Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process

Abstract

The present invention regards a variety of methods and compositions for whole genome amplification and whole transcriptome amplification. In a particular aspect of the present invention, there is a method of amplifying a genome comprising a library generation step followed by a library amplification step. In specific embodiments, the library generating step utilizes specific primer mixtures and a DNA polymerase, wherein the specific primer mixtures are designed to eliminate ability to self-hybridize and/or hybridize to other primers within a mixture but efficiently and frequently prime nucleic acid templates.

Claims

1. A kit, comprising: a container; and a) a population of primers configured to amplify a whole genome or whole transcriptome present in the container, wherein the population of primers are non-self-complementary and non-complementary to other primers in the population, and comprise in a 5′ to 3′ orientation a constant region and a variable region that are adjacent to each other, wherein the constant region sequence has a known sequence that is constant among a plurality of primers of the population and the variable region sequence is degenerate among the plurality of primers of the population, wherein the sequence of the constant region comprises at least 70% of two types of non-complementary nucleotides selected from the group consisting of adenines and guanines; adenines and cytosines; guanines and thymidines; and cytosines and thymidines, and the sequence of the variable region comprises greater than 50% non-complementary nucleotides selected from the group consisting of adenines and guanines; adenines and cytosines; guanines and thymidines; and cytosines and thymidines; wherein the constant region is 6-100 nucleotides in length; b) at least one target-specific primer for targeted amplification; c) at least one nested primer for further amplifying amplicons generated by the targeted amplification; and d) a set of instructions for using the kit to detect copy number variation (CNV), genotype single nucleotide polymorphism (SNP), genotype micro-satellite, detect insertion and/or deletion, determine zygosity, or detect mutation(s), wherein the sequence of the constant and variable regions will not cross-hybridize or self-hybridize under conditions described in the set of instructions.

2. The kit of claim 1, wherein amplicons generated by the primers in (a)-(c) are at least 100 base pairs long.

3. The kit of claim 1, wherein the primers in (a)-(c) comprise at least 10 nucleotides.

4. The kit of claim 1, wherein the primers in (a)-(c) comprise at least one modified nucleotide.

5. The kit of claim 1, wherein melting temperature of the primers in (a)-(c) is at least 45 degrees Celsius.

6. The kit of claim 1, wherein the at least one nested primer is complementary to amplicons generated by the targeted amplification.

7. The kit of claim 1, wherein the at least one target-specific primer is specific to one or more target sequences.

8. The kit of claim 1, wherein the at least one target-specific primer does not comprise an adapter sequence.

9. The kit of claim 1, wherein the set of instructions instructs a user to carry out a first series of polymerase chain reaction steps using the population of primers and the at least one target-specific primer followed by a second series of polymerase chain reaction steps using the at least one nested primer.

10. The kit of claim 9, wherein the set of instructions further instructs the user to sequence amplicons generated at the end of the second series of polymerase chain reaction steps using a sequencer.

11. The kit of claim 1, wherein the kit further comprises reagents selected from the group consisting of a cell lysis reagent, magnesium salts, a ligase, a polymerase, a reverse transcriptase, betaine and a kinase.

12. The kit of claim 1, wherein the kit is configured for use with a sample comprising nucleic acid molecules: DNA or RNA.

13. The kit of claim 12, wherein the sample is selected from the group consisting of blood, serum, plasma, cerebrospinal fluid, cheek scrapings, nipple aspirate, biopsy, semen, urine, feces, hair follicle, saliva, sweat, immunoprecipitated or physically isolated chromatin, a single cell or a plurality of cells.

14. The kit of claim 12, wherein the kit is configured for obtaining genomic copy number, sequence information, allelic variation information, cancer diagnosis, prenatal diagnosis, paternity information, disease diagnosis, detection, monitoring, or treatment information using the sample.

15. The kit according to claim 1, wherein the variable region comprises 4 to 20 nucleotides.

16. A kit, comprising: a) a population of primers configured to amplify a whole genome or whole transcriptome, wherein the population of primers are non-self-complementary and non-complementary to other primers in the population, and comprise in a 5′ to 3′ orientation a constant region and a variable region, wherein the constant region sequence has a known sequence that is constant among a plurality of primers of the population and the variable region sequence is degenerate among the plurality of primers of the population, wherein the primers of the population have sequences that are 70% or more comprised of two non-complementary and non-self-complementary nucleotides; b) at least one target-specific primer for targeted amplification; c) at least one nested primer for further amplifying amplicons generated by the targeted amplification; and d) a set of instructions for using the kit to detect copy number variation (CNV), genotype single nucleotide polymorphism (SNP), genotype micro-satellite, detect insertion and/or deletion, determine zygosity, or detect mutation(s), wherein the sequence of the constant and variable regions will not cross-hybridize or self-hybridize under conditions described in the set of instructions.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

(2) FIG. 1 illustrates a schematic presentation of whole genome and whole transcriptome amplification by incorporating known sequence with self-inert degenerate primers followed by PCR amplification. Dashed lines represent newly synthesized strands. Thicker lines represent the known sequence.

(3) FIG. 2 is a schematic presentation of design of exemplary self-inert degenerate primers designed to eliminate their ability to form primer-dimers.

(4) FIG. 3A-3C provide an analysis of self-priming and extension of degenerate YN-primers (primers containing from 0 to about 6 completely random bases (N) at the 3′ end, 10 degenerate pyrimidine bases Y, and the known pyrimidine sequence YU at the 5′ end (FIG. 2)). In FIG. 3A, YN primers containing 0, 1, 2 or 3 random N bases were used with or without dNTPs. In FIG. 3B, YN primers containing 0, 1, 2 or 3 random N bases and a model template oligonucleotide (Table III, primer 9) were used. In FIG. 3C, self-priming of YN-primers were tested. Note: Pyrimidine bases do not stain efficiently with Sybr Gold. The presence of purine bases within the completely random portion (N) of YN-primers greatly increases the efficiency of staining these oligonucleotides.

(5) FIG. 4 shows an assay for primer-dimer formation by degenerate YN primers having from 0 to 6 completely random bases at the 3′ end or by a primer comprised of T7 promoter sequence at the 5′ region and 6 completely random bases at the 3′ end (Table III, primer 17) in human whole genome amplification with the Klenow Exo− fragment of DNA Polymerase I. The number of completely random bases (N) is shown at the end of each primer's abbreviation.

(6) FIG. 5 demonstrates real-time PCR amplification of 5 ng aliquots of whole genome libraries synthesized with Klenow exo− fragment of DNA Polymerase I and self-inert degenerate primers described in FIG. 4.

(7) FIG. 6A-6B show representation analysis of 30 exemplary human STS markers following whole genome amplification with exemplary degenerate pyrimidine YN primers specified in the description of FIG. 4 and the Klenow Exo− fragment of DNA Polymerase I. Aliquots corresponding to 10 ng of amplified DNA were used for PCR analysis of STS markers. In FIG. 6A, pyrimidine primers with 0 to 3 random 3′ bases were used for the library synthesis step and in FIG. 6B, pyrimidine primers with 4 to 6 random 3′ bases were used. The number of completely random bases (N) is shown at the end of each primer's abbreviation.

(8) FIG. 7 shows real-time PCR amplification of 5 ng aliquots of whole genome pre-amplified samples of thermally fragmented human genomic DNA with Klenow Exo− fragment of DNA Polymerase I or Sequenase version 2 using self-inert degenerate pyrimidine primer Y(N).sub.2 with 2 random bases at the 3′ end.

(9) FIG. 8 demonstrates gel analysis of amplification products of thermally fragmented human genomic DNA with Klenow Exo− fragment of DNA Polymerase I or Sequenase version 2 using self-inert degenerate pyrimidine primer Y(N).sub.2 as specified in the description to FIG. 7.

(10) FIG. 9 shows representation analysis of 33 exemplary human STS markers following whole genome amplification with exemplary self-inert degenerate pyrimidine primer Y(N).sub.2 and Klenow Exo− fragment of DNA Polymerase I or Sequenase version 2. Aliquots corresponding to 10 ng of amplified DNA were used for PCR analysis of STS markers.

(11) FIG. 10 illustrates comparison between four self-inert degenerate primers comprising four possible base pair combinations known not to participate in Watson-Crick base pairing and containing two completely random bases at their 3′ ends in library synthesis reactions with Sequenase version 2 DNA polymerase. Shown is quantitative real-time PCR amplification of aliquots corresponding to 5 ng of input DNA of the library synthesis reactions. Abbreviations show the base composition of the self-inert degenerate primers.

(12) FIG. 11A-11E show representation analysis of 35 exemplary human STS markers following whole genome amplification with self-inert degenerate primers specified in the description to FIG. 10 and Sequenase version 2 DNA polymerase or a combined sample in which equal amounts of four individual reactions each with a separate degenerate primer were combined prior to PCR amplification of the STS markers. Aliquots corresponding to 10 ng of amplified DNA were used for PCR analysis of STS markers. Abbreviations show the base composition of the self-inert degenerate primers.

(13) FIG. 12 demonstrates comparison between isothermal incubation at 24° C. for 60 min, a three-step incubation at 16° C., 24° C., and 37° C. for 20 min each, and a cycling incubation for 19 cycles at 16° C., 24° C., and 37° C. for 1 min each in whole genome amplification of human DNA with Sequenase version 2 DNA polymerase and self-inert degenerate primer Y(N).sub.2. Aliquots corresponding to 5 ng of input DNA of the WGA library synthesis reactions were amplified by quantitative real-time PCR.

(14) FIG. 13 shows representation analysis of 17 Human STS markers following whole genome amplification with self-inert degenerate primer Y(N).sub.2 and Sequenase version 2 DNA polymerase as detailed in the description to FIG. 12 Aliquots corresponding to 10 ng of amplified DNA were used for PCR analysis of STS markers.

(15) FIG. 14 shows titration from 0.5 μM to 33 μM of self-inert degenerate primer K(N).sub.2 in human WGA with Sequenase version 2 DNA polymerase. Aliquots corresponding to 5 ng of input DNA of the WGA library synthesis reactions were amplified by quantitative real-time PCR.

(16) FIG. 15 shows representation analysis of 17 exemplary human STS markers following whole genome amplification with exemplary self-inert degenerate primer K(N).sub.2 applied at concentrations of 0.5 to 10 μM and Sequenase version 2 DNA polymerase as specified in the description to FIG. 14. Aliquots corresponding to 10 ng of amplified DNA were used for PCR analysis of STS markers. Shown is a distribution plot of DNA amounts derived from quantitative real-time PCR. Horizontal bars represent median values.

(17) FIG. 16 shows titration from 5 ng to 100 ng of thermally fragmented genomic DNA in WGA reaction with self-inert degenerate primer K(N).sub.2 and Sequenase version 2 DNA polymerase. Aliquots corresponding to 5 ng of input DNA of the WGA library synthesis reactions were amplified by quantitative real-time PCR.

(18) FIG. 17 shows representation analysis of 20 exemplary human STS markers following whole genome amplification of between 5 ng and 100 ng of thermally fragmented DNA with self-inert degenerate primer K(N).sub.2 and Sequenase version 2 DNA polymerase as specified in the description to FIG. 16. Aliquots corresponding to 10 ng of amplified DNA were used for PCR analysis of STS markers. Shown is a distribution plot of DNA amounts derived from quantitative real-time PCR. Horizontal bars represent median values.

(19) FIG. 18A-18C show the structure of the known primer with the ID tags. FIG. 18A illustrates replicable known primer with the known primer sequence U at the 3′-end and individual ID sequence tag T at the 5′ end. FIG. 18B shows non-replicable known primer with the known primer sequence U at the 3′ end, individual ID sequence tag T at the 5′ end, and non-replicable organic linker L between them. FIG. 18C shows 5′ overhanging structure of the ends of DNA fragments in the WGA library after amplification with non-replicable known primer.

(20) FIG. 19 shows the process of synthesis of WGA libraries with the replicable identification (ID) tag and their usage, for example for security and/or confidentiality purposes, by mixing several libraries and recovering individual library by ID-specific PCR.

(21) FIG. 20 shows the process of synthesis of WGA libraries with the non-replicable ID tag and their usage, for example for security and/or confidentiality purposes, by mixing several libraries and recovering individual libraries by ID-specific hybridization capture.

(22) FIG. 21A-21C show the process of conversion of amplified WGA libraries into libraries with additional G.sub.n or C.sub.10 sequence tag located at the 3′ or 5′ end, respectively, of the universal known primer sequence U with subsequent use of these modified WGA libraries for targeted amplification of one or several specific genomic sites using universal primer C.sub.10 and unique primer P. FIG. 21A—library tagging by incorporation of a (dG)n tail using TdT enzyme; FIG. 21B—library tagging by ligation of an adaptor with the C.sub.10 sequence at the 5′ end of the long oligonucleotide; FIG. 21C—library tagging by secondary replication of the WGA library using known primer with the C.sub.10 sequence at the 5′ end.

(23) FIG. 22 shows the process for covalent immobilization of WGA library on a solid support.

(24) FIG. 23A-23B show WGA libraries in the micro-array format. FIG. 23A illustrates an embodiment utilizing covalent attachment of the libraries to a solid support. FIG. 23B illustrates an embodiment utilizing non-covalent attachment of the libraries to a solid support.

(25) FIG. 24 shows an embodiment wherein the immobilized WGA library may be used repeatedly.

(26) FIG. 25 describes the method of WGA product purification utilizing a non-replicable known primer and magnetic bead affinity capture.

(27) FIG. 26A-26B shows comparison between the whole genome amplification described in the present invention and a commercially available kit for DOP-PCR amplification. Aliquots of 5 ng and 20 pg of genomic DNA were amplified with Klenow Exo− fragment of DNA polymerase I and 1 μM of self-inert degenerate primer K(N).sub.2 or with DOP PCR Master™ Kit (Roche Molecular Biochemicals). (FIG. 26A) Real-time PCR amplification curves for libraries form 5 ng gDNA, 20 pg gDNA, or blank control. (FIG. 26B) Logarithmic distribution plots of 16 genomic STS markers amplified from the whole genome libraries amplified in FIG. 26A. Amplification with Klenow Exo− fragment of DNA polymerase I and self-inert degenerate primer K(N).sub.2 was superior both in sensitivity and in representation of genomic markers as compared to that with DOP PCR

(28) FIG. 27 displays the amplification curves of libraries generated from DNA isolated from serum collected in a serum separator tube. The amplification was performed for 17 cycles.

(29) FIG. 28A-28B represent the analysis of the amplified products from serum DNA. In FIG. 28A, there is gel analysis of both serum DNA (Right) and amplified products (Left). Both the starting serum DNA and amplified material demonstrate a size range of 200 bp to 1.6 kb, indicating that the amplified material maintains the same size distribution as the DNA isolated from the serum. In FIG. 28B, there is real-time STS analysis of 8 STS sites in amplified products from serum DNA. The solid line crossing the entire graph represents both the amount of DNA added to the STS assay based on optical density, and the average value of the 8 STS sites. The short line represents the median value of the 8 STS sites obtained by real-time PCR analysis. All 8 sites were represented within a factor of 5 of the mean amplification.

(30) FIG. 29 illustrates amplification of single blood nucleated cells by a method of the present invention.

(31) FIG. 30 shows amplification of single sperm cells by a method of the present invention.

(32) FIG. 31 shows dilution of hair follicle samples for an exemplary forensic application of a method described herein.

(33) FIG. 32 illustrates amplification of a single copy chromosome.

(34) FIG. 33 shows micro-array hybridization analysis of the amplified DNA from a single-cell DNA produced by whole genome amplification.

(35) FIG. 34 illustrates single-cell DNA arrays for detection and analysis of cells, such as cancer cells.

(36) FIG. 35, panels A-D show real-time PCR amplification using two X-chromosome specific primer pairs to evaluate loci copy number values in WGA libraries synthesized from patient DNA of known aneuploidies of XO, XX, and XXX. Panels A and C show curves from each of 5 individual amplifications. Panels B and D show mixtures of the five libraries tested in triplicate demonstrating the maintenance of copy number information in WGA libraries.

(37) FIG. 36 shows real-time PCR amplification of WTA libraries prepared from 10 ng and 100 ng from human B-lymphocyte RNA using self-inert degenerate primer K(N)2 and MMLV reverse transcriptase. Amplification profiles show about a one-cycle difference between 100 ng of input and 10 ng of input template.

(38) FIG. 37 shows real-time PCR amplification of WTA libraries prepared with two different self-inert primers K(N).sub.2 and K(T20) and their combination. Significant improvement was observed when a combination of K(N).sub.2 and K(T20) is used.

(39) FIG. 38 shows gel electrophoretic analysis of amplified WTA libraries. The observed pattern of ethidium bromide staining visualized by fluorescence transilumination (Fluor-S, Bio-Rad) shows the range of fragment sizes and intensity resulting from varying the amounts of input RNA in library synthesis and from varying the primer combinations utilized. 100 ng of input RNA yields larger products without significant effect of the primer K(T20). Libraries from 10 ng of input RNA yield generally smaller amplification products and show significant improvement with the addition of K(T20) primer.

(40) FIG. 39 provides quantitative real-time PCR analysis of amplified WTA libraries. The plots show analysis of 11 sites corresponding to human STS markers. The long bar in each column represents the average value while the short bar represents the median value. The line at 10 ng represents the amount of amplified DNA, by spectrophotometric analysis, added to each assay. All 11 sites were detected in each sample, indicating that all sites were efficiently amplified in all samples. The representation of these 11 markers is similar between the K(N2) and K(N2)+K(T20) 100 ng libraries. The distribution is wider for the 10 ng libraries than the 100 ng libraries and the distribution of the 10 ng K(N2) library is slightly broader than the 10 ng K(N2)+K(T20) library.

(41) FIG. 40A-40C illustrate results of real-time PCR analysis of three exemplary expressed mRNA loci at three different distances from the 3′ end using human STS markers. The lengths of the mRNA for each STS are 6,642 bp for STS 42, 3,100 bp for STS 85, and 9,301 bp for STS 119. The distances from the 3′ end for the STS 42 locus are 1,087 bp, 1,795 bp, and 5,835 bp. The distances from the 3′ end for the STS 85 locus are 77 bp, 1,331 bp, and 1,827 bp. The distances from the 3′ end for the STS 119 locus are 1,834 bp, 3,746 bp, and 5,805 bp. Results are shown for 100 ng and 10 ng input libraries with either K(N).sub.2 or K(N).sub.2+K(T20) library synthesis primers. Representation of marker sequences for WTA libraries at different lengths along a specific transcript show consistent results between libraries made from different quantities of RNA and display only minor improvements in 3′ representation with the addition of K(T20).

(42) FIG. 41 illustrates results of real-time PCR analysis of input template and two principal MgCl.sub.2 concentrations typically used with the RNA dependent DNA polymerase, reverse transcriptase.

(43) FIG. 42 shows the resulting representation of specific sites analyzed by real-time PCR for their relative abundance within a subset of the samples described in FIG. 41 (10 ng and 0.25 ng input template; 3 mM and 10 mM MgCl.sub.2 concentration). As is typical of such experiments, samples that amplify more robustly also show better representation of specific sites.

(44) FIG. 43 illustrates the effect of MgCl.sub.2 concentration on WTA amplification of total RNA. Using a constant 10 ng template RNA the MgCl.sub.2 concentration was varied over a range of between 3 mM and 12 mM. A clear dependence is observed in WTA performance under these reaction conditions, with optimal amplification performance occurring between 6 mM and 10 mM.

(45) FIG. 44A-44B demonstrates the selective amplification of single stranded templates in WTA library synthesis using either DNA or RNA with or without denaturation. FIG. 44A shows real-time PCR curves of the amplification of these libraries. FIG. 44B shows the resulting products run on a 0.8% agarose gel stained with ethidium bromide. Only about 1% of DNA sample can be converted into library amplimers without denaturation, while denaturation had little effect on RNA templates.

(46) FIG. 45 illustrates principle of selective amplification of DNA and RNA from a total nucleic acid isolate using self-inert degenerate primers in combination with Klenow Exo-fragment of DNA polymerase I and heat-denatured nucleic acid (WGA) or MMLV reverse transcriptase and non-denatured nucleic acid (WTA), and a hypothetical device for isolation of DNA and RNA by selective amplification from total nucleic acid preparation.

(47) FIG. 46A-46B show the inhibitory effect of poly-C tags on amplification of synthesized WGA libraries. FIG. 46A shows real-time PCR amplification chromatograms of different length poly-C tags incorporated by polymerization. FIG. 46B shows delayed kinetics or suppression of amplification of C-tagged libraries amplified with corresponding poly-C primers.

(48) FIG. 47A-47B display real-time PCR results of targeted amplification using a specific primer and the universal C.sub.10 tag primer. FIG. 47A shows the sequential shift with primary and secondary specific primers with a combined enrichment above input template concentrations. FIG. 47B shows the effect of specific primer concentration on selective amplification. Real-time PCR curves show a gradient of specific enrichment with respect to primer concentration.

(49) FIG. 48A-48B detail the individual specific site enrichment for each unique primary oligonucleotide in the multiplexed targeted amplification. FIG. 48A shows values of enrichment for each site relative to an equal amount of starting template, while FIG. 48B displays the same data as a histogram of frequency of amplification.

(50) FIG. 49A-49B. FIG. 49A shows the analysis of secondary “nested” real-time PCR results for 45 multiplexed specific primers. Enrichment is expressed as fold amplification above starting template ranging from 100,000 fold to over 1,000,000 fold. FIG. 49B shows the distribution frequency for all 45 multiplexed sites.

(51) FIG. 50 shows a schematic representation of a whole genome sequencing project using tagged libraries synthesized from limited starting material. Libraries provide a means to recover precious or rare samples in an amplifiable form that can function both as substrate for cloning approaches and through conversion to C-tagged format a directed sequencing template for gap filling and primer walking.

(52) FIG. 51 shows a diagram illustrating universality of the nucleic acid amplification methods of the present invention and their compatibility with different sources of DNA or RNA, and the diversity of possible applications for the amplified material.

(53) FIG. 52 demonstrates an example of Background Subtracted RFU amplification curves for replicate single-cell and control no-cell whole genome amplification (WGA) reactions monitored on a Bio-Rad I-Cycler iQ.

(54) FIG. 53 shows PCR cycles for 5 cells, 1 cell and control (0 cells) as starting materials.

(55) FIG. 54A-54B show locus-specific PCR QC—testing of single-cell whole genomic amplification of DNA; (FIG. 54A) Locus-specific PCR of genomic DNA with increasing number cell-equivalents; (FIG. 54B) Locus-specific PCR of whole genome-amplified DNA from 1, 10, 100, and 1000 cell-equivalents (DNA amplified from a single cell gives the same test result as from 1,000 cells).

(56) FIG. 55 compares cell to cell variation for 2 cells in 24 Q PCR assays; single-cell whole genome amplification produces highly reproducible representation of multiple loci tested in different single cells.

(57) FIG. 56 illustrates reproducibility of representation, assayed by individual QPCR reactions across 10 replicate single cells.

(58) FIG. 57A-57B illustrate a comparison between a particular exemplary method of the claimed invention (FIG. 57A) with a method known in the art (FIG. 57B).

DETAILED DESCRIPTION OF THE INVENTION

(59) In keeping with long-standing patent law convention, the words “a” and “an” when used in the present specification in concert with the word comprising, including the claims, denote “one or more.”

(60) The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and so forth which are within the skill of the art. Such techniques are explained fully in the literature. See e.g., Sambrook, Fritsch, and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition (1989), OLIGONUCLEOTIDE SYNTHESIS (M. J. Gait Ed., 1984), ANIMAL CELL CULTURE (R. I. Freshney, Ed., 1987), the series METHODS IN ENZYMOLOGY (Academic Press, Inc.); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (J. M. Miller and M. P. Calos eds. 1987), HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, (D. M. Weir and C. C. Blackwell, Eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Siedman, J. A. Smith, and K. Struhl, eds., 1987), CURRENT PROTOCOLS IN IMMUNOLOGY (J. E. coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, eds., 1991); ANNUAL REVIEW OF IMMUNOLOGY; as well as monographs in journals such as ADVANCES IN IMMUNOLOGY. All patents, patent applications, and publications mentioned herein, both supra and infra, are hereby incorporated herein by reference.

(61) U.S. Provisional Patent Application No. 60/453,071, filed Mar. 7, 2003 is hereby incorporated by reference herein in its entirety. U.S. Nonprovisional patent application Ser. No. 10/797,333 is also hereby incorporated by reference herein in its entirety. U.S. Patent Application 20030143599 is also incorporated by reference herein in its entirety.

I. Definitions

(62) The term “base analog” as used herein refers to a compound similar to one of the four DNA bases (adenine, cytosine, guanine, and thymine) but having a different composition and, as a result, different pairing properties. For example, 5-bromouracil is an analog of thymine but sometimes pairs with guanine, and 2-aminopurine is an analog of adenine but sometimes pairs with cytosine.

(63) The term “backbone analog” as used herein refers to a compound wherein the deoxyribose phosphate backbone of DNA has been modified. The modifications can be made in a number of ways to change nuclease stability or cell membrane permeability of the modified DNA. For example, peptide nucleic acid (PNA) is a new DNA derivative with an amide backbone instead of a deoxyribose phosphate backbone. Other examples in the art include methylphosphonates.

(64) The term “blocked 3′ end” as used herein is defined as a 3′ end of DNA lacking a hydroxyl group.

(65) The term “blunt end” as used herein refers to the end of a double stranded DNA molecule having 5′ and 3′ ends, wherein the 5′ and 3′ ends terminate at the same position. Thus, the blunt end comprises no 5′ or 3′ overhang.

(66) The term “complementarity” as used herein refers to the ability to form a Watson-Crick base pair through specific hydrogen bonds.

(67) The term “contig” as used herein refers to a contiguous (continuous) sequence of DNA constructed from overlapping sequences.

(68) The term “degenerate” as used herein refers to a nucleotide or series of nucleotides wherein the identity can be selected from a variety of choices of nucleotides, as opposed to a defined sequence. In specific embodiments, there can be a choice from two or more different nucleotides. In further specific embodiments, the selection of a nucleotide at one particular position comprises selection from only purines, only pyrimidines, or from non-pairing purines and pyrimidines.

(69) The term “self-inert” as used herein refers to the inability of a primer or a mixture of primers to self-prime and initiate DNA synthesis in the presence of DNA polymerase and dNTPs but in the absence of other DNA templates. It may also refer to a collective set of mRNAs in a cell.

(70) The term “DNA immortalization” as used herein refers to the conversion of a mixture of DNA molecules into a form that allows repetitive, unlimited amplification without loss of representation and/or without size reduction. In a specific embodiment, the mixture of DNA molecules comprises more than one copy of a particular DNA sequence. In another specific embodiment, the mixture of DNA molecules comprises a genome.

(71) The term “genome” as used herein is defined as the collective gene set carried by an individual, cell, or organelle.

(72) The term “genomic DNA” as used herein is defined as DNA material comprising the partial or full collective gene set carried by an individual, cell, or organelle.

(73) The term “transcriptome” as used herein is defined as the collective RNA set expressed within a cell.

(74) The term “hybridization” as used herein refers to a process of formation of double stranded DNA regions between one, two or many complementary single stranded DNA molecules. In some embodiments, however, triple stranded DNA regions are generated through hybridization.

(75) The term “minimal redundancy” as used herein refers to a minimal number of sequenced DNA fragments that produces a contig. A skilled artisan recognizes this is as opposed to “shotgun” sequencing where high redundancy is necessary to complete all gaps. Typically, the redundancy of “shotgun” sequencing is about 10-15 (where redundancy=total amount of sequenced DNA divided by the size of the genome), whereas with minimal redundancy the redundancy may be between 1 and about 2.

(76) The term “non-canonical or non-Watson-Crick base pair” as used herein refers to all possible interactions between bases that do not include standard (Watson-Crick) A-T and G-C pairing. In a specific embodiment, the non-canonical base pair comprises an adenine nucleobase and a guanine nucleobase, an adenine nucleobase and a cytosine nucleobase, a cytosine nucleobase and a thymidine nucleobase, a guanine nucleobase and a thymidine nucleobase, an adenine nucleobase and an adenine nucleobase, a guanine nucleobase and a guanine nucleobase, a cytosine nucleobase and a cytosine nucleobase, or a thymidine nucleobase and a thymidine nucleobase.

(77) The term “non-complementary” refers to nucleic acid sequence that lacks the ability to form intermolecularly at least one Watson-Crick base pair through specific hydrogen bonds.

(78) The term “non-self-complementary” refers to nucleic acid sequence that lacks the ability to form intramolecularly at least one Watson-Crick base pair through specific hydrogen bonds.

(79) The term “non strand-displacing polymerase” as used herein is defined as a polymerase that extends until it is stopped by the presence of, for example, a downstream primer. In a specific embodiment, the polymerase lacks 5′-3′exonuclease activity.

(80) The term “randomly fragmenting” as used herein refers to fragmenting a DNA molecule in a non-ordered fashion, such as irrespective of the sequence identity or position of the nucleotide comprising and/or surrounding the break. In a specific embodiment, the random fragmentation is mechanical, chemical, or enzymatic, by well-known methods in the art.

(81) The term “RNA immortalization” as used herein refers to the conversion of a mixture of RNA molecules, such as a transcriptome, into a form that allows repetitive, unlimited amplification without loss of representation and/or without size reduction. In a specific embodiment, a transcriptome is defined as a collection of transcribed mRNA molecules from a cell, an individual, or an organelle.

(82) The term “single stranded nucleic acid molecule/primer mixture” as used herein refers to a mixture comprising at least one single stranded nucleic acid molecule wherein at least one primer, as described herein, is hybridized to a region in said single stranded nucleic acid molecule. In specific embodiments, multiple degenerate primers comprise complementary sequence to at least some part of the single stranded nucleic acid molecule. In further specific embodiments, the mixture comprises a plurality of single stranded nucleic acid molecules having multiple degenerate primers hybridized thereto. In additional specific embodiments, the single stranded nucleic acid molecule is DNA or RNA.

(83) The term “strand-displacing polymerase” as used herein is defined as a polymerase that will displace downstream fragments as it extends. In a specific embodiment, the polymerase comprises 5′-3′ exonuclease activity.

(84) The term “substantially incapable” as used herein refers to a majority of polynucleotides being incapable of an activity upon subjection to standard conditions known in the art. In a specific embodiment, the activities include self-hybridization; self-priming; hybridization to another polynucleotide in the plurality; initiation of a polymerization reaction in the plurality, or a combination thereof. In a specific embodiment, the term refers to at least about 70% of a primer molecule being comprised of two noncomplementary and non-self-complementary nucleotides, more preferably at least about 75%, more preferably at least about 80%, more preferably at least about 85%, more preferably at least about 90%, more preferably at least about 95%, more preferably at least about 97%, more preferably at least about 99%, and most preferably 100% of a primer molecule being comprised of two noncomplementary and non-self-complementary nucleotides.

(85) The term “substantially non-self-complementary and substantially non-complementary” as used herein refers to a plurality of primers that lack the ability to form intramolecularly and intermolecularly a Watson-Crick base pair through specific hydrogen bonds. In a specific embodiment, at least about 70% of a primer molecule in the plurality is comprised of two noncomplementary and non-self-complementary nucleotides, more preferably at least about 75%, more preferably at least about 80%, more preferably at least about 85%, more preferably at least about 90%, more preferably at least about 95%, more preferably at least about 97%, more preferably at least about 99%, and most preferably 100% of a primer molecule in the plurality is comprised of two noncomplementary and non-self-complementary nucleotides.

(86) The term “thermophilic DNA polymerase, as used herein refers to a heat-stable DNA polymerase.

(87) A skilled artisan recognizes that there is a conventional single letter code in the art to represent a selection of nucleotides for a particular nucleotide site. For example, R refers to A or G; Y refers to C or T; M refers to A or C; K refers to G or T; S refers to C or G; W refers to A or T; H refers to A or C or T; B refers to C or G or T; V refers to A or C or G; D refers to A or G or T; and N refers to A or C or G or T. Thus, a YN primer comprises at least one, and preferably more, series of dinucleotide sets each comprising a C or a T at the first position and an A, C, G, or T at the second position. These dinucleotide sets may be repeated in the primer (and/or adaptor).

II. Preparation of DNA Libraries for Whole Genome and Whole Transcriptome Amplification by Incorporating a Known Universal Sequence Using Self-Inert Degenerate Primers

(88) In embodiments of the present invention, there is whole genome or whole transcriptome amplification comprising incorporation of known universal sequence followed by a subsequent PCR amplification step using a known universal primer complementary to at least part of the known universal sequence. In a specific embodiment, the primers for incorporating the known universal sequence comprise a degenerate region, and in further specific embodiments, the known universal sequence and the degenerate region comprise non-self-complementary nucleic acid sequence. Thus, there is significant reduction in self-hybridization and intermolecular primer hybridization compared to primers lacking non-self-complementary sequence.

(89) Formation of primer dimers is a common problem in existing methods for DNA or RNA amplification using random primers. In order to achieve efficient priming for each individual sequence, random primers must be applied at very high concentrations. The efficiency of annealing to a specific target DNA or RNA template or the entire population of template molecules is greatly reduced by the formation of primer-dimers resulting from the high primer concentrations required for efficient priming.

(90) Other problems known in the art when using random primers to amplify DNA include an inability to amplify the genome in its entirety due to locus dropout (loss), generation of short amplification products, and in some cases, the inability to amplify degraded or artificially fragmented DNA.

(91) The described invention utilizes a novel type of oligonucleotide primer comprising at least as the majority of its sequence only two types of nucleotide bases that do not participate in stable Watson-Crick pairing with each other, and thus do not self-prime. The primers comprise a constant known sequence at their 5′end and a variable degenerate nucleotide sequence located 3′ to the constant known sequence. There are four possible two-base combinations known not to participate in Watson-Crick base pairing: C-T, G-A, A-C and G-T. They suggest four different types of degenerate primers that should not form a single Watson-Crick base pair that could lead to the generation of primer-dimers in the presence of DNA polymerase and dNTPs. These primers are illustrated in FIG. 2A and are referred to as primers Y, R, M and K, respectively, in accordance with common nomenclature for degenerate nucleotides: Y=C or T, R=G or A, M=A or C and K=G or T.

(92) For example, Y-primers have a 5′ known sequence Y.sub.U comprised of C and T bases and a degenerate region (Y).sub.10 at the 3′ end comprising ten, for example, randomly selected pyrimidine bases of C and T. R-primers have a 5′ known sequence R.sub.U comprised of G and A bases and a degenerate region (R).sub.10 at the 3′ end comprising ten, for example, randomly selected purine bases of G and A. M-primers have a 5′ known sequence M.sub.U comprised of A and C bases and a degenerate region (M).sub.10 at the 3′ end comprising ten for example, randomly selected bases of A and C. Finally, K-primers have a 5′ known sequence K.sub.U comprised of G and T bases and a degenerate region (K).sub.10 at the 3′ end comprising ten, for example, randomly selected bases of G and T. Primers of the described design will not self-prime and thus will not form primer dimers. For this reason, the term “self-inert primers” is used herein. However, they will prime at target sites containing the corresponding Watson-Crick base partners, albeit with reduced overall frequency compared to completely random primers. In specific embodiments, these primers under specific conditions are capable of forming primer dimers, but at a greatly reduced level compared to primers lacking such structure.

(93) In some embodiments, these primers are supplemented with a completely random (i.e. containing any of the four bases) short nucleotide sequence at their 3′ end. Such primers are shown on FIG. 2 and labeled as YN, RN, MN and KN. If a limited number of completely random bases are present at the 3′ end of the Y, R, M or K primers, that will increase their priming frequency, yet maintain limited ability for self-priming. By using a different number of completely random bases at the 3′ end of the degenerate Y, R, M or K primers and by carefully optimizing the reaction conditions, one can precisely control the outcome of the polymerization reaction in favor of the desired DNA product with minimum primer-dimer formation.

(94) Thus, in the first step of library synthesis primers of the described design are randomly incorporated in an extension/polymerization reaction with a DNA polymerase possessing at least a limited strand-displacement activity. The resulting branching process creates DNA molecules having known (universal) self-complementary sequences at their ends. In a second step referred to as the “amplification” step, these molecules are amplified exponentially by polymerase chain reaction using Taq polymerase (or other thermostable DNA polymerase) and a single primer corresponding to at least part of the known 5′-tail of the random primers. FIG. 1 presents a schematic outline of the invention. The invention overcomes major problems known in the art for DNA and RNA amplification by previously described random primers.

(95) 1. Source of Nucleic Acid

(96) Single-stranded or double-stranded nucleic acid of any source or complexity, or fragments thereof, can be used as a source material and amplified by the method described in the invention. That is, in some embodiments single stranded DNA is obtained and processed according to the methods described herein, and in other embodiments double stranded DNA is obtained and manipulated to generate ssDNA, wherein the ssDNA is subjected to the methods described herein. In a specific embodiment, dsDNA is denatured with heat, chemical treatment (such as alkaline pH), mechanical manipulation, radiation, or a combination thereof. In another specific embodiment, substantially single stranded RNA is obtained and processed according to the methods described herein. In a specific embodiment, total nucleic acid is obtained as a mixture of double stranded DNA and single stranded RNA molecules and then processed to selectively amplify the DNA fraction or RNA fraction only, or both separately, or both in a mixture.

(97) 2. Design of Degenerate Primers

(98) FIG. 2 illustrates the design of degenerate primers utilized in this aspect of the invention. In principle, the invention employs application of oligonucleotide primers comprising a constant known sequence at their 5′end (which may be referred to as universal sequence) and a variable degenerate nucleotide sequence at their 3′ end, each comprised of any of at least four possible base combinations known not to participate in Watson-Crick base pairing. The possible primer compositions include pyrimidines only (C and T), purines only (A and G), or non-pairing purines and pyrimidines (A and C or G and T). The last combination (G and T) is known in the art to permit non-canonical Watson-Crick base-pairing. In a preferred embodiment, the G and T pair is utilized in the invention. In a specific embodiment, the primers comprise a constant part of about 18 base sequence comprised of C and T, G and A, A and C, or G and T bases at the 5′ end, followed by about 10 random Y, R, M or K bases, respectively, and between 0 and about 6 completely random bases, N, at the 3′ end (FIG. 2, Table III, primers 1-7). Examples 1 and 2 show that Y and YN primers form only a limited amount of primer-dimers, and this is proportional to the number of completely random bases N at their 3′ termini. In contrast, a primer of similar design but comprised of bases that can participate in Watson-Crick base-pairing generates an excessive amount of primer-dimers, which greatly reduces the efficiency of DNA or RNA amplification (see Example 2).

(99) The choice of primers will depend on the base composition, complexity, and the presence and abundance of repetitive elements in the target DNA or RNA. By combining the products of individual amplification reactions with degenerate primers comprising different non-Watson-Crick pairs, but having the same known sequence at the ends, one can achieve the highest possible level of representative and uniform DNA amplification. A skilled artisan recognizes how to select the optimal primers and reaction conditions to achieve the desired result.

(100) Example 2 describes a comparison of different pyrimidine-only primers in their ability to form primer-dimers, efficiency of amplification, and uniformity (representation of randomly selected genomic markers) in a human whole genome amplification reaction with Klenow fragment of DNA Polymerase I. Of all pyrimidine-only primers tested, primers with two random 3′ bases (Y(N).sub.2) result in the most uniform whole genome amplification and at the same time form undetectable amounts of primer dimers. Thus, in a preferred embodiment degenerate primers comprising between about 1 and about 3 completely random bases at their 3′ end are utilized.

(101) 3. Choice of DNA Polymerases

(102) In a preferred embodiment, a DNA polymerase is utilized that possesses strand-displacement activity. Preferred strand-displacement DNA polymerases are: Klenow fragment of E. coli DNA polymerase I, exo− DNA polymerases of the T7 family, i.e. polymerases that require host thioredoxin subunit as co-factor, such as: T7, T3, fI, fII, W31, H, Y, gh-1, SP6, or All22, Studier (1979), exo− Bst large fragment, Bca DNA polymerase, 9° Nm polymerase, MMLV Reverse Transcriptase, AMV Reverse Transcriptase, HIV Reverse Transcriptase, phage f29 polymerase, phage M2 polymerase, phage fPRD1 polymerase, exo− VENT polymerase, and phage T5 exo− DNA polymerase.

(103) Klenow exo− fragment of DNA Polymerase I, phage T7 DNA polymerase with reduced or eliminated 3′-5′ exonuclease activities, and MMLV Reverse Transcriptase are most preferred in the present invention. Thus, in a preferred embodiment the Klenow exo− fragment of DNA Polymerase I, or Sequenase version 2 is used as the polymerase for whole genome amplification (Example 2), and MMLV reverse transcriptase is used as the polymerase for whole transcriptome amplification (Example 14).

(104) 4. Reaction Conditions

(105) In general, factors increasing priming efficiency, such as reduced temperature or elevated salt and/or Mg.sup.2+ ion concentration, inhibit the strand-displacement activity and the rate of DNA polymerases, and elevated temperatures and low Mg.sup.2+ ion or salt concentrations increase the efficiency of polymerization/strand-displacement but reduce the priming efficiency. On the other hand, factors promoting efficient priming also increase the chances of primer-dimer formation. Strand-displacement activity can be facilitated by several protein factors. Any polymerase that can perform strand-displacement replication, in the presence or in the absence of such strand-displacement or processivity enhancing factors, is suitable for use in the disclosed invention, even if the polymerase does not perform strand-displacement replication in the absence of such factor. Factors useful in strand-displacement replication are (i) any of a number of single-stranded DNA binding proteins (SSB proteins) of bacterial, viral, or eukaryotic origin, such as SSB protein of E. coli, phage T4 gene 32 product, phage T7 gene 2.5 protein, phage Pf3 SSB, replication protein A RPA32 and RPA14 subunits (Wold, 1997); (ii) other DNA binding proteins, such as adenovirus DNA-binding protein, herpes simplex protein ICP8, BMRF1 polymerase accessory subunit, herpes virus UL29 SSB-like protein; (iii) any of a number of replication complex proteins known to participate in DNA replication such as phage T7 helicase/primase, phage T4 gene 41 helicase, E. coli Rep helicase, E. coli recBCD helicase, E. coli and eukaryotic topoisomerases (Champoux, 2001).

(106) The exact parameters of the polymerization reaction will depend on the choice of polymerase and degenerate primers and a skilled artisan recognizes based on the teachings provided herein how to modify such parameters. By varying the number of random bases at the 3′ end of the degenerate primers and by carefully optimizing the reaction conditions, formation of primer-dimers can be kept to a minimum and at the same time the amplification efficiency and representation can be maximized.

(107) Random fragmentation of DNA, and if necessary, RNA can be performed by mechanical, chemical, or enzymatic treatment as described. In a preferred embodiment, DNA is fragmented by heating at about 95° C. in low salt buffers such as TE (10 mM Tris-HCl, 1 mM EDTA, having pH between 7.5 and 8.5) or TE-L (10 mM Tris-HCl, 0.1 mM EDTA, having pH between 7.5 and 8.5) for between about 1 min and about 10 min (for example, see U.S. patent application Ser. No. 10/293,048, filed Nov. 13, 2002, incorporated by reference herein in its entirety).

(108) An exemplary library synthesis reaction of the present invention is performed in a mixture having volume ranging between about 10 and about 25 μl. The reaction mixture preferably comprises about 0.5 to about 100 ng of thermally or mechanically fragmented DNA, or in particular embodiments less than about 0.5 ng DNA, about 0.5-about 30 μM of self-inert degenerate primer, about 0-about 200 nM of known sequence primer (i.e., primer corresponding to the known 5′ end of the respective degenerate primer), between about 2 and about 10 units of Klenow Exo.sup.− (New England Biolabs) or Sequenase version 2 (USB Corporation), between 0-about 360 ng SSB protein, and between about 5-about 10 mM MgCl.sub.2, and between 0 and about 100 mM NaCl. The reaction buffer preferably has a buffering capacity that is operative at physiological pH between about 6.5 and about 9. Preferably, the incubation time of the reaction is between about 10-about 180 min, and the incubation temperature between about 12° C. and about 37° C. Incubation is performed by cycling between about 12° C. and about 37° C. for a total of 3 to 5 min per cycle, or preferably by a single isothermal step between about 12° C. and about 30° C. or sequential isothermal steps between about 12° C. and about 37° C. The reaction is terminated by addition of a sufficient amount of EDTA to chelate Mg.sup.2+ or preferably by heat-inactivation of the polymerase, or both.

(109) In a preferred embodiment of the present invention, the library synthesis reaction is performed in a volume of about 15 μl. The reaction mixture comprises about 5 ng or less of thermally or mechanically fragmented DNA, for example, about 2 μM of self-inert degenerate primer K(N).sub.2 comprising G and T bases at the known and degenerate regions and 2 completely random 3′ bases, (Table III, primer #14), between about 2 units and about 4 units of Sequenase version 2 DNA polymerase (USB Corporation), between about 5 mM and about 10 mM MgCl.sub.2, about 100 mM NaCl, about 10 mM Tris-HCl buffer having pH of about 7.5, and about 7.5 mM dithiothreitol. Preferably, the incubation time of the reaction is between about 60 min and about 120 min and the incubation temperature is about 24° C. in an isothermal mode or in another preferred embodiment by sequential isothermal steps at between about 16° C. and about 37° C.

(110) In another preferred embodiment of the present invention, the library synthesis reaction is performed in a volume of about 20 μl. The reaction mixture comprises about 25 ng or less of thermally or fragmented or unfragmented RNA, for example, about 1 μM of self-inert degenerate primer K(N).sub.2 comprising G and T bases at the known and degenerate regions and 2 completely random 3′ bases, (Table III, primer #14), about 200 nM of a primer K(T).sub.20 comprising G and T bases at the 5′ known and poly T bases at the 3′ end (Table III, primer #19) between about 50 units and about 200 units of MMLV Reverse transcriptase (Epicentre Corporation), between about 3 mM and about 10 mM MgCl.sub.2, about 75 mM KCl, about 50 mM Tris-HCl buffer having pH of about 8.3, and about 10 mM dithiothreitol. Preferably, the incubation time of the reaction is between about 30 min and about 120 min and the incubation temperature is about 42° C. in an isothermal mode or in another preferred embodiment by sequential isothermal steps at between about 24° C. and about 42° C.

(111) A typical amplification step with known sequence primer comprises between about 1 and about 10 ng of library synthesis products and between about 0.3 and about 2 μM of known sequence primer in a standard PCR reaction well known in the art, under conditions optimal for thermostable DNA polymerases, such as Taq DNA polymerase, Pfu polymerase, or derivatives and mixtures thereof. For sequences known to be difficult to amplify, such as those high in G/C content that are known otherwise to benefit from PCR optimization efforts such as temperature and time of denaturation and polymerization steps, reaction additives such as DMSO and/or 7-Deaza dGTP may also improve representation in libraries constructed by the method of the invention.

III. Nucleic Acids

(112) The term “nucleic acid” or “polynucleotide” will generally refer to at least one molecule or strand of DNA, RNA, DNA-RNA chimera or a derivative or analog thereof, comprising at least one nucleobase, such as, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g. adenine “A,” guanine “G,” thymine “T” and cytosine “C”) or RNA (e.g. A, G, uracil “U” and C). The term “nucleic acid” encompasses the terms “oligonucleotide” and “polynucleotide.” The term “oligonucleotide” refers to at least one molecule of between about 3 and about 100 nucleobases in length. The term “polynucleotide” refers to at least one molecule of greater than about 100 nucleobases in length. These definitions generally refer to at least one single-stranded molecule, but in specific embodiments will also encompass at least one additional strand that is partially, substantially, or fully complementary to at least one single-stranded molecule. Thus, a nucleic acid may encompass at least one double-stranded molecule or at least one triple-stranded molecule that comprises one or more complementary strand(s) or “complement(s)” of a particular sequence comprising a strand of the molecule. As used herein, a single stranded nucleic acid may be denoted by the prefix “ss”, a double stranded nucleic acid by the prefix “ds”, and a triple stranded nucleic acid by the prefix “ts.”

(113) Nucleic acid(s) that are “complementary” or “complement(s)” are those that are capable of base-pairing according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding complementarity rules. However, in a specific embodiment, a primer of the present invention comprises a majority of nucleotides that are incapable of forming standard Watson-Crick base pairs, particularly with other nucleotides within the same primer.

(114) As used herein, the term “complementary” or “complement(s)” may refer to nucleic acid(s) that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above. The term “substantially complementary” may refer to a nucleic acid comprising at least one sequence of consecutive nucleobases, or semiconsecutive nucleobases if one or more nucleobase moieties are not present in the molecule, are capable of hybridizing to at least one nucleic acid strand or duplex even if less than all nucleobases do not base pair with a counterpart nucleobase. In certain embodiments, a “substantially complementary” nucleic acid contains at least one sequence in which about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, to about 100%, and any range therein, of the nucleobase sequence is capable of base-pairing with at least one single or double stranded nucleic acid molecule during hybridization. In certain embodiments, the term “substantially complementary” refers to at least one nucleic acid that may hybridize to at least one nucleic acid strand or duplex in stringent conditions. In certain embodiments, a “partially complementary” nucleic acid comprises at least one sequence that may hybridize in low stringency conditions to at least one single or double stranded nucleic acid, or contains at least one sequence in which less than about 70% of the nucleobase sequence is capable of base-pairing with at least one single or double stranded nucleic acid molecule during hybridization.

(115) As used herein, “hybridization”, “hybridizes” or “capable of hybridizing” is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term “hybridization”, “hybridize(s)” or “capable of hybridizing” encompasses the terms “stringent condition(s)” or “high stringency” and the terms “low stringency” or “low stringency condition(s).”

(116) As used herein “stringent condition(s)” or “high stringency” are those that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but precludes hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating at least one nucleic acid, such as a gene or nucleic acid segment thereof, or detecting at least one specific mRNA transcript or nucleic acid segment thereof, and the like.

(117) Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50° C. to about 70° C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence of formamide, tetramethylammonium chloride or other solvent(s) in the hybridization mixture. It is generally appreciated that conditions may be rendered more stringent, such as, for example, the addition of increasing amounts of formamide.

(118) It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting example only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned, it is preferred to employ varying conditions of hybridization to achieve varying degrees of selectivity of the nucleic acid(s) towards target sequence(s). In a non-limiting example, identification or isolation of related target nucleic acid(s) that do not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed “low stringency” or “low stringency conditions”, and non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20° C. to about 50° C. Of course, it is within the skill of one in the art to further modify the low or high stringency conditions to suite a particular application.

(119) As used herein a “nucleobase” refers to a naturally occurring heterocyclic base, such as A, T, G, C or U (“naturally occurring nucleobase(s)”), found in at least one naturally occurring nucleic acid (i.e. DNA and RNA), and their naturally or non-naturally occurring chimeras, derivatives, and analogs. Non-limiting examples of nucleobases include purines and pyrimidines, as well as derivatives and analogs thereof, which generally can form one or more hydrogen bonds (“anneal” or “hybridize”) with at least one naturally occurring nucleobase in a manner that may substitute for naturally occurring nucleobase pairing (e.g. the hydrogen bonding between A and T, G and C, and A and U).

(120) As used herein, a “nucleotide” refers to a nucleoside further comprising a “backbone moiety” generally used for the covalent attachment of one or more nucleotides to another molecule or to each other to form one or more nucleic acids. The “backbone moiety” in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3′- or 5′-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when the nucleotide comprises derivatives or mimics of a naturally occurring 5-carbon sugar or phosphorus moiety, and non-limiting examples are described herein.

IV. Amplification of Nucleic Acids

(121) Nucleic acids useful as templates for amplification are generated by methods described herein. In a specific embodiment, the DNA molecule from which the methods generate the nucleic acids for amplification may be isolated from cells, tissues or other samples according to standard methodologies (Sambrook et al., 1989).

(122) The term “primer,” as used herein, is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process. Typically, primers are oligonucleotides from ten to twenty and/or thirty base pairs in length, but longer sequences can be employed. Primers may be provided in double-stranded and/or single-stranded form, although the single-stranded form is preferred.

(123) Pairs of primers designed to selectively hybridize to nucleic acids are contacted with the template nucleic acid under conditions that permit selective hybridization. Depending upon the desired application, high stringency hybridization conditions may be selected that will only allow hybridization to sequences that are completely complementary to the primers. In other embodiments, hybridization may occur under reduced stringency to allow for amplification of nucleic acids containing one or more mismatches with the primer sequences. Once hybridized, the template-primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also referred to as “cycles,” are conducted until a sufficient amount of amplification product is produced.

(124) The amplification product may be detected or quantified. In certain applications, the detection may be performed by visual means. Alternatively, the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of incorporated radiolabel or fluorescent label or even via a system using electrical and/or thermal impulse signals (Affymax technology).

(125) A number of template dependent processes are available to amplify the oligonucleotide sequences present in a given template sample. One of the best known amplification methods is the polymerase chain reaction (referred to as PCR™) which is described in detail in U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159, and in Innis et al., 1990, each of which is incorporated herein by reference in their entirety. Briefly, two synthetic oligonucleotide primers, which are complementary to two regions of the template DNA (one for each strand) to be amplified, are added to the template DNA (that need not be pure), in the presence of excess deoxynucleotides (dNTP's) and a thermostable polymerase, such as, for example, Taq (Thermus aquaticus) DNA polymerase. In a series (typically 30-35) of temperature cycles, the target DNA is repeatedly denatured (around 95° C.), annealed to the primers (typically at 50-60° C.) and a daughter strand extended from the primers (72° C.). As the daughter strands are created they act as templates in subsequent cycles. Thus, the template region between the two primers is amplified exponentially, rather than linearly.

(126) A reverse transcriptase PCR™ amplification procedure may be performed to quantify the amount of mRNA amplified. Methods of reverse transcribing RNA into cDNA are well known and described in Sambrook et al., 1989. Alternative methods for reverse transcription utilize thermostable DNA polymerases. These methods are described in WO 90/07641. Polymerase chain reaction methodologies are well known in the art. Representative methods of RT-PCR™ are described in U.S. Pat. No. 5,882,864.

(127) A. LCR

(128) Another method for amplification is the ligase chain reaction (“LCR”), disclosed in European Patent Application No. 320,308, incorporated herein by reference. In LCR, two complementary probe pairs are prepared, and in the presence of the target sequence, each pair will bind to opposite complementary strands of the target such that they abut. In the presence of a ligase, the two probe pairs will link to form a single unit. By temperature cycling, as in PCR™, bound ligated units dissociate from the target and then serve as “target sequences” for ligation of excess probe pairs. U.S. Pat. No. 4,883,750, incorporated herein by reference, describes a method similar to LCR for binding probe pairs to a target sequence.

(129) B. Qbeta Replicase

(130) Qbeta Replicase, described in PCT Patent Application No. PCT/US87/00880, also may be used as still another amplification method in the present invention. In this method, a replicative sequence of RNA which has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase. The polymerase will copy the replicative sequence which can then be detected and quantified

(131) C. Isothermal Amplification

(132) An isothermal amplification method, in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide thiophosphates in one strand of a restriction site also may be useful in the amplification of nucleic acids in the present invention. Such an amplification method is described by Walker et al. 1992, incorporated herein by reference.

(133) D. Strand Displacement Amplification

(134) Strand Displacement Amplification (SDA) is another method of carrying out isothermal amplification of nucleic acids which involves multiple rounds of strand displacement and synthesis, i.e., nick translation. A similar method, called Repair Chain Reaction (RCR), involves annealing several probes throughout a region targeted for amplification, followed by a repair reaction in which only two of the four bases are present. The other two bases can be added as biotinylated derivatives for easy detection. A similar approach is used in SDA.

(135) E. Cyclic Probe Reaction

(136) Target specific sequences can also be detected using a cyclic probe reaction (CPR). In CPR, a probe having 3′ and 5′ sequences of non-specific DNA and a middle sequence of specific RNA is hybridized to DNA which is present in a sample. Upon hybridization, the reaction is treated with RNase H, and the products of the probe identified as distinctive products which are released after digestion. The original template is annealed to another cycling probe and the reaction is repeated.

(137) F. Transcription-Based Amplification

(138) Other nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR, Kwoh et al., 1989; PCT Patent Application WO 88/10315, each incorporated herein by reference).

(139) In NASBA, the nucleic acids can be prepared for amplification by standard phenol/chloroform extraction, heat denaturation of a clinical sample, treatment with lysis buffer and minispin columns for isolation of DNA and RNA or guanidinium chloride extraction of RNA. These amplification techniques involve annealing a primer which has target specific sequences. Following polymerization, DNA/RNA hybrids are digested with RNase H while double stranded DNA molecules are heat denatured again. In either case the single stranded DNA is made fully double stranded by addition of a second target specific primer, followed by polymerization. The double-stranded DNA molecules are then multiply transcribed by an RNA polymerase, such as T7 or SP6. In an isothermal cyclic reaction, the RNAs are reverse transcribed into double stranded DNA, and transcribed once again with an RNA polymerase, such as T7 or SP6. The resulting products, whether truncated or complete, indicate target specific sequences.

(140) G. Rolling Circle Amplification

(141) Rolling circle amplification (U.S. Pat. No. 5,648,245) is a method to increase the effectiveness of the strand displacement reaction by using a circular template. The polymerase, which does not have a 5′ exonuclease activity, makes multiple copies of the information on the circular template as it makes multiple continuous cycles around the template. The length of the product is very large—typically too large to be directly sequenced. Additional amplification is achieved if a second strand displacement primer is added to the reaction using the first strand displacement product as a template.

(142) H. Other Amplification Methods

(143) Other amplification methods, as described in British Patent Application No. GB 2,202,328, and in PCT Patent Application No. PCT/US89/01025, each incorporated herein by reference, may be used in accordance with the present invention. In the former application, “modified” primers are used in a PCR™ like, template and enzyme dependent synthesis. The primers may be modified by labeling with a capture moiety (e.g., biotin) and/or a detector moiety (e.g., enzyme). In the latter application, an excess of labeled probes are added to a sample. In the presence of the target sequence, the probe binds and is cleaved catalytically. After cleavage, the target sequence is released intact to be bound by excess probe. Cleavage of the labeled probe signals the presence of the target sequence.

(144) Miller et al., PCT Patent Application WO 89/06700 (incorporated herein by reference) disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter/primer sequence to a target single-stranded DNA (“ssDNA”) followed by transcription of many RNA copies of the sequence. This scheme is not cyclic, i.e., new templates are not produced from the resultant RNA transcripts.

(145) Other suitable amplification methods include “RACE” and “one-sided PCR™” (Frohman, 1990; Ohara et al., 1989, each herein incorporated by reference). Methods based on ligation of two (or more) oligonucleotides in the presence of nucleic acid having the sequence of the resulting “di-oligonucleotide”, thereby amplifying the di-oligonucleotide, also may be used in the amplification step of the present invention, Wu et al., 1989, incorporated herein by reference).

V. Enzymes

(146) Enzymes that may be used in conjunction with the invention include nucleic acid modifying enzymes listed in the following tables.

(147) TABLE-US-00001 TABLE I POLYMERASES AND REVERSE TRANSCRIPTASES Thermostable DNA Polymerases: OmniBase ™ Sequencing Enzyme Pfu DNA Polymerase Taq DNA Polymerase Taq DNA Polymerase, Sequencing Grade TaqBead ™ Hot Start Polymerase AmpliTaq Gold Tfl DNA Polymerase Tli DNA Polymerase Tth DNA Polymerase DNA Polymerases: DNA Polymerase I, Klenow Fragment, Exonuclease Minus DNA Polymerase I DNA Polymerase I Large (Klenow) Fragment Terminal Deoxynucleotidyl Transferase T4 DNA Polymerase Reverse Transcriptases: AMV Reverse Transcriptase MMLV Reverse Transcriptase HIV Reverse Transcriptase

(148) TABLE-US-00002 TABLE II DNA/RNA MODIFYING ENZYMES Ligases: T4 DNA Ligase Kinases T4 Polynucleotide Kinase

VI. DNA Polymerases

(149) In a preferred embodiment, a DNA polymerase is used in methods of the present invention. In some embodiments, it is envisioned that the methods of the invention could be carried out with one or more enzymes where multiple enzymes combine to carry out the function of a single DNA polymerase molecule retaining 5′-3′ exonuclease activities. Effective polymerases that retain 5′-3′ exonuclease activity include, for example, E. coli DNA polymerase I, Taq DNA polymerase, S. pneumoniae DNA polymerase I, Tfl DNA polymerase, D. radiodurans DNA polymerase I, Tth DNA polymerase, Tth XL DNA polymerase, M. tuberculosis DNA polymerase I, M. thermoautotrophicum DNA polymerase I, Herpes simplex-1 DNA polymerase, E. coli DNA polymerase I Klenow fragment, Vent DNA polymerase, thermosequenase and wild-type or modified T7 DNA polymerases. In preferred embodiments, the effective polymerase is E. coli DNA polymerase I, Klenow, or Taq DNA polymerase, or MMLV reverse transcriptase.

(150) Where a break in the substantially double stranded nucleic acid template is a gap of at least a base or nucleotide in length that comprises, or is reacted to comprise, a 3′ hydroxyl group, the range of effective polymerases that may be used is even broader. In such aspects, the effective polymerase may be, for example, E. coli DNA polymerase I, Taq DNA polymerase, S. pneumoniae DNA polymerase I, Tfl DNA polymerase, D. radiodurans DNA polymerase I, Tth DNA polymerase, Tth XL DNA polymerase, M. tuberculosis DNA polymerase I, M. thermoautotrophicum DNA polymerase I, Herpes simplex-1 DNA polymerase, E. coli DNA polymerase I Klenow fragment, T4 DNA polymerase, Vent DNA polymerase, thermosequenase or a wild-type or modified T7 DNA polymerase. In preferred aspects, the effective polymerase is E. coli DNA polymerase I, M. tuberculosis DNA polymerase I, Taq DNA polymerase, or T4 DNA polymerase.

VII. Hybridization

(151) Depending on the application envisioned, one would desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of the probe or primers for the target sequence, such as in the adaptor. For applications requiring high selectivity, one will typically desire to employ relatively high stringency conditions to form the hybrids. For example, relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50° C. to about 70° C. Such high stringency conditions tolerate little, if any, mismatch between the probe or primers and the template or target strand and would be particularly suitable for isolating specific genes or for detecting specific mRNA transcripts. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.

(152) Conditions may be rendered less stringent by increasing salt concentration and/or decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25 M NaCl at temperatures of about 37° C. to about 55° C., while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20° C. to about 55° C. Hybridization conditions can be readily manipulated depending on the desired results.

(153) In other embodiments, hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 35 mM MgCl.sub.2, 1.0 mM dithiothreitol, at temperatures between approximately 20° C. to about 37° C. Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl.sub.2, at temperatures ranging from approximately 40° C. to about 72° C.

EXAMPLES

(154) The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1: Design of Degenerate Pyrimidine Primers and Analysis of Self-Priming and Extension

(155) Pyrimidine primers comprising a constant 18 base sequence, followed by 10 random pyrimidines and between 0 and 6 completely random bases at the 3′ end (Table III, primers 1-7), are compared for their ability to self prime and to extend a model template oligonucleotide.

(156) TABLE-US-00003 TABLE III OLIGONUCLEOTIDE SEQUENCES No Code Sequence 5′-3′ *  1. Y CCTTTCTCTCCCTTCTCTYYYYYYYYYY (SEQ ID NO: 11)  2. YN CCTTTCTCTCCCTTCTCTYYYYYYYYYYN (SEQ ID NO: 12)  3. Y(N).sub.2 CCTTTCTCTCCCTTCTCTYYYYYYYYYYNN (SEQ ID NO: 13)  4. Y(N).sub.3 CCTTTCTCTCCCTTCTCTYYYYYYYYYYNNN (SEQ ID NO: 14)  5. Y(N).sub.4 CCTTTCTCTCCCTTCTCTYYYYYYYYYNNNN (SEQ ID NO: 15)  6. Y(N).sub.5 CCTTTCTCTCCCTTCTCTYYYYYYYYYYNNNNN (SEQ ID NO: 16)  7. Y(N).sub.6 CCTTTCTCTCCCTTCTCTYYYYYYYYYYNNNNNN (SEQ ID NO: 17)  8 Y.sub.U CCTTTCTCTCCCTTCTCT (SEQ ID NO: 18)  9. Template GTAATACGACTCACTATAGGRRRRRRRRRR (SEQ ID NO: 19) 10. R(N).sub.2 AGAGAAGGGAGAGAAAGGRRRRRRRRRRNN (SEQ ID NO: 20) 11. R.sub.U AGAGAAGGGAGAGAAAGG (SEQ ID NO: 21) 12. M(N).sub.2 CCAAACACACCCAACACAMMMMMMMMMMNN (SEQ ID NO: 22) 13. M.sub.U CCAAACACACCCAACACA (SEQ ID NO: 23) 14. K(N).sub.2 TGTGTTGGGTGTGTTTGGKKKKKKKKKKNN (SEQ ID NO: 24) 15. K TGTGTTGGGTGTGTTTGGKKKKKKKKKK (SEQ ID NO: 25) 16. K.sub.U TGTGTTGGGTGTGTTTGG (SEQ ID NO: 26) 17 T7(N).sub.6 GTAATACGACTCACTATAGGNNNNNN (SEQ ID NO: 27) 18. T7 GTAATACGACTCACTATAGG (SEQ ID NO: 28) 19. K(T20) TGTGTTGGGTGTGTTTGGTTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 29) * Random bases definitions: Y = C or T; R = A or G; M = A or C; K = G or T

(157) The model template oligonucleotide (Table III, Oligonucleotide 9) was comprised of T7 promoter sequence followed by 10 random purine bases at its 3′-terminus. The reaction mixture contained 1× ThermoPol reaction buffer (NEB), 4 units of Bst DNA Polymerase Large Fragment (NEB), 200 uM dNTPS, 350 nM template oligo 9, and 3.5 or 35 μM of degenerate pyrimidine primers Y and YN (Table III, primers 1 to 7) in a final volume of 25 Controls comprising no dNTPs are also included for each Y or YN primer. Samples were incubated for 5 min or 15 min at 45° C. and stopped by adding 2 μl of 0.5 M EDTA. Aliquots of the reactions were analyzed on 10% TB-urea denaturing polyacrylamide gels (Invitrogen) after staining with SybrGold dye (Molecular Probes). FIG. 3 shows the result of the comparison experiment. No evidence of self-priming was found with primers having up to 3 random bases at their 3′-end when applied at 35 μM concentration after 5 min incubation with Bst polymerase and dNTPs at 45° C. (FIG. 3A). In contrast, in the samples containing template oligonucleotide, a new band corresponding to extension products was observed at both 35 μM and 3.5 μM primers concentration (FIG. 3B). In a separate experiment degenerate pyrimidine primers having up to six random bases at the 3′-end were analyzed for their ability to self-prime (FIG. 3C). After 15 min of incubation with Bst polymerase, no extension products were observed with primers having 3 random bases or less (FIG. 3C, lanes 1-3), whereas the primers with higher complexity (N3 and above) showed progressively increasing amount of extension products (FIG. 3C, lanes 4-6). Control samples incubated with Bst polymerase but no dNTPs, showed no extension products (FIG. 3C, lanes 7-12).

Example 2: Comparison of Different Degenerate Pyrimidine Primers Used in the Library Synthesis with Klenow Exo− Fragment of DNA Polymerase-I and Subsequent Whole Genome Amplification

(158) Human lymphocyte genomic DNA isolated by standard procedures was randomly fragmented in TE buffer to an average size of 1.5 Kb using the Hydro Shear™ device (Gene Machines; Palo Alto, Calif.). The reaction mixture contained 50 ng of fragmented DNA in 1× EcoPol buffer (NEB), 200 μM of each dNTP, 360 ng of Single Stranded DNA Binding Protein (USB), 500 nM of known Y.sub.U primer (Table III, primer 8), and 1 μM of degenerate pyrimidine primers with 0 to 6 random 3′ bases (Table III, primers 1-7) or 1 μM of T7 primer with six random N bases at the 3′ end (Table III, T7(N).sub.6 primer 16,) in a final volume of 25 μl. After a denaturing step of 2 min at 95° C., the samples were cooled to 16° C., and the reaction was initiated by adding 5 units of Klenow enzyme that lacks 3′-5′ exonuclease activity (NEB). WGA library synthesis was carried out in a three-step protocol for 10 min at 16° C., 10 min at 24° C., and 15 min at 37° C. Reactions were stopped with 1 μl of 250 mM EDTA (pH 8.0), and samples were heated for 3 min at 95° C. Aliquots were analyzed on a 1% agarose gel after staining with EtBr (FIG. 4). FIG. 4 shows that under the conditions used in the assay, primer dimers were formed only when using YN primers with 3 or more completely random 3′ bases. The amount of dimers increased progressively with an increase in the number of random bases (FIG. 4, lanes 4-7). In contrast, no primer dimers were formed when using primers with up to 2 completely random 3′ bases (FIG. 4, lanes 1-3). When a primer containing a constant T7 promoter sequence (which contains both purines and pyrimidines) and completely random hexamers at its 3′ end was used (Table III, primer 16), excessive amount of dimers was generated (FIG. 4, lane 8).

(159) Aliquots of the library reactions corresponding to 5 ng of input DNA were further amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 μM each dNTP, 100,000× dilutions of fluorescein and SybrGold I (Molecular Probes), 1 μM known Y.sub.U primer (or in the case of degenerate T7(N).sub.6 primers, known primer T7 (Table III, primer 17), 5 units of Titanium Taq polymerase (Clontech), and 3 μl aliquots (approximately 5 ng input genomic DNA) of the Klenow library synthesis reactions in a final volume of 50 μl. Reactions were carried out for 18 cycles at 94° C. for 15 sec and 65° C. for 2 min on I-Cycler™ real-time PCR instruments (Bio-Rad). FIG. 5 shows the chromatograms of the real-time PCR. All degenerate pyrimidine primers showed similar efficiency of amplification with a signal corresponding to 50% of the maximum centered around cycle 9, whereas the T7 sequence with random hexamers at the 3′ end (Table III, primer 16) is more than an order of magnitude less efficient (4 cycles right shifted) due to formation of excessive primer dimers (see FIG. 5, lane 8).

(160) Representation analysis of the samples prepared with pyrimidine primers with 0 to 6 random 3′ bases was conducted using a panel of 30 human genomic STS markers (Table IV, STS markers 1-6, 8-10, 12, 14, 16, 19, 20, 23, 26, 29-31, 35, 36, 38, 40, 41, 43, 44, 46, 47, and 49)

(161) TABLE-US-00004 TABLE IV EXEMPLARY HUMAN STS MARKERS USED FOR REPRESENTATION ANALYSIS BY QUANTITATIVE REAL-TIME PCR No * UniSTS Database Name**  1 RH18158  2 SHGC-100484  3 SHGC-82883  4 SHGC-149956  5 SHGC-146783  6 SHGC-102934  8 csnpmnat1-pcr1-1  9 stSG62224 10 SHGC-142305 12 SHGC-80958 13 SHGC-74059 14 SHGC-83724 16 SHGC-145896 19 SHGC-155401 20 csnpharp-pcr2-3 22 stb39J12.sp6 23 SHGC-149127 26 949_F_8Left 29 SHGC-148759 30 SHGC-154046 31 WI-19180 35 SHGC-146602 36 SHGC-130262 38 SHGC-130314 40 SHGC-147491 41 stSG53466 42 SHGC-105883  42a GDB:533006  42b D19S1101 43 SHGC-79237 44 SHGC-153761 46 stSG50529 47 SHGC-132199 49 stSG49452 51 SGC32543 52 SHGC-2457 53 stSG53950 54 stSG43297 55 SHGC-81536 58 stSG48086 60 stSG62388 62 stSG50542 63 stSG44393 66 SHGC-9458 67 SHGC-5506 68 SHGC-153324 69 stSG53179 70 sts-X16316 71 stSG51782 72 stSG48421 74 stGDB:442878 76 WI-6290 77 T94852 79 SHGC-11640 80 H58497 81 stSG34953 82 KIAA0108 83 Y00805 84 sts-W93373 85 stSG45551  85a Cda0ge01  85b RH18026 86 U34806 88 SHGC-12728 89 SHGC-10570 91 stSG52141 92 SHGC-58853 94 SHGC-36464 96 stSG8946 97 SHGC-10187 99 WI-13668 103  stSG49584 104  M55047 105  SHGC-102231 106  stSG60168 107  stSG50880 108  stSG39197 110  sts-AA035504 111  SGC35140 113  stSG53011 114  sts-R44709 116  SHGC-149512 117  stSG55021 118  SHGC-79529 119  KIAA0181 119a GDB:314031 119b RH28558 120  SHGC-105119 121  SHGC-79242 122  SHGC-170363 123  stSG50637 126  RH69540 130  GDB:181552 133  1770 134  1314 135  SHGC-104164 136  SHGC-101034 137  stSG62239 138  stSG60144 139  stSG58407 140  stSG58405 141  sts-T50718 144  SHGC-17057 145  sts-N90764 152  SHGC-132991 154  SHGC-57595 Alu Yb8 * Omitted sequential numbers indicate dropped STS sequences that did not amplify well in quantitative RT-PCR **Unique names of STS marker sequences are from the National Center for Biotechnology Information UniSTS database. Sequences of the STS regions as well as the forward and backward primers used in quantitative real-time PCR can be found in the UniSTS database at the National Center for Biotechnology Information's website.

(162) The material amplified by PCR with the known Y.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on an I-Cycler (Bio-Rad), as described above, in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented DNA were used for each STS, quantities were calculated by standard curve fit for each STS (I-Cycler software, Bio-Rad) and were plotted as frequency histograms (FIG. 6). Of all pyrimidine primers tested, Y(N).sub.2 supported the most uniform whole genome amplification (FIG. 6A) with Klenow fragment of DNA polymerase I, yet produced limited amount of primer dimers (FIG. 3 and FIG. 4). Eighty three percent of the STS markers analyzed after whole genome amplification with Y(N).sub.2 primer were within a factor of 2 times the mean and 90% within a factor of 3 times the mean, whereas on average these numbers were in the range of 63 to 70% and 73 to 80% respectively for all other YN-primers analyzed.

Example 3: Whole Genome Amplification of Thermally Fragmented Genomic DNA Converted into an Amplifiable DNA Library Using Klenow Exo− Fragment of DNA Polymerase-I or Sequenase Version-2 and Degenerate Primers Y(N).SUB.2

(163) Human lymphocyte genomic DNA isolated by standard procedures was randomly fragmented in TE-L buffer (10 mM Tris, 0.1 mM EDTA, pH 7.5) by heating at 95° C. for 5 min. The reaction mixture contained 100 ng of thermally fragmented DNA in 1× EcoPol buffer (NEB) or 1× Sequenase buffer (USB), 200 μM of each dNTP, 360 ng of Single Stranded DNA Binding Protein (USB), 200 nM of known Y.sub.U primer (Table III, primer 8), and 500 nM of degenerate Y(N).sub.2 primer (Table III, primer 3) in a final volume of 25 μl. After a denaturing step of 2 min at 95° C., the samples were cooled to 16° C., and the reaction initiated by adding 2.5 units or 6.5 units of Klenow Exo.sup.− polymerase (NEB) or Sequenase version 2 (USB), respectively. WGA library synthesis was carried out in a three-step protocol for 10 min at 16° C., 10 min at 24° C., and 12 min at 37° C. Reactions were stopped with 1 μl of 500 mM EDTA (pH 8.0), and samples were heated for 3 min at 75° C. Aliquots of the library synthesis reactions corresponding to 5 ng of input DNA were further amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM known Y.sub.U primer (or in the case of random T7(N).sub.6 primers, known T7 (primer 18), 5 units of Titanium Taq polymerase (Clontech), and a volume of the library synthesis reaction corresponding to 5 ng of the input genomic DNA in a final volume of 50 μl. Reactions were carried out for 17 cycles at 94° C. for 15 sec and 65° C. for 2 min on an I-Cycler real-time PCR instrument (Bio-Rad). FIG. 7 shows the chromatograms of the real-time PCR. Sequenase version 2 showed an order of magnitude higher efficiency as compared to Klenow Exo.sup.− polymerase at both concentrations tested. Aliquots of the PCR amplification reactions were analyzed on a 1% agarose gel after staining with EtBr. Sequenase synthesis yielded amplicons of larger average size compared to Klenow Exo.sup.− polymerase (FIG. 8). Representation analysis of the PCR amplified libraries generated with Sequenase or Klenow Exo-polymerases was done using a panel of 33 human genomic STS markers (Table IV, STS markers 1, 5, 6, 14, 19, 22, 26, 38, 43, 46, 47, 52, 53, 54, 58, 60, 62, 63, 69, 72, 74, 80, 81, 82, 85, 89, 91, 94, 96, 99, 104, 107, 108)

(164) The material amplified by PCR with the known Y.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), as described above in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantities were calculated by standard curve fit for each STS (I-Cycler software, Bio-Rad), and plotted as frequency histograms (FIG. 9). Sequenase library preparations resulted in a more representative amplification compared to Klenow Exo.sup.− with fewer outliers. Between 80 and 85% of the STS markers analyzed after amplification of libraries prepared with Sequenase were within a factor of 2 times the mean value, whereas those analyzed after amplification of libraries prepared with Klenow fragment of DNA polymerase I averaged 67%.

Example 4. Comparison of Degenerate Primers Y(N).SUB.2., R(N).SUB.2., M(N).SUB.2 .and K(N).SUB.2 .Comprised of Only Two Non-Complementary Bases and Containing Two Truly Random Bases at their 3′ Terminus in their Efficiency of Human Whole Genome Library Preparation and Amplification

(165) Human lymphocyte genomic DNA isolated by standard procedures was randomly fragmented in TE-L buffer by heating at 95° C. for 4 min. The reaction mixtures (one for each degenerate primer) contained 100 ng of thermally fragmented DNA in 1× EcoPol buffer (NEB), 200 μM of each dNTP, and 1 μM of degenerate Y(N).sub.2, R(N).sub.2, M(N).sub.2, or K(N).sub.2 primers (Table III, primers 3, 10, 12, and 14) in a final volume of 24 After denaturing at 95° C. for 2 min the samples were cooled to 16° C. and the library synthesis reaction was initiated by adding 1 μl (3 units) of Sequenase version 2 (USB Corporation). The reaction was carried out in a three-step protocol for 15 min at 16° C., 15 min at 24° C., and 15 min at 37° C. Reactions were stopped by adding 1 ul of 250 mM EDTA (pH 8.0) and samples were heated for 5 min at 75° C. Aliquots of the library reactions corresponding to 5 ng of input DNA were further amplified by quantitative real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 μM each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM known Y.sub.U, R.sub.U, M.sub.U, or K.sub.U primer whose sequence is identical to the known 5′ portion of the respective degenerate primer (Table III, primers 8, 11, 13, and 16), 5 units of Titanium Taq polymerase (Clontech), and 5 ng input genomic DNA equivalent of the library synthesis reactions in a final volume of 50 ul. Amplifications were carried out for 16 cycles at 94° C. for 15 sec and 65° C. for 2 min on the I-Cycler real-time PCR instrument (Bio-Rad). FIG. 10 demonstrates that degenerate primer containing guanine and thymidine (K(N).sub.2 primer) is priming most efficiently of all primers tested. Also, both guanine containing degenerate primers (R(N).sub.2 and K(N).sub.2) are more effective as compared to cytosine containing primers (M(N).sub.2 and Y(N).sub.2). These findings can be explained by the fact that guanine and thymidine can participate in non-canonical base pairing more readily compared to the other two bases. Overall K(N).sub.2 primer was about an order of magnitude more effective as compared to Y(N).sub.2 primer (FIG. 10). Representation analysis of the PCR amplified libraries generated with Sequenase was done using a panel of 35 human genomic STS markers (Table IV, STS markers 40-44, 46, 47, 49, 52, 54, 55, 58, 60, 62, 63, 66-70, 72, 74, 76, 77, 79, 80, 81-86, 88, and 89). The material amplified by PCR with known primers was purified with Qiaquick filters (Qiagen) and 10 ng aliquots were analyzed in real-time PCR. In addition, a combined sample containing 2.5 ng of each individual amplification reaction was run in parallel. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad) in a 25 μl volume. Standards corresponding to 10.1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantities were derived by standard curve fit for each STS (I-Cycler software, Bio-Rad) and plotted as frequency histograms. As shown on FIG. 11, the use of K(N).sub.2 primer resulted in the most uniform and representative DNA amplification. In this study, 91% of the STS markers analyzed after amplification with K(N).sub.2 primer were within 2 fold of the mean value, whereas for Y(N).sub.2, M(N).sub.2 and R(N).sub.2 primers they were 63%, 74%, and 83%, respectively.

Example 5. Comparison Between Different Modes of Incubation During Preparation of Whole Genome Libraries with Sequenase Version-2 and Y(N)2 Degenerate Primers and Subsequent Representative Amplification of Human DNA

(166) Human lymphocyte genomic DNA isolated by standard procedures was randomly fragmented in TE-L buffer by heating at 95° C. for 4 min. The reaction mixture contained 100 ng of thermally fragmented DNA in 1× EcoPol buffer (NEB), 200 μM of each dNTP, and 1 μM of degenerate Y(N).sub.2 primer (Table III, primer 3) in a final volume of 25 μl. After a denaturing step of 2 min at 95° C., the samples were cooled to 16° C., or 24° C. and the WGA library synthesis reactions were initiated by adding 3 units or of Sequenase version 2 (USB). The reactions were carried out in three different protocols as follows: (i) isothermal 24° C. for 1 hour (ii) cycling between 16° C., 24° C., and 37° C. for 1 min each for total of 19 cycles (total duration 1 hour), and (iii) three step incubation protocol for 20 min at 16° C., 20 min at 24° C., and 20 min at 37° C. Reactions were stopped with 1 μl of 250 mM EDTA (pH 8.0), and samples were heated for 5 min at 75° C. Aliquots of the library synthesis reactions corresponding to 5 ng of input DNA were further amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 μM each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 μM known Y.sub.U primer (or Table III, primer 8), 5 units of Titanium Taq polymerase (Clontech), and 5 ng input genomic DNA of the synthesis reactions in a final volume of 50 μl. Reactions were carried out for 17 cycles at 94° C. for 15 sec and 65° C. for 2 min on I-Cycler real-time PCR instrument (Bio-Rad). FIG. 12 shows the chromatogram of the real-time PCR. Isothermal incubation at 24° C. for 1 hour resulted in the highest efficiency of amplification, followed by the 3-step incubation protocol. The cycling incubation resulted in 2 cycles delayed kinetics as compared to isothermal incubation (FIG. 12). Representation analysis of the samples amplified by PCR following library preparation with Sequenase was done using a panel of 31 human genomic STS markers (Table IV, STS markers 40, 42-44, 46, 47, 49, 52, 54, 58, 60, 62, 66, 67, 68, 71, 72, 74, 77, 79, 80-86, 88, and 89). The material amplified by PCR with the known Y.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), as described above in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantities were derived by a standard curve fit for each STS (I-Cycler software, Bio-Rad) and plotted as frequency histograms (FIG. 13). As shown, the isothermal amplification resulted in a slightly better representation as compared to the other two incubation protocols.

Example 6. Titration of Self-Inert Degenerate Primer K(N).SUB.2 .Concentration in Human Whole Genome Amplification Protocol with Sequenase

(167) Human lymphocyte genomic DNA isolated by standard procedures was randomly fragmented in TE-L buffer by heating at 95° C. for 4 min. The reaction mixture (25 ul) contained 100 ng of thermally fragmented DNA in 1× EcoPol buffer (NEB), 200 μM of each dNTP, and 500 nM, 1 μM, 2 μM, 10 μM, or 33 μM of the self-inert degenerate primer K(N).sub.2 containing G and T bases and 2 completely random bases at the 3′ end (Table III, primer 14). After a denaturing step of 2 min at 95° C., the samples were cooled to 24° C., and the library synthesis reaction was initiated by the addition of 3 units of Sequenase version 2 DNA polymerase (USB). WGA library synthesis was carried out isothermally at 24° C. for 45 min. Reactions were stopped with 1 μl of 250 mM EDTA (pH 8.0), and samples were heated for 5 min at 75° C. Aliquots of the library synthesis reactions corresponding to 5 ng of the input DNA were further amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 μM each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM known K.sub.U primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and a volume of the library synthesis reaction corresponding to 5 ng of input genomic DNA in a final volume of 50 μl. Reactions were carried out for 15 cycles at 94° C. for 15 sec and 65° C. for 2 min on I-Cycler real-time PCR instrument (Bio-Rad). FIG. 14 shows the chromatograms of the real-time PCR. The efficiency of amplification was similar at concentrations of the self-inert degenerate primer K(N).sub.2 between 0.5 and 2 μM. At 10 μM and at 33 μM, the amplification was inhibited (FIG. 14). Representation analysis of the samples amplified by PCR was done using a panel of 17 human STS markers (Table IV, STS markers: 40-44, 46, 47, 49, 52, 54, 55, 58, 60, 62, 63, 66, and 67). The material amplified by PCR with the known K.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantities were calculated by standard curve fit for each STS (I-Cycler software, Bio-Rad), and plotted as distribution plot (FIG. 15). As shown, the representation of STS markers improved significantly by increasing the primer K(N).sub.2 concentration from 0.5 μM to 2 μM. When 10 μM or 33 μM of the primer K(N).sub.2 was applied this resulted in a compromised representation of genomic markers (FIG. 15; data not shown for 33 μM). With primer concentrations between 0.5 and 2 μM, on average 91% of the STS markers were within a factor of 2 fold the mean, whereas at 10 μM primer the percentage was 82.

Example 7. Titration of the Input Amount of DNA in Human Whole Genome Amplification with Degenerate Primer K(N).SUB.2 .and Sequenase

(168) Human lymphocyte genomic DNA isolated by standard procedures was randomly fragmented in TE-L buffer by heating at 95° C. for 4 min. The reaction mixtures contained 100 ng, 25 ng, 10 ng, or 5 ng of thermally fragmented DNA (or just TE-L buffer as negative control) in 1× EcoPol buffer (NEB), 200 μM of each dNTP, and 1 uM degenerate primer K(N).sub.2 (Table III, primer 14) in a total volume of 15 μl. After a denaturing step of 2 min at 95° C., the samples were cooled to 16° C., and the reaction initiated by adding 1.85 units of Sequenase version 2 DNA polymerase (USB). Library synthesis was done at 16° C. for 20 min 24° C. for 20 min, and 37° C. for 20 min. Reactions were stopped with 1 μl of 83 mM EDTA (pH 8.0), and samples were heated for 5 min at 75° C. Aliquots of the synthesis reactions corresponding to 5 ng of input DNA (or in the case of 5 ng DNA the entire reaction mixture) were further amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 μM each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 μM known K.sub.U primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and 5 ng input genomic DNA of the library synthesis reactions in a final volume of 75 μl. Reactions were carried out for 14 cycles at 94° C. for 15 sec and 65° C. for 2 min on I-Cycler real-time PCR instrument (Bio-Rad). FIG. 16 shows the chromatograms of the real-time PCR. Representation analysis of the samples amplified by PCR was done using a panel of 20 human STS markers (Table IV, STS markers: 40, 42-44, 46, 47, 49, 52, 54, 55, 58, 60, 62, 63, 66-69, and 74). The material amplified by PCR with known K.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantitation was done by standard curve fit for each STS (I-Cycler software, Bio-Rad), and quantities were plotted as a distribution plot (FIG. 17). As shown, the representation of STS markers was better when libraries were synthesized with less than 100 ng of DNA (FIG. 17). One hundred percent of the samples amplified from 25 ng or from 5 ng of genomic DNA were within a factor of 2 fold the mean, whereas samples amplified from 100 ng or 10 ng were on average 95%. In this example, the highest median value for the STS markers evaluated was achieved using the 5 ng input template (FIG. 17).

(169) Genomic libraries described herein provide a very efficient resource for highly representative whole genome amplification. Size (200-2,000 bp) and a known priming (known sequence) site make them also very attractive for such applications as DNA archiving, storing, retrieving and re-amplification. Multiple libraries can be immobilized and stored as micro-arrays. Libraries covalently attached by one end to the bottom of tubes, micro-plates or magnetic beads can be used many times by replicating immobilized amplicons, dissociating replicated molecules for immediate use, and returning the original immobilized WGA library for continuing storage.

(170) The structure of WGA amplicons can also be easily modified to introduce a personal identification (ID) DNA tag to every genomic sample to prevent an unauthorized amplification and use of DNA. Only those who know the sequence of the ID tag will be able to amplify and analyze genetic material. The tags can be useful for preventing genomic cross-contaminations when dealing with many clinical DNA samples

(171) WGA libraries created from large bacterial clones (BACs, PACs, cosmids, etc) can be amplified and used to produce genomic micro-arrays.

(172) The examples presented below describe processes that can enhance the outlined applications of the WGA libraries.

Example 8. Incorporation of Individual Identification DNA Tags by Whole Genome Amplification; Recovery of the Individual WGA Libraries from a Mixture of Several WGA Libraries

(173) This example describes two processes of tagging individual WGA library (ies) with the DNA identification sequence (ID) for the purpose of subsequent recovery of this library from the mixture containing other WGA libraries. Such a situation can occur intentionally or unavoidably, such as when manipulating or storing a very large number of WGA DNA samples, or intentionally, such as when there is a need to prevent unauthorized access to genetic information within the stored libraries.

(174) Both processes involve known primers with known sequence U at the 3′ end and individual ID sequence tag at the 5′ end (FIG. 18). In the first case, the known primer is comprised of regular bases (A, T, G and C) and can be replicated (FIG. 18A). In the second case, the known primer has a non-nucleotide linker L (for example, hexa ethylene glycole, HEG) and cannot be replicated (FIGS. 18B and 18C).

(175) The process of tagging, mixing and recovery of 3 different WGA libraries using replicable known primers is shown on FIG. 19. It comprises four steps: 1) Three genomic DNA samples are converted into 3 WGA libraries using the methods described earlier in the patent application; 2) Three WGA libraries are amplified using 3 individual replicable known primers T.sub.1U, T.sub.2U, and T.sub.3U with the corresponding ID DNA tags T.sub.1, T.sub.2, and T.sub.3 at the 5′ end (FIG. 18A); 3) All three libraries are mixed together. Any attempt to amplify and genotype the mix would result in a mixed pattern; and 4) The WGA libraries are segregated by PCR using individual ID primers tags T.sub.1, T.sub.2, and T.sub.3.

(176) The process of tagging, mixing and recovery of 3 different WGA libraries using non-replicable known primers is shown in FIG. 20. It comprises five steps: 1.) Three genomic DNA samples are converted into 3 WGA libraries using the method described earlier in the patent application; 2.) Three WGA libraries are amplified using 3 individual non-replicable known primers T.sub.1U, T.sub.2U, and T.sub.3U with the corresponding ID DNA tags T.sub.1, T.sub.2, and T.sub.3 at the 5′ end (FIGS. 18B and 18C). The resulting products have 5′ single stranded tails formed by ID regions of the primers; 3.) All three libraries are mixed together. Any attempt to amplify and genotype the mix would result in a mixed pattern; 4.) The WGA libraries are segregated by hybridization of their 5′ tails to the complementary oligonucleotides T.sub.1*, T.sub.2*, and T.sub.3* immobilized on the solid support; and 5.) The segregated libraries are amplified by PCR using known primer U.

(177) The processes of tagging and recovery described above for genomic libraries can be similarly applied to individual whole transcriptome libraries.

Example 9. Incorporation of Poly-G and Poly-C Functional Tags into WGA/WTA Libraries for Targeted DNA/RNA Amplification

(178) WGA (or WTA) libraries prepared by the method of library synthesis described in the invention may be modified or tagged to incorporate specific sequences. The tagging reaction may incorporate a functional tag. For example, the functional 5′ tag composed of poly cytosine may serve to suppress library amplification with a terminal C10 sequence as a primer. Terminal complementary homo-polymeric G sequence can be added to the 3′ ends of amplified WGA library by terminal deoxynucleotidyl transferase (FIG. 21A), by ligation of adapter containing poly-C sequence (FIG. 21B), or by DNA polymerization with a primer complementary to the universal proximal sequence U with a 5′ non-complementary poly-C tail (FIG. 21C). The C-tail may be from 8-30 bases in length. In a preferred embodiment the length of C-tail is from 10 to 12 bases.

(179) As described in U.S. Patent Application 20030143599, hereby incorporated by reference in its entirety, genomic DNA libraries flanked by homo-polymeric tails consisting of G/C base paired double stranded DNA, or poly-G single stranded 3-extensions, are suppressed in their amplification capacity with poly-C primer. This suppression is caused by reduced priming efficiency at poly G region because of formation of alternative G-quartet-like secondary structure within this sequence and it does not depend on the size of DNA amplicons, in contrast to well known “suppression PCR” that results from “pan-like” double-stranded structures formed by self-complementary adaptors and as a result strongly depends on the size of DNA fragments having been more prominent for shortest amplicons (Siebert et al., 1995; U.S. Ser. No. 00/575,9822A). This suppression effect is diminished for a targeted site when balanced with a second site-specific primer, whereby amplification of a plurality of fragments containing the unique priming site and the universal terminal sequence are amplified selectively using a specific primer and a poly-C primer, for instance primer C.sub.10. Those skilled in the art will recognize that genomic complexity may dictate the requirement for sequential or nested amplifications to amplify a single species of DNA to purity from a complex WGA library.

Example 10. WGA Libraries in the Microarray Format

(180) For archiving purposes, for example, individual WGA libraries can be immobilized, such as, for example, on a micro-array. Micro-array format would allow storing tens or even hundreds or thousands of immortalized DNA samples on one small microchip and have fast automated access to them. There are two principal ways that WGA libraries can be immobilized to a micro-array surface: covalently and non-covalently. FIG. 22 shows the process of covalent immobilization. It comprises 3 steps: Step 1. Hybridization of single stranded (denatured) WGA amplicons to the known primer-oligonucleotide U covalently attached to the solid support. Step 2. Extension of the primer U and replication of the hybridized amplicons by DNA polymerase. Step 3. Washing with 100 mM sodium hydroxide solution and TE buffer. Non-covalent immobilization can be achieved by using WGA libraries with affinity tags (like biotin) or DNA sequence tags at the 5′ ends of amplicons. Biotin can be located at the 5′ end of the known primer U. Single stranded 5′ affinity and/or ID tags can be introduced by using non-replicable primers (FIG. 18 and FIG. 20). Biotinylated libraries can be immobilized through streptavidin covalently attached to the surface of the micro-array. WGA libraries with a DNA sequence tag in the form of a 5′ overhang can be hybridized to complementary oligonucleotides covalently attached to the surface of the micro-array. Examples of both covalently and non-covalently arrayed libraries are shown in FIG. 23.

Example 11. Repeated Usage of Immobilized WGA Libraries

(181) Covalently immobilized WGA libraries (or libraries immobilized through the biotin-streptavidin interaction) can be used repeatedly to produce replica libraries for whole genome amplification (FIG. 24). In this exemplary, case the process comprises four steps: 1) Retrieval of the immobilized library from the long term storage; 2) Replication of the immobilized library using DNA polymerase and known primer U; 3) Dissociating replica molecules by sodium hydroxide, neutralization and amplification; and 4) Neutralization and return of the solid phase library for a long term storage.

Example 12. Purification of the WGA Products Using a Non-Replicable Primer Affinity Tag and DNA Immobilization by Hybridization

(182) For many applications, purity of the amplified DNA is critical. WGA libraries with 5′ overhangs can be hybridized to complementary oligonucleotides covalently attached to the surface of magnetic beads, tubes or micro-plates, washed with TE buffer or water to remove excess of dNTPs, buffer and DNA polymerase and then released by heating in a small volume of TE buffer. For this purpose, the single stranded 5′-affinity tag can be introduced by using a non-replicable primer (FIG. 25).

Example 13. Comparison Between Whole Genome Amplification of Libraries Prepared by Klenow Exo− Fragment of DNA Polymerase I with Self-Inert Primers and DOP-PCR Amplification

(183) This example describes a side-by-side comparison between the whole genome amplification described in the present invention and a commercially available kit for DOP-PCR amplification.

(184) Human lymphocyte genomic DNA was isolated by standard protocol using phenol-chloroform extraction.

(185) For whole genome amplification with Klenow fragment of DNA polymerase I, samples containing 5 ng or 20 pg in 10 μl of TE-L buffer were randomly fragmented by heating at 95° C. for 4 min. Samples were supplemented with a reaction buffer containing final concentrations of 1× EcoPol buffer (NEB), 200 μM of each dNTP, 1 μM degenerate K(N).sub.2 primer (Table III, primer 14), and 15 ng/μl SSB protein (USB) in a total volume of 14 μl. After a denaturing step of 2 min at 95° C., the samples were cooled to 24° C. and the library synthesis reactions were initiated by adding 5 units (1 μl) of Klenow Exo− DNA polymerase (NEB).

(186) After incubation for 60 min at 24° C., reactions were stopped by heating at 75° C. for 5 min. The synthesis reactions were amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 μM of each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 μM universal K.sub.U primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and the entire 15 μl library synthesis reactions in a final volume of 75 Reactions were carried out at 94° C. for 15 sec and 65° C. for 2 min on I-Cycler real-time PCR instrument (Bio-Rad).

(187) Amplifications by DOP-PCR were done using DOP PCR Master™ Kit purchased from Roche Molecular Biochemicals (Catalog #1644963). Amplification reactions were carried out under Protocol 2 of the manufacturer's manual. Briefly, samples containing 5 ng or 20 pg of DNA (or control samples without DNA) in a 50 μl standard DOP PCR reaction mixture supplemented with 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) were amplified after denaturing for 5 min at 95° C. by cycling for 5 cycles at: 94° C. for 30 sec, 30° C. for 30 sec, ramping at 30° C. to 72° C. for 30 sec (1.4° C./sec), and 72° C. for 1.5 min, followed by 45 cycles at: 94° C. for 30 sec, 62° C. for 30 sec, and 72° C. for 1.5 min, and final extension at 72° C. for 7 min on I-Cycler real-time PCR instrument (Bio-Rad).

(188) FIG. 26A shows the real-time PCR curves of the whole genome amplification by Klenow Exo− and DOP-PCR. As shown, at both input DNA amounts, i.e. 5 ng and 20 pg, the whole genome amplification of libraries prepared with Klenow fragment of DNA polymerase-I and degenerate K(N).sub.2 primer was about 25 PCR cycles more efficient than amplification with DOP-PCR. This result indicates that the methods in the present invention are several orders of magnitude more sensitive than DOP-PCR technology.

(189) Representation analysis was performed using a panel of 16 random human genome STS markers (Table IV, STS markers: 40, 4-44, 46, 47, 49, 52, 54, 55, 58, 60, 62, 63, and 66). The material amplified by PCR with universal K.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantitation was by standard curve fit for each STS.

(190) FIG. 26B shows a logarithmic distribution plot of the STS markers analyzed derived from the real-time PCR standard curve fit. The distribution of all 16 genome markers was tighter and with significantly reduced representation bias in PCR amplified whole genome libraries prepared by Klenow fragment of DNA polymerase I and degenerate K(N).sub.2 primer as compared to DOP-PCR products. Also, the average quantity of STS markers by the proposed method was approximately an order of magnitude higher in the library amplified form 20 pg of genomic DNA (about 3 diploid genome equivalents) as compared to the DNA product prepared from 5 ng DNA (almost 1000 diploid genome equivalents) by DOP-PCR.

(191) Taken together, these results demonstrate the superiority of the methods in the present invention over the DOP-PCR technique (Telenius et al., 1992), both in terms of sensitivity and fidelity of genome sequence representation.

Example 14: Library Generation and Whole Genome Amplification of DNA Isolated from Serum

(192) This example describes the amplification of genomic DNA that has been isolated from serum collected in serum separator tubes (SST). Blood was collected into 8 ml vacutainer SST tubes. The serum tubes were allowed to sit at room temperature for 30′. The tubes were centrifuged for 10′ at 1,000×G with minimal acceleration and braking. The serum was subsequently transferred to a clean tube. Isolated serum samples may be used immediately for DNA extraction or stored at −20° C. prior to use.

(193) DNA from 1 ml of serum was purified using the DRI ChargeSwitch Blood Isolation kit according to the manufacturer's protocols. The resulting DNA was precipitated using the pellet paint DNA precipitation kit (Novagen) according to the manufacturer's instructions and the sample was resuspended in TE-Lo to a final volume of 30 ml for serum. The quantity and concentration of DNA present in the sample was quantified by real-time PCR using Yb8 Alu primer pairs; Yb8F 5′-CGAGGCGGGTGGATCATGAGGT-3′ (SEQ. ID NO:120), and Yb8R 5′-TCTGTCGCCCAGGCCGGACT-3′ (SEQ. ID NO:121). Briefly, 25 ml reactions were amplified for 40 cycles at 94° C. for 15 sec and 74° C. for 1 min. Standards corresponding to 10, 1, 0.1, 0.01, and 0.001 ng of genomic DNA were used and the serum DNA quantities and concentrations were calculated by standard curve fit (I-Cycler software, Bio-Rad).

(194) DNA isolated from serum was randomly fragmented in TE-L buffer by heating at 95° C. for 4 min. The reaction mixture contained 10 ng of thermally fragmented DNA in 1× EcoPol buffer (NEB), 200 μM of each dNTP, and 1 uM of degenerate K(N).sub.2 primer (Table III, primer 14) in a final volume of 15 After a denaturing step of 2 min at 95° C., the samples were cooled to 4° C. and the reaction initiated by adding 5 units Klenow Exo− (NEB). WGA library synthesis was carried out by a three-step incubation protocol for 20 min at 16° C., 20 min at 24° C., and 20 min at 37° C. Reactions were stopped by heating for 15 min at 75° C. and subsequently cooling to 4° C. The entire library reaction was further amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 10,000× dilutions of fluorescein and SybrGold I (Molecular Probes) 1 uM known K.sub.U primer (Table III, primer 15), 0.5× Titanium Taq polymerase (Clontech), and 10 ng input genomic DNA of the library reactions in a final volume of Reactions were carried out for 17 cycles at 94° C. for 15 sec and 65° C. for 2 min on an I-Cycler real-time PCR instrument (Bio-Rad). The amplification curve is illustrated in FIG. 27.

(195) The amplified material was purified by Millipore Multiscreen PCR plates and quantified by optical density. Gel analysis of the amplified products indicated a size distribution (200 bp to 1.6 kb) similar to the original serum DNA (FIG. 28A). Additionally, the amplified DNA was analyzed using real-time, quantitative PCR using a panel of human genomic STS markers. The markers that make up the panel are listed in Table IV. Quantitative Real-Time PCR was performed using an I-Cycler Real-Time Detection System (Bio-Rad), as per the manufacturer's directions. Briefly, 25 μl reactions were amplified for 40 cycles at 94° C. for 15 sec and 65° C. for 1 min. Standards corresponding to 10, 1, and 0.2 ng of fragmented DNA were used for each STS, quantities were calculated by standard curve fit for each STS (I-Cycler software, Bio-Rad) and were plotted as distributions. Quantitative real-time PCR of the WGA products from serum demonstrated that all 8 markers tested were within a factor of 5 of the mean amplification. These results indicate that the representation of the original serum DNA is maintained following WGA. FIG. 28B is a scatterplot of the representation of the human genomic STS markers in the amplified DNA.

Example 15. Whole Genome Amplification of Single Human Cells and Individual Hair Follicles from Libraries Prepared Using Self-Inert Degenerate Primer K and Klenow Exo− Fragment of DNA Polymerase I

(196) This example describes the whole genome amplification of total DNA from single human blood cells, single sperm cells, and individual hair follicles.

(197) Three microliters of freshly drawn blood from a healthy female donor were exponentially diluted in PCR tubes containing 27 μl dilution buffer composed of 10 mM Tris-HCl, pH 7.5, 100 mM NaCl, and 0.5 mM EDTA to a level of 1, 0.5, or 0.2 cells per assuming an average blood count of 5×10.sup.3 nucleated cells per ml of blood. Similarly, 3 μl of ejaculate from a healthy donor were diluted to the same level assuming a sperm count of 20,000 per μl of ejaculate. A single hair follicle from a healthy female donor was lysed as described below and then exponentially diluted in lysis buffer.

(198) One microliter of the respective cell dilutions was mixed with 9 μl of freshly prepared lysis buffer containing 10 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 20 mM NaCl, 0.007% (w/v) sodium dodecyl sulfate (SDS), and 0.12 mg/ml proteinase K (USB). In the case of a hair follicle, the follicle was suspended in 10 μl of lysis buffer. The samples were incubated for 1 hr at 50° C. to lyse the cells. The hair follicle sample was further sequentially diluted with lysis buffer from 10.sup.2 to 10.sup.6-fold and each dilution was subjected to WGA library preparation.

(199) Samples were heated at 99° C. for 4 min to inactivate the proteinase K, disintegrate the nucleoprotein, and thermally fragment the DNA. The library synthesis step was conducted in a reaction mixture containing 1× EcoPol buffer (NEB), 200 mM of each dNTP, 1 μM degenerate primer K (Table III, sequence ID 15), and 15 ng/μl SSB (USB) in a total volume of 14 After a denaturing step of 2 min at 95° C., the samples were cooled to 24° C. and the reaction initiated by adding 5 units (1 μl) of Klenow Exo− DNA polymerase (NEB). After incubation for 60 min at 24° C. reactions were stopped by heating at 75° C. for 5 min. The synthesized libraries were amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM universal K.sub.U primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and the entire 15 μl library synthesis reaction in a final volume of 75 In the case of hair follicle dilutions a blank control without DNA was included. Redundant single cell samples at different dilutions were amplified which served as auto-controls, i.e. one cell or no cells were amplified at the highest dilutions. Reactions were carried out at 94° C. for 15 sec and 65° C. for 2 min on I-Cycler real-time PCR instrument (Bio-Rad).

(200) FIG. 29 shows amplification of single nucleated blood cells. Approximately 8 cycles separate the resulting amplification profiles between single cells and no cells, allowing clear distinction between the presence or absence of a single blood cell.

(201) Representation analysis of 5 single cell samples amplified by PCR was done using a panel of 16 human STS markers (Table IV, STS markers: 40, 4-44, 46, 47, 49, 52, 54, 55, 58, 60, 62, 63, and 66). The material amplified by PCR with universal K.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantitation was by standard curve fit for each STS. To assess the effect of copy number on the amplification bias, ⅙ of the volume of each individual single cell amplification reaction was combined into a pooled sample. The pooled sample was analyzed for STS marker representation as described above. Markers amplified at a level of less than 0.2 ng of standard template were considered dropouts. Table V shows the number of dropout markers for 3 individual single cell amplifications, as compared to the pooled sample.

(202) TABLE-US-00005 TABLE V STS markers amplification from whole genome amplified single blood cells and a pool of six individually amplified single cells Markers Amplified % of total # of dropouts (n = 16) Single cell 10 37.5% Single cell 8 50.0% Single cell 10 37.5% Pooled sample 4 75.0%

(203) The majority of genomic marker dropouts were random in individual single cell amplification reactions. After pooling of individually amplified single cells, the number of dropouts decreased by approximately half (Table V).

(204) FIG. 30 shows amplification of single sperm cells. The distance between samples with a single cell and samples without cells in this case was only about 2 cycles (not the expected approximately 6 cycles for a haploid genome as compared to blood nucleated cells). In a specific embodiment, this difference is attributed to either inefficient lysis or the presence of inhibitors of the amplification in sperm cells. Nonetheless, even with 2 cycles difference one can still distinguish between a single cell and no cell.

(205) As shown on FIG. 31, exponential dilutions of a lysed hair follicle showed a progressive shift of about 3.5-4 cycles as expected. The highest dilution of 1:1,000,000 amplified about two cycles before the blank control which when compared to purified genomic DNA corresponds to approximately 2 pg of DNA. This demonstrates the potential of the method for forensic applications.

Example 16. Amplification of Single Human Chromosomes with Degenerate K(N).SUB.0 .Primer and Klenow Exo− Fragment of DNA Polymerase-I

(206) This example describes the amplification of total DNA from single copy human chromosomes.

(207) Single copies of derivative chromosomes from a lymphoblastoid cell line carrying a translocation (11;12)(q21;p13.33) sorted in 5 μl of water in a 96 well microtiter plate were obtained from the Wellcome Trust Sanger Institute. Fourteen individual samples of each translocation derivative chromosome were lysed in freshly prepared lysis buffer containing 10 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 20 mM NaCl, 0.007% (w/v) sodium dodecyl sulfate (SDS), and 0.12 mg/ml proteinase K (USB) in a final volume of 10 μl at 50° C. for 1 hr.

(208) Samples were heated at 99° C. for 4 min to inactivate the proteinase K, disintegrate the nucleoprotein, and thermally fragment the DNA. Library synthesis was conducted in a reaction mixture containing 1× EcoPol buffer (NEB), 200 μM of each dNTP, 1 mM degenerate K(N).sub.0 primer (Table III, sequence ID 15), and 15 ng/μl SSB (USB) in a total volume of 14 μl. After a denaturing step of 2 min at 95° C., the samples were cooled to 24° C. and the reaction initiated by adding 5 units (1 μl) of Klenow Exo− DNA polymerase (NEB). After incubation for 60 min at 24° C. reactions were stopped by heating at 75° C. for 5 min. The library synthesis reactions were amplified by real-time PCR in a mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 uM universal K.sub.U primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and the entire 15 μl library synthesis reaction in a final volume of 75 μl. Blank controls without DNA were also included. Reactions were carried out at 94° C. for 15 sec and 65° C. for 2 min on I-Cycler real-time PCR instrument (Bio-Rad).

(209) FIG. 32 shows amplification of single copy human chromosomes. Approximately 4 cycles distance between single chromosomes and no DNA blank controls was observed.

Example 17. Application of Single-Cell WGA for Detection and Analysis of Abnormal Cells

(210) WGA amplified single-cell DNA can be used to analyze tissue cell heterogeneity on the genomic level. In the case of cancer diagnostics it would facilitate the detection and statistical analysis of heterogeneity of cancer cells present in blood and/or biopsies. In the case of prenatal diagnostics it would allow the development of non-invasive approaches based on the identification and genetic analysis of fetal cells isolated from blood and/or cervical smears. Analysis of DNA within individual cells could also facilitate the discovery of new cell markers, features, or properties that are usually hidden by the complexity and heterogeneity of the cell population.

(211) Analysis of the amplified single-cell DNA can be performed in two ways. In the traditional approach shown on FIG. 33, amplified DNA samples are analyzed one by one using hybridization to genomic micro-array, or any other profiling tools such as PCR, sequencing, SNP genotyping, micro-satellite genotyping, etc. The method would include: 1.) Dispersal of the tissue into individual cells; 2.) Preparation and amplification of individual (single-cell) WGA libraries; 3.) Analysis of individual single-cell genomic DNA by conventional methods. This approach can be useful in situations when genome-wide assessment of individual cells is necessary.

(212) In the second approach shown on FIG. 34, amplified DNA samples are spotted on the membrane, glass, or any other solid support, and then hybridized with a nucleic acid probe to detect the copy number of a particular genomic region. The method would include: 1.) Dispersal of the tissue of interest into individual cells; 2.) Preparation and amplification of individual (single-cell) WGA libraries; 3.) Preparation of micro-arrays of individual (single-cell) WGA DNAs; 4.) Hybridization of the single-cell DNA micro-arrays to a locus-specific probe; 5.) and Quantitative analysis of the cell heterogeneity. This approach can be especially valuable in situations when only limited number of genomic regions should be analyzed in a large cell population.

Example 18. Application of Whole Genome Amplification for Detection and Analysis of Gene Copy Number

(213) WGA amplified DNA retains both sequence and copy number integrity during library synthesis and amplification. This feature of the libraries facilitates the potential evaluation of cells or tissues suspected of having undergone gene amplification events such as those observed in oncogenic transformation. Early detection of gene amplification events requires the ability to examine the event in a few suspect cells or biopsy material. This application is best illustrated with a set of model samples from patients of known chromosomal aneuploidy in the X-chromosome as described in this example.

(214) DNA from patients with XO, XX, and XXX served as template for WGA library synthesis (kindly provided by Dr. Arul Chinnaiyan, University of Michigan). DNA isolated by standard procedures was randomly fragmented in TE-L buffer by heating at 95° C. for 4 min. The reaction mixtures contained 25 ng of thermally fragmented DNA (or just TE-L buffer as negative control) in 1× EcoPol buffer (NEB), 200 μM of each dNTP, and 1 uM degenerate K(N).sub.2 primer (Table III, primer 14) 15 ng/μl SSB (USB) in a total volume of 14 After a denaturing step of 2 min at 95° C., the samples were cooled to 16° C., and the reaction initiated by adding 5 units (1 μl) of Klenow exo− DNA polymerase (USB). WGA library synthesis was done at 16° C. for 20 min 24° C. for 20 min, and 37° C. for 20 min. Reactions were stopped with 1 μl of 83 mM EDTA (pH 8.0), and samples were heated for 5 min at 75° C. Aliquots of the reactions corresponding to 5 ng of input DNA were amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 μM each dNTP, 100,000× dilutions of fluorescein and SybrGreen I (Molecular Probes) 1 μM known K.sub.U primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech), and 5 ng input genomic DNA of the library synthesis reactions in a final volume of 75 Reactions were carried out for 14 cycles at 94° C. for 15 sec and 65° C. for 2 min on I-Cycler real-time PCR instrument (Bio-Rad).

(215) For analysis, individual 5 ng aliquots of the library were compared to the combined mixture reconstituting the entire 25 ng input template using X chromosome STS primer pairs (152 and 154 Table IV). The material amplified by PCR with universal K.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 40 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), in a 25 μl volume.

(216) FIG. 35 shows the normalized STS real-time PCR curves for each set of primers. Panels A and C display the clustering of the individual 5 ng aliquots amplified from a single 25 ng WGA library for samples with 1×, 2×, and 3× chromosome copies. In each case the variation is approximately +1-0.5 cycles. FIG. 35 panels B and D display how the variation is averaged upon reconstitution of the individual amplifications. In each case the reconstituted mixture is tested in triplicate showing a full cycle shift in the doubling of the template between 1× and 2× and the predicted approximately half cycle shift when a third copy (3×) is added in the case of trisomy for the X chromosome.

(217) The precise copy number measurements shown here for WGA amplified libraries exemplify the potential for clinical applications in gene amplification events. Combined with the ability to generate libraries from low amounts of template the invention can be used in cancer and prenatal diagnostics where DNA sample is frequently very limited.

Example 19. Whole Transcriptome Amplification Using Libraries Prepared from Poly A+ RNA by MMLV Reverse Transcriptase and Self-Inert Degenerate Primers

(218) This example describes application of the invention for the creation of an amplifiable library faithfully representing the expression patterns of transcribed RNA within a cell or population of cells herein termed “Whole Transcriptome Amplification” (WTA).

(219) Purified polyA+ RNA from EBV transformed human B lymphocytes, Raji cells (Clontech), served as input template for WTA library preparation. As in the case of WGA protocol, WTA is performed in two steps: library synthesis and library amplification. Library synthesis involves similar self-inert degenerate primers (primers K), but a different DNA polymerase, specifically MMLV reverse transcriptase. It proceeds through the extension/strand displacement reactions similar to WGA, but requires no fragmentation of the RNA template (although fragmentation can be applied to reduce the average amplicon size if desireable). To improve representation of the 3′ termini of mRNA molecules primer K(T).sub.20 (Table III primer 19) complementary to the polyA tails was also added. To assemble the library synthesis reaction, primers were annealed to polyA+ RNA templates. Annealing was facilitated by briefly heating the mixture of 100 ng or 10 ng polyA+ RNA, primers K(N).sub.2 [1 μM] (Table III primer 14) and K(T).sub.20 [200 nM] (Table III primer19) either in combination, or K(N).sub.2 [1 μM] alone, dNTP mix [1 μM ea.] and RNase free water to 17 μl at 70° C. for 5 minutes followed by immediate removal to ice. The polymerase reaction was initiated by addition of 2 μl of 10×MMLV buffer to a final concentration of 75 mM KCL, 50 mM Tris-HCl, 3 mM MgCl.sub.2, 10 mM dithiothreitol, pH 8.3) and 1 μl (200 units) MMLV reverse transcriptase (NEB). Reactions were mixed, and incubated for 1 hour at 42° C. Enzyme activity was halted by heat inactivation for 5 minutes at 95° C.

(220) Aliquots of the WTA library synthesis reactions corresponding to 10 ng of input RNA (or in the case of the 10 ng sample, the entire reaction mixture) were further amplified by real-time PCR. The PCR reaction mixture contained: 1× Titanium Taq reaction buffer (Clontech), 200 nM each dNTP, 100,000× dilutions of fluorescein and SyberGreen I (Molecular Probes) 1 μM K.sub.U primer (Table III primer 16), 5 units of Titanium Taq polymerase (Clontech) and volumes representing 10 ng equivalents of the input polyA+ RNA from the library synthesis reactions in a final volume of 754 Reactions were carried out for 17 cycles (94° C. for 20 sec and 65° C. for 2 min) in real-time PCR I-Cycler™ (Bio-Rad). The effects of input template and subsequent reaction volumes transferred into the PCR amplification are seen in FIG. 36. The entire 10 ng library synthesis product shows delayed real-time PCR kinetics relative to 10 ng taken from the 100 ng library synthesis reaction. The modest effect of the amount of RNA in the library preparation step on the amplification profile (only a single cycle shift) suggests only minor differences in template availability for these RNA amounts.

(221) One specific application of whole transcriptome amplification is to enable micro-array expression analysis from small amounts of RNA. Traditional RNA amplification methods employ priming of polyA tails present within the mRNA pool of transcripts. As a result, the micro-array studies to date have been biased toward the 3′ end of mRNAs. To increase compatibility of the present invention with the existing micro-array target bias, the K(T).sub.20 primer was employed. To demonstrate the effect of this added priming, the amplifications were tested in the presence and absence of each primer. FIG. 37 shows a two cycle shift in the absence of K(T).sub.20 when 10 ng polyA+ RNA serves as template for the library synthesis step, and a six cycle shift in the absence of K(N2). The combined effect of these primers facilitates even priming across the mRNA molecules and exhibits a more uniform representation of the input RNA across the entire message.

(222) Agarose gel electrophoretic analysis of the resulting amplified library products supports the observed real-time improvements with higher input template and polyA tail specific priming. FIG. 38 shows the molecular weight range of products amplified from each of these libraries with the various primer conditions. The combination of priming both at the polyA tail and at random internal sites yields a more robust amplification over a larger product size range. The absence of K(T).sub.20 priming has much less of an effect on performance than does the absence of the K(N).sub.2 primer, which essentially eliminates products competent for amplification by failing to generate the second universal priming site on each amplicon. 100 ng input template libraries exhibit a broader size distribution of amplimers suggestive of less frequent priming or simply a greater starting quantity of larger RNA molecules.

(223) Representation of specific mRNA molecules was evaluated by real-time PCR analysis for 11 specific human STS markers residing in known genes represented in the RNA sample at various levels of expression (Table IV, STS markers: 20, 31, 47, 51, 86, 103, 106, 110, 119, 134, 140). The material amplified by PCR with universal K.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantitation was by standard curve fit for each STS. FIG. 39 demonstrates the representation of these STS sites. Each of the chosen STS sites was represented for each condition with noticeable improvement observed when the K(N).sub.2 and K(T).sub.20 primers are combined and somewhat improved average performance for the 100 ng input libraries.

(224) Another unique feature of the invention relates to WTA library representation across a particular mRNA locus. One can expect that the combined terminal and semi-random internal priming generates amplicons across the entire RNA molecule population without bias toward the 3′ end. To prove this statement three large transcripts were examined using STS primer pairs at varying distances from the 3′ end (Table IV STS 42, 42a, 42b, 85, 85a, 85b, 119, 119a, 119b). FIG. 40 illustrates the real-time PCR analysis of WTA amplification for these loci. The results indicate representation at all sites with improvement in 3′ representation attributed to the inclusion of the K(T20) primer. Relative differences in specific site amplifications are attributed to variable priming and efficiency of amplification of specific sequences. These results indicate relatively uniform library representation at different distances from the 3′ end for three randomly chosen large transcripts. Representation is consistent between libraries made from a broad range of RNA input template (100 ng-10 ng). The lower level of amplification observed at 1795 bp from the 3′ end of STS 42a compared to its neighboring more proximal and more distal sequences (42 and 42b, Table IV) suggests that WTA amplification of specific regions may be largely dependent on the nucleotide sequences surrounding the specific site of interest. Reproducibility of amplification of specific markers between libraries suggests the ability to directly compare expression levels of a particular site between two samples (i.e. cancer vs. normal tissue).

Example 20. Whole Transcriptome Amplification: Titration of Input Template and MgCl.SUB.2 .Concentration

(225) WTA amplification of RNA from systematic sampling of tissues such as biopsy tissues and laser capture micro-dissection, or where sample is limiting as in the case of rare collections from unique cohorts, dictates the need for robust amplification from low input template amounts. To evaluate the tolerated range of input template and optimal MgCl.sub.2 concentration, total RNA from normal pooled prostate (CPP, Clontech) was examined from 0.25 ng to 10 ng at 3 mM and 10 mM MgCl.sub.2. Annealing was facilitated by briefly heating the mixture of 10 ng, 1 ng, 0.5 ng, or 0.25 ng CPP total RNA (Clontech), primers K(N).sub.2 [1 μM] (Table III primer 14) and K(T20) [200 nM] (Table III; primer19), dNTP mix [1 μM ea.] and RNase free water to 17 μl at 70° C. for 5 minutes followed by immediate removal to ice. The library synthesis reaction was initiated by addition of 2 μl of 10×MMLV buffer to a final concentration of 75 mM KCL, 50 mM Tris-HCl, 3 mM or 10 mM MgCl.sub.2, 10 mM dithiothreitol, pH 8.3) and 1 μl (200 units) MMLV reverse transcriptase (NEB) or 1 μl (50 units) MMLV reverse transcriptase (Epicentre). Reactions were mixed, and incubated for 1 hour at 42° C. Enzyme activity was halted by heat inactivation for 5 minutes at 95° C.

(226) The library synthesis reactions were amplified by real-time PCR in a reaction mixture that contained: 1× Titanium Taq reaction buffer (Clontech), 200 nM each dNTP, 100,000× dilutions of fluorescein and SyberGreen I (Molecular Probes) 1 μM K.sub.U primer (Table III primer 16), 5 units of Titanium Taq polymerase (Clontech) and 50% of the library synthesis reaction (12.5 μl) representing 5 ng, 0.5 ng, 0.25 ng and 0.125 ng of starting template in a final volume of 75 μl. Reactions were carried out for 17-33 cycles (94° C. for 20 sec and 65° C. for 2 min) in real-time PCR I-Cycler™ (Bio-Rad). FIG. 41 shows the real-time amplification profiles with the expected template dependent titration. Doubling of the template results in the expected two fold increase seen as a one cycle shift, while the 10 fold increase from 0.5 ng to 5 ng gave slightly more than the expected 10 fold (3.4 cycle) shift. A striking difference in performance is observed with the two buffer enzyme combinations.

(227) To evaluate the variation in representation across the input template concentration and buffer conditions, samples from 10 ng and 0.25 ng input template amounts were evaluated by STS analysis. Representation of specific mRNA molecules was evaluated by real-time PCR analysis for 11 specific human STS markers residing in known genes represented in the RNA sample at various levels of expression (Table IV, STS markers: 20, 31, 47, 51, 86, 103, 106, 110, 119, 134, 140). The material amplified by PCR with universal K.sub.U primer was purified with Qiaquick filters (Qiagen), and 10 ng aliquots were analyzed in real-time PCR. Reactions were carried out for 45 cycles at 94° C. for 15 sec and 68° C. for 1 min on I-Cycler (Bio-Rad), in a 25 μl volume. Standards corresponding to 10, 1, and 0.2 ng of fragmented genomic DNA were used for each STS. Quantitation was by standard curve fit for each STS. FIG. 42 shows the relative quantities of each of genes assayed. Reducing the input to 0.25 ng under low (3 mM, NEB) MgCl.sub.2 conditions reduces the representation of rare messages below confidence levels. Representation is markedly increased with the increased (10 mM, Epicentre) MgCl.sub.2 conditions as predicted by the real-time amplification kinetics.

(228) To further examine the difference between the buffer systems, a titration of MgCl.sub.2 concentration was examined. Total RNA from normal pooled prostate (CPP, Clontech) 10 ng was amplified over a 3-12 mM range of MgCl.sub.2. Annealing was facilitated by briefly heating the mixture of 10 ng CPP total RNA (Clontech), primers K(N).sub.2 [1 μM] (Table III, primer 14) and K(T).sub.20 [200 nM] (Table III, primer19), dNTP mix [1 μM ea.] and RNase free water to 17 μl at 70° C. for 5 minutes followed by immediate removal to ice. The library synthesis reaction was initiated by addition of 2 μl of 10×MMLV buffer to a final concentration of 75 mM KCL, 50 mM Tris-HCl, 3 mM or supplemented in 1 mM increments to 12 mM MgCl.sub.2, 10 mM dithiothreitol, pH 8.3) and 411 (50 units) MMLV reverse transcriptase (Epicentre). Reactions were mixed, and incubated for 1 hour at 42° C. Enzyme activity was halted by heat inactivation for 5 minutes at 95° C. The library synthesis reactions were further amplified by real-time PCR in a reaction mixture that contained: 1× Titanium Taq reaction buffer (Clontech), 200 nM each dNTP, 100,000× dilutions of fluorescein and SyberGreen I (Molecular Probes) 1 μM K.sub.U primer (Table III, primer 16), 5 units of Titanium Taq polymerase (Clontech) and 50% of each library synthesis reaction (10 μl) representing 5 ng of starting template in a final volume of 75 μl. Reactions were carried out for 19 cycles (94° C. for 20 sec and 65° C. for 2 min) in real-time PCR I-Cycler™ (Bio-Rad). FIG. 43 shows real-time PCR curves detailing the effect of MgCl.sub.2 on WTA library generation. Conditions at or above 6 mM to about 12 mM MgCl.sub.2 during library preparation step yield optimal kinetics. MgCl.sub.2 is known to affect base pairing which can manifest itself at the level of primer binding as well as strand displacement in the WTA application of the invention. A skilled artisan could determine optimal concentrations for specific applications of the invention, including parameters such as template size and complexity, for example.

Example 21. Preferential Amplification of Single Stranded Nucleic Acid Templates Using WTA Methods

(229) In applications where residual DNA may be present in a clinical sample, or where total nucleic acids are isolated, the ability to selectively amplify DNA or RNA from the same sample can be beneficial. In this example, the WTA protocol is applied to samples of total RNA or genomic DNA with and without fragmentation and denaturation.

(230) To evaluate WTA library formation from DNA and RNA input templates 10 ng samples of genomic DNA (Coriell CEPH genomic DNA (#7057) or total RNA (Clontech, CPP) were diluted to a final volume of 6.5 μl in water. Fragmentation and denaturation were performed by heating to 95° C. for 4 minutes, snap cooling to ice (4° C.), addition of 1.5 μl of 10×MMLV buffer (Epicentre) to a final concentration of 75 mM KCL, 50 mM Tris-HCl, 10 mM MgCl.sub.2, 10 mM dithiothreitol, pH 8.3), primers K(N).sub.2 [1 μM] (Table III primer 14) and K(T).sub.20 [200 nM] (Table III, primer19), dNTP mix [1 μM ea.] and RNase free water to 14 followed by a brief 2 minute heating to 95° C. and cooling to ice to anneal primers. Samples not fragmented or denatured received standard 70° C. treatment for 5 minutes, followed by snap cooling to ice (4° C.) addition of 1.5 μl of 10×MMLV buffer (Epicentre) to a final concentration of 75 mM KCL, 50 mM Tris-HCl, 10 mM MgCl.sub.2, 10 mM dithiothreitol, pH 8.3), primers K(N).sub.2 [1 μM] (Table III primer 14) and K(T).sub.20 [200 nM] (Table III, primer19), dNTP mix [1 μM ea.] and RNase free water to 14 The polymerase reaction was initiated by addition of 1 μl (50 units) MMLV reverse transcriptase (Epicentre). Reactions were mixed, and incubated for 15 minutes at 23° C. followed by 1 hour at 42° C. Enzyme activity was halted by heat inactivation for 5 minutes at 95° C.

(231) The library reactions were amplified by real-time PCR in a reaction mixture that contained: 1× Titanium Taq reaction buffer (Clontech), 200 nM each dNTP, 100,000× dilutions of fluorescein and SyberGreen I (Molecular Probes) 1 μM K.sub.U primer (Table III primer 16), 5 units of Titanium Taq polymerase (Clontech) and 100% of the library reaction (15 μl) representing the entire 10 ng of starting template in a final volume of 75 μl. Reactions were carried out for 13-17 cycles (94° C. for 20 sec and 65° C. for 2 min) in real-time PCR I-Cycler™ (Bio-Rad). FIG. 44A shows the real-time amplification profiles from each template. Libraries amplified from DNA after fragmentation and denaturation show profiles similar to WGA embodiments of the invention. As claimed, MMLV polymerase activity can efficiently substitute for other polymerases in WGA library synthesis. In the absence of fragmentation and denaturation, DNA is severely inhibited, showing an approximately 6 cycle delay in amplification, or roughly 1% of template participating in the reaction. RNA templates only display a minor effect of fragmentation and denaturation conditions compared to direct annealing and extension. Differences in the molecular weight of products amplified in each of these reactions and the control reactions without template are shown in FIG. 44B. Each reaction was allowed to proceed to plateau and evaluated by agarose gel electrophoresis. The distribution of library fragments from DNA template is consistent with that observed for WGA products. Thermal treatment of RNA shifts the size distribution of library fragments by 50 to 100 base pairs shorter, demonstrating the ability to tailor amplicon size. No template controls failed to generate amplicons above 200 bp after 28 cycles of amplification.

(232) The ability to distinguish between DNA and RNA templates on the basis of fragmentation and denaturation demonstrate controlled differential access of the template. Residual traces of DNA in RNA preparations will amplify with approximately 1% efficiency with respect to the RNA template under non-denaturing conditions. Although not specifically demonstrated here, as known in the art, Klenow exo− fails to utilize RNA as a template, thereby providing a method to selectively amplify each nucleic acid population from a complex mixture.

Example 22. Total Nucleic Acid Differential Amplification Platform for Synthesis of DNA and RNA Libraries from Limited Archived or Clinical Samples

(233) In some genetic profiling studies, both the genomic (DNA) and the expression (RNA) information are required to provide a complete analysis of the tissue or cells evaluated. Only when alterations in gene sequence, copy number, and the effective expression of transcribed sequences are taken together can a complete analysis of the sample be achieved. In many cases, a clinical isolate or archival sample is limited and may only be sufficient for one isolation scheme. Amplification of genomic and expression libraries may be streamlined through a total amplification platform using the present invention.

(234) FIG. 45 illustrates selective amplification of DNA and RNA from a total nucleic acid isolate using self-inert degenerate primers in combination with Klenow Exo− fragment of DNA polymerase I and heat-denatured nucleic acid (WGA) or MMLV reverse transcriptase and non-denatured nucleic acid (WTA). A device is diagrammed for the segregation of DNA and RNA by selective amplification from a total nucleic acid preparation. The invention applied in this format, or applied in a microfluidic platform, for example, uses selective amplification rather than selective degradation or selective isolation of DNA and RNA, eliminating problems such as sample loss associated with preparation of nucleic acids from limited samples.

Example 23. Application of Homopolymeric G/C Tagged WGA Libraries for Targeted DNA Amplification

(235) Targeted amplification may be applied to genomes for which limited sequence information is available or where rearrangement or sequence flanking a known region is in question. For example, transgenic constructs are routinely generated by random integration events. To determine the integration site, directed sequencing or primer walking from sequences known to exist in the insert may be applied. The invention described herein can be used in a directed amplification mode using a primer specific to a known region and a universal primer. The universal primer is potentiated in its ability to amplify the entire library, thereby substantially favoring amplification of product between the specific primer and the universal sequence, and substantially inhibiting the amplification of the whole genome library.

(236) Conversion of WGA libraries for targeted applications involves incorporation of homo-polymeric terminal tags. Amplification of libraries with C-tailed universal primers exhibit a dependence on the length of the 5′ poly-C extension component of the primer. WGA libraries prepared by the methods described in the invention can be converted for targeted amplification by PCR re-amplification using poly-C extension primers. FIG. 46A shows potentiated amplification with increasing length of poly-C in real-time PCR. The reduced slope of the curves for C.sub.15U and C.sub.20U show delayed kinetics and suggest reduced template availability or suppression of priming efficiency.

(237) To demonstrate the suppression of library amplification imposed by poly-C tagging, libraries were purified using Qiaquick PCR purification column (Qiagen) and subjected to PCR amplification with poly-C primers corresponding to the length of their respective tag. FIG. 46B shows real-time PCR results that reflect the suppression of whole genome amplification. Only the short C.sub.10 tagged libraries retain a modest amplification capacity, while C.sub.15 and C.sub.20 tags remain completely suppressed after 40 cycles of PCR.

Example 24. Application of Homopolymeric G/C Tagged WGA Libraries for Multiplexed Targeted DNA Amplification

(238) Application of G/C tagged libraries for targeted amplification uses a single specific primer to amplify a plurality of library amplimers. The complexity of the target library dictates the relative level of enrichment for each specific primer. In low complexity bacterial genomes a single round of selection is sufficient to amplify an essentially pure product for sequencing or cloning purposes, however in high complexity genomes a secondary, internally “nested”, targeting event may be necessary to achieve the highest level of purity.

(239) Using a human WGA library with C.sub.10 tagged termini incorporated by re-amplification with C-tailed universal U primers, specific sites were targeted and the relative enrichment evaluated in real-time PCR. FIG. 47A shows the chromatograms from real-time PCR amplification for sequential primary 1° and secondary 2° targeting primers in combination with the universal tag specific primer C.sub.10, or C.sub.10 alone. The enrichment for this particular targeted amplicon achieved in the primary amplification is approximately 10,000 fold. Secondary amplification with a nested primer enriches to near purity with an additional two orders of magnitude for a total enrichment of 1,000,000 times the starting template. It is understood to those familiar with the art that enrichment levels may vary with primer specificity, while primers of high specificity applied in sequential targeted amplification reactions generally combine to enrich products to near purity.

(240) To apply targeted amplification in a multiplexed format, specific primer concentrations were reduced 5 fold (from 200 nM to 40 nM) without significant loss of enrichment of individual sites (FIG. 47B). This primer concentration reduction allows for the combination of 45 specific primers and universal C.sub.10 primer to maintain total primer concentrations within reaction tolerances [2 μM].

(241) To evaluate the utility of multiplex-targeted amplification, a set of primers were designed adjacent to STS sites (Table IV) using Oligo Version 6.53 primer analysis software (Molecular Biology Insights, Inc.: Cascade Colo.). Primers were 18-25 bases long, having high internal stability, low 3′-end stability, and melting temperatures of 57-62° C. (at 50 mM salt and 2 mM MgCl.sub.2). Primers were designed to meet all standard criteria, such as low primer-dimer and hairpin formation, and are filtered against a human genomic database 6-mer frequency table. Primary multiplexed targeted amplification of G/C tagged WGA libraries was performed using 10-50 ng of tagged WGA library, 10-40 nM each of 45 specific primers (Table VI), 200 nM C.sub.10 primer, dNTP mix, 1×PCR buffer and 1× Titanium Taq polymerase (Clontech), FCD (1:100,000) and SGI (1:100,000) dyes (Molecular Probes) added for real-time PCR detection using the I-Cycler (Bio-Rad). Amplification is carried out by heating the samples to 95° C. for 3′30″, followed by 18-24 cycles of 94° C. 20″, 68° C. 2′. The cycle number to reaction plateau is dependent on the absolute template and primer concentrations. The amplified material was purified by Qiaquick spin column (Qiagen), and quantified spectrophotometrically.

(242) The enrichment of each site was evaluated using real-time PCR. Quantitative Real-Time PCR was performed using an I-Cycler Real-Time Detection System (Bio-Rad), as per the manufacturer's directions. Briefly, 25 μl reactions were amplified for 40 cycles at 94° C. for 15 sec and 68° C. for 1 min. Standards corresponding to 10, 1, and 0.2 ng of fragmented DNA were used for each STS, quantities were calculated by standard curve fit for each STS (I-Cycler software, Bio-Rad) and were plotted as distributions. FIG. 48A shows the relative fold amplification for each targeted site. Primary amplification of sites 1 and 29 failed to amplify in multiplex reactions and displayed delayed kinetics in singlet reactions (not shown). A distribution plot of the same data shows an average enrichment of 3000 fold (FIG. 48B). Differences in enrichment level such as highly over-amplified sites are likely to arise from false priming elsewhere on the template. Such variation is compensated with the use of nested amplification of the enriched template.

(243) Secondary targeted amplifications were performed using primary targeting products as template and secondary nested primers (Table VI) in combination with the universal C.sub.10 primer. Reactant concentrations and amplification parameters were identical to primary amplifications above. Multiplexed secondary amplifications were purified by Qiaquick spin column (Qiagen) and quantified by spectrophotometer. Enrichment of specific sites was evaluated in real-time PCR using an I-Cycler Real-Time Detection System (Bio-Rad), as per the manufacturer's directions. Briefly, 25 μl reactions were amplified for 40 cycles at 94° C. for 15 sec and 68° C. for 1 min. Standards corresponding to 10, 1, and 0.2 ng of fragmented DNA were used for each STS, quantities were calculated by standard curve fit for each STS (I-Cycler software, Bio-Rad) and were plotted as distributions. FIG. 49A shows the relative abundance of each site after nested amplification and FIG. 49B plots the data in terms of frequency.

(244) Targeted amplification applied in this format reduces the primer complexity required for multiplexed PCR. The resulting pool of amplimers can be evaluated on sequencing or genotyping platforms.

Example 25. Non-Redundant Genomic Sequencing of Unculturable or Limited Species Facilitated by Whole Genome and Targeted Amplification

(245) Whole genome and targeted amplification provide a unique opportunity for sequencing genomes of microorganisms which are difficult to grow or for species that are already extinct. The diagram illustrating such a hypothetical DNA sequencing project is shown on the FIG. 50. First, limited amounts of DNA for the organism of interest (FIG. 50A) are converted into WGA library using any method described above or as described in U.S. Patent Application 60/453,071, filed Mar. 7, 2003, and the U.S. Nonprovisional Patent Application claiming priority to same and filed concomitantly herewith, and amplified (FIG. 50B). Second, a fraction of amplified WGA DNA is cloned in a bacterial vector (FIG. 50C) while another fraction of amplified WGA DNA is converted into C-tagged WGA library (FIG. 50D). Third, the cloned DNA is sequenced with minimal redundancy (FIG. 50E) to generate enough sequence information to initiate targeted sequencing and “walking” (FIG. 50F) that should ultimately result in sequencing of all gaps remaining after non-redundant sequencing and finishing the sequencing project (FIG. 50G). The outlined strategy can be used not only for sequencing of limited species but also in any large DNA sequencing projects by replacing the costly and tedious highly redundant “shotgun” method.

(246) TABLE-US-00006 TABLE VI Targeted Amplification Primers Primary Secondary STS 1P GCATATCCATATCTCCCGAAT STS 1S TAAGCAGCAAGGTCTGGG (SEQ ID NO: 30) (SEQ ID NO: 75) STS 2P CAGAGCACTCCAGACCATACG STS 2S GTGATTGAACAATTTGGACCCAC (SEQ ID NO: 31) (SEQ ID NO: 76) STS 3P CTTCGTTATGACCCCTGCTCC STS 3S ATGGCAACATTCCACCTAGTAGC (SEQ ID NO: 32) (SEQ ID NO: 77) STS 4P TCCCAAGATGAATGGTAAGACG STS 4S CTCCGTCATGATAAGATGCAGT (SEQ ID NO: 33) (SEQ ID NO: 78) STS 5P TCCAATCTCATCGGTTTACTG STS 5S ACTGTTTGGGGTGTGAAAGGAC (SEQ ID NO: 34) (SEQ ID NO: 79) STS 8P TCCAGAGCCCAGTAAACAACA STS 8S ACTAACAACGCCCTTTGCTC (SEQ ID NO: 35) (SEQ ID NO: 80) STS 10P  TTACTTCAGCCCACATGCTTC STS 10S TCAGCACTCCGTATCTTCATTTG (SEQ ID NO: 36) (SEQ ID NO: 81) STS 12P TTCCGACATAGCGACTTTGTAG STS 12S TAAACCGCTAAAACGATAGCAGC (SEQ ID NO: 37) (SEQ ID NO: 82) STS 14P AAGGATCAGAGATACCCCACGG STS 14S TCATGGTATTAGGGAAGTGGGAG (SEQ ID NO: 38) (SEQ ID NO: 83) STS 16P TCCAAGAACCAACTAAGTCCAGA STS 16S GGGAATGAAAAGAAAAGGCATTC (SEQ ID NO: 39) (SEQ ID NO: 84) STS 22P CTAAGGGCAAACATAGGGATCAA STS 22S TCTTTCCCTCTACAACCCTCTAACC (SEQ ID NO: 40) (SEQ ID NO: 85) STS 26P CAACCTTTGAAGCCACTTTGAC STS 26S CAGTACATGGGTCTTATGAGTAC (SEQ ID NO: 41) (SEQ ID NO: 86) STS 29P GCCTCCGTCATTGGTATTTTCT STS 29S AATCGAGAACGCACAGAGCAGA (SEQ ID NO: 42) (SEQ ID NO: 87) STS 30P TGGCAACACGGTGCTGACCTG STS 30S GTCTGGGGAGTAAATGCAACATC (SEQ ID NO: 43) (SEQ ID NO: 88) STS 31P ATCATGGGTTTGGCAGTAAAGC STS 31S TTCTTGATGACCCTGCACAA (SEQ ID NO: 44) (SEQ ID NO: 89) STS 35P AGAACCAGCAAACCCAGTCCC STS 35S CAGCAGAAGCACTACCAAAGACA (SEQ ID NO: 45) (SEQ ID NO: 90) STS 36P GAAAGGGTGGATGGATTGAAA STS 36S TTCACCTAGATGGAATAGCCACC (SEQ ID NO: 46) (SEQ ID NO: 91) STS 38P TCAGATTTCCTGGCTCCGCTT STS 38S GCAAGATTTTTGCTTGGCTCTAT (SEQ ID NO: 47) (SEQ ID NO: 92) STS 41P CCTTCTGCTTCCCTGTGACCT STS 41S GAATTTTGGTTTCTTGCTTTGG (SEQ ID NO: 48) (SEQ ID NO: 93) STS 42P TGAACCCCACGAGGTGACAGT STS 42S GTCAGAAGACTGAAAACGAAGCC (SEQ ID NO: 49) (SEQ ID NO: 94) STS 43P GACATTACCAGCCCCTCACCTA STS 43S CATCTCTTGATCATCCCAGCTCT (SEQ ID NO: 50) (SEQ ID NO: 95) STS 44P TCCTTGACAGTTCCATTCACCA STS 44S CACCATTGGTTGATAGCAAGGTT (SEQ ID NO: 51) (SEQ ID NO: 96) STS 46P TTTGCAGGTAGCTCTAGGTCA STS 46S TAAACATAGCACCAAGGGGC (SEQ ID NO: 52) (SEQ ID NO: 97) STS 47P GCGGACAGAGAGTAACCTCGGA STS 47S TCATGTGTGGGTCACTAAGGATG (SEQ ID NO: 53) (SEQ ID NO: 98) STS 49P CCCAGAAACCCTGAGACCCTC STS 49S CGTCTCTCCCAGCTAGGATG (SEQ ID NO: 54) (SEQ ID NO: 99) STS 52P TGTGCCACAAGTTAAGATGCT STS 52S CTTTTTCACAGAACTGGTGTCAGG (SEQ ID NO: 55) (SEQ ID NO: 100) STS 54P TGCTGTATCGTGCCTGCTCAAT STS 54S ACCCAGCTTTCAGTGAAGGA (SEQ ID NO: 56) (SEQ ID NO: 101) STS 60P TGCCCCACTCCCCAACATTCT STS 60S AATCAAAAGGCCAACAGTGG (SEQ ID NO: 57) (SEQ ID NO: 102) STS 62P AACAGAGCCTCAGGGACCAGT STS 62S ACTGGCTGAGGGAGCATG (SEQ ID NO: 58) (SEQ ID NO: 103) STS 70P GGGCTTTGTCTGTGGTTGGTA STS 70S TAAATGTAACCCCCTTGAGCC (SEQ ID NO: 59) (SEQ ID NO: 104) STS 72P TGGGCTGGCTGAGGTCAAGAT STS 72S TATTGACCACATGACCCCCT (SEQ ID NO: 60) (SEQ ID NO: 105) STS 74P TTTTGCTCCGCTGACATTTGG STS 74S TTGGGTGATGTCTTCACATGG (SEQ ID NO: 61) (SEQ ID NO: 106) STS 77P TGCTCCTGTCCCTTCCACTTC STS 77S  GCTCAATAAAAATAGTACGCCC (SEQ ID NO: 62) (SEQ ID NO: 107) STS 79P CCTTATTCCCAGCAGCAGTATTC STS 79S TTCTCCCAGCTTTGAGACGT (SEQ ID NO: 63) (SEQ ID NO: 108) STS 82P TGGGAAGGGAAAGAGGGTACT STS 82S TTTGTTACTTGCTACCCTGAG (SEQ ID NO: 64) (SEQ ID NO: 109) STS 83P TTGCTGTAGATGGGCTTTCGT STS 83S GAAGATGAAGTGAACTCCTATCC (SEQ ID NO: 65) (SEQ ID NO: 110) STS 84P TCTGCTGGGTTGATGATTTGG STS 84S GAAGCCTTGATAACGAGAGTGG (SEQ ID NO: 66) (SEQ ID NO: 111) STS 85P GGCACAAGCAAAAGGGTGTCT STS 85S ATGTTTCTCTGGCCCCAAG (SEQ ID NO: 67) (SEQ ID NO: 112) STS 86P CCAGCAATCAGGAAAGCACAA STS 86S TGGCTGCCCTTCAATAC (SEQ ID NO: 68) (SEQ ID NO: 113) STS 89P CACCTGTCTTGTTGGCATCACC STS 89S TTGGGAAATGTCAGTGACCA (SEQ ID NO: 69) (SEQ ID NO: 114) STS 92P TTGTTTTGCCTCACCAGTCATTT STS 92S TGTGGTTAGGATAGCACAAGCATT (SEQ ID NO: 70) (SEQ ID NO: 115) STS 96P TCAGCAAACCCAAAGATGTTA STS 96S TGCAATTTGAAGGTACGAGTAG (SEQ ID NO: 71) (SEQ ID NO: 116) STS 99P TTAGTCCTTTGGGCAGCACGA STS 99S TGTTAACAATTTGCATAACAAAAGC (SEQ ID NO: 72) (SEQ ID NO: 117) STS103P TGTCTCTGCTTCTGAAACGGG STS1035 GCATTTTCTGTCCCACAAGATATG (SEQ ID NO: 73) (SEQ ID NO: 118) STS113P ACTGCCAGGGTCATTGACTT STS1135 ATTGCTGTCACAGCACCTTG (SEQ ID NO: 74) (SEQ ID NO: 119) *P- denotes primary targeted amplification primer *S- denotes secondary targeted amplification primer

Example 26. Universality of the Novel Nucleic Amplification Method and its Compatibility with Different Sources of DNA and RNA and Different Methods of Analysis of the Amplified Material

(247) The diagram presented on FIG. 51 illustrates the diversity of DNA and RNA samples that are compatible with the proposed method of amplification of nucleic acid, universality of the amplification technique, and the diversity of possible applications.

(248) Nucleic acid sources include but not limited to all animals (including humans), plants, fungi, culturable and non-culturable bacteria and viruses, and extinct species found in amber and stones. They can be isolated from any fresh, frozen, or paraffin embedded formalin fixed tissue, body fluids, forensic sample, cell culture, single cell, single chromosome, etc.

(249) The library preparation step can use total nucleic acid as a template (the protocol shown in central part of the diagram, arrow A), and result in the amplification of both DNA and RNA, or use purified DNA, and result in the amplification of the whole genome (the protocol shown in left part of the diagram, arrow B), or use purified RNA, and result in the amplification of the whole transcriptome (the protocol shown in right part of the diagram, arrow C), or use total nucleic acid and a corresponding selection method, and result in the amplification of the whole genome (the protocol shown in left part of the diagram, arrow D), or whole transcriptome (the protocol shown in right part of the diagram, arrow E).

(250) Library prepared and amplified from total nucleic acid, DNA, or RNA can be modified to incorporate polyC regions at the 5′ end of the universal constant sequence (arrows F and G). C-tailed libraries can be used for targeted amplification and analysis of specific genomic regions or RNA transcripts.

(251) Library prepared and amplified from total nucleic acid, DNA, or RNA can be modified to incorporate other tags (see FIG. 19-25) and used for ID identification, immobilization on a solid support or a micro-array, or multiple usage (not shown in FIG. 51).

(252) Applications of the proposed nucleic acid amplification technology include but not limited to genotyping of small DNA/RNA samples, gene expression analysis, sequencing of un-culturable or extinct organisms, molecular diagnostics of different diseases, prenatal diagnostics, viral/bacterial diagnostics, forensics, etc.

Example 27. Amplification of Genomic DNA from Single Cells Using a Mesophilic DNA Polymerase Followed by Universal-Primer PCR with a Thermostable DNA Polymerase, and Analysis of Locus Representation by Real-Time PCR

(253) This example describes the synthesis of libraries from single cells with Klenow Exo-followed by amplification with Taq DNA polymerase and analysis of their locus representation by real-time PCR.

(254) Immortalized human prostate epithelial RWPE cells were trypsinized, washed three times with PBS, and single cells were collected by Flow Cytometry in 5 ul of TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA). Control samples containing either 5 cells or just TE buffer were also included in the analysis to assess the locus representation of more than one genome equivalent and the amplification background respectively. Cells were immediately frozen on dry ice after collection and stored at 80° C. prior to use.

(255) Wells containing sorted cells were thawed on ice and DNA was extracted by addition of 5 ul of freshly prepared 2× cell lysis buffer comprising: 0.015% SDS, 40 mM NaCl, 20 mM Tris-HCl pH 7.5, 0.2 mM EDTA, 0.24 mg/mL Proteinase K and incubated for 1 hour at 50° C., followed by 4 min at 99° C. Samples were briefly centrifuged and placed on ice. Four μL of library synthesis buffer comprising 37.5 mM Tris-HCl pH 7.5, 18.75 mM MgCl.sub.2, 28.125 mM DTT, 0.75 mM each dNTP, 0.05 mg/mL E. coli SSB, and oligonucleotide 3 (Table VII, SEQ ID NO:128) were added to each well and the samples were heated at 95° C. for 2 min and cooled on ice.

(256) Library synthesis was initiated by addition of 1 μl of Klenow exo at 5 Units/uL. Samples were incubated in a thermal cycler as follows: 16° C. for 20 minutes, 24° C. for 20 minutes, 37° C. for 20 minutes, 75° C. for 5 minutes. Libraries were further amplified to saturation by real-time PCR on BioRad i-Cycler by addition of 60 ul of library amplification buffer comprising: 1.25× Titanium Taq buffer (BD-Clontech), 0.5 mM each dNTP, 7 mM MgCl.sub.2, 2.5 uM oligonucleotide 4 (Table VII, SEQ ID NO:129), 0.6× Titanium Taq DNA polymerase (BD-Clontech), and 10000:1 dilutions of fluorescein calibration dye and SybrGreen I (Life Technologies). After initial denaturation at 95° C. for 3 min samples were incubated for 29 cycles at 94° C. for 30 sec and 68° C. for 2 min. Library DNA was purified using MultiScreen HTS PCR kit (Millipore Cat #MSNU03050) following manufacturer's instructions, quantified using absorbance at 260 nm, and 50 ng aliquots were used in locus-specific PCR for representation analysis.

(257) Results show exemplary amplification of 4 individual libraries from sorted single cells, one library of sorted 5 cells, and duplicate “no cells” controls. Locus representation of libraries from sorted cells was analyzed by real-time PCR using a panel of 40 human genomic STS and promoter assays (Table VIII). The PCR reaction mixture comprised: 1× Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 0.2 uM of each forward and reverse primer, 0.5 ul of Titanium Taq polymerase (Clontech), 50 ng library DNA, and 5000:1 dilutions of fluorescein and SybrGreen I (Life Technologies) in a final volume of 25 ul. In the case of analyzing promoter sequences 4% DMSO and 0.5 M betaine were added to the reaction mixture.

(258) After initial denaturation for 3 min reactions were carried out at 95° C. for 20 sec, 68° C. for 1 min, 75° C. for 30 sec, and 80° C. for 15 sec on i-Cycler real-time PCR instrument (BioRad). Statistical analysis of data was performed using Excel (Microsoft).

Example 28. Amplification of Genomic DNA from Single Cells Using a Thermostable DNA Polymerase and Analysis of Locus Representation by Real-Time PCR

(259) This example describes the amplification of genomic DNA from single cells sorted by Flow Cytometry and the analysis of its locus representation by real-time PCR.

(260) Immortalized human prostate epithelial RWPE cells were trypsinized, washed three times with PBS and single cells were collected by Flow Cytometry into 5 ul of cell lysis buffer comprising 5 mM Tris-HCl pH 8.3, and 0.01% Triton X-100 in deionized nuclease-free water. Control samples containing either 5 cells or just lysis buffer (no cells) were also included in the analysis to assess the locus representation of more than one genome equivalent and the amplification background respectively. Cells were immediately frozen on dry ice after collection and stored at −80° C. prior to use.

(261) Wells containing sorted cells were thawed on ice and DNA was extracted by addition of 4 ul of cell lysis buffer containing 0.2 units of proteinase enzyme (prepGEM Saliva 500 Kit, VWR Catalog #95044-052) and incubated for 10 min at 75° C. Five ul of library preparation buffer comprising: 3×KAPA 2G Robust buffer B (KAPA Biosystems, Cat #KB 5003), 0.6 mM each dNTP, 6 mM MgCl.sub.2, 12% DMSO, 6 uM oligonucleotide 1 (Table VII, SEQ ID NO:25) [or alternatively 15 uM oligonucleotide 5 (Table VII, SEQ ID NO:130)] were added to each well and the samples were heated at 95° C. for 4 min.

(262) Library synthesis was initiated by addition of 1 ul of KAPA 2G Robust DNA polymerase (KAPA Biosystems, Cat #KE 5004) at a concentration of 1 unit/ul. After initial denaturation for 2 min at 95° C. samples were incubated for 12 cycles at: 95° C. for 15 sec, 15° C. for 50 sec, 25° C. for 40 sec, 35° C. for 30 sec, 65° C. for 40 sec, and 75° C. for 40 sec.

(263) Libraries were further amplified to saturation by real-time PCR on BioRad Cycler by addition of 60 ul of library amplification buffer comprising: 1.25×KAPA 2G Robust buffer B (KAPA Biosystems, Cat #KB 5003), 0.5 mM each dNTP, 3.75 mM MgCl.sub.2, 6.25% DMSO, 2.5 uM oligonucleotide 2 (Table VII, SEQ ID NO:26), 4.5 units of KAPA 2G Robust DNA polymerase (KAPA Biosystems, Cat #KE 5004), and 5000:1 dilutions of fluorescein calibration dye and SybrGreen I (Life Technologies).

(264) After initial denaturation at 95° C. for 2 min samples were incubated for 13 cycles at 96° C. for 15 sec, 65° C. for 1 min, and 75° C. for 1 min. Library DNA was purified using MultiScreen HTS PCR kit (Millipore Cat #MSNU03050), and 50 ng aliquots were used in locus-specific PCR for representation analysis.

(265) Locus representation of libraries from sorted cells was analyzed by real-time PCR using a panel of 40 human genomic STS and promoter assays (Table VIII). The PCR reaction mixture comprised: 1× Titanium Taq reaction buffer (Clontech), 200 uM each dNTP, 0.2 uM of each forward and reverse primer, 0.5 ul of Titanium Taq polymerase (Clontech), 50 ng library DNA, and 5000:1 dilutions of fluorescein and SybrGreen I (Life Technologies) in a total volume of 25 ul. In the case of analyzing promoter sequences 4% DMSO and 0.5 M betaine were also added to the reaction mixture. After initial denaturation for 3 min reactions were carried out at 95° C. for 20 sec, 68° C. for 1 min, 75° C. for 30 sec, and 80° C. for 15 sec on i-Cycler real-time PCR instrument (BioRad). Statistical analysis of data was performed using Excel (Microsoft).

(266) FIG. 52 shows an exemplary amplification of replicate single-cell and control no-cell whole genome amplification reactions. It demonstrates the ability of the methods and compositions disclosed herein to amplify DNA from a single genome with much higher sensitivity and farther away from the non-specific background characteristic of other methods generally used in the field. This should make it possible to apply the disclosed methods and compositions for analysis of individual chromosomes as well as limited number of bacterial cells and even viral genomes.

(267) An exemplary amplification of 10 individual libraries from sorted single cells, duplicate sorted 5 cells, and quadruplicate “no cells” controls is shown on FIG. 53. It demonstrates that highly consistent and reproducible results are generated by the methods and compositions disclosed in the present invention with small sample-to-sample variation.

(268) FIG. 54 demonstrates the input range and reproducibility of whole genome DNA amplification by the methods and compositions disclosed herein. FIG. 54A shows locus-specific qPCR testing of whole genome amplification from replicate samples corresponding to increasing number of cell equivalent inputs in the range of 1-10,000. FIG. 54B shows that after saturating whole genome amplification form 1, 10, 100, or 1000 cell equivalents the copy number of a single locus as analyzed by qPCR gives practically the same results.

(269) In quantitative genome analysis sample to sample variation represents a significant problem. FIG. 55 shows cell to cell variation for two individual cells in 24 qPCR assays. As seen from the correlation plot highly reproducible representation over multiple loci is achieved by the methods and compositions disclosed in the present invention.

(270) FIG. 56 illustrates the reproducibility of whole genome amplification by the disclosed methods and compositions in representing 25 individual loci assayed by qPCR across 10 replicate cells. This figure demonstrates that there is inherent amplification bias but it is highly reproducible and can be easily corrected for, a feature that can be highly advantageous in quantitative genome analysis.

Example 29. Analyzing Amplification Efficiency

(271) Sample amplification efficiencies can be analyzed by performing the amplification reactions with SYBR® Green I in a real-time thermal cycler. During the amplification reaction, double-stranded amplified molecules are bound by the nonsequence-dependent SYBR® Green I dye, and the accumulation of amplified product is detected as an increase in fluorescence by the real-time instrument.

(272) Data analysis is performed on raw background-subtracted fluorescence, and the instrument/software should be set to the appropriate mode.

(273) Amplification curves will have a similar appearance for successfully amplified single-cell WGA products, with an immediate 8-9 cycle upward sloping phase, followed by a relatively flat “plateau” phase (FIG. 52).

(274) No-cell control amplification curves are delayed (right-shift) by 5-6 PCR cycles compared to single-cell amplification curves. A smaller delay of control curves may indicate DNA contamination introduced with the sample or during the WGA process.

Example 30. Protocol

(275) 1. Add 5 uL of PicoPlex Pre-Amp Buffer to 9 uL of single-cell lysate or control no-cell lysate.

(276) 2. Incubate samples in a thermal cycler as follows:

(277) TABLE-US-00007 1 cycle 95 C. 4 min 1 cycle Room Hold Temp

(278) 3. Briefly centrifuge samples. 4. Combine the following components and mix well.

(279) TABLE-US-00008 Synthesis Enzyme Mix Volume Per 5 samples Pre-Amp Enzyme Dilution Buffer 4 uL PicoPlex Pre-Amp Enzyme 1 uL Total Volume 5 uL

(280) 5. Add 1 uL of Pre-Amp Enzyme Mix to sample. 6. Incubate samples according to thermal cycler program below:

(281) TABLE-US-00009 1 cycle 95 C. .sup. 2 min 95 C. 15 sec 15 C. 50 sec 12 cycles 25 C. 40 sec 35 C. 30 sec 65 C. 40 sec 75 C. 40 sec 1 cycle  4 C. hold

(282) 7. Briefly centrifuge samples and place synthesis reaction products on ice. 8. Combine the following Amplification Cocktail components and mix well.

(283) TABLE-US-00010 Amplification Cocktail Volume Per 5 Samples PicoPlex Amplification Buffer 125 uL PicoPlex Amplification Enzyme  4 uL Nuclease-Free Water 171 uL Total Volume 300 uL Note: Sample amplification efficiencies can be analyzed by adding SYBR Green I dye (Invitrogen, S7563) at 0.125x final concentration in the Amplification Cocktail and by performing the amplification in a real-time thermal cycler (see Appendix A). Some instruments may also require additional reference dyes for SYBR signal normalization.

(284) 9. Mix 60 uL of the freshly prepared Amplification Cocktail with the 15 uL synthesis reaction product and mix by pipet. 10. Amplify samples according to thermal cycler program below:

(285) TABLE-US-00011 1 cycle 95 C. 2 min 95 C. 15 sec.sup.  13 cycles 65 C. 1 min 75 C. 1 min Note: 13 cycles is recommended in certain embodiments based on testing performed with single cultured cells obtained by flow sorting, dilution, and micromanipulation. Some cell types or lysis conditions may require additional cycles (up to 15) to obtain maximal yields.

Example 31. Exemplary Kit Materials and Methods

(286) The methods and compositions disclosed herein amplify DNA directly from many types of cells. Some of the methods used in the isolation and amplification of DNA from cells are as follows:

(287) Single Cell Collection Methods

(288) Flow sorting, dilution, and micromanipulation are collection methods that are compatible with the methods and compositions disclosed herein. Cell staining may negatively affect whole genome amplification performance, especially staining methods that include fixing (e.g. with formaldehyde) steps.

(289) Sample Volume

(290) Single cells may be collected and lysed/extracted in a total of about 9 μL volume.

(291) Cell Lysis and DNA Extraction Methods

(292) Single-cell PCR lysis/extraction methods (e.g. protease/detergent incubation or alkaline treatment followed by neutralization) are compatible with the methods and compositions disclosed herein, as long as, for example, monovalent salt concentrations do not exceed 20 mM in the final 9 μL lysate volume.

(293) Considerable (>5 μL) evaporation may occur, if the incubation is being performed in a PCR plate without a very tight seal. Evaporation during PCR may be minimized by using an appropriate thermal cycler, for example, the combination of iCycler IQ 96-well PCR plates (Bio-Rad, 223-9441) and Axymat silicone sealing mats (Axygen, AM-96-PCR-RD).

(294) Exemplary Kit Components

(295) TABLE-US-00012 Component Name 1. PicoPlex Pre-Amp Buffer 2. PicoPlex Pre-Amp Enzyme 3. Pre-Amp Enzyme Dilution Buffer 4. PicoPlex Amplification Buffer 5. PicoPlex Amplification Enzyme 6. Nuclease-Free Water

(296) TABLE-US-00013 TABLE VII OLIGONUCLEOTIDE SEQUENCES USED IN SINGLE GENOME LIBRARIES PREPARATION No Sequence 5′-3′ * 1. TGTGTTGGGTGTGTTTGGKKKKKKKKKK (SEQ ID NO: 25) 2. TGTGTTGGGTGTGTTTGG (SEQ ID NO: 26) 3. TGTTGTGGGTTGTGTTGGKKKKKKKKKK (SEQ ID NO: 128) 4. TGTTGTGGGTTGTGTTGG (SEQ ID NO: 129) 5. TGTGTTGGGTGTGTTTGGNKKNKKNKK (SEQ ID NO: 130) * Random bases definitions: K = G, T; N = A, G, C, T

(297) TABLE-US-00014 TABLE VIII OLIGONUCLEOTIDE SEQUENCES USED IN LOCUS- SPECIFIC REAL-TIME PCR ASSAYS Assay No *** Sequence 5′-3′ **  1 F AGAGGCTTCTGGCAGTTTGC (SEQ ID NO: 131)  1 R CCCAGCCTCTGGAAAATCAG (SEQ ID NO: 132)  2 F CCCTAACATGGAGGTAGGAGC (SEQ ID NO: 133)  2 R TCTTCCTGGTGTGAGCCTCT (SEQ ID NO: 134)  3 F GAGAACCGGAGCGTGCTT (SEQ ID NO: 135)  3 R TATTGACCACATGACCCCCT (SEQ ID NO: 136)  4 F GCAAAATCCATACCCTTTCTGC (SEQ ID NO: 137)  4 R TCTTTCCCTCTACAACCCTCTAACC (SEQ ID NO: 138)  5 F GCAAAATGCCTTCTTGTGTTTTTC (SEQ ID NO: 139)  5 R GCATTTTCTGTCCCACAAGATATG (SEQ ID NO: 140)  6 F ATGTTTCTCTGGCCCCAAG (SEQ ID NO: 141)  6 R TTCTCCATGAGATTGGACTGG (SEQ ID NO: 142) 10 F TCATCATGATCAACAGGAAAGA (SEQ ID NO: 143) 10 R CAACCCTGGCCTCAGGAT (SEQ ID NO: 144) 11 F GTGAATATAGTGAGTGACAGATGGC (SEQ ID NO: 145) 11 R CTTTATGAAACGGGGCCATA (SEQ ID NO: 146) 12 F CAATGTACAGGTCCTGTTGCC (SEQ ID NO: 147) 12 R AAAACAATGCTTCCAGTGGC (SEQ ID NO: 148) 13 F ACAGTCCCATTCTGGCAAAC (SEQ ID NO: 149) 13 R TCACTCCCTCCAACAATTCC (SEQ ID NO: 150) 14 F TTTGTTACTTGCTACCCTGAG (SEQ ID NO: 151) 14 R CAACCATCATCTTCCACAGTC (SEQ ID NO: 152) 15 F CGGCATGAGGAAGGTGCAGGAG (SEQ ID NO: 153) 15 R CGACACCATGCGAGACACGCTTG (SEQ ID NO: 154) 16 F AATGCCCAGCAGAACCGCC (SEQ ID NO: 155) 16 R ACTCCACAAACTCATCCAGGTCCTC (SEQ ID NO: 156) 17 F GCAAGATTTTTGCTTGGCTCTAT (SEQ ID NO: 157) 17 R CTTTGGTATTTGCTTCCACCAAC (SEQ ID NO: 158) 18 F TGAGGCTTCACATTCCAGC (SEQ ID NO: 159) 18 R TATTCCCAGTGCTGGAGAGG (SEQ ID NO: 160) 19 F TCATTGGGGCTGAGCAAT (SEQ ID NO: 161) 19 R TCAGGAGCCTTTTAGTCTGAGG (SEQ ID NO: 162) 20 F TGTTAACAATTTGCATAACAAAAGC (SEQ ID NO: 163) 20 R TGATTAATTTGCGAGACTAACTTTG (SEQ ID NO: 164) 21 F GGTTCCTCCAAAGAACAGCA (SEQ ID NO: 165) 21 R TGAGATTTGGCCTTGCTTCT (SEQ ID NO: 166) 22 F TCCATTGTTTACCCCAAAGC (SEQ ID NO: 167) 22 R TCTGGGAGTGGGAAGAGTTG (SEQ ID NO: 168) 23 F CCCAGCCCTCTCTCCGCC (SEQ ID NO: 169) 23 R CCTAAACTGGAGACGGATCCTGCCC (SEQ ID NO: 170) 24 F ACAGGCCTCCATTCATGTCCCTTCC (SEQ ID NO: 171) 24 R TCGTGGCCGCCAAGGCAC (SEQ ID NO: 172) 25 F GCATCCTATAAAAGCAGCCATGT (SEQ ID NO: 173) 25 R GGCTGAGTCATCTTCCTCTTGAA (SEQ ID NO: 174) 26 F GACCATCAGGCGACAGATT (SEQ ID NO: 175) 26 R GCTCAGGCATAACCCCTC (SEQ ID NO: 176) 28 F CTACCATGCCTGGCAGAAAT (SEQ ID NO: 177) 28 R TTGCTAACCTAAAAGACAGCAGG (SEQ ID NO: 178) 29 F TGAAAAGGATACCAAAGTGCG (SEQ ID NO: 179) 29 R TTGGGAAATGTCAGTGACCA (SEQ ID NO: 180) 30 F GGCCAACAGGAACAGCAG (SEQ ID NO: 181) 30 R TTCTCTGGATCTTTTCAGCC (SEQ ID NO: 182) 31 F CCGCGAGCTCCCTCTGCC (SEQ ID NO: 183) 31 R CTCTGTAGCCCTAGGACCGGTCTG (SEQ ID NO: 184) 32 F CTGCCGACATTCCACGGGTTTCTTG (SEQ ID NO: 185) 32 R AGCCTTCCGCTGGAAGTCCAACTTT (SEQ ID NO: 186) 33 F TTTCACATTTCCTAAGCAGCC (SEQ ID NO: 187) 33 R TTGCTTTTGCCCCCACTACTG (SEQ ID NO: 188) 34 F TGCCAGAGAAGTTTTAACAATCACA (SEQ ID NO: 189) 34 R GGATGACAACTGCTAAGGTCCAT (SEQ ID NO: 190) 35 F TATTTAAAATGTGGGCAAGATATCA (SEQ ID NO: 191) 35 R TGGTGTAAATAAAGACCTTGCTATC (SEQ ID NO: 192) 38 F CCATTTCGTATCAGTCTAGCCCA (SEQ ID NO: 193) 38 R GTCAGTGCTGCTATGGAGCTTTT (SEQ ID NO: 194) 41 F GCTTACTGATGAAAAACTCATCCA (SEQ ID NO: 195) 41 R TGGTTATAACTAACAAACCTGAACA (SEQ ID NO: 196) 42 F CTCTATGTGGCTCACGCAG (SEQ ID NO: 197) 42 R TTTACAAATGAGGGAACTCCC (SEQ ID NO: 198) 43 F TGGGAAAAGTCAGCTCGTG (SEQ ID NO: 199) 43 R AACTGGGGGCAAGAACAAC (SEQ ID NO: 200) 44 F TCATTAACACCAGTCTGCAACA (SEQ ID NO: 201) 44 R TGCAATTTGAAGGTACGAGTAG (SEQ ID NO: 202) 45 F GCACCTGCTAAGGAGGGAG (SEQ ID NO: 203) 45 R TCATTTTTTGCTGATGGTTCC (SEQ ID NO: 204) 46 F CCGCTGGATTCTTTTTCAAA (SEQ ID NO: 205) 46 R AAGGCTCAAATGCCAAATTG (SEQ ID NO: 206) 47 F AGCGGCCTGGATGAGATGCTG (SEQ ID NO: 207) 47 R CTGGTTCACAGCCCAAAGGCTGA (SEQ ID NO: 208) 48 F CTCCCACAGACCGACCAGCTTCC (SEQ ID NO: 209) 48 R GTGCATCGTGATCTCGGGTGAGAGC (SEQ ID NO: 210) * F = forward primer, R = reverse primer ** Sequences in bold represent promoter regions *** Omitted sequential numbers indicate bad quality or failed assays

(298) TABLE-US-00015 TABLE 3 Troubleshooting Guide Problem Potential Cause Suggested Solutions Sample well did not Confirm that single-cell contain a cell isolation process is properly dispensing a single cell per tube or well Single-Cell Inefficient sample lysis Use alternative lysis Amplification Curve method or EDTA-free cell Looks Like Control collection buffer. No-Cell Cell lysate contained Do not exceed 20 mM Amplification WGA inhibitors monovalent salt Curve concentration in cell lysate Cells have been Handle cells without exposed to fixatives or fixation or staining contain dye molecules Control No-Cell DNA contamination of Carefully wash cells in Amplification Curve sample fresh PBS or other serum- Appears Early free medium Exogenous DNA Clean area thoroughly and contamination in use PCR-dedicated sample or work plastics and pipettes. environment Reagents are Use fresh kit contaminated

REFERENCES

(299) All patents and publications mentioned in the specification are indicative of the levels of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

PATENTS

(300) U.S. Pat. No. 5,759,822 U.S. Pat. No. 6,107,023 U.S. Pat. No. 6,114,149 U.S. Pat. No. 6,124,120 U.S. Pat. No. 6,280,949 U.S. Pat. No. 6,365,375 U.S. Ser. No. 00/551,4545A U.S. Ser. No. 00/593,2451A US20030186237A1 WO 02/72772 US 2003/0013671 US2003/0017591 A1 U.S. Ser. No. 00/627,1002B1 US20030113754A1 Japan Patent No. JP8173164A2 U.S. Pat. No. 4,683,195, U.S. Pat. No. 4,683,202 U.S. Pat. No. 4,800,159 WO 90/07641 U.S. Pat. No. 5,882,864. European Patent Application No. 320,308 U.S. Pat. No. 4,883,750 Patent Application No. PCT/US87/00880 PCT Patent Application WO 88/10315 U.S. Pat. No. 5,648,245 British Patent Application No. GB 2,202,328 PCT Patent Application No. PCT/US89/01025 PCT Patent Application WO 89/06700 U.S. Patent Application 20030143599 U.S. Ser. No. 00/575,9822A WO/016545 A1

PUBLICATIONS

(301) Advances in Immunology, Academic Press, New York. Annual Review of Immunology, Academic Press, New York. Allsopp, R. C., Chang, E., Kashefi-aazam, M., Rogaev, E. I., Piatyszek, M. A., Shay, J. W. and Harley, C. B. 1995. Telomere shortening is associated with cell division in vitro and in vivo. Exp. Cell Res., 220:194-200. Allsopp, R. C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E. V., Futcher, A. B., Greider, C. W. and Harley, C. B. 1992. Telomere length predicts replicative capacity of human fibroblasts. Proc. Natl Acad. Sci. USA, 89:10114-10118. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. O., Seidman, J. S., Smith, J. A., and Struhl, K. 1987. Current protocols in molecular biology. Wiley, New York, N.Y. Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C.-P., Morin, G. B., Harley, C. B., Shay, J. W., Lichtsteiner, S. and Wright W. E. 1998. Extension of life-span by introduction of telomerase into normal human cells. Science, 279:349-352. Bohlander, S. K., Espinosa, R., LeBeau, M. M., Rowler, J. D., Diaz, M. O. 1992. A method for the rapid sequence-independent amplification of microdissected chromosomal material. Genomics, 13:1322-1324. Bond, J., Haughton, M., Blaydes, J., Gire, V., Wynfordthomas, D. and Wyllie, F. 1996. Evidence that transcriptional activation by p53 plays a direct role in the induction of cellular senescence. Oncogene, 13:2097-2104. Buchanan, A. V., Risch, G. M., Robichaux, M., Sherry, S. T., Batzer, m. A., Weiss, K. M. 2000. Long DOP-PCR of rare archival anthropological samples. Hum. Biol., 72:911-925. Champoux J. J. (2001) DNA topoisomerases: structure, function, and mechanism Annu Rev Biochem, 70:369-413. Chang, K. S., Vyas, R. C., Deaven, L. L., Trujillo, J. M., Stass, S. A., Hittelman W. N. 1992. PCR amplification of chromosome-specific DNA isolated from flow cytometry-sorted chromosomes. Genomics, 12:307-312. Cheng, J., Waters, L. C., Fortina, P., Hvichia, G., Jacobson, S. C., Ramsey, J. M., Kricka, L. J., Wilding, P. 1998. Degenerate oligonucleotide-primed polymerase chain reaction and capillary electrophoretic analysis of human DNA on a microchip-based devices. Anal. Biochem., 257:101-106. Cheung, V. G., Nelson, S. F. 1996. Whole genome amplification using a degenerate oligonucleotide primer allows hundreds of genotypes to be performed on less than one nanogram of genomic DNA. Proc. Natl. Acad. Sci. USA, 93:14676-14679. Coligan, J. E., Kruisbeek A. M., Margulies, D. H., Shevach, E. M., Strober, W. 1991. Current protocols in immunology. John Wiley and Sons, Hoboken, N.J. Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B. and Bacchetti, S. 1992. Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J., 11:1921-1929. Dean, F., hosono, S., Fang, L., Wu, X., Faruqi, A. F., Bray-Ward, P., Sun, Z., Zong, Q., Du, Y., Du, J., Driscoll, M., Song, W., Kingsmore, S., Egholm, M., Lasken, R. S. 2002. Comprehensive human genome amplification using multiple displacement amplification. Proc. Natl. Acad. Sci. USA, 99:5261-5266. Dean, F., Nelson, J., Giesler, T., Lasken, R. 2001. Rapid amplification of plasmid and phage DNA using ϕ29 DNA polymerase and multiply-primed rolling circle amplification. Genome Res., 11:1095-1099. DeRisi Laboratory, Dept. of Biochemistry & Biophysics, Univ. of California at San Francisco (2001) Random DNA Amplification. Directions for amplifying products for printing on arrays. World Wide Web website available. Di Leonardo, A., Linke, S. P., Clarkin, K. and Wahl, G. M. 1994. DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cipl in normal human fibroblasts. Genes Dev., 8:2540-2551. Dietmaier, W., Hartmann, A., Wallinger, S., Heinmöller, E., Kerner, T., Endl, E., Jauch, K. W., Hofstädter, F., Riischoff, J. 1999. Multiple mutation analyses in single tumor cells with improved whole genome amplification. Am. J. Path., 154:83-95. Freshney, R. I. 1987. Culture of animal cells: a manual of basic technique, 2d ed., Wiley-Liss, London. Frohman, M. A. 1990. Race: Rapid amplification of cDNA ends. In Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. eds., PCR protocols. Academic press, New York. Pp 28-38. Gait, M. 1984. Oligonucleotide Synthesis. Practical Approach Series. IRL Press, Oxford, U.K. Grothues, D., Cantor, C. R., Smith, C. L. 1993. PCR amplification of megabase DNA with tagged random primers (T-PCR). Nucleic Acids Res., 21:1321-1322. Guan X Y, Trent J M, Meltzer P S. 1993 Generation of band-specific painting probes from a single microdissected chromosome. Hum Mol Genet, 2(8):1117-1121 Hadano, S., Watanabe, M., Yokoi, H., Kogi, M., Kondo, I., Tsuchiya, H., Kanazawa, I., Wakasa, K., Ikeda, J. E. 1991. Laser microdissection and single unique primer PCR allow generation of regional chromosome DNA clones from a single human chromosome. Genomics, 11:364-373. Hara, E., Smith, R., Parry, D., Tahara, H. and Peters, G. 1996. Regulation of p16 (CdkN2) expression and its implications for cell immortalization and senescence. Mol. Cell. Biol., 16:859-867. Hayflick, L. and Moorhead, P. S. 1961. The serial cultivation of human diploid cell strains. Exp. Cell Res., 25:585-621. Hayflick, L. 1965. The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res., 37:614-636. Hiyama, E., Tatsumoto, N., Kodama, T., Hiyama, K., Shay, J. W. and Yokoyama, T. 1996. Telomerase activity in human intestine. Int. J. Oncol., 9:453-458. Jiang, X. R., Jimenez, G., Chang, E., Frolkis, M., Kusler, B., Sage, M., Beeche, M., Bodnar, A. G., Wahl, G. M., Tlsty, T. D. and Chiu, C. P. 1999. Telomerase expression in human somatic cells does not induce changes associated with a transformed phenotype. Nature Genet., 21:111-114 Johnson, D. H. 1990. Molecular cloning of DNA from specific chromosomal regions by microdissection and sequence-independent amplification of DNA. Genomics, 6:243-251. Kao, F. T., Yu, J. W. 1991. Chromosome microdissection and cloning in human genome and genetic disease analysis. Proc. Natl. Acad. Sci. USA, 88:1844-1848. Kinzer, K. W., Vogelstein, B. 1989. Whole genome PCR: application to the identification of sequences bound by gene regulatory proteins. Nucleic Acid Res., 17:3645-3653. Kittler, R., Stoneking, M., Kayser, M. 2002. A whole genome amplification method to generate long fragments from low quantities of genomic DNA. Anal. Biochem., 300:237-244. Klein, C. A., Schmidt-Kittler, O., Schardt, J. A., Pantel, K., Speicher, M. R., Riethmüller, G. 1999. Comparative genomic hybridization, loss of heterozygosity, and DNA sequence analysis of single cells. Proc. Natl. Acad. Sci. USA, 96:4494-4499. Kleyn, P. W., Wang, C. H., Lien, L. L., Vitale, E., Pan, J., Ross, B. M., Grunn, A., Palmer, D. A., Warburton, D., Brzustowicz, L. M. 1993. Construction of yeast artificial chromosome contig spanning the spinal muscular atrophy disease gene region. Proc. Natl. Acad. Sci., 90:6801-6805. Ko, M. S. H., Ko, S. B. H., Takahashi, N., Nishiguchi, K., Abe, K. 1990. Unbiased amplification of highly complex mixture of DNA fragments by ‘lone linker’-tagged PCR. Nucleic Acids Res., 18:4293-4294. Korenburg, J. R., Rykowski, M. C. 1988. Human genome organization: Alu, LINES, and the molecular structure of metaphase chromosome bands. Cell, 53:391-400. Kwoh, D. Y., Davis, G. R., Whitfield, K. M., Chappelle, H. L., DiMichele, L. J., and Gingeras, T. R. 1989. Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format. Lüdecke, H. J., Senger, G., Claussen, U., Horsthemke, B. 1989. Cloning defined regions of human genome by microdissection of banded chromosomes and enzymatic amplification. Nature, 338:348-350. Makrigiorgos, M. G., Chakrabarti, s., Zhang, Y., Kauer. M., and Price, B. D. 2002. A PCR-based amplification method retaining the quantitative difference between two complex genomes. Nature Biotechnology, 20:936-939. Martin, G. M., Sprague, C. A. and Epstein, C. J. 1970. Replicative lifespan of cultivated human cells: effect of donor's age, tissue and genotype. Lab. Invest., 23:86-92. Methods in Enzymology. Academic Press, New York. Milan, D., Yerle, M., Schmitz, A., Chaput, B., Vaiman, M., Frelatm, G., Gellin, J. 1993. A PCR-base method to amplify DNA with random primers: Determining the chromosomal content of porcine flow-karyotype peaks by chromosome painting. Cytogenet. Cell Genet., 62:139-141. Miller, J. M., and Calos, M. P. 1987. Gene Transfer Vectors for Mammalian Cells. Cold Spring Harbor Laboratory, Cold Spring Harbor. Miyashita, K., Vooijs, M. A., Tucker, J. D., Lee, D. A., Gray, J. W., Pallavicini, M. G. 1994. A mouse chromosome 11 library generated from sorted chromosomes using linker-adapter polymerase chain reaction. Cytogenet. Cell Genet., 66:54-57. Morales, C. P., Holt, S. E., Ouellette, M., Kaur, K. J., Yan, Y., Wilson, K S., White, M A., Wright, W. E. and Shay, J. W. 1999. Lack of cancer-associated changes in human fibroblasts immortalized with telomerase. Nature Genet., 21:115-118. Naylor, J., Brinke, A., Hassock, S., Green, P. M., Giannelli, F. 1993. Characteristic mRNA abnormality found in half the patients with sever hemophilia A is due to large DNA inversions. Hum. Mol. Genet., 2:1773-1778. Nelson, D. G., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Solis, R., Webster, T. D., Ledbetter, D. H., Caskey, C. T. 1989. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences fro complex DNA sources. Proc. Natl. Acad. Sci. USA, 86:6686-6690. Ohara O., Dorit, R. L., and Gilbert, W. 1989. One-sided polymerase chain reaction: the amplification of cDNA. Proc. Natl. Acad. Sci. USA, 86:5673-5677. Olovnikov, A. M. 1973. A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J. Theor. Biol., 41:181-190. Paunio, T., Reima I., Syvanen, A. C. 1996. Preimplantation diagnosis by whole-genome amplification, PCR amplification, and solid-phase minisequencing of blastomere DNA. Mol. Path. Genet., 42:1382-1390. Phillips J., Eberwine J. H., 1996. Antisense RNA amplification: a linear amplification method for analyzing the mRNA population from single living cells. Methods 10:283-8 Ramirez, R. D., Wright, W. E., Shay, J. W. and Taylor, R. S. 1997. Telomerase activity concentrates in the mitotically active segments of human hair follicles. J. Invest. Dermatol., 108:113-117. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Smith, J. C., Markham, A. F. 1990. A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res., 18:2887-2890. Robles, S. J. and Adami, G. R. 1998. Agents that cause DNA double strand breaks lead to p16-ink4a enrichment and to premature senescence of normal fibroblasts. Oncogene, 6:1113-1123. Saiki, R. K., Scharf, S., Faloona, F. A., Mullis, K. B., Horn, G. T., Erlich, H. A., Arnheim, N. 1985. Enzymatic amplification of fl-globin sequences and restriction site amplification for diagnosis of sickle cell anemia. Science, 230:1350-1354. Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, second edition, Cold Spring Harbor Laboratory, Cold Spring Harbor. Sanchez-Cespedes, M., Cairns, P., Jen, J., Sidransky, D. 1998. Degenerate oligonucleotide-primed PCR (DOP-PCR): Evaluation of its reliability for screening of genetic alteration in neoplasia. Biotechniques, 25:1036-1038. Saunders, R. D. C., Glover, D. M., Ashburner, M., Siden-Kiamos, I., Louis, C., Monastirioti, M., Savakis, C., Kafatos, F. 1989. PCR amplification of DNA microdissected from a single polytene chromosome band: A comparison with conventional microcloning. Nucleic Acids Res., 17:9027-9037. Schmidt, W. M. and Meuller, M. W. 1999. CapSelect: a highly sensitive method for 5′ CAP-dependent enrichment of full-length cDNA in PCR-mediated analysis of mRNAs. Nucleic Acids Res., 27:e31 Shay, J. W., Pereira-Smith, O. M. and Wright, W. E. 1991. A role for both RB and p53 in the regulation of human cellular senescence. Exp. Cell Res., 196:33-39. Shay, J. W., Van Der Haegen, B. A., Ying, Y. and Wright, W. E. 1993. The frequency of immortalization of human fibroblasts and mammary epithelial cells transfected with SV40 large T-antigen. Exp. Cell Res., 209:45-52. Siebert, P. D., Chenchik, A., Kellogg, D. E., Lukyanov, K. A., Lukyanov, S. A. 1995. An improved PCR method fpr walking in uncloned genomic DNA. Nucleic Acids Res., 23:1087-1088. Smith, L., Underhill, P., Pritchard, C., Tymowska-Lalanee, Zuzanna., Abdul-Hussein, S., Hilton, H., Winchester, L., Williams, D., Freeman, T., Webb, S., and Greenfield, A. 2003. Nucleic Acids Res. 31: No. 3 e9. Studier F. W. (1979) Relationships among different strains of T7 and among T7-related bacteriophages. Virology, 95(1):70-84. Telenius, H., Carter, N. P., Bebb, C. E., Nordenskjold, M., Ponder, B. A. J., Tunnacliffe, A. 1992. Degenerate oligonucleotide-primed PCR: General amplification of target DNA by a single degenerate primer. Genomics, 13:718-725. Ulaner, G. A. and Giudice, L. C. 1997. Developmental regulation of telomerase activity in human fetal tissues during gestation. Mol. Hum. Reprod., 3:769-773. Valdes, J. M., Tagle, D. A., Collins, F. S. 1994. Island rescue sequences from yeast artificial chromosomes and cosmids. Proc. Natl. Acad. Sci. USA, 91:5377-5381. VanDevanter, D. R., Choongkittaworn, N. M., Dyer, K. A., Aten, J., Otto, P., Behler, C., Bryant, E. M., Rabinovitch, P. S. 1994. Pure chromosome-specific PCR libraries from single sorted chromosome. Proc. Natl. Acad. Sci. USA, 91-5858-5862. Vaziri, H. and Benchimol, S. 1996. From telomere loss to p53 induction and activation of a DNA-damage pathway at senescence: the telomere loss/DNA damage model of cell aging. Exp. Gerontol., 31:295-301. Vaziri, H. and Benchimol, S. 1998. Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr. Biol., 8:279-282. Vooijs, M., Yu, L. C., Tkachuk, D., Pinkel, D., Johnson, D., Gray, J. W. 1993. Libraries for each human chromosome, constructed from sorter-enriched chromosomes by using linker-adaptor PCR. Am. J. Hum. Genet., 52:586-597. Walker, G. T., Frasier, M S., Schram, J. L., Little, M. C., Nadeau, J. G., and Malinowski, D. P. 1992. Strand displacement amplification—an isothermal, in vitro DNA amplification technique. Nucleic Acids Res., 20:1691-1696. Watson, J. D. 1972. Origin of concatemeric T4 DNA. Nature, 239:197-201. Weir, D. M. 1978. Handbook of Experimental Immunology. Blackwell Scientific Publications, Oxford, U.K. Wells, D., Sherlock, J. K., handyside, A. H., Delhanty, J. D. A. 1999. Detailed chromosomal and molecular genetic analysis of single cells by whole genome amplification and comparative genomic hybrindisation. Nucleic Acids Res., 27:1214-1218. Wesley, C. S., Ben M., Kreitman, M., Haga, N., Easnes, W. F. 1990. Cloning regions of the Drosophila genome by microdissection of polytene chromosome DNA and PCR with nonspecific primer. Nucleic Acids Res., 18:599-603. Wold, M S (1997) Replication protein A: A heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Ann. Rev. Biochem. 66:61-92. Wong, K. K., Stillwell, L. C., Dockery, C. A., Saffer, J. D. 1996. Use of tagged random hexamer amplification (TRHA) to clone and sequence minute quantities of DNA-applications to a 180 kb plasmid from Sphingomonas F199. Nucleic Acids Res., 24:3778-3783. Wright, W. E., Piatyszek, M. A., Rainey, W. E., Byrd, W. and Shay, J. W. 1996. Telomerase activity in human germline and embryonic tissues and cells. Dev. Genet., 18:173-179. Wright, W. E. and Shay, J. W. 1992. The two-stage mechanism controlling cellular senescence and immortalization. Exp. Gerontol., 27:383-389. Wu, D. Y., and Wallace R. B. 1989. The ligation amplification reaction (LAR)—amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics, 4:560-569 Yui, J., Chiu, C. P. and Lansdorp, P. M. 1998. Telomerase activity in candidate stem cells from fetal liver and adult bone marrow. Blood, 91:3255-3262. Zhang, L., Cui, X., Schmitt, K., Hubert, R., Navidi, W., Arnheim, N. 1992. Whole genome amplification from a single cell: Implications for genetic analysis. Proc. Natl. Acad. Sci. USA, 89:5847-5851. Zheleznaya L A, Kossykh V G, Svad'bina I V, Oshman T S, Matvienko N I. 1999. PCR Fragmentation of DNA. Biochemistry (Mosc), 64(4):373-378.

(302) Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, manufacture, composition of matter, means, methods and steps described in the specification. As one of ordinary skill in the art will readily appreciate from the disclosure of the present invention, processes, manufacture, compositions of matter, means, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufacture, compositions of matter, means, methods, or steps.