strain was grown anaerobically on a 20 g/L glucose mineral medium containing minerals salts as previously described (Meynial-salles et al. 2005) supplemented with 4 g/l of yeast extract, 5 mM nitrate and spectinomycin (100 g/ml) and inoculated with 100 l of a LB overnight culture. Cells were grown up at 37 C. during several days, and the pH was maintained by buffering the culture medium with MOPS. As a control, the E.coli MG1655 ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTa dhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07::FRT ptrc30/RBS01*2-atoB::FRT strain was grown in the same conditions.

[0378] The comparative phenotypic analysis was performed by measuring both glucose consumption as well as the concentration of fermentation products for the culture of each strain as is shown in table 4:

TABLE-US-00045 Glucose consumption Products yield (% g/g glucose consumed) Strains (g/l) Butanol Succinate Lactate Butyrate Acetate Ethanol Pyruvate CO.sub.2 MG1655ldhA::FRTpflAB:: 2.53 0 5.30 0 10.27 0 12.25 62 16.9 FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRTadhE:: FR TmelB::TT02- Ptrc01/RBS01*2-crt-hbd- TT07ptrc30/RBS01*2-atoB MG1655ldhA::FRTpflAB:: 32 29.54 0.65 0.4 4.71 0.46 2.88 0.37 7 FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRTadhE:: FRTmelB::TT02- Ptrc01/RBS01*2-crt-hbd- TT07ptrc30/RBS01*2-atoB pSC101_PGI-cac2229-cac0764- cac0303-udhA_pthl-cap0035- cac2711-cac2710-cac2709

[0379] As shown in table 4, the expression of the both synthetic CA_C2229-CA_C0764-CA C0303 and CA P0035-CA C2711-CA C2710-CA C2709 operons into the MG1655ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA ::FRTadhE::FRTmelB::TT02-Ptrc01/RBS01*2-crt-hbd-TT07ptrc30/RBS01*2-atoB E.coli strain led to the production of butanol as the main fermentation product from glucose at a yield of 0.3 g/g glucose consumed corresponding to 73% of the theoretical yield. Moreover, the expression of the both synthetic CA_C2229-CA_C0764-CA_C0303 and CA _P0035-CA_C2711-CA_C2710-CA_C2709 operons, favoured the growth which was strongly hampered in the control strain (without plasmid).

[0380] 4.6 : Ferredoxin NADP+ Reductase Activity Determination in the the E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07::FRT ptrc30/RBS01*2-atoB::FRT pSC101_PGI-cac2229-cac0764-cac0303-udhA_PThl-cap0035-cac2711-cac2710-cac2709 Modified Strain.

[0381] The E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT melB::TT02-Ptrc01/RBS01*2-crt-hbd-TT07::Km ptrc30/RBS01*2-atoB::cm pSC101_pGI-cac2229-cac0764-cac0303-udhA_pthl-cap0035-cac2711-cac2710-cac2709 strain was grown anaerobically on a 20 g/L glucose mineral medium containing minerals salts as previously described (Meynial-salles et al. 2005) supplemented with 4 g/l of yeast extract, 5 mM nitrate and spectinomycin (100 g/ml) and inoculated with 100 l of a LB overnight culture. Cells were grown up at 37 C. up to an approximatively OD.sub.550nm of 2, and the pH was maintained by buffering the culture medium with MOPS. As a control, the E.coli MG1655 ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTa dhE::FRT melB::TT02-ptrc01/RBS01*2-crt-hbd-TT07::FRT ptrc30/RBS01*2-atoB::FRT strain was grown in the same conditions.

[0382] Cells were transferred into anaerobic chamber, harvested, washed and 20 times concentrated in 100 mM Tris-HCl 2 mM DTT 10% glycerol (pH 7.6) buffer, frozen at 80 C. or immediately used. Cells were further broken by sonication using an ultrasonic disintegrator (vibracell 72434, Bioblock) at 4 C. in four cycles of 30 sec with 2-min intervals. Debris were removed by centrifugation at 8600 g for 10 min, 4 C. (Sigma centrifuge 2-16K) and the acellular crude extract was loaded onto a SephadexG25 column to eliminate salts and metabolites, before the ferredoxin NADP.sup.+ reductase activity determination using ferredoxin as a substrate and following the procedure already described in 1.1 (table D).

TABLE-US-00046 TABLE D Ferredoxin NADP.sup.+ reductase specific activities determined on crude extracts using ferredoxin as a substrate: Ferredoxin NADP.sup.+ reductase Strains specific activity U/mg protein MG1655ldhA::FRTpflAB:: 0 FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRTadhE:: FR TmelB::TT02-Ptrc01/ RBS01*2-crt-hbd-TT07ptrc30/ RBS01*2-atoB MG1655ldhA::FRTpflAB:: 0.11 FRTackA-pta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRTadhE:: FRTmelB::TT02-Ptrc01/ RBS01*2-crt-hbd-TT07 ptrc30/ RBS01*2-atoBpSC101_PGI- cac2229-cac0764-cac0303- udhA_pthl-cap0035-cac2711- cac2710-cac2709

[0383] As shown in table D, a ferredoxin NADP.sup.+ reductase activity is only detected into the E. coli modified strain expressing the CA_C0764 encoding gene.

Example 5

Heterologous Production of 1, 3 Propanediol from Glycerol by a new Metabolic Pathway in an E. coli Strain with an Enhanced Ferredoxin NADP Reductase Activity.

[0384] 5.1: construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT, mgsA::FRT adhE::FRT, aldA::FRT, aldB::FRT, glpD::FRT, glpA::FRT Modified Strain

[0385] 5.1.1: Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT Modified Strain:

[0386] The iscR gene was then replaced with a kanamycin resistance cassette into the MG1655 ldhA::FRTpflAB::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655iscR::km strain (see 3.1.7).

[0387] The Km.sup.R transductants were selected on plate and the replacement of the iscR gene by the kanamycin cassette into the MG1655dhA::FRTpflAB::FRT was checked by PCR analysis using both iscrs and iscr1rv oligonucleotides. Finally, i) hslJC and ldhAC2 and ii) pFLAB1 and pflAB2 couple of primers were also used in PCR analysis to confirm the deletion of ldhA and pflAB genes respectively in the strain iscR::km. The resulting strain was named MG1655 ldhA::FRTpflAB::FRT iscR::km.

[0388] The kanamycin-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Km.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 24 and 25). The new strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRT.

[0389] 5.1.2: Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT Modified Strain:

[0390] The frdABCD genes were then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRTpflAB::FRTiscR::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655frdABCD::cm E. coli strain (see 3.1.9).

[0391] The CmR transductants were selected on plate and the replacement of the frdABCD genes by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR::FRT was checked by PCR analysis using both frdABCD1s and frdABCD1 rv oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 and iii) iscr1s and iscr1rv couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB and iscR genes respectively, in the strain frdABCD::cm. The resulting strain was named MG1655ldhA::FRT pflAB::FRiscR::FRTfrdABCD::cm.

[0392] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 28 and 29). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT.

[0393] 5.1.3: Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT Modified Strain:

[0394] The aceE gene was then replaced with a kanamycin resistance cassette into the MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655.Math.aceE:: km E. coli strain (see 3.1.11).

[0395] The km.sup.R transductants were selected on plate and the replacement of the aceE gene by the kanamycin cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRT was checked by PCR analysis using both aceEs and aceErv oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2 iii) iscr1s and iscr1rv and iv) frdABCD1s and frdABCD1 rv primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR and frdABCD genes respectively in the strain aceE::km. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTiscR::FRTaceE::km.

[0396] The kanamycin-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Km.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 32 and 33). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT aceE::FRT.

[0397] 5.1.4.: Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT, mgsA::FRT Modified Strain:

[0398] The mgsA gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655mgsA::cm E. coli strain (see 3.1.13).

[0399] The Cm.sup.R transductants were selected on plate and the replacement of the mgsA gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRTaceE::FRT was checked by PCR analysis using both mgsAs and mgsArv oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv iv) frdABCD1s and frdABCD1 rv and v) aceEs and aceErv couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD and aceE genes respectively in the strain mgsA::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::cm.

[0400] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 36 and 37). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRT.

[0401] 5.1.5.: Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT, mgsA::FRT adhE::FRT Modified Strain:

[0402] The adhE gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRT mgsA::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655adhE::cm E. coli strain (see 4.1.1).

[0403] The Cm.sup.R transductants were selected on plate and the replacement of the adhE gene by the chloramphenicol cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRTmgsA::FRT was checked by PCR analysis using both ychGf and adhECr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv, iv) frdABCD1s and frdABCD1rv, v) aceEs and aceErv and vi) mgsAs and mgsArv couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE and mgsA genes respectively in the strain AadhE::cm. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::cm.

[0404] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 36 and 37). The new strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRT.

[0405] 5.1.6.: Construction of a E. coli MG1655 aldA::FRT-cm-FRT Modified Strain:

[0406] The aldA gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0407] Two oligonucleotides were designed and used to replace the aldA gene:

TABLE-US-00047 1-AldADfconsistingof100bases(SEQIDNo54) atgtcagtacccgttcaacatcctatgtatatcgatggacagtttgttac ctggcgtggagacgcatggattgatgtggtaGTGTAGGCTGGAGCTGCTT CG

[0408] With a region (lower-case letters) homologous to the sequence (1486256-1486336) including the aldA gene initiation codon of the aldA gene (sequence 1486256 to 1487695), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00048 2-aldADrconsistingof100bases(SEQIDNo55): ttaagactgtaaataaaccacctgggtctgcagatattcatgcaagccat gtttaccatctgcgccgccaataccggatttCATATGAATATCCTCCTTA G

[0409] With a region (lower-case letters) homologous to the sequence (1487615-1487695) corresponding to the C terminal part encoding sequence of the including the stop codon aldA gene (1486256 to 1487695), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid. Both oligonucleotides AldADr and aldADf were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the aldA gene by the chloramphenicol cassette was checked by PCR analysis using both Ydc F C f and gapCCr oligonucleotides.

TABLE-US-00049 3.YdcFCf(SEQIDNO56): tgcagcggcgcacgatggcgacgttccgccg(homologoustothe sequence1485722to1485752) 4.gapCCr(SEQIDNO57): cacgatgacgaccattcatgcctatactggc(homologoustothe sequence1488195to1488225)

[0410] 5.1.7.: Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT, mgsA::FRT adhE::FRTaldA::FRT Modified Strain:

[0411] The aldA gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRT mgsA::FRT.Math.adhE::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0412] The Cm.sup.R transductants were selected on plate and the replacement of the adhE gene by the chloramphenicol cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRTmgsA::FRTadhE::FRT was checked by PCR analysis using both Ydc F C f and gapCCr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv, iv) frdABCD1s and frdABCD1rv, v) aceEs and aceErv vi) mgsAs and mgsArv and vii) ychGf and adhECr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE, mgsA and adhE genes respectively in the strain aldA::cm. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTald A::cm.

[0413] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 56 and 57). The new strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTaldA ::FRT 5.1.8.: Construction of a E. coli MG1655 aldB::FRT-cm-FRT Modified Strain:

[0414] The aldB gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0415] Two oligonucleotides were designed and used to replace the aldB gene:

TABLE-US-00050 1-AldBDfconsistingof100bases(SEQIDNo58) tcagaacagccccaacggtttatccgagtagctcaccagcaggcacttgg tttgctggtaatgaccagcatcatcttgtGTGTAGGCTGGAGCTGCTTCG

[0416] With a region (lower-case letters) homologous to the sequence (3752996 to 3753075) of the aldB gene (sequence 3752996 3754534), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00051 2-AldBDrconsistingof100bases(SEQIDNo59): atgaccaataatcccccttcagcacagattaagcccggcgagtatggttt ccccctcaagttaaaagcccgctatgacaaCATATGAATATCCTCCTTAG

[0417] With a region (lower-case letters) homologous to the sequence (3754455 to 3754534) of the aldB gene (sequence 3752996 3754534), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid.

[0418] Both oligonucleotides AldBDr and aldBDf were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the aldB gene by the chloramphenicol cassette was checked by PCR analysis using both aldBCf et YiaYCr oligonucleotides.

TABLE-US-00052 3-aldBCf(SEQIDNO60): catatttccacaaagaatataaaaaagaacaattaacgc (homologoustothesequence3752449to3752488) 4-YiaYCr(SEQIDNO61): tatgttcatgcgatggcgcaccagagggcg(homologoustothe sequence3755040to3755070)

[0419] 5.1.9.: Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT mgsA::FRT adhE::FRTaldA::FRTaldB ::FRT Modified Strain:

[0420] The aldB gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRT mgsA::FRT adhE::FRT aldA::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972). The Cm.sup.R transductants were selected on plate and the replacement of the adhE gene by the chloramphenicol cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTaldA::FRT was checked by PCR analysis using both aldBCf and YiaYCr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv, iv) frdABCD1s and frdABCD1rv, v) aceEs and aceErv vi) mgsAs and mgsArv vii) ychGf and adhECr and viii)Ydc F C f and gapCCr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE, mgsA adhE and aldA genes respectively in the strain AaldB::cm. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTald A::FRTaldB::cm.

[0421] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 60 and 61). The new strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTaldA ::FRTaldB::FRT.

[0422] 5.1.6.: Construction of a MG1655 glpD::FRT-cm-FRT E. coli Modified Strain:

[0423] The glpD gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0424] Two oligonucleotides were designed and used to replace the glpD gene:

TABLE-US-00053 1-DglpDfconsistingof100bases(SEQIDNo62): atggaaaccaaagatctgattgtgatagggggcggcatcaatggtgctgg tatcgcggcagacgccgctggacgcggtttCATATGAATATCCTCCTTAG

[0425] With a region (lower-case letters) homologous to the sequence (3560036-3560115) including the glpD gene initiation codon of the glpD gene (sequence 3560036 to 3561541), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00054 2-DglpDrconsistingof100bases(SEQIDNo63): ttacgacgccagcgataacctctgctgcgtatactccaccagccactgac tcacacgagattgttgatccgcatttagccTGTAGGCTGGAGCTGCTTCG

[0426] With a region (lower-case letters) homologous to the sequence (3561462-3561541) corresponding to the C terminal part encoding sequence of the including the stop codon glpD gene (3560036 to 3561541), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0427] Both oligonucleotides DglpDr and DglpDf were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the glpD gene by the chloramphenicol cassette was checked by PCR analysis using both glpDCf and glpDCr oligonucleotides.

TABLE-US-00055 3-glpDCf(SEQIDNo64): cgttaatacattcgaactgatcc(homologoustothe sequence3559822to3559844) 4-glpDCr(SEQIDNo65): gcgtgggctttgcggtaattccc(homologoustothe sequence3561750to3561772)

[0428] 5.1.7: construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRTaceE::FRT,mgsA::FRTadhE::FRTaldA::FRTaldB::FRTglpD::FRT E. coli Modified Strain:

[0429] The glpD gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRT mgsA::FRT adhE::FRT aldA::FRTaldB::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0430] The Cm.sup.R transductants were selected on plate and the replacement of the glpD gene by the chloramphenicol cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::FRT was checked by PCR analysis using both glpDCf and glpDCr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv, iv) frdABCD1s and frdABCD1rv, v) aceEs and aceErv vi) mgsAs and mgsArv vii) ychGf and adhECr viii)Ydc F C f and gapCCr and ix) aldBCf and YiaYCr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE, mgsA, adhE, aldA, aldB, genes respectively in the strain AglpD::cm. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTald A::FRTaldB::FRTglpD::cm.

[0431] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 64 and 65). The new strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::FRTglpD::FRT.

[0432] 5.1.8.: Construction of a E. coli MG1655 glpA::FRT-cm-FRT Modified Strain:

[0433] The glpA gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0434] Two oligonucleotides were designed and used to replace the glpA gene:

TABLE-US-00056 D1 1-DglpAfconsistingof100bases(SEQIDNo66): atgaaaactcgcgactcgcaatcaagtgacgtgattatcattggcggcgg cgcaacgggagccgggattgcccgcgactgCATATGAATATCCTCCTTAG

[0435] With a region (lower-case letters) homologous to the sequence (2350669-2350748) including the glpA gene initiation codon of the glpA gene (sequence 2350669 to 2352297), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00057 2-DglpArconsistingof100bases(SEQIDNo67): tcaaagcgcatattctgctccttaccagaccacacaatccctgataaacc cagcgggtaaattcgctttcgcgcaGTGTAGGCTGGAGCTGCTTCG

[0436] With a region (lower-case letters) homologous to the sequence (2352297-2352220) corresponding to the C terminal part encoding sequence of the including the stop codon of glpA gene (2350669 to 2352297), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0437] Both oligonucleotides DglpAr and DglpAf were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the glpA gene by the chloramphenicol cassette was checked by PCR analysis using both glpACf and glpACr oligonucleotides.

TABLE-US-00058 3-glpACf(SEQIDNo68): ttagcctccgttgcgttcttgc(homologoustothesequence 2349038to2349052) 4-glpACr(SEQIDNo69): gccgcccataatgacagtatcaaagcgc(homologoustothe sequence2352316to3352289)

[0438] 5.1.9: Construction of an E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRTace::FRT,mgsA::FRTadhE::FRTaldA::FRTaldB::FRTglpD::FRT glpA::FRT Modified Strain:

[0439] The glpA gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRT mgsA::FRT adhE::FRT aldA::FRTaldB::FRTglpD::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972).

[0440] The Cm.sup.R transductants were selected on plate and the replacement of the glpA gene by the chloramphenicol cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRT frdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::FRTglpD::FRT was checked by PCR analysis using both glpACf and glpACr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv, iv) frdABCD1s and frdABCD1rv, v) aceEs and aceErv vi) mgsAs and mgsArv vii) ychGf and adhECr viii)Ydc F C f and gapCCr ix) aldBCf and YiaYCr and x) glpDCf and glpDCr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE, mgsA, adhE, aldA, aldB, glpD genes respectively in the strain AglpA::cm. The resulting strain was named MG1655 ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTald A::FRTaldB::FRTglpD::FRTglpA::cm.

[0441] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 68 and 69). The new strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::FRTglpD::FRTglpA::FRT.

[0442] 5.2. Construction of the pSC101- pGI-cac2229-cac0764-cac0303-pntAB Expression Vector

[0443] The pntAB genes were amplified from the genomic DNA of E. coli MG1655 using primers pntA-NheIf and pntB-xma1r. The primers were designed to introduce a RBS region along with the pntA gene, as well as placing NheI and XmaI restriction sites upstream pntA and downstream pntB respectively:

TABLE-US-00059 pntAA-NheIf:(SEQIDNo70): AATT ATTATATACA AAACAGCTatgcgaattggcataccaagagaacg g pntB-xma1r:(SEQIDNo71) AATT ATAATTttacagagctttcaggattgc

[0444] The amplified PCR fragment was then subcloned into a Zero Blunt TOPO vector (Invitrogen, Saint Aubin, France) to yield the Zero Blunt TOPO-pntAB plasmid and sequenced using universal primers T7P and T3P to assure that no mutations were introduced. The fragment containing the pntAB genes was purified on an agarose gel after digestion of the Zero Blunt TOPO-pntAB vector with NheI and XmaI. The 9.54 kb pSC101_pGI-cac2229-cac0764-cac0303 expression vector (3.2) was also digested with NheI and XmaI and ligated to the NheI-XmaI digested pntAB fragment, yielding the 12.5 kb pSC101_pGI-cac2229-cac0764-cac0303-pntAB vector.

[0445] 5.3. Construction of the pSC101- pGI-cac2229-cac0764-cac0303-pntAB_pthl-dhaB1-dhaB2-yqhD Expression Vector

[0446] Both dhAB1 and dhaB2 genes were amplified from the pSPD5 plasmid (Meynial-SalIes et al. 2005) using primers pdhaB1 and pdhaB2. The primers were designed to introduce a RBS region along with the dhaB1 gene, as well as placing BamHI and XhoI restriction sites upstream dhAB1 and downstream dhaB2 respectively:

TABLE-US-00060 pdhaB1f:BamHI-RBSdhaB1(SEQIDNo72) ggatccgtgattggaggagtaaaaatgataagtaaagg pdhaB2r:XhoI-dhaB2(SEQIDNo73) CTCGAGttactcagctccaattgtgcacggtattcccat

[0447] The amplified PCR fragment was then subcloned into a Zero Blunt TOPO vector (Invitrogen, Saint Aubin, France) to yield the Zero Blunt TOPOdhaB1-dhaB2 plasmid and sequenced using universal primers T7P and T3P to assure that no mutations were introduced. The fragment containing the dhaB1-dhaB2 genes was purified on an agarose gel after digestion of the Zero Blunt TOPOdhaB1-dha2 vector with BamHI and XhoI.

[0448] The yqhD gene was amplified from genomic DNA of E. coli MG1655 using primers pyqhD1 and pyqhD2. The primers were designed to introduce the RBS01 region along with the yqhD gene, as well as placing XhoI and SfoI restriction sites upstream and downstream respectively:

TABLE-US-00061 pyqhD1: XhoI RBS01 yqhD (SEQ ID No74) CTCGAGttataacctccttaatgaacaactttaatctgcacaccccaacc cgcattct pyqhD2: SfoI-yqhDrv (SEQ ID No75) GGCGCCttagcgggcggcttcgtatatacggcggctgacat

[0449] The amplified PCR fragment was then subcloned into a Zero Blunt TOPO vector (Invitrogen, Saint Aubin, France) to yield the Zero Blunt TOPO-yqhD plasmid and sequenced using universal primers T7P and T3P to assure that no mutations were introduced. The fragment containing the yqhD gene was purified on an agarose gel after digestion of the Zero Blunt TOPO-yqhD vector with XhoI and SfoI.

[0450] The 7 kb pSOS95 plasmid (Genbank accession number AY187686.1) was digested with BamHI (located downstream the thl promoter) and SfoI (located upstream the adc terminator) and ligated to both the BamHI-XhoI dhaB1 dhaB2 and XhoI-SfoI yqhD fragments to yield the pSOS95 pthl-dhaB1-dhaB2-yqhD plasmid. The pSOS95 pthl-dhaB1-dhaB2-yqhD plasmid was then digested with SalI and the operon containing fragment was purified on agarose gel before to be ligated to the pSC101_pGI-cac2229-cac0764-cac0303-pntAB plasmid pre-digested with SalI (5.2.), yielding the pSC101-pGI-cac2229-cac0764-cac0303-pntAB-pthl- dhaB1-dhaB2-yqhD plasmid.

[0451] 5.4. Introduction of the pSC101-pGI- cac2229-cac0764-cac0303-pntAB_pthl-dhaB1-dhaB2-yqhD expression vector into the MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTaceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::FRTglpD:: FRTglpA::FRT.

[0452] The pSC101-pGI-cac2229-cac0764-cac0303-pntAB_pthl-dhaB1-dhaB2-yqhD expression vector was used to transform the MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTaceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::FRTglpD::F RTglpA::FRT by electroporation (Sambrook and Russel 2001). The transformants were selected on LB agar plates supplemented with spectinomycin (70 g/ml) at 37 C. Some transformants were then grown in LB liquid culture supplemented with spectinomycin (100 g/ml) overnight at 37 C. to carry out a DNA plasmid extraction (GenElute HP plasmid miniprep kit, Sigma) and check for the presence of the plasmid. The pSC101-pGI- cac2229-cac0764-cac0303-pntAB_pthl-dhaB1-dhaB2-yqhD plasmid was finally controlled by restriction.

[0453] The final E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRT aceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::FRTglpD::FRTglpA::FRT. pSC101-pGI- cac2229-cac0764-cac0303-pntAB_pthl-dhaB1-dhaB2-yqhD was grown in LB liquid medium supplemented with spectinomycin (100 g/ml) and kept in 20% glycerol solution at 80 C.

[0454] 5.5. Physiological Characterization of the E. coli MG1655 ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FR T adhE::FRTaldA::FRTaldB::FRTglpD::FRTglpA::FRTpSC101-pGI- cac2229-cac0764-cac0303-pntAB_pthl-dhaB1-dhaB2-yqhD modified strain.

[0455] The E. coli MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::F RTglpD::FRTglpA::FRT pSC101-pGI- cac2229-cac0764-cac0303-pntAB_pthl-dhaB1-dhaB2-yqhD strain was grown anaerobically on a 20 g/L glycerol mineral medium containing minerals salts as previously described (Meynial-salles et al. 2005) supplemented with 4 g/l of yeast extract, 5 mM sodium nitrate and spectinomycin (100 g/ml) and inoculated with 100 l of a LB overnight culture. Cells were grown up at 37 C. during several days, and the pH was maintained by buffering the culture medium with MOPS. As a control, the E. coli MG1655ldhA::FRTpflAB::FRTackApta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA ::FRTadhE::FRTaldA::FRTaldB::FRTglpD::FRTglpA::FRT strain was grown in the same conditions.

[0456] The comparative phenotypic analysis was performed by measuring both glycerol consumption as well as the concentration of fermentation products for the culture of each strain as is shown in table 5:

TABLE-US-00062 Glycerol consumption Concentration (g/L) Strains (g/l) 1.3 propanediol Acetate E. coli 1.2 0 0.1 MG1655ldhA::FRTpflAB:: FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRTadhE:: FRTaldA::FRTaldB:: FRTglpD::FRTglpA::FRT E.coli 23 13.8 3.9 MG1655ldhA::FRTpflAB:: FRTackApta::FRTiscR:: FRTfrdABCD::FRTaceE:: FRTmgsA::FRTadhE:: FRTaldA::FRTaldB:: FRTglpD::FRTglpA:: FRT pSC101-pGI-cac2229- cac0764-cac0303-pntAB pthl-dhaB1-dhaB2-yqhD

[0457] As shown in table 5, the expression of the both CA_C2229-CA_C0764-CA_C0303-pntAB and dhaB1-dhaB2-yqhD operons into the MG1655 ldhA::FRTpflAB::FRTackA-pta::FRTiscR::FRTfrdABCD::FRTaceE::FRTmgsA::FRTadhE::FRTaldA::FRTaldB::F RTglpD::FRTglpA::FRT E.coli led to the production of 1.3 propanediol and acetate as the main fermentation products from glycerol. Moreover, the expression of both CA_C2229-CA_C0764-CA_C0303-pntAB and dhaB1-dhaB2-yqhD operons favoured the growth which was strongly hampered in the control strain.

Example 6

Heterologous Production of 1, 2 Propanediol by a new Metabolic Pathway in an E. coli Strain with an Enhanced Ferredoxin NADP Reductase Activity.

[0458] 6.1: Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT, tpiA::FRT adhE::FRT, aldA::FRT, aldB::FRT, gloA::FRT, hchA::FRT Modified Strain

[0459] 6.1.1. Construction of an E. coli MG1655tpiA::cm Modified Strain:

[0460] The tpiA gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0461] Two oligonucleotides were designed and used to replace the tpiA gene:

TABLE-US-00063 DtpiAr consisting 100 bases (SEQ ID No76): atgcgacatcctttagtgatgggtaactggaaactgaacggcagccgcca catggttcacgagctggtttctaacctgcgtaCATATGAATATCCTCCTT AG

[0462] With a region (lower-case letters) homologous to the sequence (4109530-4109449) including the tpiA gene initiation codon of the tpiA gene (sequence 4108763 to 4109530), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00064 DtpiAf consisting of 100 bases (SEQ ID No 77): Cttaagcctgtttagccgcttctgcagctttaacgattactgcgaaggcg tcagctttcagagaagcaccaccaaccagcTGTAGGCTGGAGCTGCTTCG

[0463] With a region (lower-case letters) homologous to the sequence (4108762-4108841) corresponding to the C terminal part encoding sequence of the including the stop codon tpiA gene (4108763 to 4109530), a reference sequence on the website http:ilecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0464] Both DtpiAr and DtpiAf oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the tpiA gene by the chloramphenicol cassette was checked by PCR analysis using both cdh and YIIQ oligonucleotides.

TABLE-US-00065 cdh (SEQ ID No78): ggtgatgatagttatcgccg (homologous to the sequence 4107979 to 4107998) YIIQ (SEQ ID No79): cgtgccatcgacagcagtcc (homologous to the sequence 4110023 to 4110042)

[0465] 6.1.2. Construction of a E. coli MG16554ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT, tpiA::FRT Modified Strain:

[0466] The tpiA gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRT strain (see 5.1.3) and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655tpiA::cm E. coli strain.

[0467] The Cm.sup.R transductants were selected on plate and the replacement of the tpiA gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRTaceE::FRT was checked by PCR analysis using both cdh and YIIQ oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rviv) frdABCD1s and frdABCD1 rv and v) aceEs and aceErv couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD and aceE genes respectively in the strain tpiA::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::cm.

[0468] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 78 and 79). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT.

[0469] 6.1.3. Construction of a E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT, tpiA::FRTadhE::FRT Modified Strain:

[0470] The adhE gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655adhE::cm E. coli strain (see 4.1.1).

[0471] The Cm.sup.R transductants were selected on plate and the replacement of the adhE gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRTaceE::FRTTpiA::FRT was checked by PCR analysis using both ychGf and adhECr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv iv) frdABCD1s and frdABCD1rv v) aceEs and aceErv and vi) cdh and YIIQ couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE and tpiA genes respectively in the strain adhE::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRTadhE::cm.

[0472] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 40 and No 41). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT.

[0473] 6.1.4. Construction of an E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT, frdABCD::FRT aceE::FRT, tpiA::FRTadhE::FRT aldA::FRT Modified Strain:

[0474] The aldA gene was then replaced with a chloramphenicol resistance cassette into the

[0475] MG1655ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRT tpiA::FRT adhE::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655aldA::cm E. coli strain (see 5.1.6).

[0476] The Cm.sup.R transductants were selected on plate and the replacement of the aldA gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT was checked by PCR analysis using both YdcFCF and gapCCr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv iv) frdABCD1s and frdABCD1 rv v) aceEs and aceErv vi) cdh and YIIQ and vii) ychGf and adhECr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, ace, tpiA and adhE genes respectively in the strain aldA::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRTaldA: :cm.

[0477] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 56 and No 57). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRTaldA::FRT.

[0478] 6.1.5. Construction of an E. coli MG1655ldhA::FRT, pflAB::FRT, iscR::FRT,frdABCD::FRTaceE::FRT,tpiA::FRTadhE::FRT aldA::FRT aldB::FRT Modified Strain:

[0479] The aldB gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655aldB::cm E. coli strain (see 5.1.8).

[0480] The Cm.sup.R transductants were selected on plate and the replacement of the aldB gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT aldA::FRT was checked by PCR analysis using both aldBCf and YiaYCr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv iv) frdABCD1s and frdABCD1rv v) aceEs and aceErv vi) cdh and YIIQ, ychGf and adhECr and vii) YdcFCF and gapCCr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE, tpiA adhE and aldA genes respectively in the strain aldB::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRTaldA: :FRTaldB::cm.

[0481] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 60 and No 61). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::F RTaldA::FRTaldB::FRT.

[0482] 6.1.6 Construction of an E. coli MG1655gloA::FRT-cm-FRT Modified Strain:

[0483] The gloA gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

TABLE-US-00066 Two oligonucleotides were designed and used to replacethe gloA gene: GLOAD f consisting of 100 bases (SEQ ID No80): atgcgtcttcttcataccatgctgcgcgttggcgatttgcaacgctccat cgatttttataccaaagtgctgggcatgaaGTGTAGGCTGGAGCTGCTTC G

[0484] With a region (lower-case letters) homologous to the sequence (1725861-1725940) including the gloA gene initiation codon of the gloA gene (sequence 1725861 to 1726268), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00067 GLOA D R consisting of 100 bases (SEQ ID No81) ttagttgcccagaccgcgaccggcgtctttctcttcgattaactcaattt tgtaaccgtccggatcttccacaaacgcgaCATATGAATATCCTCCTTAG

[0485] With a region (lower-case letters) homologous to the sequence (1726189-1726268) corresponding to the C terminal part encoding sequence of the including the stop codon gloA gene (1725861 to 1726268), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0486] Both GLOADr and GLOADf oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the gloA gene by the chloramphenicol cassette was checked by PCR analysis using both NemACd and RntCr oligonucleotides.

TABLE-US-00068 NemACd (SEQ ID No 82): gaagtggtcgatgccgggattgaagaatggg (homologous to the sequence 1725331 to 1725361) Rnt Cr (SEQ ID No83): gggttacgtttcagtgaggcgcgttctgcgg (homologous to the sequence 1726765 to 1726795)

[0487] 6.1.7 Construction of an E. coli MG1655ldhA::FRT,pflAB::FRT, iscR::FRT,frdABCD::FRTaceE::FRT,tpiA::FRTadhE::FRT aldA::FRT aldB::FRT gloA::FRT Modified Strain:

[0488] The gloA gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT aldA::FRT aldB::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655gloA::cm E. coli strain.

[0489] The Cm.sup.R transductants were selected on plate and the replacement of the gloA gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT aldA::FRT aldB::FRT was checked by PCR analysis using both NemACd and RntCr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv iv) frdABCD1s and frdABCD1rv v) aceEs and aceErv vi) cdh and YIIQ, ychGf and adhECr vii) YdcFCF and gapCCr cand viii) aldBCf and YiaYCr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE, tpiA, adhE, aldA and aldB genes respectively in the strain AgloA::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRTaldA: :FRTaldB::FRTgloA::cm.

[0490] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 82 and No 83). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::F RTaldA::FRTaldB::FRTgloA::FRT.

[0491] 6.1.8 Construction of an E. coli MG1655gloB::FRT-cm-FRT Modified Strain:

[0492] The gloB gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0493] Two oligonucleotides were designed and used to replace the gloB gene:

TABLE-US-00069 GLOBD f consisting of 100 bases (SEQ ID No84): acaatcaggcagcgacctgcttcatcattcaaaacccagatgtaattgtc atcaaaggcgggaatactgttaagattcatGTGTAGGCTGGAGCTGCTTC G

[0494] With a region (lower-case letters) homologous to the sequence (234703-234782) including the gloB gene initiation codon of the gloB gene (sequence 234027 to 234782), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00070 GLOB D R consisting of 100 bases (SEQ ID No85) taatgtaattaatgaagaaacattattgcaacaacctgaagagcgttttg catggttaaggtcaaagaaagataggttctgaCATATGAATATCCTCCTT AG

[0495] With a region (lower-case letters) homologous to the sequence (234027-234108) corresponding to the C terminal part encoding sequence of the including the stop codon gloB gene (234027 to 234782), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0496] Both GLOBDr and GLOBDf oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the gloB gene by the chloramphenicol cassette was checked by PCR analysis using both MltDCfd and YafS Cr oligonucleotides.

TABLE-US-00071 MltDCfd (SEQ ID No 86): ggcgagtaatatcgcttttgcc (homologous to the sequence 233929 to 233950) YafS Cr (SEQ ID No87): gacagtttgagggactcttgccgg (homologous to the sequence 234822 to 234845)

[0497] 6.1.9.Construction of an E. coli MG1655ldhA::FRT,pflAB::FRT, iscR::FRT,frdABCD::FRTaceE::FRT,tpiA::FRTadhE::FRT aldA::FRT aldB:: FRT gloA::FRT gloB::FRT Modified Strain:

[0498] The gloB gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT aldA::FRT aldB::FRT gloA::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655gloB::cm E. coli strain.

[0499] The Cm.sup.R transductants were selected on plate and the replacement of the gloB gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT aldA::FRT aldB::FRT gloA::FRT was checked by PCR analysis using both MltDCfd and YafS Cr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv iv) frdABCD1s and frdABCD1 rv v) aceEs and aceErv vi) cdh and YIIQ, ychGf and adhECr vii) YdcFCF and gapCCr cand viii) aldBCf and YiaYCr and NemACd and RntCr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE, tpiA, adhE, aldA, aldB and gloA genes respectively in the strain AgloB::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRTaldA: :FRTaldB::FRTgloA::FRTgloB::cm.

[0500] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 86 and No 87). The new strain was named MG1655ldhA::FRTApflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRTaldA::FRTaldB::FRTgloA::FRTgloB::FRT.

[0501] 6.1.10. Construction of an E. coli MG1655hchA::FRT-cm-FRT Modified Strain:

[0502] The hchA gene was replaced with a chloramphenicol antibiotic resistance cassette flanked by Flp recognition target (FRT) that is generated by PCR by using primers with 80-nt homology extensions deleting most of the concerned gene. The used technique was described by Datsenko and Wanner in 2000.

[0503] Two oligonucleotides were designed and used to replace the hchA gene:

TABLE-US-00072 HchAD f consisting of 100 bases (SEQ ID No88): atgactgttcaaacaagtaaaaatccgcaggtcgatattgctgaagataa tgcattcttcccttcagaatattcgcttagCCTTCAGAATATTCGCTTAG GTGTAGGCTGGAGCTGCTTCG

[0504] With a region (lower-case letters) homologous to the sequence (2033859-2033938) including the hchA gene initiation codon of the hchA gene (sequence 2033859 to 2034710), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette of the pKD3 plasmid

TABLE-US-00073 HchA D R consisting of 100 bases (SEQ ID No89) ttaacccgcgtaagctgccagcatttcctgcgccgccagtttacccaacg cattcgctgcaaaaggactgtcgccggtgaCATATGAATATCCTCCTTAG

[0505] With a region (lower-case letters) homologous to the sequence (2034631-2034710) corresponding to the C terminal part encoding sequence of the including the stop codon hchA gene (2033859 to 2034710), a reference sequence on the website http://ecocyc.org/, and a region (upper-case letters) for the amplification of the chloramphenicol resistance cassette carried by the pKD3 plasmid.

[0506] Both HchADr and HchADf oligonucleotides were used to amplify the chloramphenicol resistance cassette from the pKD3 plasmid. The amplified PCR fragment was then introduced by electroporation into the MG1655 E. coli strain carrying the RED plasmid helper (pKD46) expressing the system , and exo genes encoding Gam, Bet and Exo recombinases to promote homologous recombination. The antibiotic-resistant transformants were then selected and the replacement of the hchA gene by the chloramphenicol cassette was checked by PCR analysis using both YedS_3Cf and YedvCr oligonucleotides.

TABLE-US-00074 YedS_3Cf (SEQ ID No90): tgtgggcttagtctaccagttc (homologous to the sequence 2033243-2033264) Yedv Cr (SEQ ID No91): cgttaccgcaaagaaattaa (homologous to the sequence 2034818 to 2034837)

[0507] 6.1.11.Construction of an E. coli MG1655ldhA::FRT,pflAB::FRT, iscR::FRT,frdABCD::FRTaceE::FRT,tpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT Modified Strain:

[0508] The hchA gene was then replaced with a chloramphenicol resistance cassette into the MG1655ldhA::FRT pflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT aldA::FRT aldB::FRT gloA::FRT gloB::FRT strain and the deletion was achieved by generalized P1 phage transduction from the single mutant lysate (Miller 1972) using the MG1655hchA::cm E. coli strain.

[0509] The Cm.sup.R transductants were selected on plate and the replacement of the hchA gene by the chloramphenicol cassette into the MG1655ldhA::FRTpflAB::FRTiscR ::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRT aldA::FRT aldB::FRT gloA::FRT gloB::FRT was checked by PCR analysis using both YedS_3Cf and YedvCr oligonucleotides. Finally, i) hslJC and ldhAC2, ii) pFLAB1 and pflAB2, iii) iscr1s and iscr1rv iv) frdABCD1s and frdABCD1 rv v) aceEs and aceErv vi) cdh and YIIQ, ychGf and adhECr vii) YdcFCF and gapCCr cand viii) aldBCf and YiaYCr, NemACd and RntCr and MltDCfd and YafS Cr couple of primers were also used in PCR analysis to confirm the deletion of ldhA, pflAB, iscR, frdABCD, aceE, tpiA, adhE, aldA, aldB, gloA and gloB genes respectively in the strain hchA::cm. The resulting strain was named MG1655 ldhA::FRTpflAB::FRTiscR::FRTfrdABCD::FRTaceE::FRTtpiA::FRT adhE::FRTaldA: :FRTaldB::FRTgloA::FRTgloB::FRThchA::cm.

[0510] The chloramphenicol-resistance cassette was then eliminated by using the Flp helper pCP20 plasmid (Cheperanov and Wagernagel 1995). Cm.sup.R mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C., after which a few were colony purified at 42 C. and then tested for loss of the antibiotic resistance by PCR analysis using oligonucleotides previously described (SEQ ID No 90 and No 919). The new strain was named MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT.

[0511] 6.2 Construction of the pSC101- pGI-cac2229-cac0764-cac0303pth1 gldA-yqhD Expression Vector

[0512] The gldA gene was amplified from genomic DNA of E. coli MG1655 using primers pgldA1f and pgldA2r. The primers were designed to introduce the RBS01 region along with the gldA gene, as well as placing BamHI and XhoI restriction sites upstream and downstream respectively:

TABLE-US-00075 pgldA1f: BamHI-RBS gldA (SEQ ID No92) GGATCCttataacctccttaatggaccgcattattcaatcaccggg pgldAr: XhoI-gldA (SEQ ID No93) CTCGAGttattcccactcttgcaggaaacgc

[0513] The amplified PCR fragment was then subcloned into a Zero Blunt TOPO vector (Invitrogen, Saint Aubin, France) to yield the Zero Blunt TOPO-gldA plasmid and sequenced using universal primers T7P and T3P to assure that no mutations were introduced. The fragment containing the dhaB1-dhaB2 genes was purified on an agarose gel after digestion of the Zero Blunt TOPO-gldA vector with BamHI and XhoI.

[0514] The pSOS95 pthl-dhaB1-dhaB2-yqhD plasmid (see 5.3) was digested with BamHI and XhoI and ligated to the BamHI-XhoI gldA fragment to yield the pSOS95 pthl-gldA-yqhD plasmid. The pSOS95 pthl-gldA-yqhD plasmid was then digested with SalI and the operon containing fragment was purified on agarose gel before to be ligated to the pSC101_pGI-cac2229-cac0764-cac0303 plasmid pre-digested with SalI (3.2.), yielding the pSC101-pGI-cac2229-cac0764-cac0303_pth1-gldA-yqhD plasmid.

[0515] 6.3 Construction of the pSC101- pGI-cac2229-cac0764-cac0303-pntAB_pthl sadh.sub.beij-yqhD Expression Vector

[0516] The sadh gene from C. beijerinckii was amplified from the pSOS952 plasmid (Dussaux et al. 2013) using primers psadh1 and psadh2r. The primers were designed to amplify the RBS region along with the sadh gene, as well as placing BamHI and XhoI restriction sites upstream and downstream sadh respectively:

TABLE-US-00076 psadh1f: BamHI-RBSsadh (SEQ ID No94) GGATCCtatatttaaggaggaacatattttatgaaaggttttgcaatgc psadh2r: XhoI-sadh (SEQ ID No95) CTCGAGttataatataactactgctttaattaagtcttttggc

[0517] The amplified PCR fragment was then subcloned into a Zero Blunt TOPO vector (Invitrogen, Saint Aubin, France) to yield the Zero Blunt TOPO-sadh plasmid and sequenced using universal primers T7P and T3P to assure that no mutations were introduced. The fragment containing the sadh gene was purified on an agarose gel after digestion of the Zero Blunt TOPO-sadh vector with BamHI and XhoI.

[0518] The pSOS95 pthl-dhaB1-dhaB2-yqhD plasmid (see 5.3) was digested with BamHI and XhoI and ligated to the BamHI-XhoI sadh fragment to yield the pSOS95 pthl-sadh-yqhD plasmid. The pSOS95 pthl-sadh-yqhD plasmid was then digested with SalI and the operon containing fragment was purified on agarose gel before to be ligated to the pSC101_pGI-cac2229-cac0764-cac0303-pntAB plasmid pre-digested with SalI (5.2.), yielding the pSC101-pGI-cac2229-cac0764-cac0303-pntAB_pthl-sadh-yqhD plasmid.

[0519] 6.4. Introduction of the pSC101- pGI-cac2229-cac0764-cac0303-pntAB_pthl gldA-yqhD expression vector into the MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT E. coli strain:.

[0520] The pSC101- pGI-cac2229-cac0764-cac0303-pntAB_pthl gldA-yqhD expression vector was used to transform MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT E. coli strain by electroporation (Sambrook and Russel 2001).

[0521] The transformants were selected on LB agar plates supplemented with spectinomycin (70 g/ml) at 37 C. Some transformants were then grown in LB liquid culture supplemented with spectinomycin (100 g/ml) overnight at 37 C. to carry out a DNA plasmid extraction (GenElute HP plasmid miniprep kit, Sigma) and check for the presence of the plasmid. The pSC101-pGI-cac2229-cac0764-cac0303-pthlgldA-yqhD plasmid was finally controlled by restriction profile.

[0522] The final MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT pSC101-pGI- cac2229-cac0764-cac0303-pthlgldA-yqhD E. coli strain was grown in LB liquid medium supplemented with spectinomycin (100 g/ml) and kept in 20% glycerol solution at 80 C.

[0523] 6.5. Introduction of the pSC101- pGI-cac2229-cac0764-cac0303-pntAB_pthl sadh.sub.beij-yqhD expression vector into the

[0524] MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT E. coli strain:.

[0525] The pSC101- pGI-cac2229-cac0764-cac0303-pntAB_pthl sadh.sub.beij-yqhD expression vector was used to transform MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT E. coli strain by electroporation (Sambrook and Russel 2001).

[0526] The transformants were selected on LB agar plates supplemented with spectinomycin (70 g/ml) at 37 C. Some transformants were then grown in LB liquid culture supplemented with spectinomycin (100 g/ml) overnight at 37 C. to carry out a DNA plasmid extraction (GenElute HP plasmid miniprep kit, Sigma) and check for the presence of the plasmid. The pSC101-pGI-cac2229-cac0764-cac0303-pntAB pthl-sadh.sub.beij-yqhD plasmid was finally controlled by restriction profile.

[0527] The final MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRAgloA::FRTgloB::FRThchA::FRT pSC101-pGI-cac2229-cac0764-cac0303-pntAB_pthl-sadh.sub.beij-yqhD E. coli strain was grown in LB liquid medium supplemented with spectinomycin (100 g/ml) and kept in 20% glycerol solution at 80 C.

[0528] 6.6 Physiological Characterization of the E. coli MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE:: FRTaldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT pSC101-pGI-cac2229-cac0764-cac0303-pntAB_pthl-sadh.sub.beij-yqhD and MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE:: FRTaldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT pSC101-pGI- cac2229-cac0764-cac0303-pthlgldA-yqhD modified strains.

[0529] Both E. coli MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT (pSC101-pGI-cac2229-cac0764-cac0303-pntAB_pthl-sadh.sub.beij-yqhD) and MG1655ldhA::FRTpflAB::FRTiscR::FR4frdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT (pSC101-pGI- cac2229-cac0764-cac0303 pthlgldA-yqhD) strains were grown anaerobically on a 20 g/L glucose mineral medium containing minerals salts as previously described (Meynial-salles et al. 2005) supplemented with 4 g/l of yeast extract, 5 mM sodium nitrate and spectinomycin (100 g/ml) and inoculated with 100 l of a LB overnight culture. Cells were grown up at 37 C. during several days, and the pH was maintained by buffering the culture medium with MOPS. As a control, the E. coli MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT strain was grown in the same conditions.

[0530] The comparative phenotypic analysis was performed by measuring both glucose consumption as well as the concentration of fermentation products for the culture of each strain as is shown in table 6:

TABLE-US-00077 Glucose consumption Concentration (g/L) Strains g/1 1.2 propanediol Acetate MG1655ldhA::FRTpflAB:: 2.3 0.2 0.05 FRTiscR::FRfrdABCD:: FRTaceE::FRTtpiA:: FRTadhE::FRTaldA:: FRTaldB::FRTgloA:: FRTgloB::FRThchA::FRT MG1655ldhA::FRTpflAB:: 16.4 6.3 5.2 FRTiscR::FRfrdABCD:: FRTaceE::FRTtpiA:: FRTadhE::FRTaldA:: FRTaldB::FRTgloA:: FRTgloB::FRThchA:: FRT pSC101-pGI-cac2229- cac0764-cac0303-pthl- sadh.sub.beij-yqhD MG1655ldhA::FRTpflAB:: 19.8 7.2 6.3 FRTiscR::FRfrdABCD:: FRTaceE::FRTtpiA:: FRTadhE::FRTaldA:: FRTaldB::FRTgloA:: FRTgloB::FRThchA:: FRT pSC101-pGI-cac2229- cac0764-cac0303_pthl- gldA-yqhD

[0531] As shown in table 6, the expression of the both CA_C2229-CA_C0764-CA_C0303 and gldA-yqhD operons or both CA_C2229-CA_C0764-CA_C0303 and sadh.sub.beij-yqhD operons into the MG1655ldhA::FRTpflAB::FRTiscR::FRfrdABCD::FRTaceE::FRTtpiA::FRTadhE::FRT aldA::FRTaldB::FRTgloA::FRTgloB::FRThchA::FRT E. coli strain led to the production of 1.2 propanediol and acetate as the main fermentation products from glucose. Moreover, the expression of operons, whaterever the combination is, favoured the growth which was strongly hampered in the control strain.

REFERENCES

[0532] Almeida J R, Fvaro LC, Quirino BF 2012 Biodiesel biorefinery: opportunities and challenges for microbial production of fuels and chemicals from glycerol waste. Biotechnology for biofuels, 5,48. [0533] Altaras N E, Cameron D C 2000. Enhanced production of (R)-1,2-propanediol by metabolically engineered Escherichia coli. Biotechnol. Prog. 16 : 940-946 [0534] Anderson E H 1946. Growth Requirements of Virus-Resistant Mutants of Escherichia Coli Strain B.Proc. Natl. Acad. Sci. USA 32:120-128 [0535] Atsumi S, Cann A F, Connor M R, Shen C R, Smith K M, Brvnildsen M P, Chou K J, Hanai T, Liao J C. 2007. Metabolic engineering of Escherichia coli for 1-butanol production : Metab Eng., 10, 305-311. [0536] Baldom L, Aguilar J. 1988 Metabolism of L-fucose and L-rhamnose in Escherichia coli: aerobic-anaerobic regulation of L-lactaldehyde dissimilation. J Bacteriol, 170, 416-21 [0537] Bennett G N, San K Y. 2001 Microbial formation, biotechnological production and applications of 1,2-propanediol. Appl Microbiol Biotechnol., 55, 1-9. [0538] Berezina O V, Zakharova N V, Brandt A, Yarotsky S V, Schwarz W H, Zverlov V Y. 2010. Reconstructing the clostridial n-butanol metabolic pathway in Lactobacillus brevis. Appl. Microb. Biotechnol. 87 :6365-646. [0539] Bernardi A, Bernardi F 1984. Complete sequence of pSC101. Nucleic Acids Res. 12, 9415-26. [0540] Bond-Watts B B, Bellerose R J, Chang M C, 2011. Enzyme mechanism as a kinetic control element for designing synthetic biofuel pathways. Nat. Chem. Biol. 7: 222-227. [0541] Bradford M M 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72 : 248-264 [0542] Cherepanov P. P., Wackernagel W. 1995. Gene disruption in Escherichia coli: Tc.sup.R and Km.sup.R cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158(1):9-14. [0543] Cintesoli A, Clomburg J M, Rigou V., Zygourakis K., Gonzalez R. 2012 Quantitative analysis of the fermentative metabolism of glycerol in Escherichia coli, Biotech. Bioeng., 109, 187-198. [0544] Clomburg J M, Gonzalez R 2011 Metabolic engineering of Escherichia coli for the production of 1,2-propanediol from glycerol., Biotech. Bioeng., 108, 867-879. [0545] Cornillot E, Nair R V, Papoutsakis, Soucaille P. 1997. The genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 reside on a large plasmid whose loss leads to degeneration of the strain. J. Bacteriol. 179:5442-7. [0546] Datsenko K. A., Wanner B. L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97(12):6640. [0547] Dellomonaco C, Clomburg J M, Miller E N, Gonzalez R.2011 Engineered reversal of the -oxidation cycle for the synthesis of fuels and chemicals, Nature. 2011 355-9. [0548] Demuez M, Cournac L, Guerrini O, Soucaille P, Girbal L.2007, Complete activity profile of Clostridium acetobutylicum [FeFe]-hydrogenase and kinetic parameters for endogenous redox partners: FEMS Microbiol Lett. 275, 113-21. [0549] Dussaux S, Croux C, Soucaille P, Meynial-SalIes I. 2013. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for the high-yield production of a biofuel composed of an isopropanol/butanol/ethanol mixture. Metab Eng.,18,1-8 [0550] Fontaine L, Meynial-SalIes I, Yang X, Croux C and P Soucaille. 2002. Molecular characterisation and transcriptional analysis of adhE2, the gene encoding the NADH dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J. Bacteriol. 184: 821-830. [0551] Garza E, Zhao J, Wang Y, Wang J, Iverson A, Manow R, Finan C, Zhou S. 2012. Engineering a homobutanol fermentation pathway in Escherichia coli EG03. J Ind Microbiol Biotechnol., 39:1101-1107. [0552] Girbal L., and Soucaille P. 1998. Regulation of solvent production in Clostridium acetobutylicum. Trends. Biotechnol. 16, 11-16. [0553] Girbal L., Von Abendroth G., Winkler M., Benton P. M. C., Meynial-SalIes I., Croux C., Peters J., Happe T. and Soucaille P. 2005. Homologous/heterologous over-expression in Clostridium acetobutylicum and characterization of purified clostridial and algal Fe-only hydrogenases with high specific activity: Appl. Environ. Microbiol. 71, 2777-2781. [0554] Girio, F. M., C. Fonseca, F. Carvalheiro, L. C. Duarte, S. Marques, and R. Bogel-Lukasik. 2010. Hemicelluloses for fuel ethanol: A review. Bioresour Technol 101:4775-800. [0555] Heap J T, Pennington O J, Cartman S T, Carter G P, Minton N P 2007. The ClosTron: a universal gene knock-out system for the genus Clostridium. J Microbiol Methods. 70:452-64 [0556] Meynial-SalIes I.*, Gonzalez-Pajuelo M.*, Mendes P., Andrade J. C., Vasconcelos I. and Soucaille P. 2005. Metabolic engineering of Clostridium acetobutylicum for the industrial production of 1.3 propanediol from glycerol: Met. Eng., 7, 329-336: * equivalent contribution. [0557] Harrington K. J., Laughlin R. B. and Liang S. 2001. Balanced branching in transcription termination. Proc Natl Acad Sci U S A. 98(9):5019-24. Ingram L. and Beall D. 1992. Ethanol production by recombinant hosts: WO9216615. [0558] Inui M, Suda M, Kimura S, Yasuda K, Suzuki H, Toda H, Yamamoto S, Okino S, Suzuki N, Yukawa H. 2008. Expression of Clostridium acetobutylicum butanol synthetic genes in Escherichia coli: Appl Microbiol Biotechnol. 77: 1305-16. [0559] Jang Y S, Lee J Y, Lee J, Park J H, Im J A, Eom M H, Lee J, Lee S H, Song H, Cho J H, Seung do Y, Lee SY. 2012. Enhanced butanol production obtained by reinforcing the direct butanol-forming route in Clostridium acetobutylicum. mBio, 3, 1-5. [0560] Jarboe L. R., Grabar T. B., Yomano L. P., Shanmugan K. T. and Ingram L. 0. 2007. Development of ethanologenic bacteria, Adv. Biochem. Engin. Biotechnol., 108:237-61. [0561] Jiang Y, Xu C, Dong F, Yang Y, Jiang W, Yang S. 2009. Disruption of the acetoacetate decarboxylase gene in solvent-producing Clostridium acetobutylicum increases the butanol ratio. Met. Eng. 11:284-291. [0562] Keseler I M, Collado-Vides J, Gama-Castro S, Ingraham J, Paley S, Paulsen I T, Peralta-Gil M, Karp PD. 2005. EcoCyc: a comprehensive database resource for Escherichia coli, Nucleic Acids Res. 1;33 (Database issue):D334-7. [0563] Kim Y., Ingram L. O. and Shanmugan K. T. 2007. Construction of an Escherichia coli K12 mutant for homoethanologenic fermentation of glucose or xylose without foreign genes: Appl Environ Microb 73: 1766-71. [0564] Lau M W, Gunawan C., Balan V. and Dale B. E. 2010 Comparing the fermentation performance of Escherichia coliK011, Saccharomyces cerevisiae424(LNH-ST) and Zymomonas mobilis AX101 for cellulosic ethanol production. Biotechnol. Biofuels, 3, 11. [0565] Li F, Hinderberger J, Seedorf H, Zhang J, Buckel W, Thauer R K. 2008. Coupled ferredoxin and crotonyl coenzyme A (CoA) reduction with NADH catalyzed by the butyryl-CoA dehydrogenase/Etf complex from Clostridium kluyveri: J Bacteriol. 190. 843-50. [0566] Matsuoka K, Kimura K.1986. Glutamate synthase from Bacillus subtilis PCI 219. J Biochem. 99(4):1087-100 [0567] Mermelstein, L. D., Welker, N. E., Bennett, G. G., Papoutsakis, E. T., 1992. Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824. Biotechnology. 10, 190-195. [0568] Miller J, H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor N. Y. [0569] Meynial-SalIes I., Cervin M. A. and Soucaille P. 2005. New tool for metabolic pathway engineering in E. coli: one step method to modulate the expression of chromosomal genes: Appl. Environ. Microbiol. 71, 2140-2144 [0570] Meynial-Salles I., Gonzalez B. and Soucaille P. 2005 Microorganismes volus pour la production de 1.2 propanediol: PCT/FRO5/00070. [0571] Meynial-Salles I.*, Gonzalez-Pajuelo M.*, Mendes P., Andrade J. C., Vasconcelos I. and Soucaille P. 2005. Metabolic engineering of Clostridium acetobutylicum for the industrial production of 1.3 propanediol from glycerol: Met. Eng., 7, 329-336: * equivalent contribution. [0572] Nilling J, Breton G, Omelchenko M V, Makarova K S, Zeng Q, Gibson R, Lee H M, Dubois J, Qiu D, Hitti J, Wolf Y I, Tatusov R L, Sabathe F, Doucette-Stamm L, Soucaille P, Daly M J, Bennett G N, Koonin E V, Smith D R. 2001. Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum, J Bacteriol. 183(16):4823-38 [0573] Norrander, J., T. Kempe, and J. Messing. 1983. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene 26:101-106. [0574] Nielsen D. R., Leonard E, Yoon S H, Tseng H C, Yuan C, Prather K L 2009. Engineering alternative butanol production platforms in heterologous bacteria. Met. Eng. 11: 262-273. [0575] Papoutsakis E T. 2008. Engineering solventogenic clostridia. Curr Opin Biotechnol., 19:420-9. [0576] Perutka J, Wang W, Goerlitz D, Lambowitz A M 2004, Use of computer-designed group II introns to disrupt Escherichia coli DExH/D-box protein and DNA helicase genes. J Mol Biol. 336:421-39. [0577] Saint-Amans S, Girbal L, Andrade J, Ahrens K, Soucaille P. 2001 Regulation of carbon and electron flow in Clostridium butyricum VPI 3266 grown on glucose-glycerol mixtures, J. bacteriol., 183:1748-54. [0578] Sambrook J, Russell D W 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York [0579] Sanchez-Rivera F, Cameron D C, and Cooney D C 2001. Influence of environmental factors in the production of 1.2 propanediol by Clostridium thermosaccharolyticum, Biotechnol. Lett. 9, 449-454. [0580] Sarabal P. Croux C. Soucaille P. 1999. PCT no FR00/01981, Procd de prparation du 1,3-Propanediol par un micro-organisme recombinant en labsence de coenzyme B12 ou de lun de ses prcurseurs [0581] Saxena R K, Anand P, Saran S, Isar J.2009 Microbial production of 1,3-propanediol: Recent developments and emerging opportunities. Biotechnol Adv., 27, 895-9. [0582] Saxena R K, Anand P, Saran S, Isar J, Agarwal L. 2010 Microbial production and applications of 1,2-propanediol. Indian J Microbiol, 50, 2-11. [0583] Schaefer U, Boos W, Takors R, Weuster-Botz D 1999. Automated sampling device for monitoring intracellular metabolite dynamics Anal. Biochem. 270: 88-96 [0584] Shen C. R., Lan E. I., Dekishima Y., Baez A., Cho K. M., Liao J. C. 2011. Driving forces Enable High-Titer Anaerobic 1-Butanol Synthesis in Escherichia coli. Appl. Environ. Microbiol. 77: 2905-15. [0585] Singhal R K, Krishnan I S, Dua R D.1989 Stabilization, purification, and characterization of glutamate synthase from Clostridium pasteurianum, Biochemistry. 28(19):7928-35 [0586] Soucaille P., Cervin M., Valle F. 2012. Method of Creating a Library of Bacterial Clones with Varying Levels of Gene Expression US2012015849. [0587] Soucaille, P., Figge, R.,Croux, C.,2006. Process for Chromosomal Integration and DNA Sequence Replacement in Clostridia. Patent WO2006EP66997 20061003.

[0588] Soucaille, P., 2007. Process for the biological production of n-butanol with high yield. Patent EP20070821988 20071029. [0589] Steen E J., Chan R, Prasad N, Myers S, Petzold C J, Redding A, Ouellet M, Keasling J D. 2008 Metabolic engineering of Saccharomyces cerevisiae for the production of n-butanol. Microb. Cell Factories 7: 1-8. [0590] Tang X, Tan Y, Zhu H, Zhao K, Shen W. 2009 Microbial conversion of glycerol to 1,3-propanediol by an engineered strain of Escherichia coli. Appl. Environ. Microbiol., 1628-1634. [0591] Tracy B. 2012. Improving butanol fermentation to enter the advanced biofuel market. MBio. 3: 1-3. [0592] Tran Din K. and Gottschalk G. 1985 Formation of D()-1,2-propanediol and D()-lactate from glucose by Clostridium sphenoides under phosphate limitation : Arch. Microbiol. 142, 87-92. [0593] Trinh C T, Huffer S, Clark M E, Blanch H W, Clark DS 2010 Elucidating mechanisms of solvent toxicity in ethanologenic Escherichia coli. Biotechnol Bioeng. 106:721-30 [0594] Vanoni M A, Curti B.1999 Glutamate synthase: a complex iron-sulfur flavoprotein. Cell Mol Life Sci. 55(4):617-38. Review [0595] Vasconcelos, I., Girbal, L., Soucaille, P., 1994. Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral pH on mixtures of glucose and glycerol. J. Bacteriol. 176, 1443-1450. [0596] Xu YZ.sup.1, Guo N N, Zheng Z M, Ou X J, Liu H J, Liu D H. 2009. Metabolism in 1,3-propanediol fed-batch fermentation by a D-lactate deficient mutant of Klebsiella pneumoniae. Biotechnol Bioeng, 104, 965-972. [0597] Yu M, Du Y, Jiang W, Chang W L, Yang S T, Tang IC. 2012 Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl. Microbiol. Biotechnol. 881-9.