C5a binding nucleic acids

Abstract

The present invention is related to a nucleic acid molecule capable of binding to human C5a, wherein the nucleic acid molecule comprises a central stretch of nucleotides, wherein the central stretch of nucleotides comprises a nucleotide sequence of 5′ AUGn.sub.1GGUGKUn.sub.2n.sub.3RGGGHUGUKGGGn.sub.4Gn.sub.5CGACGCA 3′ [SEQ ID NO: 61], wherein n.sub.1 is U or dU, n.sub.2 is G or dG, n.sub.3 is A or dA, n.sub.4 is U or dU, n.sub.5 is U or dU and G, A, U, C, H, K, and R are ribonucleotides, and dU, dG and dA are 2′-deoxyribonucleotides.

Claims

1. A method comprising administering to a subject with a respiratory disorder or cancer, a nucleic acid molecule that binds human C5a, wherein the nucleic acid molecule comprises a central stretch of nucleotides, wherein the central stretch of nucleotides comprises a nucleotide sequence of TABLE-US-00024 (SEQ ID NO: 61) 5′ AUGn.sub.1GGUGKUn.sub.2n.sub.3RGGGHUGUKGGGn.sub.4Gn.sub.5CGACGCA 3′, wherein n.sub.1 is U or dU, n.sub.2 is G or dG, n.sub.3 is A or dA, n.sub.4 is U or dU, n.sub.5 is U or dU, and G, A, U, C, H, K, and R are ribonucleotides, and dU, dG and dA are 2′-deoxyribonucleotides to alleviate a symptom of said respiratory disorder or said cancer.

2. The method of claim 1, wherein the central stretch of nucleotides consists of ribonucleotides and 2′-deoxyribonucleotides.

3. The method of claim 1, wherein the nucleic acid molecule comprises in 5′.fwdarw.3′ direction a first terminal stretch of nucleotides, the central stretch of nucleotides and a second terminal stretch of nucleotides, wherein the first terminal stretch of nucleotides comprises one to five nucleotides, and the second terminal stretch of nucleotides comprises one to five nucleotides.

4. The method of claim 1, wherein the nucleic acid molecule binds human C5a and mouse C5a.

5. The method of claim 1, wherein the nucleic acid molecule comprises at least one binding moiety which binds human C5a and mouse C5a, wherein such binding moiety consists of L-nucleotides.

6. The method of claim 1, wherein said nucleic acid molecule comprises an L-nucleotide.

7. The method of claim 1, wherein the nucleic acid molecule is an L-nucleic acid molecule.

8. The method of claim 1, wherein the nucleic acid molecule is an antagonist of an activity mediated by human and/or mouse C5a.

9. The method of claim 1, wherein the nucleic acid molecule comprises a modification group.

10. The method of claim 9, wherein the modification group is polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate or poly (2-hydroxyethyl)-L-glutamine.

11. The method of claim 10, wherein said linear polyethylene glycol or said branched polyethylene glycol comprises a molecular weight of from about 20,000 to about 120,000 Da, from about 30,000 to about 80,000 Da or about 40,000 Da.

12. The method of claim 10, wherein said hydroxyethyl starch comprises a molecular weight of from about 50 to about 1000 kDa, from about 100 to about 700 kDa or from 200 to 500 kDa.

13. The method of claim 10, wherein said modification group is coupled to the nucleic acid molecule via a linker.

14. The method of claim 10, wherein the modification group is coupled to the 5′-terminal nucleotide and/or the 3′-terminal nucleotide of the nucleic acid molecule and/or to a nucleotide of the nucleic acid molecule between the 5′-terminal nucleotide of the nucleic acid molecule and the 3′-terminal nucleotide of the nucleic acid molecule.

15. The method of claim 1, wherein said subject is an animal or a human.

16. The method of claim 1, wherein said respiratory disorder comprises acute lung injury and/or acute respiratory distress syndrome.

17. The method of claim 1, wherein said subject has sepsis.

18. The method of claim 1, wherein said respiratory disorder comprises pneumonia.

19. The method of claim 1, wherein said cancer comprises breast cancer, prostate cancer, ovary cancer, osteosarcoma, glioblastoma, melanoma, small cell lung cancer or colorectal cancer.

Description

(1) The present invention is further illustrated by the figures, examples and the sequence listing from which further features, embodiments and advantages may be taken, wherein

(2) FIG. 1 shows an alignment of sequences of nucleic acid molecules capable of binding human and mouse C5a including the K.sub.D value and relative binding activity to human and mouse C5a as determined by surface plasmon resonance measurement;

(3) FIG. 2 shows derivatives of nucleic acid molecule NOX-D19001 with a single ribonucleotide to 2′-deoxyribonucleotide substitution including the K.sub.D value and relative binding activity to human C5a as determined by surface plasmon resonance measurement;

(4) FIG. 3 shows derivatives of nucleic acid molecule NOX-D19001 with two, three, four, five or six ribonucleotide to 2′-deoxyribonucleotide substitutions including the K.sub.D value and relative binding activity to human C5a as determined by surface plasmon resonance measurement;

(5) FIGS. 4 A+B show truncations of nucleic acid molecule NOX-D19001-6×DNA including the K.sub.D value and relative binding activity to human C5a as determined by surface plasmon resonance measurement;

(6) FIG. 5 shows derivatives of nucleic acid molecule NOX-D20001 with none, one, two, three or four ribonucleotide to 2′-deoxyribonucleotide substitutions including the K.sub.D value and relative binding activity to human C5a as determined by surface plasmon resonance measurement;

(7) FIG. 6 shows the kinetic evaluation by Biacore measurement of nucleic acid molecules NOX-D19001, NOX-D19001-D09 and NOX-D19001-D09-16-17-30-32-40 (also referred to as NOX-D19001-6×DNA) to human C5a whereby the data for 500 nM of Spiegelmer NOX-D19001, NOX-D19001-D09 (abbr. D09) and NOX-D19001-D09-16-17-30-32-40 (abbr. D09-16-17-30-32-40) are shown;

(8) FIG. 7 is a diagram showing the efficacy of 5′-terminal 40 kDa PEGylated C5a binding Spiegelmers NOX-D19001-5′PEG (also referred as NOX-D19) NOX-D20 (also referred to as NOX-D19001-6×DNA-020-5′40 kDa PEG) in chemotaxis assays, wherein cells were allowed to migrate towards 0.1 nM huC5a preincubated at 37° C. with various amounts of Spiegelmers,

(9) FIG. 8 shows the kinetic evaluation by Biacore measurement of nucleic acid molecules NOX-D20 (also referred to as NOX-D19001-6×DNA-020-5′40 kDa PEG) to human C5a, rat C5a, mouse C5a, monkey C5a; whereby the data for 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9, and 1.95-0 nM of Spiegelmer NOX-D20 are shown;

(10) FIG. 9 shows the kinetic evaluation by Biacore measurement of nucleic acid molecules NOX-D20 (also referred to as NOX-D19001-6×DNA-020-5′40 kDa PEG) to human C5, and human desArg-C5a; whereby the data for 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9, and 1.95-0 nM of Spiegelmer NOX-D20 are shown;

(11) FIG. 10 shows the kinetic evaluation by Biacore measurement of nucleic acid molecules NOX-D21 (also referred to as NOX-D19001-2dU-1dC-020-5′40 kDa PEG) to human C5a, human C5, human desArg-C5a, mouse C5a and mouse desArg-C5a; whereby the data for 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9, and 1.95-0 nM of Spiegelmer NOX-D21 binding to human C5a and human C5 are shown;

(12) FIG. 11 shows the polypeptide sequence aligment of C5a from human, rhesus monkey, mouse and rat;

(13) FIG. 12A is a diagram showing the efficacy of C5a binding Spiegelmers NOX-D20 in chemotaxis assays with human C5a and mouse C5a, cells were allowed to migrate towards 0.1 nM huC5a or 0.3 nM mC5a preincubated at 37° C. with various amounts of Spiegelmer; wherein a) the cells counts were normalized to the largest value of each data set and depicted as percent count against Spiegelmer concentration, b) the Spiegelmer concentrations at which the chemotaxis is inhibited by 50% (IC.sub.50) were calculated using nonlinear regression (four parameter fit) with Prism5 software;

(14) FIG. 12B is a diagram showing the efficacy of C5a binding Spiegelmers NOX-D21 in chemotaxis assays with human C5a, cells were allowed to migrate towards 0.1 nM huC5a preincubated at 37° C. with various amounts of Spiegelmer; wherein a) the cells counts were normalized to the largest value of each data set and depicted as percent count against Spiegelmer concentration, b) the Spiegelmer concentrations at which the chemotaxis is inhibited by 50% (IC.sub.50) were calculated using nonlinear regression (four parameter fit) with Prism5 software:

(15) FIGS. 13 A&B are diagrams showing the efficacy of C5a binding Spiegelmers NOX-D19 and NOX-D20 in chemotaxis assays (FIG. 13A), and elastase release assays (FIG. 13B) of primary human PMNs with human C5a; wherein cells were allowed to migrate towards 1 nM huC5a and elastase release was stimulated by 30 nM huC5a preincubated at 37° C. with various amounts of Spiegelmer;

(16) FIGS. 14 A&B are diagrams showing evaluation of C5 cleavage inhibition using a sheep erythrocyte hemolysis assay with Spiegelmers NOX-19 and NOX-D20 (FIG. 14A), and NOX-D21 (FIG. 14B). A positive (C5C6) and negative controls (revNOX-D19 and revNOX-D21) are shown;

(17) FIG. 15 is a diagram showing survival in the cecal ligation and puncture (CLP) mouse model of polymicrobial sepsis; NOX-D19 at the indicated doses or vehicle was injected intraperitoneally daily starting right after CLP surgery. Sham animals received surgery without CLP, followed by vehicle injections;

(18) FIGS. 16 A&B are diagrams showing serum creatinine levels (FIG. 16A) and blood urea nitrogen (BUN) levels (FIG. 16B) pre-surgery (day −4) and 1 day after CLP surgery in mice treated with NOX-D19 at indicated doses, in vehicle treated mice and in sham animals. Serum creatinine and BUN are biomarkers for renal function;

(19) FIGS. 17 A&B are diagrams showing serum levels of alanine aminotransferase (ALT) (FIG. 17A) and serum levels of aspartate aminotransferase (AST) (FIG. 17B) pre-surgery (day −4) and 1 day after CLP surgery in mice treated with NOX-D19 at indicated doses, in vehicle treated mice and in sham animals. Serum ALT is a biomarker for hepatocellular damage. Serum AST is a biomarker for multiorgan failure;

(20) FIG. 18 is a diagram showing survival in the cecal ligation and puncture (CLP) mouse model of polymicrobial sepsis; NOX-D20 at the indicated doses or vehicle was injected intraperitoneally daily starting right after CLP surgery. One group received a single dose of 1 mg/kg NOX-D20 right after CLP surgery followed by daily vehicle injections. Sham animals received surgery without CLP, followed by vehicle injections.

(21) FIGS. 19A-C are diagrams showing serum creatinine levels (FIG. 19A), blood urea nitrogen (BUN) (FIG. 19B) and serum levels of alanine aminotransferase (ALT) (FIG. 19C) at day 1 after CLP surgery in mice treated with NOX-D20 at indicated doses, in vehicle treated mice and in sham animals. Serum creatinine and BUN are biomarkers for renal function. Serum ALT is a biomarker for hepatocellular damage;

(22) FIGS. 20A-C are diagrams showing the effect of NOX-D20 treatment at indicated doses on serum lactate dehydrogenase (LDH) (FIG. 20A), a biomarker for tissue injury, vascular leakage (FIG. 20B), and PMN infiltration into the peritoneum (FIG. 20C) at day 1 after CLP surgery. Vehicle treated mice and in sham animals are shown as controls;

(23) FIG. 21 is a diagram showing survival in a model of ischemia/reperfusion injury induced acute kidney injury; NOX-D21 at the indicated doses or vehicle was injected intravenously 1 h prior to surgery and subsequently intraperitoneally every 24 h for 3 days;

(24) FIG. 22 shows the 2′deoxyribonucleotides that the nucleic acid molecules according to the present invention consist of;

(25) FIG. 23 shows the ribonucleotides that the nucleic acid molecules according to the present invention consist of;

EXAMPLE 1: NUCLEIC ACID MOLECULES CAPABLE OF BINDING HUMAN AND MOUSE C5A

(26) Several C5a binding nucleic acid molecules and derivatives thereof were identified: the nucleotide sequences of which are depicted in FIGS. 1 to 5. The C5a binding nucleic acid molecules were characterized as a) aptamers, i. e. D-nucleic acid molecules using a direct pull-down assay (Example 3) and/or a comparative competition pull-down assay (Example 3) b) Spiegelmers, i. e. L-nucleic acid molecules by surface plasmon resonance measurement (Example 4), and by an in vitro assay with cells expressing the human C5a receptor (Example 5). Moreover Spiegelmers were tested for the inhibition of C5a-induced activation of primary human neutrophils (Example 6) and in vivo (Example 8, 9 and 10 The Spiegelmers and aptamers were synthesized as described in Example 2.

(27) The nucleic acid molecules thus generated exhibit slightly different sequences, whereby the sequences can be summarized or grouped as a sequence family.

(28) For definition of ribonucleotide sequence motifs, the IUPAC abbreviations for ambiguous nucleotides are used:

(29) TABLE-US-00012 S strong G or C; W weak A or U; R purine G or A; Y pyrimidine C or U; K keto G or U; M imino A or C; B not A C or U or G; D not C A or G or U; H not G A or C or U; V not U A or C or G; N all A or G or C or U

(30) If not indicated to the contrary, any nucleic acid sequence or sequence of stretches, respectively, is indicated in the 5′.fwdarw.3′ direction.

(31) For differentiation between the 2′-deoxyribonucleotides and the ribonucleotides the following abbreviations are used:

(32) For 2′-deoxyribonucleotides: dG, dC, dT, dA and dU (see FIG. 22).

(33) For ribonucleotides: G, C, T, U (see FIG. 23).

(34) As depicted in FIG. 1 to FIG. 5 C5a binding nucleic acid molecules comprise one central stretch of nucleotides defining a potential C5a binding motif, whereby FIG. 1 shows the different sequences of the sequence family, the FIGS. 2 to 5 show derivatives of the nucleic acid molecule NOX-D19001 including NOX-D20001 (also referred to as NOX-D19001-6×-DNA-020, FIG. 4A) and NOX-D21001 (also referred to as NOX-D19001-2dU-1dC-020, FIG. 5).

(35) In general, C5a binding nucleic acid molecules comprise at the 5′-end and the 3′-end terminal stretches of nucleotides: the first terminal stretch of nucleotides and the second terminal stretch of nucleotides. The first terminal stretch of nucleotides and the second terminal stretch of nucleotides can hybridize to each other, whereby upon hybridization a double-stranded structure is formed. However, such hybridization is not necessarily given in the molecule in vivo and in vitro.

(36) The three stretches of nucleotides of C5a binding nucleic acid molecules—the first terminal stretch of nucleotides, the central stretch of nucleotides and the second terminal stretch of nucleotides—are arranged to each other in 5′.fwdarw.3′-direction: the first terminal stretch of nucleotides—the central stretch of nucleotides—the second terminal stretch of nucleotides. However, alternatively, the first terminal stretch of nucleotides, the central stretch of nucleotides and the second terminal stretch of nucleotides are arranged to each other in 5′.fwdarw.3′-direction: the second terminal stretch of nucleotides—the central stretch of nucleotides—the first terminal stretch of nucleotides.

(37) The sequences of the defined stretches may be different between the C5a binding nucleic acid molecules which influences the binding affinity to C5a. Based on binding analysis of the different C5a binding nucleic acid molecules the central stretch of nucleotides and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to human C5a.

(38) The C5a binding nucleic acid molecules according to the present invention as shown in FIG. 1 consist of ribonucleotides and are shown in FIGS. 1 to 5. The C5a binding nucleic acid molecule 274-H6-002 was tested as aptamer in a comparative competition pull-down assays (for protocol see example 3) vs. C5a binding nucleic acid 274-D5-002. C5a binding nucleic acid molecule 274-H6-002 showed weaker binding affinity in comparison to C5a binding nucleic acid molecule 274-D5-002. The C5a binding nucleic acid molecules 274-B5-002, 274-D5-002, 274-C8-002, 274-C8-002-G14 (=NOX-D19001), 274-05-002 and 274-G6-002 were tested as Spiegelmers for their ability to bind human and mouse C5a by plasmon resonance measurement (see Example 4, FIG. 1).

(39) C5a binding nucleic acid molecule 274-C8-002-G14 (=NOX-D19001) shows the best binding affinity with a K.sub.D of 0.3 nM for mouse C5a and with a K.sub.D of 1.38 nM for human C5a (FIG. 1).

(40) The C5a binding nucleic acid molecules 274-B5-002, 274-D5-002, 274-C8-002, 274-C8-002-G14 (=NOX-D19001), 274-05-002, 274-G6-002 and 274-H6-002 share the sequence

(41) TABLE-US-00013 [SEQ ID NO: 69] 5′ AUGUGGUGKUGARGGGHUGUKGGGUGUCGACGCA 3′,

(42) wherein G, A, U, C, H, K, and R are ribonucleotides.

(43) The C5a binding nucleic acid molecules 274-C8-002, 274-C8-002-G14 (=NOX-D19001) and 274-05-002 showed the best binding affinity to C5a and comprise the following sequences for the central stretch:

(44) TABLE-US-00014 a) 274-C8-002: [SEQ ID NO: 70] 5′ AUGUGGUGUUGAAGGGUUGUUGGGUGUCGACGCA 3′, b) 274-C8-002-G14: [SEQ ID NO: 71] 5′ AUGUGGUGGUGAAGGGUUGUUGGGUGUCGACGCA 3′, c) 274-05-002: [SEQ ID NO: 72] 5′ AUGUGGUGGUGAGGGGUUGUGGGGUGUCGACGCA 3′,

(45) wherein d G, A, U and C are ribonucleotides.

(46) The inventors surprisingly showed that the binding affinity of C5a binding nucleic acid molecule NOX-D19001 was improved by replacing ribonucleotides by 2′-deoxyribonucleotides within the sequence of the central stretch of nucleotides and the second terminal stretch of nucleotides. In particular replacing up to six ribonucleotides by 2′-deoxyribonucleotides in the C5a binding nucleic acid molecule NOX-D19001 resulted in improved binding affinity to human C5a by a factor of 3.5. In more detail, the inventors have surprisingly found that a) replacing one ribonucleotide by one 2′-deoxyribonucleotide at position 4, 11, 12, 25 or 27 in the central stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 resulted in improved binding affinity to human C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 2; Spiegelmers NOX-D19001-D09, NOX-D19001-D16, NOX-D19001-D17, NOX-D19001-D30, NOX-D19001-D32); b) replacing one ribonucleotide by one 2′-deoxyribonucleotide at position 1 in the second terminal stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 resulted in improved binding affinity to human C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 2; Spiegelmers NOX-D19001-D40); c) replacing two ribonucleotides by two 2′-deoxyribonucleotide at position 4/25, 4/27, or 25/27 in the central stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 resulted in improved binding affinity to biotinylated C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 3; Spiegelmers NOX-D19001-D09-30, NOX-D19001-D09-32, NOX-D19001-D30-32); d) replacing two ribonucleotides, wherein one ribonucleotide was replaced by one 2′-deoxyribonucleotide at position 1 in the second terminal stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 and one ribonucleotide was replaced by one 2′-deoxyribonucleotide at position 4, 25 or 27 in the central stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001, resulted in improved binding affinity to human C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 3; Spiegelmers NOX-D19001-D09-40, NOX-D19001-D30-40, NOX-D19001-D32-40); e) replacing three ribonucleotides, wherein one ribonucleotide was replaced by one 2′-deoxyribonucleotide at position 1 in the second terminal stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 and two ribonucleotides were replaced by two 2′-deoxyribonucleotides at position 4/25, 4/27, 25/27 in the central stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001, resulted in improved binding affinity to human C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 3; Spiegelmers, NOX-D19001-D09-30-40, NOX-D19001-D09-32-40, NOX-D19001-D30-32-40); f) replacing three ribonucleotides by three 2′-deoxyribonucleotide at position 04/25/27 in the central stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 resulted in improved binding affinity to biotinylated C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 3; Spiegelmer NOX-D19001-D09-30-32); g) replacing four ribonucleotides, wherein one ribonucleotide was replaced by one 2′-deoxyribonucleotide at position 1 in the second terminal stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 and three ribonucleotides were replaced by three 2′-deoxyribonucleotides at position 04/25/27 in the central stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001, resulted in improved binding affinity to human C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 3; Spiegelmer NOX-D19001-D09-30-32-40); h) replacing five ribonucleotides, wherein one ribonucleotide was replaced by one 2′-deoxyribonucleotide at position 1 in the second terminal stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 and four ribonucleotides were replaced by four 2′-deoxyribonucleotides at position 04/11/25/27 or 04/12/25/27 in the central stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001, resulted in improved binding affinity to human C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 3; Spiegelmer NOX-D19001-D09-16-30-32-40, NOX-D19001-D09-17-30-32-40); i) replacing six ribonucleotides, wherein one ribonucleotide was replaced by one 2′-deoxyribonucleotide at position 1 in the second terminal stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001 and five ribonucleotides were replaced by five 2′-deoxyribonucleotides at position 04/11/12/25/27 in the central stretch of nucleotides of C5a binding nucleic acid molecule NOX-D19001, resulted in improved binding affinity to human C5a in comparison to the binding affinity of C5a binding nucleic acid molecule NOX-D19001 (see FIG. 3; Spiegelmer NOX-D19001-D09-16-17-30-32-40=NOX-D19-001-6×DNA).

(47) Based on the data shown that replacing ribonucleotides by 2′-deoxyribonucleotides at several positions of the central stretch of nucleotides of C5a binding nucleic acid molecules lead to improved binding to C5a the central stretch of all tested C5a binding nucleic acid molecules can be summarized in a the following formula

(48) TABLE-US-00015 [SEQ ID NO: 61] 5′ AUGn.sub.1GGUGKUn.sub.2n.sub.3RGGGHUGUKGGGn.sub.4Gn.sub.5CGACGCA 3′,

(49) wherein n.sub.1 is U or dU, n.sub.2 is G or dG, n.sub.3 is A or dA, n.sub.4 is U or dU, n.sub.5 is U or dU

(50) and G, A, U, C, H, K,

(51) and R are ribonucleotides, and dU, dG and dA are 2′-deoxyribonucleotides,

(52) wherein a) in a preferred embodiment the central stretch of nucleotides comprise the sequence

(53) TABLE-US-00016 [SEQ ID NO: 62] 5′ AUGn.sub.1GGUGUUn.sub.2n.sub.3AGGGUUGUGGGGn.sub.4Gn.sub.5CGACGCA 3′ (see 274-B5-002);  or b) in a preferred embodiment the central stretch of nucleotides comprise the sequence

(54) TABLE-US-00017 [SEQ ID NO: 63] 5′ AUGn.sub.1GGUGUUn.sub.2n.sub.3GGGGUUGUGGGGn.sub.4Gn.sub.5CGACGCA 3′ (see 274-D5-002);  or c) in a preferred embodiment the central stretch of nucleotides comprise the sequence

(55) TABLE-US-00018 [SEQ ID NO: 64] 5′ AUGn.sub.1GGUGUUn.sub.2n.sub.3AGGGUUGUUGGGn.sub.4Gn.sub.5CGACGCA 3′ (see 274-C8-002);  or d) in a preferred embodiment the central stretch of nucleotides comprise the sequence

(56) TABLE-US-00019 [SEQ ID NO: 65] 5′ AUGn.sub.1GGUGGUn.sub.2n.sub.3AGGGUUGUUGGGn.sub.4Gn.sub.5CGACGCA 3′ (see NOX-D19001);  or e) in a preferred embodiment the central stretch of nucleotides comprise the sequence

(57) TABLE-US-00020 [SEQ ID NO: 66] 5′ AUGn.sub.1GGUGGUn.sub.2n.sub.3GGGGUUGUGGGGn.sub.4Gn.sub.5CGACGCA 3′ (see 274-05-002);  or f) in a preferred embodiment the central stretch of nucleotides comprise the sequence

(58) TABLE-US-00021 [SEQ ID NO: 67] 5′ AUGn.sub.1GGUGGUn.sub.2n.sub.3GGGGAUGUGGGGn.sub.4Gn.sub.5CGACGCA 3′ (see 274-G6-002);  or g) in a preferred embodiment the central stretch of nucleotides comprise the sequence

(59) TABLE-US-00022 [SEQ ID NO: 68] 5′ AUGn.sub.1GGUGUUn.sub.2n.sub.3GGGGCUGUGGGGn.sub.4Gn.sub.5CGACGCA 3′ (see 274-H6-002).

(60) The C5a binding nucleic acid molecules NOX-D19001-D09, NOX-D19001-D16, NOX-D19001-D17, NOX-D19001-D30, NOX-D19001-D32, NOX-D19001-D09-30, NOX-D19001-D09-32, NOX-D19001-D09-40, NOX-D19001-D30-32, NOX-D19001-D30-40, NOX-D19001-D32-40, NOX-D19001-D09-30-32, NOX-D19001-D09-30-40, NOX-D19001-D09-32-40, NOX-D19001-D30-32-40, NOX-D19001-D09-30-32-40, NOX-D19001-D09-16-30-32-40, NOX-D19001-D09-17-30-32-40, NOX-D19001-D09-16-17-30-32-40 (see FIGS. 2 and 3) showed the best binding affinity to C5a and comprise the following sequence for the central stretch of nucleotides:

(61) TABLE-US-00023 a) [SEQ ID NO: 73] 5′ AUGdUGGUGGUGAAGGGUUGUUGGGUGUCGACGCA 3′ (see NOX-D19001-D09, NOX-D19001-D09-40); or b) [SEQ ID NO: 74] 5′ AUGUGGUGGUdGAAGGGUUGUUGGGUGUCGACGCA 3′ (see NOX-D19001-D16); or c) [SEQ ID NO: 75] 5′ AUGUGGUGGUGdAAGGGUUGUUGGGUGUCGACGCA 3′ (see NOX-D19001-D17); or d) [SEQ ID NO: 76] 5′ AUGUGGUGGUGAAGGGUUGUUGGGdUGUCGACGCA 3′ (see NOX-D19001-D30, NOX-D19001-D30-40); or e) [SEQ ID NO: 77] 5′ AUGUGGUGGUGAAGGGUUGUUGGGUGdUCGACGCA 3′ (see NOX-D19001-D32, NOX-D19001-D32-40); or f) [SEQ ID NO: 78] 5′ AUGdUGGUGGUGAAGGGUUGUUGGGdUGUCGACGCA 3′ (see NOX-D19001-D09-30, NOX-D19001-D09-30-40); or g) [SEQ ID NO: 79] 5′ AUGdUGGUGGUGAAGGGUUGUUGGGUGdUCGACGCA 3′ (see NOX-D19001-D09-32, NOX-D19001-D09-32-40); h) [SEQ ID NO: 80] 5′ AUGUGGUGGUGAAGGGUUGUUGGGdUGdUCGACGCA 3′ (see NOX-D19001-D30-32, NOX-D19001-D30-32-40); or i) [SEQ ID NO: 81] 5′ AUGdUGGUGGUGAAGGGUUGUUGGGdUGdUCGACGCA 3′ (NOX-D19001-D09-30-32, NOX-D19001-D09-30-32-40); or j) [SEQ ID NO: 82] 5′ AUGdUGGUGGUdGAAGGGUUGUUGGGdUGdUCGACGCA 3′ (see NOX-D19001-D09-16-30-32-40); or k) [SEQ ID NO: 83] AUGdUGGUGGUGdAAGGGUUGUUGGGdUGdUCGACGCA 3′ (see NOX-D19001-D09-17-30-32-40); or l) [SEQ ID NO: 84] 5′ AUGdUGGUGGUdGdAAGGGUUGUUGGGdUGdUCGACGCA 3′ (see NOX-D19001-D09-16- 17-30-32-40 = NOX-D19001-6xDNA),

(62) wherein G, A, U and C are ribonucleotides, and dG, dA and dU are 2′-deoxyribonucleotides.

(63) The binding affinity of C5a binding nucleic acid molecule NOX-D19001 was significantly improved by replacing one up to six ribonucleotides by 2′-deoxyribonucloetides as determined by surface plasmon resonance measurement and exemplarily shown for the C5a binding nucleic acids NOX-D19001-D09 and NOX-D19001-D09-16-17-30-32-40 (also referred to as NOX-D19001-6×DNA) (FIG. 6):

(64) NOX-D19001: K.sub.D of 1.38 nM,

(65) NOX-D19001-D09: K.sub.D of 709 pM,

(66) NOX-D19001-D09-16-17-30-32-40: K.sub.D of 361 pM.

(67) NOX-D19001-6×DNA comprises a central stretch of nucleotides with five 2′-deoxyribonucleotides instead of ribonucleotides, a first terminal stretch of nucleotides with five ribonucleotides and a second terminal stretch of nucleotides with four ribonucleotides and one 2′-deoxyribonucleotide. Surprisingly, the inventors could show that the first and the second terminal stretch of nucleotides can be truncated without reduction in affinity to four or three nucleotides. As shown herein, the first and the second terminal stretch of nucleotides of NOX-D19001-6×DNA could be truncated from five to three nucleotides (see NOX-D19001-6×DNA-020 also referred to as NOX-D20001) while retaining affinity (FIG. 4A).

(68) FIG. 4 demonstrates the successful combination of ribonucleotide-to-2′-deoxyribonucleotide substitution and truncation: The mother molecule of NOX-D19001-6×DNA and NOX-D19001-6×DNA-020 (also referred to as NOX-D20001), NOX-D19001, consisting of ribonucleotides and a first and a second terminal stretch of nucleotides with five nucleotides each has a binding affinity (K.sub.D) of 1.38 nM. After six ribonucleotide-to-2′-deoxyribonucleotide substitutions (leading to NOX-D19001-6×DNA) and truncation to a first and a second terminal stretch of nucleotides with three nucleotides (leading to NOX-D19001-6×DNA-020, also referred to as NOX-D20001) the binding affinity for human C5a was improved by a more than factor four (NOX-D20001, K.sub.D of 0.3 nM). Truncation of the first or the second stretch of nucleotides to one nucleotide led to reduced activity, but such molecules still bind to C5a with K.sub.D's lower than 10 nM (see FIG. 4A, 4B)

(69) Another example for the successful substitution of ribonucleotides by 2′-deoxyribonucleotides is shown in FIG. 5. Molecule NOX-D19001-020 is a truncated derivative of NOX-D19001 and has a K.sub.D of 11.3 nM (see FIG. 5) instead of 1.38 nM as determined for NOX-D19001 (see FIGS. 1 and 2). Both molecules comprise the identical central stretch of ribonucleotides, but NOX-D19001-020 comprises of a first terminal stretch of only three instead of five ribonucleotides and a second terminal stretch of only three instead of five ribonucleotides. By substitution of two or three ribonucleotides by 2′-deoxyribonucleotides in the central stretch of nucleotides and optionally of one ribonucleotide by 2′-deoxyribonucleotide in the second terminal stretch of nucleotides the binding affinity of NOX-D19001-020 can be improved by a factor of more than 10 (see FIG. 5, NOX-D19001-2×DNA-020, NOX-D19001-3×DNA-020, NOX-D19001-2dU-1 dC-020 also referred to as NOX-D21001, NOX-D19001-3dU-1dC-020).

(70) Taken together, the first and the second terminal stretches of C5a binding nucleic acid molecules comprise one, two, three, four or five nucleotides (FIG. 1 to FIG. 5), whereby the stretches optionally hybridize with each other, whereby upon hybridization a double-stranded structure is formed. This double-stranded structure can consist of one to five basepairs. However, such hybridization is not necessarily given in the molecule.

(71) Analyzing the first terminal stretch of nucleotides and the second terminal stretch of nucleotides of all tested C5a binding nucleic acid molecules the generic formula for the first terminal stretch of nucleotides is 5′ Z.sub.1Z.sub.2Z.sub.3Z.sub.4G 3′ and the generic formula for the second terminal stretch of nucleotides is 5′ Z.sub.5Z.sub.6Z.sub.7Z.sub.8 Z.sub.9 3′,

(72) wherein

(73) Z.sub.1 is G or absent, Z.sub.2 is S or absent, Z.sub.3 is S or absent, Z.sub.4 is B or absent, Z.sub.5 is C or dC, Z.sub.6 is V or absent, Z.sub.7 is S or absent, Z.sub.8 is S or absent, Z.sub.9 is C or absent, and

(74) G, S, B, C, V are ribonucleotides, and dC is a 2′-deoxyribonucleotide,

(75) whereby in a first preferred embodiment a) Z.sub.1 is G, Z.sub.2 is S, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is C, or b) Z.sub.1 is absent, Z.sub.2 is S, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is absent, or c) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is absent, Z.sub.9 is absent, or d) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is absent, Z.sub.8 is absent, Z.sub.9 is absent, or e) Z.sub.1 is absent, Z.sub.2 is S, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is C, or f) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is C, or g) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is C, or h) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is absent, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is C, or i) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is absent, or j) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is absent, or k) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is absent, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is S, Z.sub.9 is absent, or l) Z.sub.1 is absent, Z.sub.2 is S, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is absent, Z.sub.9 is absent, or m) Z.sub.1 is absent, Z.sub.2 is S, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is absent, Z.sub.8 is absent, Z.sub.9 is absent, or n) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is absent, Z.sub.5 is C, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is absent, Z.sub.9 is absent, or o) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is S, Z.sub.8 is absent, Z.sub.9 is absent, or p) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is V, Z.sub.7 is absent, Z.sub.8 is absent, Z.sub.9 is absent, or q) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is S, Z.sub.4 is B, Z.sub.5 is C or dC, Z.sub.6 is absent, Z.sub.7 is absent, Z.sub.8 is absent, Z.sub.9 is absent;

(76) in a second preferred embodiment a) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCCUG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence 5′ CAGGC or b) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCCUG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCAGGC 3′, or c) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ CCUG 3′ or 5′ CUG 3′ or 5′ UG 3′ or 5′ G 3′, and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCAGGC 3′, or d) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCUG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCAGC 3′, or e) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCCG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCGGC 3′, or f) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GGCG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCGCC 3′, or g) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ CUG 3′ or 5′ UG 3′ or 5′ CG 3′ or 5′ G 3′, and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCAGC 3′, or h) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCUG 3′, and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCAC 3′ or 5′ dCC 3′ or 5′ dCA 3′, or i) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCAC 3′, or j) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ UG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCA 3′, or k) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCGC 3′, or l) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ CG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCGC 3′, or m) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ G 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCGC 3′, or n) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCC 3′, or o) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dC 3′, or p) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ dCC 3′, or q) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ CGC 3′.

(77) In order to prove their functionality, the C5a binding nucleic acid molecules NOX-D19001, NOX-D20001 and NOX-D21001 were synthesized as a Spiegelmer comprising an amino-group at its 5′-end. To said amino-modified Spiegelmers a 40 kDa PEG-moiety was coupled leading to C5a binding Spiegelmers NOX-D19, NOX-D20 and NOX-D21. Synthesis and PEGylation of the Spiegelmer is described in Example 2.

(78) The effect of improved binding affinity could be shown for the functionality of C5a binding nucleic acid molecules. As determined by a chemotaxis assay (Example 5), the C5a binding nucleic acid molecule NOX-D19 (IC.sub.50=1.9 nM) exclusively consisting of ribonucleotides was less potent to inhibit the function of human C5a than the NOX-D20, a derivative C5a binding nucleic acid molecule of NOX-D19 comprising six ribonucleotide-to-2′-deoxyribonucleotide substitutions (IC.sub.50=0.28 nM) (FIG. 7).

(79) NOX-D20 showed a very high affinity binding to murine C5a with a dissociation constant K.sub.D of 19 pM, whereas for human C5a a K.sub.D of 299 pM was determined (Example 4, FIG. 8). NOX-D20 inhibits the function of human C5a with an inhibitory constant IC.sub.50 of 275 pM as determined by a chemotaxis assay (Example 5, FIGS. 7 and 12 A). For stoichiometric reasons, the sensitivity of the chemotaxis assays for mouse C5a is limited to 150 pM due a stimulatory concentration of mouse C5a of 300 pM. Accordingly, for mouse C5a an IC.sub.50 of 140 pM was measured for NOX-D20 (Example 5, FIG. 12 A).

(80) NOX-D20 showed no binding to C5a from rat or rhesus monkey, indicating very high target specificity (FIG. 8). From the polypeptide sequence alignment of human, mouse, rat and rhesus monkey C5a and the determined specificity it is most likely that the residues Serine16 and Valine28 of human C5a are essential binding residues on C5a (FIG. 11). These are conserved in human and murine C5a but are different in rhesus monkey and rat C5a.

(81) NOX-D21 contains the major affinity-improving sites of NOX-D20 and showed a high affinity to human and murine C5a as shown by Biacore measurement (K.sub.D(murine C5a)=29 pM, K.sub.D(human C5a)=815 pM, K.sub.D(human C5)=413 pM, see FIG. 11). NOX-D21 inhibits the function of human C5a with an inhibitory constant IC.sub.50 of 476 pM, as determined by a chemotaxis assay (Example 5, FIG. 12B).

(82) In vivo a truncated version of C5a is generated by enzymatic cleavage of the C-terminal arginine residue, known as des-Arg-C5a (also referred to as C5a.sub.desArg). The biological function of des-Arg-C5a is not fully understood but there is evidence that des-Arg-C5a retains leukocyte activating functions. Therefore it was investigated, whether NOX-D20 also bound to des-Arg-C5a. NOX-D20 showed a dose-dependent binding to immobilized recombinant human des-Arg-C5a (FIG. 9).

(83) Detailed kinetic evaluation as described showed that human des-Arg-C5a is bound by NOX-20 with comparable affinity to the full-length human C5a with a dissociation constant of 316 pM and 299 pM, respectively. NOX-D21 bound to mouse and human des-Arg-C5a with dissociation constants of 28 pM and 854 pM, respectively (FIG. 10). Thus even after cleavage of C5a to des-Arg-C5a C5a binding nucleic acid molecules such as NOX-20 and NOX-D21 still bind to their target.

(84) Surprisingly NOX-D20 and NOX-D21 also showed binding to C5 purified from human plasma with an affinity of 164 pM and 413 pM, respectively (FIGS. 9 and 10). This phenomenon could not be foreseen. However, it is plausible since C5a is a part of C5 that is cleaved off by the C5 convertase when the complement system is activated or by thrombin or other members of an activated coagulation system. Furthermore, the C5 purified from human plasma carries the native glycosylation structure on asparagine64. Glycosylation had not been present on the murine mirror image C5a polypeptide that was used for identification of NOX-D19, NOX-D20, NOX-D21 and other nucleic acid molecules according to the present invention.

(85) Binding to C5 may influence pharmacokinetics due to the expected low clearance of the large C5 protein and a published plasma concentration of 350-390 nM. Binding to C5 may also influence pharmacodynamics. C5 is bound by C5a binding nucleic acid molecules such as NOX-20 and NOX-D21 and thus C5a is already blocked by the Spiegelmer before it is liberated and may lead to receptor signaling.

EXAMPLE 2: SYNTHESIS AND DERIVATIZATION OF APTAMERS AND SPIEGELMERS

(86) Small Scale Synthesis

(87) Aptamers (D-RNA nucleic acids) and Spiegelmers (L-RNA nucleic acids) were produced by solid-phase synthesis with an ABI 394 synthesizer (Applied Biosystems, Foster City, Calif., USA) using 2′TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993). rA(N-Bz)-, rC(Ac)-, rG(N-ibu)-, and rU-phosphoramidites in the D- and L-configuration were purchased from ChemGenes, Wilmington, Mass. Aptamers and Spiegelmers were purified by gel electrophoresis.

(88) Large Scale Synthesis Plus Modification

(89) Spiegelmers were produced by solid-phase synthesis with an ÄktaPilot100 synthesizer (Amersham Biosciences; General Electric Healthcare, Freiburg) using 2′TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993). L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N-ibu)-, and L-rU-phosphoramidites were purchased from ChemGenes, Wilmington, Mass. The 5′-amino-modifier was purchased from American International Chemicals Inc. (Framingham, Mass., USA). Synthesis of the unmodified or 5′-Amino-modified Spiegelmer was started on L-riboG, L-riboC, L-riboA or L-riboU modified CPG pore size 1000 Å (Link Technology, Glasgow, UK. For coupling (15 min per cycle), 0.3 M benzylthiotetrazole (CMS-Chemicals, Abingdon, UK) in acetonitrile, and 3.5 equivalents of the respective 0.1 M phosphoramidite solution in acetonitrile was used. An oxidation-capping cycle was used. Further standard solvents and reagents for oligonucleotide synthesis were purchased from Biosolve (Valkenswaard, NL). The Spiegelmer was synthesized DMT-ON; after deprotection, it was purified via preparative RP-HPLC (Wincott et al., 1995) using Source15RPC medium (Amersham). The 5′DMT-group was removed with 80% acetic acid (30 min at RT). Subsequently, aqueous 2 M NaOAc solution was added and the Spiegelmer was desalted by tangential-flow filtration using a 5 K regenerated cellulose membrane (Millipore, Bedford, Mass.).

(90) PEGylation of Spiegelmers

(91) In order to prolong the Spiegelmer's plasma residence time in vivo, Spiegelmers was covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at 5′-end

(92) For PEGylation (for technical details of the method for PEGylation see European patent application EP 1 306 382), the purified 5′-amino modified Spiegelmer was dissolved in a mixture of H.sub.2O (2.5 ml), DMF (5 ml), and buffer A (5 ml; prepared by mixing citric acid.H.sub.2O [7 g], boric acid [3.54 g], phosphoric acid [2.26 ml], and 1 M NaOH [343 ml] and adding water to a final volume of 1 l; pH=8.4 was adjusted with 1 M HCl).

(93) The pH of the Spiegelmer solution was brought to 8.4 with 1 M NaOH. Then, 40 kDa PEG-NHS ester (Jenkem Technology, Allen, Tex., USA) was added at 37° C. every 30 min in six portions of 0.25 equivalents until a maximal yield of 75 to 85% was reached. The pH of the reaction mixture was kept at 8-8.5 with 1 M NaOH during addition of the PEG-NHS ester.

(94) The reaction mixture was blended with 4 ml urea solution (8 M), and 4 ml buffer B (0.1 M triethylammonium acetate in H.sub.2O) and heated to 95° C. for 15 min. The PEGylated Spiegelmer was then purified by RP-HPLC with Source 15RPC medium (Amersham), using an acetonitrile gradient (buffer B; buffer C: 0.1 M triethylammonium acetate in acetonitrile). Excess PEG eluted at 5% buffer C, PEGylated Spiegelmer at 10-15% buffer C. Product fractions with a purity of >95% (as assessed by HPLC) were combined and mixed with 40 ml 3M NaOAc. The PEGylated Spiegelmer was desalted by tangential-flow filtration (5 K regenerated cellulose membrane, Millipore, Bedford Mass.).

EXAMPLE 3: DETERMINATION OF BINDING CONSTANTS TO C5A FOR APTAMERS (PULL-DOWN ASSAY)

(95) Direct Pull-Down Assay

(96) The affinity of C5a binding nucleic acids was measured as binding of aptamers (D-RNA nucleic acids) to biotinylated mouse D-C5a (SEQ.ID. 89) in a pull down assay format at 37° C. Aptamers were 5′-phosphate labeled by T4 polynucleotide kinase (Invitrogen) using [γ-.sup.32P]-labeled ATP (Hartmann Analytic, Braunschweig, Germany). The specific radioactivity of labeled aptamers was 200,000-800,000 cpm/pmol. Assays were carried out in selection buffer (20 mM Tris-HCl pH 7.4; 150 mM NaCl; 5 mM KCl; 1 mM MgCl.sub.2; 1 mM CaCl.sub.2; 4 U/ml RNase inhibitor (RNaseOUT, Invitrogen); 0.1% [w/vol] Tween-20 supplemented with 50 μg/ml bovine serum albumin (Sigma), and 10 μg/ml non-specific Spiegelmer in order to prevent adsorption of binding partners with surfaces of used plasticware or the immobilization matrix). Aptamers were incubated after de- and renaturation at 0.2-1 nM concentration at 37° C. in selection buffer together with varying amounts of biotinylated mouse D-C5a for 3-4 hours in order to reach equilibrium at low concentrations. The concentration range of biotinylated mouse D-C5a was set from 640 pM to 10 μM; total reaction volume was 80-200 μl. Biotinylated mouse D-C5a and complexes of aptamer and biotinylated mouse D-C5a were immobilized on 5 μl NeutrAvidin Agarose Plus particles (Pierce Biotechnology) which had been preequilibrated with selection buffer. Particles were kept in suspension for 30 min at the 37° C. in a thermomixer. Immobilized radioactivity was quantitated in a scintillation counter after detaching the supernatant and appropriate washing. The percentage of binding was plotted against the concentration of biotinylated mouse D-C5a and dissociation constants were obtained by using software algorithms (GraphPad Prism) assuming a 1:1 stoichiometry.

(97) Competitive Pull-Down Assay

(98) In order to compare different D-C5a binding nucleic acids, a competitive ranking assay was performed. For this purpose the most affine aptamer available was radioactively labeled (see above) and served as reference. After de- and renaturation it was incubated in selection buffer at 37° C. with biotinylated mouse D-C5a at conditions that resulted in around 5-10% binding to the biotinylated mouse D-C5a after immobilization and washing on 4 μl NeutrAvidin Agarose Plus particles (Pierce Biotechnology) without competition. An excess of de- and renatured non-labeled D-RNA aptamer variants was added at concentrations ranging from 9 pM-400 nM with the labeled reference aptamer to parallel binding reactions; total reaction volume was 160-400 μl. After 3-4 hour incubation biotinylated mouse D-C5a and complexes of aptamer and biotinylated were immobilized and assays were analysed as described above. The aptamers to be tested competed with the reference aptamer for target binding, thus decreasing the binding signal in dependence of their binding characteristics. The aptamer that was found most active in this assay could then serve as a new reference for comparative analysis of further aptamer variants.

EXAMPLE 4: BIACORE MEASUREMENT OF SPIEGELMERS BINDING TO C5A AND RELATED PEPTIDES

(99) The instrument was set to an enduring temperature of 37° C. The Biacore 2000 instrument was cleaned using the DESORB method before the start of each experiment/immobilization of a new chip. After docking a maintenance chip, the instrument was consecutively primed with desorb solution 1 (0.5% sodium dodecyl sulphate, SDS), desorb solution 2 (50 mM glycine, pH 9.5) and HBS-EP buffer. Finally, the system was primed with HBS-EP buffer.

(100) For Biacore experiments the C5a-binding Spiegelmers were prepared in sterile water and had a concentration of 100

(101) The CM5 chip was primed with HBS-EP buffer and equilibrated until a stable baseline was observed. The flow cells were immobilized beginning from flow cell 4 to flow cell 1. 100 μl of a 1:1 mixture of 0.4 M EDC and 0.1 M NHS were injected using the QUICKINJECT command at a flow of 10 μl/min. Activation of the flow cell was monitored by an increase in RU after NHS/EDC injection (typically 150-500 RU for CM5 chips). Solutions of 0.1-1 μg/ml in 10 mM NaAc pH5.5 for C5a or 10 mM NaAc pH5.5 for human C5 were transferred to a vial and injected using the MANUALINJECT command at a flow of 10 μl/min. 1000-3000 RU were immobilized the chip. All flow cells were then blocked with an injection of 70 μl of 1 M ethanolamine hydrochloride, pH 8 at a flow of 10 μl/min. Injection of 30 μl of the regeneration solution (1 M NaCl) at a flow of 30 μl/min was performed to remove unspecifically bound protein from the chip surface.

(102) Kinetic parameters and dissociation constants were evaluated by a series of Spiegelmer injections at concentrations of 2,000−1,000−500−200−125−62.5−31.3−15.6 (2×)−7.8−3.9−1.95−0.98−0.48−0.24−0.12−0 nM diluted in running buffer, starting with the lowest concentration. In all experiments, the analysis was performed at 37° C. using the Kinject command defining an association time of 240 and a dissociation time of 240 seconds at a flow of 30 μl/min. The assay was double referenced, whereas FC1 served as (blocked) surface control (bulk contribution of each Spiegelmer concentration) and a series of buffer injections without analyte determined the bulk contribution of the buffer itself. At least one Spiegelmer concentration was injected twice to monitor the regeneration efficiency and chip integrity during the experiments. Regeneration was performed by injecting 60 μl of 1M NaCl at a flow of 30 μl/min. Stabilization time of baseline after each regeneration cycle was set to 1 min at 30 μl/min.

(103) Data analysis and calculation of dissociation constants (K.sub.D) was done with the BIAevaluation 3.1.1 software (BIACORE AB, Uppsala, Sweden) using a modified Langmuir 1:1 stoichiometric fitting algorithm, with a constant RI and mass transfer evaluation with a mass transport coefficient kt of 1×10.sup.7 [RU/M*s].

EXAMPLE 5: DETERMINATION OF INHIBITORY CONCENTRATION IN A CHEMOTAXIS ASSAY

(104) Generation of a Cell Line Expressing the Human Receptor for C5a

(105) A stably transfected cell line expressing the human receptor for C5a was generated by transfecting BA/F3 mouse pro B cells with a plasmid coding for the human C5a receptor (NCBI accession NM_001736 in pcDNA3.1+). Cells expressing C5aR were selected by treatment with geneticin and tested for expression with RT-PCR and for functionality with chemotaxis assay.

(106) Chemotaxis Assay

(107) The day before the experiment, cells are seeded in a new flask at 0.3×10.sup.6/ml. For the experiment, cells were centrifuged, washed once in HBH (HBSS, containing 1 mg/ml bovine serum albumin and 20 mM HEPES) and resuspended at 1.33×10.sup.6 cells/ml. 75 μl of this suspension were added to the upper compartments of a 96 well Corning Transwell plate with 5 μm pores (Costar Corning, #3388; NY, USA). In the lower compartments recombinant human C5a (SEQ.ID. 50) or mouse C5a (SEQ.ID. 54) was pre-incubated together with Spiegelmers in various concentrations in 235 μl HBH at 37° C. for 20 to 30 min prior to addition of cells. Cells were allowed to migrate at 37° C. for 3 hours. Thereafter the insert plate (upper compartments) was removed and 30 μl of 440 μM resazurin (Sigma, Deisenhofen, Germany) in phosphate buffered saline was added to the lower compartments. After incubation at 37° C. for 2.5 hours, fluorescence was measured at an excitation wavelength of 544 nm and an emission wavelength of 590 nm.

(108) Fluorescence values are corrected for background fluorescence (no C5a in well) and plotted against Spiegelmer concentration. The IC.sub.50 values are determined with non-linear regression (4 parameter fit) using GraphPad Prism. Alternatively, the value for the sample without Spiegelmer (C5a only) is set 100% and the values for the samples with Spiegelmer are calculated as percent of this. The percent-values are plotted against Spiegelmer concentration and the IC.sub.50-values are determined as described above.

(109) Determination of the Half-Maximal Effective Concentration (EC.sub.50) for Human and Mouse C5a

(110) After 3 hours migration of BA/F3/huC5aR cells towards various human C5a or mouse C5a concentrations, dose-response curves for human and mouse C5a were obtained, indicating half effective concentrations (ECH) of 0.1 nM for huC5a and 0.3 nM for mC5a. For the experiments on inhibition of chemotaxis by Spiegelmers 0.1 nM human C5a and 0.3 nM mouse C5a were used.

EXAMPLE 6: INHIBITION OF C5A-INDUCED ACTIVATION OF PRIMARY HUMAN NEUTROPHILS

(111) Isolation of Human PMNs

(112) Polymorphonuclear leukocytes (PMN) were isolated from whole blood by discontinuous gradient centrifugation at room temperature. Blood was collected in acid citrate dextrose containing blood collection tubes (Sarstedt). Dextran 500 (Accurate Chemical) was added to a final concentration of 2% w/v and the blood/dextran was layered on to Histopaque (1.077 g/ml, Sigma). After centrifugation all liquid and cells above the gradient interface were discarded. Pellet and circa 80% of remaining liquid above were collected and diluted 1:1 with a mixture of Voluven 80% v/v (Fresenius Kabi), PBS 16% v/v (Sigma) and ACD 4% v/v (Sigma). Mixture was centrifuged at 400 rpm for 15 minutes. Supernatant was collected and centrifuged at 1,000 rpm for 7 minutes. The pellet was gently re-suspended and remaining erythrocytes were removed by lysis.

(113) Inhibition of C5a-Induced Chemotaxis of Human PMNs

(114) Human C5a (1 nM) was preincubated with indicated concentrations of NOX-D19 or NOX-D20 in HBSS+0.01% BSA+25 mM HEPES in the lower chamber of a chemotaxis plate. Human neutrophils were added to the upper chambes of a chemotaxis plate and chemotaxis was performed over 25 min at 37° C. and 5% CO.sub.2. Following incubation the upper chamber was fitted to a white luminescence plate containing Accutase to harvest cells bound to the underside of the chemotaxis mesh. Glo reagent (Promega) was added and equilibrated for 10 min. Luminescence was measured using a Biotek Synergy 2 plate reader.

(115) Inhibition of C5a-Induced Elastase Release by Human PMNs

(116) Human neutrophils were primed with TNFα (10 ng/ml) and cytochalasin B (5 μg/ml) for 30 minutes at 37° C., 5% CO.sub.2. Cells were stimulated for 45 min with human C5a (30 nM) which had been pre-incubated with NOX-D19 or NOX-D20 at indicated concentrations. Cells were then separated by centrifugation and 25 μl of supernatant were incubated with elastase substrate (Calbiochem) in Tris-HCl 0.1 M pH 7.4 for 1 h at 37° C. with readings being taken at an absorbance of 405 nm every 5 minutes. The kinetic data was analysed to determine the v.sub.max for each sample. The mean percentage elastase activity relative to control was calculated for each sample (background not subtracted).

(117) Results

(118) NOX-D19 and NOX-D20 efficiently inhibit the activation of freshly isolated human peripheral blood PMN by C5a. 10 nM NOX-D19 or NOX-D20 were sufficient to block more than 85% of huC5a-induced chemotaxis of human PMN (FIG. 13 A). HuC5a-induced release of antimicrobial elastase was efficiently inhibited by NOX-D19 and NOX-D20 (FIG. 13 B). 30 nM NOX-D19 or NOX-D20 suppressed about 50% of C5a-induced elastase release. Of note, for stoichiometric reasons the sensitivity of this assay is limited to IC.sub.50=15 nM, as elastase release is induced by 30 nM huC5a.

EXAMPLE 7: C5A BINDING NUCLEIC ACIDS DO NOT INTERFERE WITH COMPLEMENT-DEPENDENT HEMOLYSIS

(119) The ultimate product of the complement cascade is the membrane attack complex (MAC), a pore consisting of C5b-9. MAC is believed to insert into the cytoplasmic membranes of pathogens and kill them by induction of cytoplasmic leakage.

(120) The C5a binding nucleic acids (Spiegelmers) presented here have been shown to recognize C5a in the context of C5 (see Example 1, FIG. 9 and FIG. 10). Therefore it was investigated whether C5 cleavage to the anaphylatoxin C5a and C5b, which is part of the MAC is inhibited by these the Spiegelmers. This was achieved by using a complement-dependent sheep erythrocyte hemolysis test.

(121) Methods

(122) Reconstituted human lyophilized serum (‘Human Complement Serum’ (Sigma Aldrich, Germany) was pre-incubated with PEGylated Spiegelmers NOX-D19, NOX-D20 and NOX-D21 in the range of 10 nM to 10,000 nM in 96-well plates (Nunc-Immuno™ Plate, MaxiSorp Surface™). As a positive control the C5-binding aptamer C5C6 with maximal 2′OMe purine and 2′fluoro pyrimidine substitution (Biesecker et al. 1999) (synthesized in house) which inhibits C5 cleavage was used in the same concentration range. As a control for potential unspecific Spiegelmer effects on the assay PEGylated Spiegelmers with the reverse sequence of NOX-D19 and NOX-D21, revNOX-D19 and revNOX-D21 were included. revNOX-D19 and revNOX-D21 were earlier shown not to inhibit C5a in a Biacore and cell based assays. After 1 hour incubation at 37° C. sheep erythrocytes opsonized with rabbit anti-sheep erythrocyte antibodies, known as hemolytic system (Institut Virion/Serion GmbH, Germany) were added to the pre-incubated serum complement inhibitor mixture. Complement is activated via the classical pathway leading to the cleavage of C5 to C5a and C5b. C5b then associates with C6-C9 to form the lytic membrane attack complex (MAC). Sheep erythrocyte hemolysis due to MAC formation was determined 30 min later by a colorimetric measurement after spinning down intact cells. The higher the degree of hemolysis the higher the absorption at 405 nm (measured in a Fluo Star plate reader).

(123) Results

(124) The aptamer C5C6 inhibited complement-dependent lysis of the sheep erythrocytes with an IC.sub.50 of approximately 1 μM (FIG. 14 A, B). The Spiegelmers tested, namely C5 and C5a binding nucleic acids NOX-D19 and NOX-D20 (FIG. 14 A) and NOX-D21 (FIG. 14 B) and the non-C5- or C5a-binding Spiegelmers revNOX-D19 (FIG. 14 A) and revNOX-D21 (FIG. 14 B) did not inhibit hemolysis.

(125) Discussion

(126) The C5a binding Spiegelmers tested were shown not to inhibit MAC formation and are therefore selective antagonists of C5a only. If used as a medicine, this may be advantageous, since inhibition of MAC-formation can compromise the body's defense mechanism to invading pathogens, mainly Gram-negative bacteria.

EXAMPLE 8: THE C5A-BINDING NUCLEIC ACID NOX-D19 SHOWS EFFICACY IN THE MURINE CECAL LIGATION AND PUNCTURE MODEL FOR POLYMICROBIAL SEPSIS

(127) The effect of intraperitoneal injections of NOX-D19 on the course of polymicrobial sepsis was tested in a rodent cecal ligation and puncture (CLP) model.

(128) Methods

(129) Animal Model

(130) 10-12 week old male C57BL/6 mice (Charles River Laboratories, Germany) were used for the study. Peritonitis was surgically induced under light isofluran anesthesia. Incisions were made into the left upper quadrant of the peritoneal cavity (normal location of the cecum). The cecum was exposed and a tight ligature was placed around the cecum with sutures distal to the insertion of the small bowel (75% were ligated). One puncture wound was made with a 24-gauge needle into the cecum and small amounts of cecal contents were expressed through the wound. The cecum was replaced into the peritoneal cavity and the laparotomy site was closed. 500 μl saline was given s.c. as fluid replacement. Sham animals underwent the same procedure except for ligation and puncture of the cecum. Finally, animals were returned to their cages with free access to food and water.

(131) Study Groups

(132) 4 groups (n=6 mice for sham surgery and n=10 mice per group for CLP surgery) were tested: (1) sham surgery with vehicle (saline) treatment, (2) CLP surgery with vehicle treatment, (3) CLP surgery with low dose NOX-D19 (1 mg/kg) treatment and (4) CLP surgery with high dose NOX D19 (10 mg/kg) treatment. The investigators were blinded to the treatment strategy and did not know which compound contains vehicle or verum. Route of administration was i.p. every day for 6 days starting at time of the CLP surgery.

(133) Survival

(134) Follow up was 7 days in each group. Mice were monitored daily and Kaplan Meier survival curves were generated using GraphPad Prism 4 software.

(135) Blood Drawing

(136) Blood samples were obtained under light ether anaesthesia from the cavernous sinus with a capillary prior to surgery (baseline, day −4) and at day 1 after surgery to allow measurement of routine serum markers of acute kidney injury (serum creatinine, and blood urea nitrogen, BUN) and acute liver failure (serum alanin-aminotransferase, serum ALT). The level of aspartate aminotransferase (serum AST) was measured in serum as a marker of multiorgan failure. Measurement of clinical chemistry parameters was performed on an Olympus analyser (AU400).

(137) Statistics

(138) Statistical significance was calculated by Student's T-test. For survival Kaplan Meier curves were generated and log rank test for significance was performed. GraphPad Prism 4 software was used.

(139) Results

(140) Survival

(141) As expected no mortality occurred in animals with sham surgery without CLP (FIG. 15). In mice that received CLP surgery and were treated with vehicle only, median survival was 1.5 days NOX-D19 treatment after CLP surgery improved median survival (FIG. 15). Mice treated with low dose NOX-D19 (1 mg/kg) showed the longest median survival (5 days, p<0.0001 vs. vehicle). Mice treated with high dose NOX-D19 (10 mg/kg) had a median survival of 3 days which was significantly longer than in vehicle treated mice (p=0.0401) but was not significantly different from low dose NOX-D19 treatment (p=0.4875). 100% of vehicle mice died within 4 days after CLP surgery. 100% and 90% mortality occurred not before 7 days in mice treated with low and high dose NOX-D19, respectively (FIG. 15).

(142) Clinical Chemistry

(143) Renal Function

(144) The serum creatinine and blood urea nitrogen (BUN) concentration are parameters for renal function. Renal function was assessed before the start of the study (day −4) and on day 1 after CLP surgery.

(145) By day 1 CLP induced a significant increase in serum creatinine levels in vehicle treated mice. Low dose NOX-D19 treatment (1 mg/kg) prevented this increase (FIG. 16 A). In mice treated with high dose NOX-D19 (10 mg/kg) a moderate but statistically not significant increase in serum creatinine levels was observed (p=0.1873 vs. vehicle) (FIG. 16 A).

(146) BUN (FIG. 16 B), which is a more sensitive parameter of renal function than creatinine, was significantly increased at day 1 after CLP surgery in vehicle treated mice. Treatment of mice with low and high dose NOX-D19 significantly suppressed the increase of BUN upon CLP (FIG. 16 B).

(147) Liver Function

(148) The most reliable marker of hepatocellular injury or necrosis is serum alanine aminotransferase (serum ALT). All groups showed an increase of serum ALT at day 1 after CLP surgery. However, both groups of NOX-D19 treated septic mice demonstrated improved liver function compared to vehicle treated mice (FIG. 17 A).

(149) Multiorgan Failure

(150) The serum level of aspartate aminotransferase (serum AST) (FIG. 17 B) was measured as a marker of multiorgan failure since AST has been shown to be elevated in diseases affecting other organs besides liver, such as myocardial infarction, acute pancreatitis, acute hemolytic anemia, severe burns, acute renal disease, musculoskeletal diseases, and trauma.

(151) Similar to ALT, all groups showed an increase of AST levels at day 1 after CLP surgery (p<0.001 vs. sham). However, similar to liver function, both groups of NOX-D19 treated septic mice demonstrated less pronounced AST levels compared to vehicle treated mice (FIG. 17 B).

EXAMPLE 9: THE IMPROVED C5A-BINDING NUCLEIC ACID NOX-D20 SHOWS EFFICACY IN THE MURINE CECAL LIGATION AND PUNCTURE MODEL FOR POLYMICROBIAL SEPSIS

(152) The effect of intraperitoneal injections of NOX-D20 on the course of polymicrobial sepsis was tested in a rodent cecal ligation and puncture (CLP) model.

(153) Methods

(154) Animal Model

(155) Polymicrobial sepsis was induced in 10-12 week old male C57BL/6 mice (Charles River Laboratories, Germany) as described in Example 8 with 60-75% of the cecum being ligated.

(156) Survival

(157) Follow up was 7 days in each group. Mice were monitored daily and Kaplan Meier survival curves were generated using GraphPad Prism 4 software.

(158) Study Groups

(159) 5 groups (n=5 mice for sham surgery and n=10 mice per group for CLP surgery) were tested: (1) sham surgery with vehicle (saline) treatment, (2) CLP surgery with vehicle treatment, (3) CLP surgery with daily low dose NOX-D20 (1 mg/kg) treatment, (4) CLP surgery with daily high dose NOX-D20 (3 mg/kg) treatment and (5) CLP surgery with a single low dose NOX-D20 (1 mg/kg) after surgery followed by daily vehicle treatment. The investigators were blinded to the treatment strategy and did not know which compound contains vehicle or verum. Route of administration was i.p.

(160) Clinical Chemistry and Inflammatory Parameters

(161) Blood samples were obtained as described in Example 8 under light ether anaesthesia from the cavernous sinus with a capillary at day 1 after surgery. Routine serum markers of acute kidney injury (serum creatinine, and blood urea nitrogen, BUN), acute liver failure (serum ALT) and endothelial injury (serum lactate dehydrogenase, serum LDH) were measured. Peritoneal lavage (PL) was performed using 3 ml PBS. The volume of the collected PL was measured in each sample, and the total cell count was assessed using a hemocytometer (Neubauer Zaehlkammer, Gehrden, Germany). Serum and PL levels of tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), and CCL2 (=macrophage chemoattractant protein-1, MCP-1) were quantified by bead-based flow cytometry assay (CBA Kit, BD Biosciences, Heidelberg, Germany). Serum and PL concentrations of CXCL1 (=keratinocyte chemoattractant, KC) and CXCL2 (=macrophage inflammatory protein 2, MIP-2) were determined by ELISA (R&D Systems, Wiesbaden, Germany). Differential cell count in the PL was performed on hematoxylin and eosin (H&E) stained cytospins (cytospin4, Thermo Scientific).

(162) Capillary Leakage

(163) Immediately after CLP surgery, 0.25% w/v Evans blue (200 μl) was injected intravenously. After 18 h mice were sacrificed and PL was performed as described above. Concentrations of Evans Blue dye in serum and PL fluids was measured spectrophotometrically at 620 nm. The following formula was used to correct the optical densities for contamination with heme pigments: E620 (corrected)=E620 (raw)−(E405 (raw)×0.014). Plasma exudation was quantitated as the ratio of extinction in PL fluid to extinction in plasma.

(164) Statistics

(165) Statistical significance was calculated by one-way ANOVA and Dunnetts test. For survival long rank test for significance was performed. GraphPad Prism 4 software was used.

(166) Results

(167) Survival

(168) As expected no mortality occurred in sham operated mice within 7 days after surgery (FIG. 18). In vehicle-treated CLP mice median survival was 3 days. Daily treatment of mice with 1 mg/kg NOX-D20 significantly prolonged median survival to 7 days (p=0.0043 vs. vehicle). An increase of the dosage to 3 mg/kg NOX-D20 had no additional protective effect with a similar median survival of 6.5 days (p=0.0092 vs. vehicle). Notably, a single injection of 1 mg/kg NOX-D20 after CLP surgery was as effective as daily treatment and significantly prolonged median survival to 6.5 days (FIG. 18). While 100% of vehicle treated mice dies within 5 days, 30-40% of NOX-D20 treated mice were still alive at the end of the experiment at day 7 (FIG. 18).

(169) Organ Function

(170) Systemic inflammation often causes multiple organ failure. Increased serum levels of creatinine and BUN are parameters for decreased glomerular filtration rate and kidney failure. Both parameters were significantly increased in vehicle treated mice one day after CLP surgery compared to sham mice. NOX-D20 treatment efficiently prevented the increase of both markers implying a protective effect of NOX-D20 on renal function (FIG. 19 A, B). Alanine aminotransferase (ALT) is a common marker of hepatocellular injury and necrosis and CLP-induced sepsis was associated with increased of ALT serum levels. NOX-D20 treated mice demonstrated significantly reduced levels of serum ALT compared to vehicle treated mice suggesting improved liver function (FIG. 19 C). Elevated serum levels of lactate dehydrogenase (LDH) occur after tissue injury and are therefore a general marker of organ failure. The increase in LDH levels provoked by CLP was effectively blocked by NOX-D20 (FIG. 20 A). Breakdown of the endothelial barrier and edema formation is a common fatal event in sepsis. Sepsis induction resulted in a two-fold increase in relative plasma protein extravasation into the peritoneal cavity in vehicle treated compared to sham operated mice. NOX-D20 treatment significantly inhibited capillary leakage (FIG. 20 B). For all parameters tested here 1 mg/kg NOX-D20 was sufficient to significantly improve organ function which is reflected in improved survival of NOX-D20 treated mice.

(171) Inflammation

(172) CLP resulted in a strong local and systemic upregulation of pro-inflammatory cytokines and chemokines. Blockade of C5a by NOX-D20 efficiently reduced the concentrations of TNFα, IL-6, CCL2, CXCL1 and CXCL2 in the peritoneum and in serum at day 1 after CLP. The up-regulation of these chemokines is associated with a recruitment of polymorphonuclear leukocytes (PMN) to the peritoneum. Accordingly, C5a-inhibition by NOX-D20 inhibited the accumulation of PMN in the peritoneal cavity (FIG. 20 C). Similarly, infiltration of monocytes was blocked by NOX-D20.

EXAMPLE 10: EFFICACY OF NOX-D21 IN A MODEL OF ISCHEMIA REPERFUSION-INDUCED ACUTE KIDNEY INJURY

(173) The effect of NOX-D21 on acute kidney injury (AKI) was tested in a rodent model of renal ischemia/reperfusion injury (IRI).

(174) Methods

(175) Animal Model

(176) 12-15 week old male C57BL/6 mice (Charles River, Germany) were anaesthetized using isoflurane via a nose mask and placed supine on a heating table to maintain body temperature around 32° C. Midline incision was performed and the right and left renal pedicle were clipped with a micro-aneurysm clip for 30 min. After removal of the clip and suture of the skin mice were returned to the cages and monitored until fully awake.

(177) Study Groups

(178) 3 groups (n=10 mice per group) were tested: (1) IRI surgery with vehicle treatment, (2) IRI surgery with low dose NOX-D21 (1 mg/kg) treatment, (3) IRI surgery with high dose NOX-D21 (10 mg/kg) treatment. The investigators were blinded to the treatment strategy and did not know which compound contains vehicle or verum. NOX-D21 was given i.v. 1 h prior to surgery at d0 and during the next 3 days (d1-d3) it was given i.p. once daily.

(179) Survival

(180) Mice were monitored daily for 14 days. Kaplan Meier survival curves were generated and significance was determined by log-rank test using GraphPad Prism 4 software.

(181) Results

(182) Survival was significantly improved by treatment with high NOX-D21 (FIG. 21). Low dose NOX-D21 treatment resulted in an evident yet not satistically significant improvement of survival. In the control group treated with vehicle only one mouse survived until day 14. NOX-D21 treatment increased the percentage of surviving mice to 45-55% (FIG. 21).

REFERENCES

(183) The complete bibliographic data of the documents recited herein the disclosure of which is incorporated by reference is, if not indicated to the contrary, as follows. Altschul S F, Gish W, Miller W. Myers E W, Lipman D J (1990), Basic local alignment search tool. J Mol Biol. 215(3):403-10. Altschul S F, Madden T L, Schaffer A A, Zhang J, Zhang Z, Miller W, Lipman D J (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25(17):3389-402. Arumugam T V, Shiels I A, Strachan A J, Abbenante G, Fairlie D P, Taylor S M (2003) A small molecule C5a receptor antagonist protects kidneys from ischemia/reperfusion injury in rats. Kidney Int 63(1): 134-142 Arumugam T V, Woodruff T M, Stocks S Z, Proctor L M, Pollitt S, Shiels I A, Reid R C, Fairlie D P, Taylor S M (2004) Protective effect of a human C5a receptor antagonist against hepatic ischaemia-reperfusion injury in rats. J Hepatol 40(6): 934-941 Bergh K, Iversen O J, Lysvand H. (1993). Surprisingly high levels of anaphylatoxin C5a des Arg are extractable from psoriatic scales. Arch Dermatol Res 285(3):131-134. Biesecker G, Dihel L, Enney K, Bendele R A (1999) Derivation of RNA aptamer inhibitors of human complement C5. Immunopharmacology 42(1-3): 219-230. Bonifati D M, Kishore U. (2007) Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 44(5): 999-1010. Bosmann M, Ward P A (2012) Role of C3, C5 and anaphylatoxin receptors in acute lung injury and in sepsis. Adv Exp Med Biol 946: 147-159 Breivik T, Gundersen Y, Gjermo P, Taylor S M, Woodruff T M, Opstad P K (2011) Oral treatment with complement factor C5a receptor (CD88) antagonists inhibits experimental periodontitis in rats. J Periodontal Res 46(6): 643-647 Chen M, Daha M R, Kallenberg C G (2010) The complement system in systemic autoimmune disease. J Autoimmun 34(3): J276-286 Copland D A, Hussain K, Baalasubramanian S, Hughes T R, Morgan B P, Xu H, Dick A D, Nicholson L B (2010) Systemic and local anti-C5 therapy reduces the disease severity in experimental autoimmune uveoretinitis. Clin Exp Immunol 159(3): 303-314 Czermak B J, Sarma V, Pierson C L, Warner R L, Huber-Lang M, Bless N M, Schmal H, Friedl H P, Ward P A (1999) Protective effects of C5a blockade in sepsis. Nat Med 5(7): 788-792 Damha M J and Ogilvie K K, Methods in Molecular Biology, Vol. 20 Protocols for oligonucleotides and analogs, ed. S. Agrawal, p. 81-114, Humana Press Inc. (1993) Ehrnthaller C, Ignatius A, Gebhard F, Huber-Lang M (2011) New Insights of an Old Defense System: Structure, Function, and Clinical Relevance of the Complement System. Mol Med 17(3-4): 317-329 Farkas I, Baranyi L, Liposits Z S, Yamamoto T, Okada H (1998) Complement C5a anaphylatoxin fragment causes apoptosis in TGW neuroblastoma cells. Neuroscience 86(3): 903-911 Fernandez H N, Hugli T E (1978) Primary structural analysis of the polypeptide portion of human C5a anaphylatoxin. Polypeptide sequence determination and assignment of the oligosaccharide attachment site in C5a. J Biol Chem 253(19): 6955-6964 Flierl M A, Rittirsch D, Nadeau B A, Day D E, Zetoune F S, Sarma J V, Huber-Lang M S, Ward P A (2008) Functions of the complement components C3 and C5 during sepsis. FASEB J 22(10): 3483-3490 Fonseca M I, Ager R R, Chu S H, Yazan O, Sanderson S D, LaFerla F M, Taylor S M, Woodruff T M, Tenner A J (2009) Treatment with a C5aR antagonist decreases pathology and enhances behavioral performance in murine models of Alzheimer's disease. J Immunol 183(2): 1375-1383 Gueler F, Rong S, Gwinner W, Mengel M, Brocker V, Schon S, Greten T F, Hawlisch H, Polakowski T. Schnatbaum K, Menne J, Haller H, Shushakova N (2008) Complement 5a receptor inhibition improves renal allograft survival. J Am Soc Nephrol 19(12): 2302-2312 Heller T, Hennecke M, Baumann U, Gessner J E, zu Vilsendorf A M, Baensch M, Boulay F, Kola A, Klos A, Bautsch W, Kohl J. (1999) Selection of a C5a receptor antagonist from phage libraries attenuating the inflammatory response in immune complex disease and ischemia/reperfusion injury. J Immunol 163(2):985-994. Hillmen P, Muus P, Duhrsen U, Risitano A M, Schubert J, Luzzatto L, Schrezenmeier H. Szer J, Brodsky R A, Hill A, Socie G, Bessler M, Rollins S A, Bell L, Rother R P, Young N S (2007). Effect of the complement inhibitor eculizumab on thromboembolism in patients with paroxysmal nocturnal hemoglobinuria. Blood, 110(12):4123-8 Huber-Lang M, Sarma V J, Lu K T, McGuire S R, Padgaonkar V A, Guo R F, Younkin E M, Kunkel R G, Ding J, Erickson R, Curnutte J T, Ward P A (2001) Role of C5a in multiorgan failure during sepsis. J Immunol 166(2): 1193-1199

(184) Huber-Lang M S, Younkin E M, Sarma J V, McGuire S R, Lu K T, Guo R F, Padgaonkar V A, Cumutte J T, Erickson R, Ward P A (2002) Complement-induced impairment of innate immunity during sepsis. J Immunol 169(6): 3223-3231 Jacob A, Hack B, Bai T, Brorson J R, Quigg R J, Alexander J J (2010a) Inhibition of C5a receptor alleviates experimental CNS lupus. J Neuroimmunol 221(1-2):46-52 Jacob A, Hack B, Chiang E, Garcia J G, Quigg R J, Alexander J J (2010b) C5a alters blood-brain barrier integrity in experimental lupus. FASEB J 24(6):1682-8 Kambas K, Markiewski M M, Pneumatikos I A, Rafail S S, Theodorou V, Konstantonis D, Kourtzelis I, Doumas M N, Magotti P, Deangelis R A, Lambris J D, Ritis K D (2008) C5a and TNF-alpha up-regulate the expression of tissue factor in intra-alveolar neutrophils of patients with the acute respiratory distress syndrome. J Immunol 180(11): 7368-7375 Khan M A, Jiang X, Dhillon G, Beilke J, Holers V M, Atkinson C, Tomlinson S, Nicolls M R (2011) CD4+ T cells and complement independently mediate graft ischemia in the rejection of mouse orthotopic tracheal transplants. Circ Res 109(11): 1290-1301 Kirschfink M. (1997) Controlling the complement system in inflammation. Immunopharmacology 38(1-2):51-62. Klos A, Tenner A J, Johswich K O, Ager R R, Reis E S, Kohl J (2009) The role of the anaphylatoxins in health and disease. Mol Immunol 46(14): 2753-2766 Klussmann S. (2006). “The Aptamer Handbook—Functional Oligonucleotides and their Applications.” Edited by S. Klussmann. WILEY-VCH, Weinheim, Germany, ISBN 3-527-31059-2 Kohl J. (2001) Anaphylatoxins and infectious and non-infectious inflammatory diseases. Mol Immunol 38(2-3):175-187. Kusser W (2000). J Biotechnol 74:27-38 Laudes I J, Chu J C, Sikranth S, Huber-Lang M, Guo R F, Riedemann N, Sarma J V, Schmaier A H, Ward P A (2002) Anti-c5a ameliorates coagulation/fibrinolytic protein changes in a rat model of sepsis. Am J Pathol 160(5): 1867-1875 Lewis A G, Kohl G, Ma Q, Devaraj an P, Kohl J. (2008) Pharmacological targeting of C5a receptors during organ preservation improves kidney graft survival. Clin Exp Immunol 153(1): 117-126. Li K, Wang N, Peng Q, Lu B, Ma L, Lambris J D, Sacks S, Zhou W (2012) C5a/C5aR signaling is an important negative regulator of murine nature killer cell homeostasis and effector function. Immunobiology 217(11): 1146 Makrides S C. (1998) Therapeutic inhibition of the complement system. Pharmacol Rev 50(1):59-87. Manderson A P, Botto M, Walport M J. (2004) The role of complement in the development of systemic lupus erythematosus. Annu Rev Immunol 22: 431-456 Markiewski M M, DeAngelis R A, Benencia F, Ricklin-Lichtsteiner S K, Koutoulaki A, Gerard C, Coukos G, Lambris J D (2008) Modulation of the antitumor immune response by complement. Nat Immunol. (11):1225-35 McGinnis S, Madden T L (2004) BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32(Web Server issue):W20-5. Min X, Wei L, Li Z, Sacks S, Zhou W, Li K (2012) Negative regulation of human nature killer cells by complement. Immunobiology 217(11): 1189 Muller-Ladner U, Jones J L, Wetsel R A, Gay S, Raine C S, Barnum S R. (1996) Enhanced expression of chemotactic receptors in multiple sclerosis lesions. J Neurol Sci 144(1-2): 135-141. Needleman & Wunsch (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol. 48(3):443-53. Nozaki M, Raisler B J, Sakurai E, Sarma J V, Barnum S R, Lambris J D, Chen Y, Zhang K, Ambati B K, Baffi J Z, Ambati J. (2006) Drusen complement components C3a and C5a promote choroidal neovascularization. Proc Natl Acad Sci USA 103(7): 2328-2333 Ostrand-Rosenberg S (2008) Cancer and complement. Nat Biotechnol. 26(12):1348-9. Patel S N, Berghout J, Lovegrove F E, Ayi K, Conroy A, Serghides L, Min-oo G, Gowda D C, Sarma J V, Rittirsch D, Ward P A, Liles W C, Gros P, Kain K C (2008) C5 deficiency and C5a or C5aR blockade protects against cerebral malaria. J Exp Med 205(5): 1133-1143 Pearson & Lipman (1988) Improved tools for biological sequence comparison. Proc. Nat'l. Acad. Sci. USA 85: 2444 Piccolo M T, Wang Y, Sannomiya P, Piccolo N S, Piccolo M S, Hugli T E, Ward P A, Till G O. (1999) Chemotactic mediator requirements in lung injury following skin burns in rats. Exp Mol Pathol 66(3):220-226. Ricklin D, Lambris J D. (2007) Complement-targeted therapeutics. Nat Biotechnol 25(11): 1265-1275 Riley R D, Sato H, Zhao Z Q, Thourani V H, Jordan J E, Fernandez A X, Ma X L, Hite D R, Rigel D F, Pellas T C, Peppard J, Bill K A, Lappe R W, Vinten-Johansen J. (2000) Recombinant human complement C5a receptor antagonist reduces infarct size after surgical revascularization. J Thorac Cardiovasc Surg 120(2):350-358. Rittirsch D, Flierl M A, Nadeau B A, Day D E, Huber-Lang M, Mackay C R, Zetoune F S, Gerard N P, Cianflone K, Kohl J, Gerard C, Sarma J V, Ward P A (2008) Functional roles for C5a receptors in sepsis. Nat Med 14(5): 551-557 Sim R B, Laich A. (2000) Serine proteases of the complement system. Biochem Soc Trans 28(5):545-550. Smith & Waterman (1981) Adv. Appl. Math. 2: 482 Sprong T, Brandtzaeg P. Fung M, Pharo A M, Hoiby E A, Michaelsen T E, Aase A, van der Meer J W, van Deuren M, Mollnes T E (2003) Inhibition of C5a-induced inflammation with preserved C5b-9-mediated bactericidal activity in a human whole blood model of meningococcal sepsis. Blood 102(10): 3702-3710 Tokodai K, Goto M. Inagaki A, Nakanishi W, Ogawa N, Satoh K, Kawagishi N, Sekiguchi S, Nilsson B, Okada N, Okada H, Satomi S (2010) Attenuation of cross-talk between the complement and coagulation cascades by C5a blockade improves early outcomes after intraportal islet transplantation. Transplantation 90(12): 1358-1365 van der Pals J, Koul S, Andersson P, Gotberg M, Ubachs J F, Kanski M, Arheden H, Olivecrona G K, Larsson B, Erlinge D (2010) Treatment with the C5a receptor antagonist ADC-1004 reduces myocardial infarction in a porcine ischemia-reperfusion model. BMC Cardiovasc Disord 10:45 Venkatesan N, Kim S J, Kim B H (2003) Novel phosphoramidite building blocks in synthesis and applications toward modified oligonucleotides. Curr Med Chem 10(19): 1973-1991 Wagner E, Frank M M (2010) Therapeutic potential of complement modulation. Nat Rev Drug Discov 9(1): 43-56 Walport M J. (2001a) Complement. First of two parts. N Engl J Med 344(14):1058-1066. Walport M J. (2001b) Complement. Second of two parts. N Engl J Med 344(15):1140-1144. Wang Y. (2006) Complementary therapies for inflammation. Nat Biotechnol 24(10): 1224-1226 Ward P A (2010a) The harmful role of c5a on innate immunity in sepsis. J Innate Immun 2(5): 439-445 Ward P A (2010b) Role of C5 activation products in sepsis. ScientificWorldJournal 10: 2395-2402 Wincott F, DiRenzo A, Shaffer C, Grimm S, Tracz D, Workman C, Sweedler D, Gonzalez C, Scaringe S, and Usman N (1995). Synthesis, deprotection, analysis and purification of RNA and ribosomes. Nucleic Acids Res. 23:2677-2684. Woodruff T M, Arumugam T V, Shiels I A, Reid R C, Fairlie D P, Taylor S M. (2003) A potent human C5a receptor antagonist protects against disease pathology in a rat model of inflammatory bowel disease. J Immunol 171(10):5514-5520. Woodruff T M, Strachan A J, Dryburgh N, Shiels I A, Reid R C, Fairlie D P, Taylor S M. (2002) Antiarthritic activity of an orally active C5a receptor antagonist against antigen-induced monarticular arthritis in the rat. Arthritis Rheum 46(9):2476-2485. Yao Y M, Redl H, Bahrami S, Schlag G. (1998) The inflammatory basis of trauma/shock-associated multiple organ failure. Inflamm Res 47(5): 201-210. Zheng X, Zhang X, Feng B, Sun H, Suzuki M, Ichim T, Kubo N, Wong A, Min L R, Budohn M E, Garcia B, Jevnikar A M, Min W P (2008) Gene silencing of complement C5a receptor using siRNA for preventing ischemia/reperfusion injury. Am J Pathol 173(4): 973-980

(185) The features of the present invention disclosed in the specification, the claims, the sequence listing and/or the drawings may both separately and in any combination thereof be material for realizing the invention in various forms thereof.